taqman probes  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher taqman probes
    Trans-activation of the endogenous Abcc6 gene in TIB-73 cells Hepatocytes were transfected with a vector expressing the HNF1 α , HNF4 α or p45-NFE2 cDNAs. As a negative control, the cells were transfected with an empty vector. The levels of the endogenous mAbcc6 gene were determined by quantitative <t>PCR</t> with <t>TaqMan</t> probes specific to the murine mAbcc6 cDNA. The results were normalized to the transfection efficiency by measuring the level of expression of the neomycin-resistance gene present on the vector expressing the transcription factors. The assays were performed three times at least in triplicate. Standard errors are indicated.
    Taqman Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 771 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman probes/product/Thermo Fisher
    Average 99 stars, based on 771 article reviews
    Price from $9.99 to $1999.99
    taqman probes - by Bioz Stars, 2020-02
    99/100 stars

    Images

    1) Product Images from "HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression"

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression

    Journal: Biochimica et biophysica acta

    doi: 10.1016/j.bbaexp.2006.08.002

    Trans-activation of the endogenous Abcc6 gene in TIB-73 cells Hepatocytes were transfected with a vector expressing the HNF1 α , HNF4 α or p45-NFE2 cDNAs. As a negative control, the cells were transfected with an empty vector. The levels of the endogenous mAbcc6 gene were determined by quantitative PCR with TaqMan probes specific to the murine mAbcc6 cDNA. The results were normalized to the transfection efficiency by measuring the level of expression of the neomycin-resistance gene present on the vector expressing the transcription factors. The assays were performed three times at least in triplicate. Standard errors are indicated.
    Figure Legend Snippet: Trans-activation of the endogenous Abcc6 gene in TIB-73 cells Hepatocytes were transfected with a vector expressing the HNF1 α , HNF4 α or p45-NFE2 cDNAs. As a negative control, the cells were transfected with an empty vector. The levels of the endogenous mAbcc6 gene were determined by quantitative PCR with TaqMan probes specific to the murine mAbcc6 cDNA. The results were normalized to the transfection efficiency by measuring the level of expression of the neomycin-resistance gene present on the vector expressing the transcription factors. The assays were performed three times at least in triplicate. Standard errors are indicated.

    Techniques Used: Activation Assay, Transfection, Plasmid Preparation, Expressing, Negative Control, Real-time Polymerase Chain Reaction

    2) Product Images from "Adult onset cardiac dilatation in a transgenic mouse line with Gal?1,3GalNAc ?2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy"

    Article Title: Adult onset cardiac dilatation in a transgenic mouse line with Gal?1,3GalNAc ?2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy

    Journal: Proceedings of the Japan Academy. Series B, Physical and Biological Sciences

    doi: 10.2183/pjab.87.550

    Production of ST3Gal-II transgenic mice. (A) Sal I- Bam HI fragments of a pCAGGS-based plasmid containing mouse ST3Gal-II cDNA were injected into mouse zygotes. (B) Integration of the transgene was confirmed by Southern blot analysis. Lane 1: transgenic mice, Lane 2: non-transgenic (WT) mice, Lane 3: C57BL/6Cr. M: DNA size markers. (C) Expression of the transgene was confirmed by TaqMan based quantitative RT-PCR analysis of hearts from homozygous ( n = 5), hemizygous ( n = 3), and wild ( n = 5) mice at 3 months of age. ST3Gal-II expression was normalized with GAPDH expression and displayed as mean ± S.D. with the average of wild values as 1. Values with different labels (a, b, and c) are significantly different (p
    Figure Legend Snippet: Production of ST3Gal-II transgenic mice. (A) Sal I- Bam HI fragments of a pCAGGS-based plasmid containing mouse ST3Gal-II cDNA were injected into mouse zygotes. (B) Integration of the transgene was confirmed by Southern blot analysis. Lane 1: transgenic mice, Lane 2: non-transgenic (WT) mice, Lane 3: C57BL/6Cr. M: DNA size markers. (C) Expression of the transgene was confirmed by TaqMan based quantitative RT-PCR analysis of hearts from homozygous ( n = 5), hemizygous ( n = 3), and wild ( n = 5) mice at 3 months of age. ST3Gal-II expression was normalized with GAPDH expression and displayed as mean ± S.D. with the average of wild values as 1. Values with different labels (a, b, and c) are significantly different (p

    Techniques Used: Transgenic Assay, Mouse Assay, Plasmid Preparation, Injection, Southern Blot, Expressing, Quantitative RT-PCR

    3) Product Images from "Comparing gene expression data from formalin-fixed, paraffin embedded tissues and qPCR with that from snap-frozen tissue and microarrays for modeling outcomes of patients with ovarian carcinoma"

    Article Title: Comparing gene expression data from formalin-fixed, paraffin embedded tissues and qPCR with that from snap-frozen tissue and microarrays for modeling outcomes of patients with ovarian carcinoma

    Journal: BMC Clinical Pathology

    doi: 10.1186/s12907-015-0017-1

    Range of gene expression measured from the selected pathways. The bell curve represents the distribution of expression across the entire TCGA cohort, using Affymetrix array. The red ticks on the x-axis represent gene expression levels aggregated within a pathway from the 18 patients whose FFPE samples were measured using qPCR. The range of expression can be normalized across the Affymetrix and TaqMan qPCR platforms. Patient samples measured with qPCR have a range of expression that does not appear biased within the normal curve
    Figure Legend Snippet: Range of gene expression measured from the selected pathways. The bell curve represents the distribution of expression across the entire TCGA cohort, using Affymetrix array. The red ticks on the x-axis represent gene expression levels aggregated within a pathway from the 18 patients whose FFPE samples were measured using qPCR. The range of expression can be normalized across the Affymetrix and TaqMan qPCR platforms. Patient samples measured with qPCR have a range of expression that does not appear biased within the normal curve

    Techniques Used: Expressing, Formalin-fixed Paraffin-Embedded, Real-time Polymerase Chain Reaction

    Correlation of gene expression of 91 genes from 10 snap-frozen TCGA samples measured with Affymetrix U133 microarray (X-axis) and, in the current study, with TaqMan qPCR (Y-axis). The 91 probes from the 10 samples were each normalized to the average of three housekeeping genes (GUSB, GAPDH, and HPRT1). a The scatterplot shows that gene-to-gene expression has similar ranges across both technologies when normalized to the same three-gene average (r = 0.60). b Lowess smoothing curves. Red dots signify Ct values > 34 which are not included in final index measurements
    Figure Legend Snippet: Correlation of gene expression of 91 genes from 10 snap-frozen TCGA samples measured with Affymetrix U133 microarray (X-axis) and, in the current study, with TaqMan qPCR (Y-axis). The 91 probes from the 10 samples were each normalized to the average of three housekeeping genes (GUSB, GAPDH, and HPRT1). a The scatterplot shows that gene-to-gene expression has similar ranges across both technologies when normalized to the same three-gene average (r = 0.60). b Lowess smoothing curves. Red dots signify Ct values > 34 which are not included in final index measurements

    Techniques Used: Expressing, Microarray, Real-time Polymerase Chain Reaction

    4) Product Images from "E-Cadherin and FGFR1 Expression in Mouse Osteoblastogenesis in Normoxic Cultures"

    Article Title: E-Cadherin and FGFR1 Expression in Mouse Osteoblastogenesis in Normoxic Cultures

    Journal: International Journal of Biomedical Science : IJBS

    doi:

    Mouse primary osteoblastogenesis. Primary osteoblasts were differentiated over 4 weeks in osteogenic medium. Panel A shows significant increases in the ALP activity, an osteoblast differentiation marker, during osteoblastogenesis on day 14 and 21. Panel B shows significant increases in the alizarin red staining, an osteoblasts maturation marker, during osteoblastogenesis. Panel C shows electrophoresis of total mRNA isolated from cells and RT-PCR of GAPDH mRNA during osteoblastogenesis. The relative expression of osteoblast marker genes; COL1A2 (panel D), Runx2 (panel E) and osteocalcin (OCN) (panel F) expression during osteoblastogenesis were analyzed using TaqMan.
    Figure Legend Snippet: Mouse primary osteoblastogenesis. Primary osteoblasts were differentiated over 4 weeks in osteogenic medium. Panel A shows significant increases in the ALP activity, an osteoblast differentiation marker, during osteoblastogenesis on day 14 and 21. Panel B shows significant increases in the alizarin red staining, an osteoblasts maturation marker, during osteoblastogenesis. Panel C shows electrophoresis of total mRNA isolated from cells and RT-PCR of GAPDH mRNA during osteoblastogenesis. The relative expression of osteoblast marker genes; COL1A2 (panel D), Runx2 (panel E) and osteocalcin (OCN) (panel F) expression during osteoblastogenesis were analyzed using TaqMan.

    Techniques Used: ALP Assay, Activity Assay, Marker, Staining, Electrophoresis, Isolation, Reverse Transcription Polymerase Chain Reaction, Expressing

    Expression of E-cadherin and FGFR1 during osteoblastogenesis. Primary osteoblasts were differentiated over 4 weeks in osteogenic medium. Panel A shows the expression of E-cadherin and FGFR1 mRNA during osteoblastogenesis. Panel B shows the expression of E-cadherin protein in immature (day 7) and mature (day 28) osteoblasts using western blotting. Panel C shows the expression of FGFR1 protein in immature (day 7) and mature (day 28) osteoblasts using western blotting. Panel D shows the relative expression of E-cadherin during osteoblastogenesis using TaqMan. Panel E shows the relative expression of FGFR1 during osteoblastogenesis using TaqMan.
    Figure Legend Snippet: Expression of E-cadherin and FGFR1 during osteoblastogenesis. Primary osteoblasts were differentiated over 4 weeks in osteogenic medium. Panel A shows the expression of E-cadherin and FGFR1 mRNA during osteoblastogenesis. Panel B shows the expression of E-cadherin protein in immature (day 7) and mature (day 28) osteoblasts using western blotting. Panel C shows the expression of FGFR1 protein in immature (day 7) and mature (day 28) osteoblasts using western blotting. Panel D shows the relative expression of E-cadherin during osteoblastogenesis using TaqMan. Panel E shows the relative expression of FGFR1 during osteoblastogenesis using TaqMan.

    Techniques Used: Expressing, Western Blot

    5) Product Images from "Thymic regulatory T cell niche size is dictated by limiting interleukin 2 from antigen-bearing dendritic cells and feedback competition"

    Article Title: Thymic regulatory T cell niche size is dictated by limiting interleukin 2 from antigen-bearing dendritic cells and feedback competition

    Journal: Nature immunology

    doi: 10.1038/ni.3171

    Antigen-bearing dendritic cells provide a local source of IL-2 to developing thymic T reg cells. (a-d) Impact of IL2 mutation on ability of DCs to support T reg cell development. Bone marrow derived DCs from WT or Il2 −/− mice were incubated with 1 mg/ml OVA protein and added to WT thymic slices along with OT-II thymocytes. OT-II T reg cell development was assessed after 3 days of culture. (a) Representative flow cytometry analysis of gated OT-II CD4SP. (b) Number of OT-II T reg cells (CD25+Foxp3+) recovered per thymic slice. (c) Ratio of OT-II T reg cells to slice CD4 single positive thymocytes. (d) Quantification of endogenous slice T reg cells recovered per slice. (a-d) n=20 and 21 slices respectively, data pooled from 3 independent experiments. (e) qRT-PCR analysis of IL-2 expression. RNA was prepared from the indicated samples and analyzed by qRT-PCR using TaqMan probes. Data are normalized to GAPDH and presented as fold increase over the background values from Il2 −/− bone marrow derived DCs. Thymi from wild type mice were dissociated with collagenase-digestion and separated into single cell suspension “whole thymus” and an adherent fraction “stroma:. For some samples, single cell suspensions were depleted of CD11c+ cells using magnetic beads: “CD11c depleted”. CD11c enriched fractions were further purified by FACS to yield > 85% CD11c+ cells: “thymic DC”. Bone marrow derived DCs from wild type or Il2 −/− mice were included for comparison. For Il2 −/− DCs, no IL2 signal was observed after 40 cycles of PCR, therefore values reported are upper estimates (indicated by grey shading), and the dashed line indicates the lower limit of detection of the assay. Data from thymic DC samples are included on both plots for comparison. n=12 experimental replicates from 4 biological samples except “CD11c depleted” n=9 experimental replicates, 3 biological samples or “stroma” n=3 experimental replicates, 1 biological sample. Error bars represent +/− SEM. *p
    Figure Legend Snippet: Antigen-bearing dendritic cells provide a local source of IL-2 to developing thymic T reg cells. (a-d) Impact of IL2 mutation on ability of DCs to support T reg cell development. Bone marrow derived DCs from WT or Il2 −/− mice were incubated with 1 mg/ml OVA protein and added to WT thymic slices along with OT-II thymocytes. OT-II T reg cell development was assessed after 3 days of culture. (a) Representative flow cytometry analysis of gated OT-II CD4SP. (b) Number of OT-II T reg cells (CD25+Foxp3+) recovered per thymic slice. (c) Ratio of OT-II T reg cells to slice CD4 single positive thymocytes. (d) Quantification of endogenous slice T reg cells recovered per slice. (a-d) n=20 and 21 slices respectively, data pooled from 3 independent experiments. (e) qRT-PCR analysis of IL-2 expression. RNA was prepared from the indicated samples and analyzed by qRT-PCR using TaqMan probes. Data are normalized to GAPDH and presented as fold increase over the background values from Il2 −/− bone marrow derived DCs. Thymi from wild type mice were dissociated with collagenase-digestion and separated into single cell suspension “whole thymus” and an adherent fraction “stroma:. For some samples, single cell suspensions were depleted of CD11c+ cells using magnetic beads: “CD11c depleted”. CD11c enriched fractions were further purified by FACS to yield > 85% CD11c+ cells: “thymic DC”. Bone marrow derived DCs from wild type or Il2 −/− mice were included for comparison. For Il2 −/− DCs, no IL2 signal was observed after 40 cycles of PCR, therefore values reported are upper estimates (indicated by grey shading), and the dashed line indicates the lower limit of detection of the assay. Data from thymic DC samples are included on both plots for comparison. n=12 experimental replicates from 4 biological samples except “CD11c depleted” n=9 experimental replicates, 3 biological samples or “stroma” n=3 experimental replicates, 1 biological sample. Error bars represent +/− SEM. *p

    Techniques Used: Mutagenesis, Derivative Assay, Mouse Assay, Incubation, Flow Cytometry, Cytometry, Quantitative RT-PCR, Expressing, Magnetic Beads, Purification, FACS, Polymerase Chain Reaction

    6) Product Images from "Adipose stem cells and their paracrine factors are therapeutic for early retinal complications of diabetes in the Ins2Akita mouse"

    Article Title: Adipose stem cells and their paracrine factors are therapeutic for early retinal complications of diabetes in the Ins2Akita mouse

    Journal: Stem Cell Research & Therapy

    doi: 10.1186/s13287-018-1059-y

    Ins2 Akita mice display differential gene expression with and without ASCs and ASC-CM. Gene transcripts associated with retinal inflammation and neurovascular tissue remodeling by TaqMan qPCR expressed as fold change normalized to internal control in the study groups 3 weeks post intravitreal injections. Data represented as the mean ± SEM from n = 6–8 animals/group normalized to WT mice. * p
    Figure Legend Snippet: Ins2 Akita mice display differential gene expression with and without ASCs and ASC-CM. Gene transcripts associated with retinal inflammation and neurovascular tissue remodeling by TaqMan qPCR expressed as fold change normalized to internal control in the study groups 3 weeks post intravitreal injections. Data represented as the mean ± SEM from n = 6–8 animals/group normalized to WT mice. * p

    Techniques Used: Mouse Assay, Expressing, Real-time Polymerase Chain Reaction

    7) Product Images from "Altered expression of neuropeptides in FoxG1-null heterozygous mutant mice"

    Article Title: Altered expression of neuropeptides in FoxG1-null heterozygous mutant mice

    Journal: European Journal of Human Genetics

    doi: 10.1038/ejhg.2015.79

    Relative quantification of mRNA levels of Nnat and Mef2c in silenced neurons assessed by qRT-PCR using commercial Taqman probes. Analyses were performed in triplicate and data are reported as mean+SEM.
    Figure Legend Snippet: Relative quantification of mRNA levels of Nnat and Mef2c in silenced neurons assessed by qRT-PCR using commercial Taqman probes. Analyses were performed in triplicate and data are reported as mean+SEM.

    Techniques Used: Quantitative RT-PCR

    ( a ) Relative quantification of mRNA levels of OXT, AVP, NNAT and MEF2C genes assessed by qRT-PCR using commercial Taqman probes. Analyses were performed in triplicate on the same tissues used for cDNA microarray experiments and data are reported as mean±SEM, * P
    Figure Legend Snippet: ( a ) Relative quantification of mRNA levels of OXT, AVP, NNAT and MEF2C genes assessed by qRT-PCR using commercial Taqman probes. Analyses were performed in triplicate on the same tissues used for cDNA microarray experiments and data are reported as mean±SEM, * P

    Techniques Used: Quantitative RT-PCR, Microarray

    8) Product Images from "Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition"

    Article Title: Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition

    Journal: Stem Cell Reports

    doi: 10.1016/j.stemcr.2013.07.003

    Interrogating Downstream Effectors of GSK3 Inhibition in Rat ESCs (A) TopFlash assay of β-catenin transcriptional activity in rat and mouse ESCs in PL, T2iL, and 2iL. Values are normalized to mouse ESCs in PL. Error bars represent SD of technical triplicates. (B) Immunostaining of β-catenin in rat ESCs cultured in T2iL and 2iL. (C) qRT-PCR analysis of Tcf1 , Tcf3 , Tcf4 , and Lef1 in rat ESCs maintained in T2iL, using TaqMan probes. Values are normalized to Gapdh and relative to Tcf1 . (D) qRT-PCR analysis using conserved primers of Lef1 expression in rat and mouse ESCs maintained in 2iL. (E) qRT-PCR analysis of a panel of gene expression after Tcf3 and Lef1 knockdown. Gene expression was normalized to Gapdh and relative to values in siGFP transfected cells cultured in 2iL. Error bars represent SD of technical triplicates. (F) Effect of stable knockdown of LEF1 on colony formation in 2iL or T2iL. A total of 80 cells were plated per well and analyzed by AP staining after 5 days. Error bars are SDs of four technical replicates. Data were analyzed by unpaired t test. ∗ p
    Figure Legend Snippet: Interrogating Downstream Effectors of GSK3 Inhibition in Rat ESCs (A) TopFlash assay of β-catenin transcriptional activity in rat and mouse ESCs in PL, T2iL, and 2iL. Values are normalized to mouse ESCs in PL. Error bars represent SD of technical triplicates. (B) Immunostaining of β-catenin in rat ESCs cultured in T2iL and 2iL. (C) qRT-PCR analysis of Tcf1 , Tcf3 , Tcf4 , and Lef1 in rat ESCs maintained in T2iL, using TaqMan probes. Values are normalized to Gapdh and relative to Tcf1 . (D) qRT-PCR analysis using conserved primers of Lef1 expression in rat and mouse ESCs maintained in 2iL. (E) qRT-PCR analysis of a panel of gene expression after Tcf3 and Lef1 knockdown. Gene expression was normalized to Gapdh and relative to values in siGFP transfected cells cultured in 2iL. Error bars represent SD of technical triplicates. (F) Effect of stable knockdown of LEF1 on colony formation in 2iL or T2iL. A total of 80 cells were plated per well and analyzed by AP staining after 5 days. Error bars are SDs of four technical replicates. Data were analyzed by unpaired t test. ∗ p

    Techniques Used: Inhibition, TOPFlash assay, Activity Assay, Immunostaining, Cell Culture, Quantitative RT-PCR, Expressing, Transfection, Staining

    9) Product Images from "Deletion of 12/15-Lipoxygenase Alters Macrophage and Islet Function in NOD-Alox15null Mice, Leading to Protection against Type 1 Diabetes Development"

    Article Title: Deletion of 12/15-Lipoxygenase Alters Macrophage and Islet Function in NOD-Alox15null Mice, Leading to Protection against Type 1 Diabetes Development

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0056763

    Expression of Macrophage 12/15-LO and downstream mediators. A) 12/15-LO expression of NOD mice macrophages versus lymphocytes. Data are shown as ΔCt X10 6 . B) Macrophage mRNA expression of downstream effectors of the 12/15-LO pathway. Thioglycollate-induced peritoneal macrophages of NOD (n = 5) and NOD- Alox15 null (n = 3) mice were tested for mRNA expression of proinflammatory cytokines and STAT4 by qRT-PCR using Taqman probes. Data are shown as 1/ΔCt. Data represent 2 experiments with n = 4 mice per group. C) Protein levels for total STAT4 and IL-1β in thioglycollate-induced macrophages were measured in duplicate by ELISA (NOD, n = 5; NOD- Alox15 null , n = 4). D) IL-12p70 levels in bone marrow macrophages were determined by intracellular flow cytometry (n = 3 for each strain. *p
    Figure Legend Snippet: Expression of Macrophage 12/15-LO and downstream mediators. A) 12/15-LO expression of NOD mice macrophages versus lymphocytes. Data are shown as ΔCt X10 6 . B) Macrophage mRNA expression of downstream effectors of the 12/15-LO pathway. Thioglycollate-induced peritoneal macrophages of NOD (n = 5) and NOD- Alox15 null (n = 3) mice were tested for mRNA expression of proinflammatory cytokines and STAT4 by qRT-PCR using Taqman probes. Data are shown as 1/ΔCt. Data represent 2 experiments with n = 4 mice per group. C) Protein levels for total STAT4 and IL-1β in thioglycollate-induced macrophages were measured in duplicate by ELISA (NOD, n = 5; NOD- Alox15 null , n = 4). D) IL-12p70 levels in bone marrow macrophages were determined by intracellular flow cytometry (n = 3 for each strain. *p

    Techniques Used: Expressing, Mouse Assay, Quantitative RT-PCR, Enzyme-linked Immunosorbent Assay, Flow Cytometry, Cytometry

    10) Product Images from "Identification of Direct Thyroid Hormone Response Genes Reveals the Earliest Gene Regulation Programs during Frog Metamorphosis *"

    Article Title: Identification of Direct Thyroid Hormone Response Genes Reveals the Earliest Gene Regulation Programs during Frog Metamorphosis *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M109.066084

    Real-time qRT-PCR Assays Using SYBR Green Dye and TaqMan Probes
    Figure Legend Snippet: Real-time qRT-PCR Assays Using SYBR Green Dye and TaqMan Probes

    Techniques Used: Quantitative RT-PCR, SYBR Green Assay

    11) Product Images from "Nucleosome and transcription activator antagonism at human ?-globin locus control region DNase I hypersensitive sites"

    Article Title: Nucleosome and transcription activator antagonism at human ?-globin locus control region DNase I hypersensitive sites

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkm620

    Association of transcriptional activators in the LCR. ( A ) Sequences of LCR HSs cores are presented. Potential sites with which transcription activators could interact are indicated. Red, GATA-1 motifs; blue, NF-E2/AP1 motifs; turquoise, CTCF site in HS5; purple, underlined sequences represents the TaqMan amplicons for each HS. ( B ) ChIP was performed with antibodies specific to NF-E2 and GATA-1 and chromatin fixed with 1% formaldehyde. Relative intensity was determined by quantitatively comparing the amount of target sequence in immunoprecipitated DNA to the amount of target sequence in input DNA. Values for GATA-1 were re-scaled by dividing by 4 to present alongside the results for NF-E2. Signals obtained without antibody and with normal rabbit IgG were included as controls. The results of three independent experiments ± SEM are depicted.
    Figure Legend Snippet: Association of transcriptional activators in the LCR. ( A ) Sequences of LCR HSs cores are presented. Potential sites with which transcription activators could interact are indicated. Red, GATA-1 motifs; blue, NF-E2/AP1 motifs; turquoise, CTCF site in HS5; purple, underlined sequences represents the TaqMan amplicons for each HS. ( B ) ChIP was performed with antibodies specific to NF-E2 and GATA-1 and chromatin fixed with 1% formaldehyde. Relative intensity was determined by quantitatively comparing the amount of target sequence in immunoprecipitated DNA to the amount of target sequence in input DNA. Values for GATA-1 were re-scaled by dividing by 4 to present alongside the results for NF-E2. Signals obtained without antibody and with normal rabbit IgG were included as controls. The results of three independent experiments ± SEM are depicted.

    Techniques Used: Chromatin Immunoprecipitation, Sequencing, Immunoprecipitation

    12) Product Images from "Identification, Classification and Differential Expression of Oleosin Genes in Tung Tree (Vernicia fordii)"

    Article Title: Identification, Classification and Differential Expression of Oleosin Genes in Tung Tree (Vernicia fordii)

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0088409

    qPCR optimization, specificity and efficiency for OLE assay. (A) TaqMan qPCR optimization. TaqMan qPCR reactions contained 5 ng RNA-equivalent cDNA from tung seeds, various concentrations of the primers and TaqMan probe. Ole1 assay optimization is presented. (B) Specificity of SYBR Green qPCR by melt curve analysis and gel electrophoresis of amplification products. The qPCR reactions contained 5 ng RNA-equivalent cDNA from tung tree seeds. The qPCR products were separated by agarose gel electrophoresis. Lane 100 bp represents DNA ladders with 100 bp as the smallest band, increasing upward in 100 bp increments. The results using RNA isolated from leaves and flowers are presented in Figure S3 . (C) qPCR efficiency for OLE assay. TaqMan and SYBR Green qPCR reaction mixtures contained variable concentrations of RNA-equivalent cDNA from tung seeds, the optimized concentrations of each primer and probe (200 nM), and Absolute QPCR Mix (TaqMan qPCR) or each primer and 1 x iQ SYBR Green Supermix (SYBR Green qPCR). The results using RNA isolated from stage 4 seeds of tree 1 are shown in the figure. The results for Ole2, Ole3 and Ole4 assays are presented in Figure S4 . The results using RNA from other stages of tung seeds, leaves and flowers are presented in Table S1 .
    Figure Legend Snippet: qPCR optimization, specificity and efficiency for OLE assay. (A) TaqMan qPCR optimization. TaqMan qPCR reactions contained 5 ng RNA-equivalent cDNA from tung seeds, various concentrations of the primers and TaqMan probe. Ole1 assay optimization is presented. (B) Specificity of SYBR Green qPCR by melt curve analysis and gel electrophoresis of amplification products. The qPCR reactions contained 5 ng RNA-equivalent cDNA from tung tree seeds. The qPCR products were separated by agarose gel electrophoresis. Lane 100 bp represents DNA ladders with 100 bp as the smallest band, increasing upward in 100 bp increments. The results using RNA isolated from leaves and flowers are presented in Figure S3 . (C) qPCR efficiency for OLE assay. TaqMan and SYBR Green qPCR reaction mixtures contained variable concentrations of RNA-equivalent cDNA from tung seeds, the optimized concentrations of each primer and probe (200 nM), and Absolute QPCR Mix (TaqMan qPCR) or each primer and 1 x iQ SYBR Green Supermix (SYBR Green qPCR). The results using RNA isolated from stage 4 seeds of tree 1 are shown in the figure. The results for Ole2, Ole3 and Ole4 assays are presented in Figure S4 . The results using RNA from other stages of tung seeds, leaves and flowers are presented in Table S1 .

    Techniques Used: Real-time Polymerase Chain Reaction, SYBR Green Assay, Nucleic Acid Electrophoresis, Amplification, Agarose Gel Electrophoresis, Isolation

    Relative levels of OLE gene expression in developing tung seeds, leaves and flowers. (A) TaqMan qPCR. The qPCR reaction mixtures contained 25 ng of RNA-equivalent cDNA from tung seeds and 200 nM of each primer and probe. (B) SYBR Green qPCR. The qPCR reaction mixtures contained 5 ng of RNA-equivalent cDNA from various stages of tung seed, leaves and flowers and 200 nM of each primer. The means of mRNA expression levels calculated from two qPCR assays in each seed stage using Rpl19b as the reference mRNA is presented. The results using Gapdh and Ubl as the reference mRNA are presented in Figure S5 (TaqMan qPCR assay) and Figure S6 (SYBR Green qPCR assay).
    Figure Legend Snippet: Relative levels of OLE gene expression in developing tung seeds, leaves and flowers. (A) TaqMan qPCR. The qPCR reaction mixtures contained 25 ng of RNA-equivalent cDNA from tung seeds and 200 nM of each primer and probe. (B) SYBR Green qPCR. The qPCR reaction mixtures contained 5 ng of RNA-equivalent cDNA from various stages of tung seed, leaves and flowers and 200 nM of each primer. The means of mRNA expression levels calculated from two qPCR assays in each seed stage using Rpl19b as the reference mRNA is presented. The results using Gapdh and Ubl as the reference mRNA are presented in Figure S5 (TaqMan qPCR assay) and Figure S6 (SYBR Green qPCR assay).

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, SYBR Green Assay

    13) Product Images from "Myocarditis in CD8-Depleted SIV-Infected Rhesus Macaques after Short-Term Dual Therapy with Nucleoside and Nucleotide Reverse Transcriptase Inhibitors"

    Article Title: Myocarditis in CD8-Depleted SIV-Infected Rhesus Macaques after Short-Term Dual Therapy with Nucleoside and Nucleotide Reverse Transcriptase Inhibitors

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0014429

    Quantification of virus burden and expression of TNF-α in myocardial tissue by real time RT-PCR. Tissue virus burdens were significantly lower in the left ventricles of animals that received CART as compared to untreated controls ( A ). Horizontal bars represent median values for each data set. Real-time RT-PCR with TNF-α specific TaqMan probe revealed significantly greater levels of TNF-α expression in the myocardium of animals that received CART as compared to control animals ( B ). Note that TNF-α expression in the untreated group is similar to SIV-negative controls. Horizontal bars represent median values for each data set.
    Figure Legend Snippet: Quantification of virus burden and expression of TNF-α in myocardial tissue by real time RT-PCR. Tissue virus burdens were significantly lower in the left ventricles of animals that received CART as compared to untreated controls ( A ). Horizontal bars represent median values for each data set. Real-time RT-PCR with TNF-α specific TaqMan probe revealed significantly greater levels of TNF-α expression in the myocardium of animals that received CART as compared to control animals ( B ). Note that TNF-α expression in the untreated group is similar to SIV-negative controls. Horizontal bars represent median values for each data set.

    Techniques Used: Expressing, Quantitative RT-PCR

    14) Product Images from "Intraamniotic LPS modulates expression of antimicrobial peptides in the fetal sheep lung"

    Article Title: Intraamniotic LPS modulates expression of antimicrobial peptides in the fetal sheep lung

    Journal: Pediatric research

    doi: 10.1038/pr.2014.113

    Expression of DAMP mRNAs in preterm fetal sheep lung after IA LPS Expression of the antimicrobial DAMP mRNAs by RT-qPCR using Taqman probes was performed. A: IL-α expression peaked at 12 hours, B: lactoferrin peaked 24 hours, C: HMGB1, D: RAGE, E: HSP70. (*p
    Figure Legend Snippet: Expression of DAMP mRNAs in preterm fetal sheep lung after IA LPS Expression of the antimicrobial DAMP mRNAs by RT-qPCR using Taqman probes was performed. A: IL-α expression peaked at 12 hours, B: lactoferrin peaked 24 hours, C: HMGB1, D: RAGE, E: HSP70. (*p

    Techniques Used: Expressing, IA, Quantitative RT-PCR

    15) Product Images from "Combining genomic analyses with tumour-derived slice cultures for the characterization of an EGFR-activating kinase mutation in a case of glioblastoma"

    Article Title: Combining genomic analyses with tumour-derived slice cultures for the characterization of an EGFR-activating kinase mutation in a case of glioblastoma

    Journal: BMC Cancer

    doi: 10.1186/s12885-018-4873-9

    L861Q TaqMan assay (droplet digital PCR). 2D plots and amounts of L861Q-positive droplets (indicated in red) obtained via ddPCR with FFPE DNA ( a ) or cfDNA ( b to h ). a ) the primary tumour, b ) on the day of surgery (D0), c ) before concomitant chemotherapy (CT) and radiotherapy (RT) (pre-RT), d ) 1 month after RT (post-RT), e ) 1 month after the first cycle of CT (CT-1), f ) 1 month after four cycles of CT (CT-4), g ) after 9 weeks of afatinib treatment (post-TKI), and h ) after two cycles of lomustine with bevacizumab (Lom + Bev-2). The plasma DNA concentration is expressed as the amount per ml of plasma. ddPCR, droplet digital PCR; FFPE, formalin-fixed, paraffin-embedded; pDNA, plasma DNA; AU, arbitrary units; WT, wild type; CT, chemotherapy; RT, radiotherapy
    Figure Legend Snippet: L861Q TaqMan assay (droplet digital PCR). 2D plots and amounts of L861Q-positive droplets (indicated in red) obtained via ddPCR with FFPE DNA ( a ) or cfDNA ( b to h ). a ) the primary tumour, b ) on the day of surgery (D0), c ) before concomitant chemotherapy (CT) and radiotherapy (RT) (pre-RT), d ) 1 month after RT (post-RT), e ) 1 month after the first cycle of CT (CT-1), f ) 1 month after four cycles of CT (CT-4), g ) after 9 weeks of afatinib treatment (post-TKI), and h ) after two cycles of lomustine with bevacizumab (Lom + Bev-2). The plasma DNA concentration is expressed as the amount per ml of plasma. ddPCR, droplet digital PCR; FFPE, formalin-fixed, paraffin-embedded; pDNA, plasma DNA; AU, arbitrary units; WT, wild type; CT, chemotherapy; RT, radiotherapy

    Techniques Used: TaqMan Assay, Digital PCR, Formalin-fixed Paraffin-Embedded, Concentration Assay

    16) Product Images from "Combining genomic analyses with tumour-derived slice cultures for the characterization of an EGFR-activating kinase mutation in a case of glioblastoma"

    Article Title: Combining genomic analyses with tumour-derived slice cultures for the characterization of an EGFR-activating kinase mutation in a case of glioblastoma

    Journal: BMC Cancer

    doi: 10.1186/s12885-018-4873-9

    L861Q TaqMan assay (droplet digital PCR). 2D plots and amounts of L861Q-positive droplets (indicated in red) obtained via ddPCR with FFPE DNA ( a ) or cfDNA ( b to h ). a ) the primary tumour, b ) on the day of surgery (D0), c ) before concomitant chemotherapy (CT) and radiotherapy (RT) (pre-RT), d ) 1 month after RT (post-RT), e ) 1 month after the first cycle of CT (CT-1), f ) 1 month after four cycles of CT (CT-4), g ) after 9 weeks of afatinib treatment (post-TKI), and h ) after two cycles of lomustine with bevacizumab (Lom + Bev-2). The plasma DNA concentration is expressed as the amount per ml of plasma. ddPCR, droplet digital PCR; FFPE, formalin-fixed, paraffin-embedded; pDNA, plasma DNA; AU, arbitrary units; WT, wild type; CT, chemotherapy; RT, radiotherapy
    Figure Legend Snippet: L861Q TaqMan assay (droplet digital PCR). 2D plots and amounts of L861Q-positive droplets (indicated in red) obtained via ddPCR with FFPE DNA ( a ) or cfDNA ( b to h ). a ) the primary tumour, b ) on the day of surgery (D0), c ) before concomitant chemotherapy (CT) and radiotherapy (RT) (pre-RT), d ) 1 month after RT (post-RT), e ) 1 month after the first cycle of CT (CT-1), f ) 1 month after four cycles of CT (CT-4), g ) after 9 weeks of afatinib treatment (post-TKI), and h ) after two cycles of lomustine with bevacizumab (Lom + Bev-2). The plasma DNA concentration is expressed as the amount per ml of plasma. ddPCR, droplet digital PCR; FFPE, formalin-fixed, paraffin-embedded; pDNA, plasma DNA; AU, arbitrary units; WT, wild type; CT, chemotherapy; RT, radiotherapy

    Techniques Used: TaqMan Assay, Digital PCR, Formalin-fixed Paraffin-Embedded, Concentration Assay

    17) Product Images from "Synemin isoforms differentially organize cell junctions and desmin filaments in neonatal cardiomyocytes"

    Article Title: Synemin isoforms differentially organize cell junctions and desmin filaments in neonatal cardiomyocytes

    Journal: The FASEB Journal

    doi: 10.1096/fj.10-179408

    Expression of synemin mRNA in cardiac myocytes. A , B ) TaqMan assays that detect α-synemin or α+β-synemin cDNAs were used to determine relative ratios of synemin mRNA expression vs . GAPDH in rat hearts as a function of developmental time. Hearts were isolated at E16, E19, P1, P3, P7, P21, and 6 mo. DNA (20 μg) from each was assayed in triplicate to detect desmin, vimentin, α-actinin, vinculin and GAPDH ( A ), or 50 μg DNA was used to detect α-synemin or α+β-synemin ( B ). Highest values for α-synemin and α+β-synemin cDNAs were detected at P7. C ) After normalization to GAPDH, expression of desmin cDNA was highest in adult rat hearts (6 mo), as opposed to vimentin, which was highest at E16 and decreased into adulthood. Two other binding partners of synemin, α-actinin and vinculin, were also assayed; those mRNAs remained similar across the selected time points.
    Figure Legend Snippet: Expression of synemin mRNA in cardiac myocytes. A , B ) TaqMan assays that detect α-synemin or α+β-synemin cDNAs were used to determine relative ratios of synemin mRNA expression vs . GAPDH in rat hearts as a function of developmental time. Hearts were isolated at E16, E19, P1, P3, P7, P21, and 6 mo. DNA (20 μg) from each was assayed in triplicate to detect desmin, vimentin, α-actinin, vinculin and GAPDH ( A ), or 50 μg DNA was used to detect α-synemin or α+β-synemin ( B ). Highest values for α-synemin and α+β-synemin cDNAs were detected at P7. C ) After normalization to GAPDH, expression of desmin cDNA was highest in adult rat hearts (6 mo), as opposed to vimentin, which was highest at E16 and decreased into adulthood. Two other binding partners of synemin, α-actinin and vinculin, were also assayed; those mRNAs remained similar across the selected time points.

    Techniques Used: Expressing, Isolation, Binding Assay

    18) Product Images from "Mast Cell Mediators Inhibit Osteoblastic Differentiation and Extracellular Matrix Mineralization"

    Article Title: Mast Cell Mediators Inhibit Osteoblastic Differentiation and Extracellular Matrix Mineralization

    Journal: Journal of Histochemistry and Cytochemistry

    doi: 10.1369/0022155417734174

    Mast cell mediators modulate the expression of mRNA of osteoblastic differentiation proteins. Osteoblastic cells were cultured for 7 days in DMEM, OM, or OM+Med. The expression of mRNA of osteoblastic differentiation proteins was evaluated by Real-Time PCR using TaqMan PCR Master Mix. The graphs represent the relative expression of mRNA of osteoblastic differentiation proteins. Data are representative of 3 independent experiments. Abbreviations: OM, osteogenic medium; OM+Med, osteogenic medium containing mast cell mediators; ALP, alkaline phosphatase; BSP, bone sialoprotein; OPN, osteopontin; OC, osteocalcin; PCR, polymerase chain reaction; Runx2, runt-related transcription factor 2; OSX, osterix. * p
    Figure Legend Snippet: Mast cell mediators modulate the expression of mRNA of osteoblastic differentiation proteins. Osteoblastic cells were cultured for 7 days in DMEM, OM, or OM+Med. The expression of mRNA of osteoblastic differentiation proteins was evaluated by Real-Time PCR using TaqMan PCR Master Mix. The graphs represent the relative expression of mRNA of osteoblastic differentiation proteins. Data are representative of 3 independent experiments. Abbreviations: OM, osteogenic medium; OM+Med, osteogenic medium containing mast cell mediators; ALP, alkaline phosphatase; BSP, bone sialoprotein; OPN, osteopontin; OC, osteocalcin; PCR, polymerase chain reaction; Runx2, runt-related transcription factor 2; OSX, osterix. * p

    Techniques Used: Expressing, Cell Culture, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, ALP Assay

    19) Product Images from "MicroRNA Expression Changes during Interferon-Beta Treatment in the Peripheral Blood of Multiple Sclerosis Patients"

    Article Title: MicroRNA Expression Changes during Interferon-Beta Treatment in the Peripheral Blood of Multiple Sclerosis Patients

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms140816087

    Down-regulation of hsa-miR-29c-3p in response to IFN-beta therapy. The hsa-miR-29c-3p expression dynamics within the first month of IFN-beta treatment are presented. ( A ) TaqMan miRNA cards revealed reduced levels of this miRNA in the PBMC of 6 patients (Pat1-6, the main cohort); ( B ) Affymetrix miRNA arrays were then used to replicate the measurement for three of these patients (Pat1-3); ( C ) Finally, the down-regulation of hsa-miR-29c-3p was confirmed in an independent group of 12 patients (the validation cohort) using TaqMan single-tube assays. The Affymetrix analysis was based on hybridization of miRNA molecules to probes (probe set “ hsa-miR-29c_st ”), whereas the TaqMan analyses were based on real-time PCR. The TaqMan data are in linear scale, and the Affymetrix data are in log2 scale due to a different data preprocessing.
    Figure Legend Snippet: Down-regulation of hsa-miR-29c-3p in response to IFN-beta therapy. The hsa-miR-29c-3p expression dynamics within the first month of IFN-beta treatment are presented. ( A ) TaqMan miRNA cards revealed reduced levels of this miRNA in the PBMC of 6 patients (Pat1-6, the main cohort); ( B ) Affymetrix miRNA arrays were then used to replicate the measurement for three of these patients (Pat1-3); ( C ) Finally, the down-regulation of hsa-miR-29c-3p was confirmed in an independent group of 12 patients (the validation cohort) using TaqMan single-tube assays. The Affymetrix analysis was based on hybridization of miRNA molecules to probes (probe set “ hsa-miR-29c_st ”), whereas the TaqMan analyses were based on real-time PCR. The TaqMan data are in linear scale, and the Affymetrix data are in log2 scale due to a different data preprocessing.

    Techniques Used: Expressing, Hybridization, Real-time Polymerase Chain Reaction

    20) Product Images from "MicroRNA-1 inhibits tumorigenicity of esophageal squamous cell carcinoma and enhances sensitivity to gefitinib"

    Article Title: MicroRNA-1 inhibits tumorigenicity of esophageal squamous cell carcinoma and enhances sensitivity to gefitinib

    Journal: Oncology Letters

    doi: 10.3892/ol.2017.7378

    Inverse correlation between the levels of miR-1 expression and PIK3CA expression in ESCC tissues. (A) The relative level of miR-1 expression was analyzed by TaqMan RT-qPCR in 74 ESCC tissues and corresponding non-tumor tissues. (B) The level of PIK3CA mRNA expression was analyzed by RT-qPCR in 74 ESCC tissues and corresponding non-tumor tissues. (C) Correlation between the levels of miR-1 and PIK3CA mRNA expression in ESCC tissues. Data are presented as the mean ± standard error from three independent experiments. **P
    Figure Legend Snippet: Inverse correlation between the levels of miR-1 expression and PIK3CA expression in ESCC tissues. (A) The relative level of miR-1 expression was analyzed by TaqMan RT-qPCR in 74 ESCC tissues and corresponding non-tumor tissues. (B) The level of PIK3CA mRNA expression was analyzed by RT-qPCR in 74 ESCC tissues and corresponding non-tumor tissues. (C) Correlation between the levels of miR-1 and PIK3CA mRNA expression in ESCC tissues. Data are presented as the mean ± standard error from three independent experiments. **P

    Techniques Used: Expressing, Quantitative RT-PCR

    Expression of miR-1 and PIK3CA in transfected cells. TE-1 cells were transiently transfected with miR-1 mimics (50 nM) or the negative control. The cells were obtained after 48 h for analysis. (A) TaqMan RT-qPCR detection of miR-1 expression levels in TE-1 cells. (B) The level of PIK3CA mRNA expression was detected by RT-qPCR in TE-1 cells. (C) Cell lysates were prepared and used for western blotting with antibodies specific for PIK3CA, total Akt, p-Akt and survivin. Data are presented as the mean ± standard error from three independent experiments. **P
    Figure Legend Snippet: Expression of miR-1 and PIK3CA in transfected cells. TE-1 cells were transiently transfected with miR-1 mimics (50 nM) or the negative control. The cells were obtained after 48 h for analysis. (A) TaqMan RT-qPCR detection of miR-1 expression levels in TE-1 cells. (B) The level of PIK3CA mRNA expression was detected by RT-qPCR in TE-1 cells. (C) Cell lysates were prepared and used for western blotting with antibodies specific for PIK3CA, total Akt, p-Akt and survivin. Data are presented as the mean ± standard error from three independent experiments. **P

    Techniques Used: Expressing, Transfection, Negative Control, Quantitative RT-PCR, Western Blot

    21) Product Images from "Cholecystokinin Is Up-Regulated in Obese Mouse Islets and Expands ?-Cell Mass by Increasing ?-Cell Survival"

    Article Title: Cholecystokinin Is Up-Regulated in Obese Mouse Islets and Expands ?-Cell Mass by Increasing ?-Cell Survival

    Journal: Endocrinology

    doi: 10.1210/en.2010-0233

    CCK is up-regulated in pancreatic islets of ob / ob mice. A, Cck mRNA abundance in 18-d-, 4-wk-, and 14-wk-old islets (n = 3–5). Comparisons were made by ANOVA followed by Bonferroni-corrected Student’s unpaired t tests. B and C, CCK protein was measured by RIA analysis; B, total CCK levels were measured in 14-wk islets from lean and ob / ob islets (n = 4); C, islets from ob / ob mice were fractionated by HPLC, and RIA was performed on each fraction to determine CCK species. Antibodies for amidated and sulfated CCK are shown. Sulfated and amidated standards were used and labeled to help identify the different species. Nonamidated and nonsulfated antibodies were used, and no immunoreactivity was detected. D, Cckar and Cckbr mRNA abundance in 14-wk-old islets (n = 5 for each). E, Cck mRNA abundance in brain and intestinal tissue from 14-wk-old mice (n = 4–5 for each). F and G, Plasma insulin (F) and Cck mRNA (G) abundance in 16-wk-old agouti mice (n = 3). For all quantitative RT-PCR, TaqMan cycle threshold (Ct) values were normalized to β-actin levels to generate ΔCt values. Plasma insulin comparisons were made using log 10 -transformed values. All comparisons were made by Student’s unpaired t test unless otherwise stated.
    Figure Legend Snippet: CCK is up-regulated in pancreatic islets of ob / ob mice. A, Cck mRNA abundance in 18-d-, 4-wk-, and 14-wk-old islets (n = 3–5). Comparisons were made by ANOVA followed by Bonferroni-corrected Student’s unpaired t tests. B and C, CCK protein was measured by RIA analysis; B, total CCK levels were measured in 14-wk islets from lean and ob / ob islets (n = 4); C, islets from ob / ob mice were fractionated by HPLC, and RIA was performed on each fraction to determine CCK species. Antibodies for amidated and sulfated CCK are shown. Sulfated and amidated standards were used and labeled to help identify the different species. Nonamidated and nonsulfated antibodies were used, and no immunoreactivity was detected. D, Cckar and Cckbr mRNA abundance in 14-wk-old islets (n = 5 for each). E, Cck mRNA abundance in brain and intestinal tissue from 14-wk-old mice (n = 4–5 for each). F and G, Plasma insulin (F) and Cck mRNA (G) abundance in 16-wk-old agouti mice (n = 3). For all quantitative RT-PCR, TaqMan cycle threshold (Ct) values were normalized to β-actin levels to generate ΔCt values. Plasma insulin comparisons were made using log 10 -transformed values. All comparisons were made by Student’s unpaired t test unless otherwise stated.

    Techniques Used: Mouse Assay, High Performance Liquid Chromatography, Labeling, Quantitative RT-PCR, Transformation Assay

    22) Product Images from "HDL-associated ApoM is anti-apoptotic by delivering sphingosine 1-phosphate to S1P1 S1P3 receptors on vascular endothelium"

    Article Title: HDL-associated ApoM is anti-apoptotic by delivering sphingosine 1-phosphate to S1P1 S1P3 receptors on vascular endothelium

    Journal: Lipids in Health and Disease

    doi: 10.1186/s12944-017-0429-2

    Pharmacological activation of S1P1 or S1P3 protects endothelial cells against serum/GF deprivation-induced cell death. a Relative expression of S1PR in HUVEC. Total RNA was analyzed by qPCR using Taqman probes for S1PR and normalized against GAPDH expression. S1P1 expression was chosen as reference. Error bars correspond to SD, n.d., not detected. b – e HUVEC were grown up to confluence in full medium, then switched to serum/GF deprivation medium with SEW2971 5 μM b and e , ML-031 5 μM c and e or/and CYM5541 5 μM d and e for 18 h and then analyzed by flow cytometry. The percentage of apoptotic cells (AnnexinV + and 7-ADD − ) was normalized versus serum/GF starvation condition. Error bars correspond to SEM. In b , n = 9, Mann-Whitney U -test p
    Figure Legend Snippet: Pharmacological activation of S1P1 or S1P3 protects endothelial cells against serum/GF deprivation-induced cell death. a Relative expression of S1PR in HUVEC. Total RNA was analyzed by qPCR using Taqman probes for S1PR and normalized against GAPDH expression. S1P1 expression was chosen as reference. Error bars correspond to SD, n.d., not detected. b – e HUVEC were grown up to confluence in full medium, then switched to serum/GF deprivation medium with SEW2971 5 μM b and e , ML-031 5 μM c and e or/and CYM5541 5 μM d and e for 18 h and then analyzed by flow cytometry. The percentage of apoptotic cells (AnnexinV + and 7-ADD − ) was normalized versus serum/GF starvation condition. Error bars correspond to SEM. In b , n = 9, Mann-Whitney U -test p

    Techniques Used: Activation Assay, Expressing, Real-time Polymerase Chain Reaction, Flow Cytometry, Cytometry, MANN-WHITNEY

    23) Product Images from "CpG-Oligodeoxynucleotide Is a Potent Adjuvant with an Entamoeba histolytica Gal-Inhibitable Lectin Vaccine against Amoebic Liver Abscess in Gerbils "

    Article Title: CpG-Oligodeoxynucleotide Is a Potent Adjuvant with an Entamoeba histolytica Gal-Inhibitable Lectin Vaccine against Amoebic Liver Abscess in Gerbils

    Journal: Infection and Immunity

    doi: 10.1128/IAI.74.1.528-536.2006

    Taqman real-time PCR analysis of spleen (A) and mesenteric lymph node (B) cytokine gene expression ( n = 3 per group per time point). Gene expression was normalized to 18S rRNA and represented as the increase over normal nontreated gerbil mRNA.
    Figure Legend Snippet: Taqman real-time PCR analysis of spleen (A) and mesenteric lymph node (B) cytokine gene expression ( n = 3 per group per time point). Gene expression was normalized to 18S rRNA and represented as the increase over normal nontreated gerbil mRNA.

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    24) Product Images from "?-Globin Intergenic Transcription and Histone Acetylation Dependent on an Enhancer ▿"

    Article Title: ?-Globin Intergenic Transcription and Histone Acetylation Dependent on an Enhancer ▿

    Journal: Molecular and Cellular Biology

    doi: 10.1128/MCB.02337-06

    Structure of the human β-globin locus and minichromosomal locus containing the ɛ-globin gene and LCR HS2. The human β-globin locus is diagrammed across the top of the figure. A domain of histone modification mapped over the LCR and ɛ- and γ-globin genes in K562 cells is indicated by the colored rectangle. LCR HS2 (1.46 kb) was fused to the ɛ-globin gene (3.7 kb) in the minichromosome locus (see Materials and Methods). Two mutant loci were created in which either the HS2 NF-E2 site or the ɛ-globin promoter TATA box was destroyed by clustered point mutations. The positions of TaqMan probes used for real-time PCR are indicted at the bottom.
    Figure Legend Snippet: Structure of the human β-globin locus and minichromosomal locus containing the ɛ-globin gene and LCR HS2. The human β-globin locus is diagrammed across the top of the figure. A domain of histone modification mapped over the LCR and ɛ- and γ-globin genes in K562 cells is indicated by the colored rectangle. LCR HS2 (1.46 kb) was fused to the ɛ-globin gene (3.7 kb) in the minichromosome locus (see Materials and Methods). Two mutant loci were created in which either the HS2 NF-E2 site or the ɛ-globin promoter TATA box was destroyed by clustered point mutations. The positions of TaqMan probes used for real-time PCR are indicted at the bottom.

    Techniques Used: Modification, Mutagenesis, Real-time Polymerase Chain Reaction

    25) Product Images from "Prazosin Can Prevent Glucocorticoid Mediated Capillary Rarefaction"

    Article Title: Prazosin Can Prevent Glucocorticoid Mediated Capillary Rarefaction

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0166899

    Alterations to VEGF-A and TSP-1 with elevated CORT and concomitant prazosin treatment. RNA or protein was isolated from the TA muscle after 1W or 2W of CORT with or without concurrent prazosin treatment. Taqman qPCR was used to assess the mRNA levels of VEGF-A (A,B) and TSP-1 (D,E), while VEGF-A protein was assessed by ELISA (C) and TSP-1 protein by Western blot (F). (A) VEGF-A mRNA was not altered in response to 1W CORT and/or prazosin. (B) VEGF-A mRNA was not affected by 2W CORT ( P = 0.08), while a significant prazosin effect was detected within the 2W CORT-prazosin group (* P
    Figure Legend Snippet: Alterations to VEGF-A and TSP-1 with elevated CORT and concomitant prazosin treatment. RNA or protein was isolated from the TA muscle after 1W or 2W of CORT with or without concurrent prazosin treatment. Taqman qPCR was used to assess the mRNA levels of VEGF-A (A,B) and TSP-1 (D,E), while VEGF-A protein was assessed by ELISA (C) and TSP-1 protein by Western blot (F). (A) VEGF-A mRNA was not altered in response to 1W CORT and/or prazosin. (B) VEGF-A mRNA was not affected by 2W CORT ( P = 0.08), while a significant prazosin effect was detected within the 2W CORT-prazosin group (* P

    Techniques Used: Isolation, Real-time Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay, Western Blot

    CORT influence on Ang-1 mRNA and Akt phosphorylation. RNA was isolated from the TA muscle after 1W or 2W of CORT treatment with or without concurrent prazosin or from cultured endothelial or C2C12 cell extracts after 48 hours of CORT-treatment. (A,B) Ang-1 mRNA, assessed by Taqman qPCR and represented as 2 -ΔCt relative to the housekeeping gene HPRT1, was significantly reduced with CORT treatment ( # P = 0.02; main effect of 1W CORT; ## P
    Figure Legend Snippet: CORT influence on Ang-1 mRNA and Akt phosphorylation. RNA was isolated from the TA muscle after 1W or 2W of CORT treatment with or without concurrent prazosin or from cultured endothelial or C2C12 cell extracts after 48 hours of CORT-treatment. (A,B) Ang-1 mRNA, assessed by Taqman qPCR and represented as 2 -ΔCt relative to the housekeeping gene HPRT1, was significantly reduced with CORT treatment ( # P = 0.02; main effect of 1W CORT; ## P

    Techniques Used: Isolation, Cell Culture, Real-time Polymerase Chain Reaction

    26) Product Images from "Bone marker gene expression in calvarial bones: different bone microenvironments"

    Article Title: Bone marker gene expression in calvarial bones: different bone microenvironments

    Journal: Journal of Biological Research

    doi: 10.1186/s40709-017-0066-y

    TaqMan analysis of bone resorption molecules: RANK, RANKL and OPG expression in calvariae of C57BL/KalwRiJHsD mice. RNA was extracted with cDNA synthesized from frontal (F), parietal (P) and interparietal (IP) bones. The relative expression of osteoclast marker genes was adjusted to the relative expression of a housekeeping gene, β-actin. Data show that the RANK gene was only expressed in interparietal bone, while it was not expressed in frontal or parietal bones. Additionally, there was a significant increase in the relative expression of the RANK gene ( a ) in interparietal bone compared to frontal and parietal bones. On the other hand, there was a significant increase in the relative expression of the RANKL ( b ) and OPG ( c ) genes in parietal bone compared to frontal and interparietal bones
    Figure Legend Snippet: TaqMan analysis of bone resorption molecules: RANK, RANKL and OPG expression in calvariae of C57BL/KalwRiJHsD mice. RNA was extracted with cDNA synthesized from frontal (F), parietal (P) and interparietal (IP) bones. The relative expression of osteoclast marker genes was adjusted to the relative expression of a housekeeping gene, β-actin. Data show that the RANK gene was only expressed in interparietal bone, while it was not expressed in frontal or parietal bones. Additionally, there was a significant increase in the relative expression of the RANK gene ( a ) in interparietal bone compared to frontal and parietal bones. On the other hand, there was a significant increase in the relative expression of the RANKL ( b ) and OPG ( c ) genes in parietal bone compared to frontal and interparietal bones

    Techniques Used: Expressing, Mouse Assay, Synthesized, Marker

    TaqMan analysis of osteoblast markers: Runx2, OC and OSX expression in calvariae of C57BL/KalwRiJHsD mice. RNA was extracted with cDNA synthesized from frontal (F), parietal (P) and interparietal (IP) bones. The relative expression of osteoblast marker genes was adjusted to the relative expression of a housekeeping gene, β-actin. Data showed that there was a significant increase in the relative expression levels of Runx2 ( a ), OC ( b ) and OSX ( c ) in parietal bone compared to frontal and interparietal bones
    Figure Legend Snippet: TaqMan analysis of osteoblast markers: Runx2, OC and OSX expression in calvariae of C57BL/KalwRiJHsD mice. RNA was extracted with cDNA synthesized from frontal (F), parietal (P) and interparietal (IP) bones. The relative expression of osteoblast marker genes was adjusted to the relative expression of a housekeeping gene, β-actin. Data showed that there was a significant increase in the relative expression levels of Runx2 ( a ), OC ( b ) and OSX ( c ) in parietal bone compared to frontal and interparietal bones

    Techniques Used: Expressing, Mouse Assay, Synthesized, Marker

    27) Product Images from "MAPT Genetic Variation and Neuronal Maturity Alter Isoform Expression Affecting Axonal Transport in iPSC-Derived Dopamine Neurons"

    Article Title: MAPT Genetic Variation and Neuronal Maturity Alter Isoform Expression Affecting Axonal Transport in iPSC-Derived Dopamine Neurons

    Journal: Stem Cell Reports

    doi: 10.1016/j.stemcr.2017.06.005

    Dopaminergic Neuronal Cultures Exhibit Significant Differences in Isoform Expression from H1 and H2 Alleles at 6 Months TaqMan-based real-time qPCR expression assays on samples at DIV190. Mean ± SEM; individual 1, n = 1 clone; individuals 2 and 3, n = 3 clones; ≥3 cDNA samples per clone. (A) Total MAPT expression reported as relative ΔC T of geometric mean of three housekeeper genes ( GAPDH, HPRT1, and ACTB ). n.s., not significant, one-way ANOVA. (B) Percent inclusion of alternatively spliced exons 3 (light blue) and 10 (dark blue) at DIV190. The three individuals show similar inclusion of exon 3, whereas individual 3 shows a significantly greater inclusion of exon 10. Significant difference between groups in an unpaired t test: ∗∗∗ p = 0.0005. (C–E) Allele-specific expression assays distinguishing transcripts of H1 and H2 allelic origin, presented as H1:H2 ratio, i.e., values > 1 show higher H1 expression. Data from analysis of human midbrain (C) n = 9; (D) n = 5; and (E) n = 9. (C) Individuals 2 and 3 show significantly greater expression of total MAPT transcripts from the H1 chromosome (individual 2, ∗∗ p = 0.0059; individual 3, ∗ p = 0.0471; midbrain, n.s.). (D and E) The H1:H2 ratio is normalized to the H1:H2 ratio of total MAPT transcripts per sample. ∗ Significant difference from mean of 1 in a one-sample t test. (D) There are 2-fold greater exon 3-containing transcripts coming from the H2 chromosome. Individual 2, ∗∗ p = 0.0032; individual 3, ∗∗ p = 0.0040; midbrain, ∗∗ p = 0.0020. (E) Haplotype-specific expression of exon 10 varies between individuals and midbrain: Individual 2, n.s.; individual 3, ∗∗∗ p = 0.0008; midbrain, ∗∗ p = 0.0005. Significant difference between groups in an unpaired t test: ∗∗∗ p = 0.0005. See also Figures S3 and S4 .
    Figure Legend Snippet: Dopaminergic Neuronal Cultures Exhibit Significant Differences in Isoform Expression from H1 and H2 Alleles at 6 Months TaqMan-based real-time qPCR expression assays on samples at DIV190. Mean ± SEM; individual 1, n = 1 clone; individuals 2 and 3, n = 3 clones; ≥3 cDNA samples per clone. (A) Total MAPT expression reported as relative ΔC T of geometric mean of three housekeeper genes ( GAPDH, HPRT1, and ACTB ). n.s., not significant, one-way ANOVA. (B) Percent inclusion of alternatively spliced exons 3 (light blue) and 10 (dark blue) at DIV190. The three individuals show similar inclusion of exon 3, whereas individual 3 shows a significantly greater inclusion of exon 10. Significant difference between groups in an unpaired t test: ∗∗∗ p = 0.0005. (C–E) Allele-specific expression assays distinguishing transcripts of H1 and H2 allelic origin, presented as H1:H2 ratio, i.e., values > 1 show higher H1 expression. Data from analysis of human midbrain (C) n = 9; (D) n = 5; and (E) n = 9. (C) Individuals 2 and 3 show significantly greater expression of total MAPT transcripts from the H1 chromosome (individual 2, ∗∗ p = 0.0059; individual 3, ∗ p = 0.0471; midbrain, n.s.). (D and E) The H1:H2 ratio is normalized to the H1:H2 ratio of total MAPT transcripts per sample. ∗ Significant difference from mean of 1 in a one-sample t test. (D) There are 2-fold greater exon 3-containing transcripts coming from the H2 chromosome. Individual 2, ∗∗ p = 0.0032; individual 3, ∗∗ p = 0.0040; midbrain, ∗∗ p = 0.0020. (E) Haplotype-specific expression of exon 10 varies between individuals and midbrain: Individual 2, n.s.; individual 3, ∗∗∗ p = 0.0008; midbrain, ∗∗ p = 0.0005. Significant difference between groups in an unpaired t test: ∗∗∗ p = 0.0005. See also Figures S3 and S4 .

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Clone Assay

    28) Product Images from "Proteome Analysis and Conditional Deletion of the EAAT2 Glutamate Transporter Provide Evidence against a Role of EAAT2 in Pancreatic Insulin Secretion in Mice *"

    Article Title: Proteome Analysis and Conditional Deletion of the EAAT2 Glutamate Transporter Provide Evidence against a Role of EAAT2 in Pancreatic Insulin Secretion in Mice *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M113.529065

    The levels of EAAT2 and VGLUT3 mRNAs are very low. A , TaqMan real time PCR was used to compare the levels of EAAT2 mRNA in brain regions ( Hip , hippocampus; Th , thalamus; Cb , cerebellum) with those in liver ( Li ), kidney ( K ), and whole pancreas ( P ). The tissues were collected from three 6–9-week-old mice. Data were normalized to 18 S mRNA levels determined by RT-PCR. Note that the EAAT2 mRNA levels in the liver and in the whole pancreas were 10 and 4000 times lower, respectively, than in the hippocampus. B , multiple small pieces (less than 1 mg) of pancreatic tissue were collected from the body of pancreas. The levels of mRNAs encoding VGLUT3 ( open triangles ), EAAT2 ( open circles ), and glucagon ( open squares ) were determined, and the data ( cycle threshold (CT) values) were sorted and plotted according to glucagon levels. Consequently, the graph shows increasing glucagon levels. Hippocampus was used as a control ( solid symbols ). Note that the EAAT2 levels in the pancreas did not correlate with the glucagon levels (the line is horizontal ). Also note that the cycle threshold values for VGLUT3 in the pancreas are similar to those of glucagon in the hippocampus, indicating that VGLUT3 is close to transcription background (higher cycle threshold values means lower mRNA levels as the cycle threshold values represent the number of PCR cycles needed to reach the detection threshold). The tissues were collected from 6–7-week-old mice. The data are from two independent experiments.
    Figure Legend Snippet: The levels of EAAT2 and VGLUT3 mRNAs are very low. A , TaqMan real time PCR was used to compare the levels of EAAT2 mRNA in brain regions ( Hip , hippocampus; Th , thalamus; Cb , cerebellum) with those in liver ( Li ), kidney ( K ), and whole pancreas ( P ). The tissues were collected from three 6–9-week-old mice. Data were normalized to 18 S mRNA levels determined by RT-PCR. Note that the EAAT2 mRNA levels in the liver and in the whole pancreas were 10 and 4000 times lower, respectively, than in the hippocampus. B , multiple small pieces (less than 1 mg) of pancreatic tissue were collected from the body of pancreas. The levels of mRNAs encoding VGLUT3 ( open triangles ), EAAT2 ( open circles ), and glucagon ( open squares ) were determined, and the data ( cycle threshold (CT) values) were sorted and plotted according to glucagon levels. Consequently, the graph shows increasing glucagon levels. Hippocampus was used as a control ( solid symbols ). Note that the EAAT2 levels in the pancreas did not correlate with the glucagon levels (the line is horizontal ). Also note that the cycle threshold values for VGLUT3 in the pancreas are similar to those of glucagon in the hippocampus, indicating that VGLUT3 is close to transcription background (higher cycle threshold values means lower mRNA levels as the cycle threshold values represent the number of PCR cycles needed to reach the detection threshold). The tissues were collected from 6–7-week-old mice. The data are from two independent experiments.

    Techniques Used: Real-time Polymerase Chain Reaction, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

    29) Product Images from "The F-Box Protein Fbp1 Shapes the Immunogenic Potential of Cryptococcus neoformans"

    Article Title: The F-Box Protein Fbp1 Shapes the Immunogenic Potential of Cryptococcus neoformans

    Journal: mBio

    doi: 10.1128/mBio.01828-17

    Depletion of CCR2 + cells impairs CD4 + T cell activation and leads to the death of fbp1 Δ mutant yeast-infected mice. CCR2-DTR mice and control (DTR-negative) littermates were treated with 250 ng of DT intraperitoneally before and after infection with 10 6 fbp1 Δ mutant cells as illustrated in panel A. (B) Survival curve of fbp1 Δ mutant yeast - infected, CCR2-depleted mice (dashed red line) and control littermates (solid red line). The data shown are cumulative from three independent experiments with four or five mice per group. ****, P ≤ 0.0001 (determined by log rank [Mantel-Cox] test). (C) Total number of CD4 + T cells recovered from the BALF of fbp1 Δ mutant - infected, CCR2-depleted mice (red symbols) and control littermates (black symbols) on day 6 after infection. Each symbol represents one mouse. The data shown are cumulative from two experiments with four or five mice per group ***, P ≤ 0.001 (determined by Mann-Whitney test). (D) Representative FACS profile of cytokine production by CD4 + T cells recovered from the BALF of fbp1 Δ mutant - infected, CCR2-depleted mice or control littermates. Plots are gated on Thy1.2 + CD4 + CD8 − lymphocytes in BALF. (E) CFU counts in lung tissue of fbp1 Δ mutant - infected, CCR2-depleted mice (red symbols) and control littermates (black symbols) on day 6 after infection. Data are cumulative from two independent experiments with three or four mice per group. ***, P ≤ 0.001 (determined by Mann-Whitney test). (F) Cytokine gene transcription in lung tissue was examined on day 6 after infection with the fbp1 Δ mutant in CCR2-depleted mice (red bars) and control littermates (red striped bars). Control C57BL/6J mice infected with H99 were also analyzed as a control population (black bars). Differential gene expression relative to GAPDH was examined by qRT-PCR with cytokine-specific TaqMan probes and calculated by the ΔΔ CT method. The data shown are cumulative from two independent experiments with four mice per group and are depicted as mean ± the standard error of the mean. **, P ≤ 0.01 (determined by Mann-Whitney test).
    Figure Legend Snippet: Depletion of CCR2 + cells impairs CD4 + T cell activation and leads to the death of fbp1 Δ mutant yeast-infected mice. CCR2-DTR mice and control (DTR-negative) littermates were treated with 250 ng of DT intraperitoneally before and after infection with 10 6 fbp1 Δ mutant cells as illustrated in panel A. (B) Survival curve of fbp1 Δ mutant yeast - infected, CCR2-depleted mice (dashed red line) and control littermates (solid red line). The data shown are cumulative from three independent experiments with four or five mice per group. ****, P ≤ 0.0001 (determined by log rank [Mantel-Cox] test). (C) Total number of CD4 + T cells recovered from the BALF of fbp1 Δ mutant - infected, CCR2-depleted mice (red symbols) and control littermates (black symbols) on day 6 after infection. Each symbol represents one mouse. The data shown are cumulative from two experiments with four or five mice per group ***, P ≤ 0.001 (determined by Mann-Whitney test). (D) Representative FACS profile of cytokine production by CD4 + T cells recovered from the BALF of fbp1 Δ mutant - infected, CCR2-depleted mice or control littermates. Plots are gated on Thy1.2 + CD4 + CD8 − lymphocytes in BALF. (E) CFU counts in lung tissue of fbp1 Δ mutant - infected, CCR2-depleted mice (red symbols) and control littermates (black symbols) on day 6 after infection. Data are cumulative from two independent experiments with three or four mice per group. ***, P ≤ 0.001 (determined by Mann-Whitney test). (F) Cytokine gene transcription in lung tissue was examined on day 6 after infection with the fbp1 Δ mutant in CCR2-depleted mice (red bars) and control littermates (red striped bars). Control C57BL/6J mice infected with H99 were also analyzed as a control population (black bars). Differential gene expression relative to GAPDH was examined by qRT-PCR with cytokine-specific TaqMan probes and calculated by the ΔΔ CT method. The data shown are cumulative from two independent experiments with four mice per group and are depicted as mean ± the standard error of the mean. **, P ≤ 0.01 (determined by Mann-Whitney test).

    Techniques Used: Activation Assay, Mutagenesis, Infection, Mouse Assay, MANN-WHITNEY, FACS, Expressing, Quantitative RT-PCR

    Effective maturation of CCR2 + Ly6C + monocytes into mo-DCs after fbp1 Δ mutant yeast infection. Differentiation of mo-DCs was analyzed on day 3 after i.n. infection with H99 (black bars) or the fbp1 Δ mutant (red bars). The data shown are cumulative from two independent experiments with four or five mice per group and are depicted as the mean ± the standard error of the mean. (A) Representative FACS profile of Ly6C + monocyte maturation into mo-DCs (defined as CD45 + CD11b + Ly6C hi Ly6G-CD11c + class II + ) in H99- or fbp1 Δ mutant-infected mice. MHC, major histocompatibility complex. (B) Percentages of mo-DCs (CD11c + class II + ) in monocyte gate (CD45 + CD11b + Ly6C hi Ly6G − ) in mice infected with H99 (black bar) or the fbp1 Δ mutant (red). (C) Total numbers of mo-DCs recruited to the lungs. (D to F) Total numbers of recruited neutrophils (D), monocytes (E), and mo-DCs (F) on day 3 after infection with H99 (black symbols), the fbp1 Δ mutant (red symbols), or the complemented strain ( fbp1 Δ FBP1 ) (gray symbols). (G to I) Chemokine expression in lung tissue was analyzed by qRT-PCR. The expression of each CCR2 ligand was examined with TaqMan probes. Differential gene expression relative to GAPDH was calculated by the ΔΔ CT method. **, P ≤ 0.01 (determined by Mann-Whitney test).
    Figure Legend Snippet: Effective maturation of CCR2 + Ly6C + monocytes into mo-DCs after fbp1 Δ mutant yeast infection. Differentiation of mo-DCs was analyzed on day 3 after i.n. infection with H99 (black bars) or the fbp1 Δ mutant (red bars). The data shown are cumulative from two independent experiments with four or five mice per group and are depicted as the mean ± the standard error of the mean. (A) Representative FACS profile of Ly6C + monocyte maturation into mo-DCs (defined as CD45 + CD11b + Ly6C hi Ly6G-CD11c + class II + ) in H99- or fbp1 Δ mutant-infected mice. MHC, major histocompatibility complex. (B) Percentages of mo-DCs (CD11c + class II + ) in monocyte gate (CD45 + CD11b + Ly6C hi Ly6G − ) in mice infected with H99 (black bar) or the fbp1 Δ mutant (red). (C) Total numbers of mo-DCs recruited to the lungs. (D to F) Total numbers of recruited neutrophils (D), monocytes (E), and mo-DCs (F) on day 3 after infection with H99 (black symbols), the fbp1 Δ mutant (red symbols), or the complemented strain ( fbp1 Δ FBP1 ) (gray symbols). (G to I) Chemokine expression in lung tissue was analyzed by qRT-PCR. The expression of each CCR2 ligand was examined with TaqMan probes. Differential gene expression relative to GAPDH was calculated by the ΔΔ CT method. **, P ≤ 0.01 (determined by Mann-Whitney test).

    Techniques Used: Mutagenesis, Infection, Mouse Assay, FACS, Expressing, Quantitative RT-PCR, MANN-WHITNEY

    30) Product Images from "Elevated IKK? Accelerates the Differentiation of Human Neuronal Progenitor Cells and Induces MeCP2-Dependent BDNF Expression"

    Article Title: Elevated IKK? Accelerates the Differentiation of Human Neuronal Progenitor Cells and Induces MeCP2-Dependent BDNF Expression

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0041794

    IKKα regulates REST and miR-124a expression. ( A ) IKKα accumulates in the nuclei of differentiating MESC2.10 NPCs. Representative Western blot results for levels of endogenous IKKα in the cytoplasm (C) and nuclear (N) fractions of differentiating NPCs (top panel) are shown. IKKα was detected with a mouse anti-IKKα antibody. Nuclear LaminB1 and cytoplasmic tubulin were used as loading controls (middle and bottom panels, respectively). ( B ) REST protein levels also decline faster in differentiating IKKα+ NPCs compared to differentiating controls. Representative western blot results are shown from nuclear lysates for REST (top panel), IKKα (middle panel) and laminB1 (bottom panel). REST was detected with a mouse anti-REST antibody and Anti-Flag antibody was used to detect IKKα. LaminB1 was used a as loading control. ( C ) After initiating differentiation, REST mRNA levels decline faster in IKKα+ NPCs than in control cells. Taqman probes were used to quantify the mRNA levels at the days shown. The data are shown relative to the level in proliferating control NPCs. GAPDH mRNA was used for normalization. Triplicate samples were averaged for each point, and the SEMs indicated. N.D., not detected. ( D, E ) The accumulation of primary (pri-miRNA) and mature miRNA-124a are shown in D and E, respectively. Taqman probes were used for the qPCR. Pri-miRNA was normalized to GAPDH mRNA and mature miRNA was normalized to the small RNA, RNU6. The data are shown relative to the levels in proliferating control NPCs. P values were obtained using student's t-test.
    Figure Legend Snippet: IKKα regulates REST and miR-124a expression. ( A ) IKKα accumulates in the nuclei of differentiating MESC2.10 NPCs. Representative Western blot results for levels of endogenous IKKα in the cytoplasm (C) and nuclear (N) fractions of differentiating NPCs (top panel) are shown. IKKα was detected with a mouse anti-IKKα antibody. Nuclear LaminB1 and cytoplasmic tubulin were used as loading controls (middle and bottom panels, respectively). ( B ) REST protein levels also decline faster in differentiating IKKα+ NPCs compared to differentiating controls. Representative western blot results are shown from nuclear lysates for REST (top panel), IKKα (middle panel) and laminB1 (bottom panel). REST was detected with a mouse anti-REST antibody and Anti-Flag antibody was used to detect IKKα. LaminB1 was used a as loading control. ( C ) After initiating differentiation, REST mRNA levels decline faster in IKKα+ NPCs than in control cells. Taqman probes were used to quantify the mRNA levels at the days shown. The data are shown relative to the level in proliferating control NPCs. GAPDH mRNA was used for normalization. Triplicate samples were averaged for each point, and the SEMs indicated. N.D., not detected. ( D, E ) The accumulation of primary (pri-miRNA) and mature miRNA-124a are shown in D and E, respectively. Taqman probes were used for the qPCR. Pri-miRNA was normalized to GAPDH mRNA and mature miRNA was normalized to the small RNA, RNU6. The data are shown relative to the levels in proliferating control NPCs. P values were obtained using student's t-test.

    Techniques Used: Expressing, Western Blot, Real-time Polymerase Chain Reaction

    31) Product Images from "A Novel Real-Time PCR Assay of microRNAs Using S-Poly(T), a Specific Oligo(dT) Reverse Transcription Primer with Excellent Sensitivity and Specificity"

    Article Title: A Novel Real-Time PCR Assay of microRNAs Using S-Poly(T), a Specific Oligo(dT) Reverse Transcription Primer with Excellent Sensitivity and Specificity

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0048536

    Comparison of the sensitivity of three different miRNA qPCR assays. Total RNAs were reverse transcribed into cDNA using S-Poly(T) RT primer, oligo(dT) RT primer and Stem-loop RT primer, respectively. Hsa-miR-21 (A), hsa-miR-16 (B) and has-miR-210 (C) were amplified and detected with SYBR Green I followed by melting curve analysis. Hsa-miR-140-5p was reverse transcribed into cDNA using the S-Poly(T) RT primer and the RT primer from TaqMan® microRNA assays kit (Applied Biosystems). The cDNAs were then amplified and detected with either a universal Taqman probe (S-Poly(T) method) or a specific Taqman probe (stem-loop method). The threshold was set at 0.2 on PRISM 7300 Real-time PCR system (Applied Biosystems). All PCR reactions were run in triplicate.
    Figure Legend Snippet: Comparison of the sensitivity of three different miRNA qPCR assays. Total RNAs were reverse transcribed into cDNA using S-Poly(T) RT primer, oligo(dT) RT primer and Stem-loop RT primer, respectively. Hsa-miR-21 (A), hsa-miR-16 (B) and has-miR-210 (C) were amplified and detected with SYBR Green I followed by melting curve analysis. Hsa-miR-140-5p was reverse transcribed into cDNA using the S-Poly(T) RT primer and the RT primer from TaqMan® microRNA assays kit (Applied Biosystems). The cDNAs were then amplified and detected with either a universal Taqman probe (S-Poly(T) method) or a specific Taqman probe (stem-loop method). The threshold was set at 0.2 on PRISM 7300 Real-time PCR system (Applied Biosystems). All PCR reactions were run in triplicate.

    Techniques Used: Real-time Polymerase Chain Reaction, Amplification, SYBR Green Assay, Polymerase Chain Reaction

    32) Product Images from "A rapid and cost-effective method for genotyping apolipoprotein E gene polymorphism"

    Article Title: A rapid and cost-effective method for genotyping apolipoprotein E gene polymorphism

    Journal: Molecular Neurodegeneration

    doi: 10.1186/s13024-016-0069-4

    Schematic diagram of the human APOE gene and APOE genotyping method. a The APOE gene is located on chromosome 19, and is polymorphic at two single nucleotides (rs429358 and rs7412) resulting in three different alleles (ε2, ε3 and ε4). b Amplifications of the APOE ε2, ε3 and ε4 alleles are initiated by allele-specific PCR primers. One double-dye oligonucleotide TaqMan probe was included in all reactions to monitor real-time DNA amplification products
    Figure Legend Snippet: Schematic diagram of the human APOE gene and APOE genotyping method. a The APOE gene is located on chromosome 19, and is polymorphic at two single nucleotides (rs429358 and rs7412) resulting in three different alleles (ε2, ε3 and ε4). b Amplifications of the APOE ε2, ε3 and ε4 alleles are initiated by allele-specific PCR primers. One double-dye oligonucleotide TaqMan probe was included in all reactions to monitor real-time DNA amplification products

    Techniques Used: Polymerase Chain Reaction, Amplification

    33) Product Images from "MicroRNA-24/MODY Gene Regulatory Pathway Mediates Pancreatic β-Cell Dysfunction"

    Article Title: MicroRNA-24/MODY Gene Regulatory Pathway Mediates Pancreatic β-Cell Dysfunction

    Journal: Diabetes

    doi: 10.2337/db13-0151

    Elevated miR-24 reduces cell viability and impairs β-cell function. A : Pre–miR-24 mimetics or pre-Neg at different concentrations (2, 10, or 50 nmol/L) were transfected into MIN6 cells for 48 h, when TaqMan qRT-PCR was carried out. Transfection caused an effective increase in miR-24 abundance in MIN6 cells. B : Overexpression of miR-24 for 48 h caused a decrease of cell viability in MIN6 cells, measured by the WST-1 assay. Transfection of 10 nmol/L miR-24 led to a decrease of cell number in the S phase ( C ) and to an increase in the G2 phase ( D ). The same results were detected with transfection of miR-24 at 50 nmol/L but not at 2 nmol/L, which was insufficient to induce cell cycle arrest. E and F : BrdU labeling was used to confirm the reduced DNA synthesis accompanying the elevation of miR-24 . E : Representative images show BrdU and Hoechst stained cells, and at least 800 cells were counted. F : The BrdU labeling index is defined as the ratio of the number of BrdU + nuclei to the total number of nuclei within the fields. G : Decreased cell proliferation was also detected in primary islets isolated from ICR mice. GSIS and KSIS assays were performed on MIN6 cells overexpressing miR-24 for 48 h, and the GSIS index ( H ) and KSIS index ( I ) were calculated. The results were similar to those in palmitate-treated cells. ** P
    Figure Legend Snippet: Elevated miR-24 reduces cell viability and impairs β-cell function. A : Pre–miR-24 mimetics or pre-Neg at different concentrations (2, 10, or 50 nmol/L) were transfected into MIN6 cells for 48 h, when TaqMan qRT-PCR was carried out. Transfection caused an effective increase in miR-24 abundance in MIN6 cells. B : Overexpression of miR-24 for 48 h caused a decrease of cell viability in MIN6 cells, measured by the WST-1 assay. Transfection of 10 nmol/L miR-24 led to a decrease of cell number in the S phase ( C ) and to an increase in the G2 phase ( D ). The same results were detected with transfection of miR-24 at 50 nmol/L but not at 2 nmol/L, which was insufficient to induce cell cycle arrest. E and F : BrdU labeling was used to confirm the reduced DNA synthesis accompanying the elevation of miR-24 . E : Representative images show BrdU and Hoechst stained cells, and at least 800 cells were counted. F : The BrdU labeling index is defined as the ratio of the number of BrdU + nuclei to the total number of nuclei within the fields. G : Decreased cell proliferation was also detected in primary islets isolated from ICR mice. GSIS and KSIS assays were performed on MIN6 cells overexpressing miR-24 for 48 h, and the GSIS index ( H ) and KSIS index ( I ) were calculated. The results were similar to those in palmitate-treated cells. ** P

    Techniques Used: Cell Function Assay, Transfection, Quantitative RT-PCR, Over Expression, WST-1 Assay, Labeling, DNA Synthesis, Staining, Isolation, Mouse Assay

    Oxidative stress induced miR-24 expression. MIN6 cells were precultured in DMEM with 5.5 mmol/L glucose for 24 h, and then cells were incubated with the indicated concentration of H 2 O 2 for an additional 24 h or with glucose for an additional 48 h. Relative expression of miR-24 induced by H 2 O 2 ( A ) or glucose ( B ) was analyzed by TaqMan qRT-PCR relative to corresponding controls. U6 detected by a TaqMan probe was used as an internal control. Values are the mean ± SEM of three individual experiments (* P
    Figure Legend Snippet: Oxidative stress induced miR-24 expression. MIN6 cells were precultured in DMEM with 5.5 mmol/L glucose for 24 h, and then cells were incubated with the indicated concentration of H 2 O 2 for an additional 24 h or with glucose for an additional 48 h. Relative expression of miR-24 induced by H 2 O 2 ( A ) or glucose ( B ) was analyzed by TaqMan qRT-PCR relative to corresponding controls. U6 detected by a TaqMan probe was used as an internal control. Values are the mean ± SEM of three individual experiments (* P

    Techniques Used: Expressing, Incubation, Concentration Assay, Quantitative RT-PCR

    34) Product Images from "Highly effective combination of LSD1 (KDM1A) antagonist and pan-histone deacetylase inhibitor against human AML cells"

    Article Title: Highly effective combination of LSD1 (KDM1A) antagonist and pan-histone deacetylase inhibitor against human AML cells

    Journal: Leukemia

    doi: 10.1038/leu.2014.119

    Treatment with SP2509 increases H3K4Me3 on the promoters of p57 Kip, KLF4, and p21 and induces mRNA expression of p57Kip, KLF4 and p21 in AML cells A-B . OCI-AML3 cells were treated with the indicated concentrations of SP2509 for 16 hours. At the end of treatment, chromatin was cross-linked, sonicated, and chromatin immunoprecipitation (chIP) was performed for H3K4Me3 and H3K27Me3. The chIP'ed DNA was used as template for qPCR. The fold enrichment was calculated using the Ct value of the chIP'ed DNA versus the Ct for the input DNA. C . OCI-AML3 cells were treated with the indicated concentrations of SP2509 for 16 hours. Then, total RNA was isolated and reverse transcribed. The resulting cDNA was utilized for quantitative PCR of p57Kip, KLF4 and p21 using TaqMan probes. The relative mRNA expression was normalized against GAPDH.
    Figure Legend Snippet: Treatment with SP2509 increases H3K4Me3 on the promoters of p57 Kip, KLF4, and p21 and induces mRNA expression of p57Kip, KLF4 and p21 in AML cells A-B . OCI-AML3 cells were treated with the indicated concentrations of SP2509 for 16 hours. At the end of treatment, chromatin was cross-linked, sonicated, and chromatin immunoprecipitation (chIP) was performed for H3K4Me3 and H3K27Me3. The chIP'ed DNA was used as template for qPCR. The fold enrichment was calculated using the Ct value of the chIP'ed DNA versus the Ct for the input DNA. C . OCI-AML3 cells were treated with the indicated concentrations of SP2509 for 16 hours. Then, total RNA was isolated and reverse transcribed. The resulting cDNA was utilized for quantitative PCR of p57Kip, KLF4 and p21 using TaqMan probes. The relative mRNA expression was normalized against GAPDH.

    Techniques Used: Expressing, Sonication, Chromatin Immunoprecipitation, Real-time Polymerase Chain Reaction, Isolation

    35) Product Images from "High-fat maternal diet during pregnancy persistently alters the offspring microbiome in a primate model"

    Article Title: High-fat maternal diet during pregnancy persistently alters the offspring microbiome in a primate model

    Journal: Nature communications

    doi: 10.1038/ncomms4889

    Exposure to a high fat diet diminishes the presence of Campylobacter M. fuscata were vaginally birthed to mothers consuming a control or high fat diet. Infants consumed the maternal diet until weaning when they were either maintained on the maternal diet (control cohort) or switched to the opposing diet (crossover cohort). At one year of age, animals were sacrificed and DNA was isolated from the stool. DNA was subjected to PCR amplification for both universal 16S rRNA and for Campylobacter 16S rRNA genes. The number of juveniles ( n ) in each cohort is indicated in parenthesis in the figure legend. (a) Quantitative real-time PCR (qPCR) analysis of stool isolated from juvenile cohorts designated by maternal/post-wean diet. DNA was amplified for universal and Campylobacter 16S rRNA genes using both TaqMan and SYBR qPCR assays. The presence of Campylobacter 16S rRNA was normalized to total universal 16S rRNA presence to provide relative abundance. Each qPCR assay (TaqMan or SYBR) was repeated in three individual assays. Results were pooled and statistical analysis was performed using a one-way ANOVA (** p
    Figure Legend Snippet: Exposure to a high fat diet diminishes the presence of Campylobacter M. fuscata were vaginally birthed to mothers consuming a control or high fat diet. Infants consumed the maternal diet until weaning when they were either maintained on the maternal diet (control cohort) or switched to the opposing diet (crossover cohort). At one year of age, animals were sacrificed and DNA was isolated from the stool. DNA was subjected to PCR amplification for both universal 16S rRNA and for Campylobacter 16S rRNA genes. The number of juveniles ( n ) in each cohort is indicated in parenthesis in the figure legend. (a) Quantitative real-time PCR (qPCR) analysis of stool isolated from juvenile cohorts designated by maternal/post-wean diet. DNA was amplified for universal and Campylobacter 16S rRNA genes using both TaqMan and SYBR qPCR assays. The presence of Campylobacter 16S rRNA was normalized to total universal 16S rRNA presence to provide relative abundance. Each qPCR assay (TaqMan or SYBR) was repeated in three individual assays. Results were pooled and statistical analysis was performed using a one-way ANOVA (** p

    Techniques Used: Isolation, Polymerase Chain Reaction, Amplification, Real-time Polymerase Chain Reaction

    36) Product Images from "An alternative splicing program promotes adipose tissue thermogenesis"

    Article Title: An alternative splicing program promotes adipose tissue thermogenesis

    Journal: eLife

    doi: 10.7554/eLife.17672

    Design and validation of Taqman assays to detect inclusion of the mutually exclusive exons 7a and 7b in Mapk8 and Mapk9 mRNA. ( A ) Schematic illustration of the design of Taqman assays to detect expression of Mapk8α , Mapk8β , Mapk9α , and Mapk9β mRNA. ( B ) Taqman assays were performed using 1 ng of cDNA template ( Mapk8α , Mapk8β , Mapk9α , and Mapk9β cDNA) and probes designed to detect Mapk8α , Mapk8β , Mapk9α , and Mapk9β . The data presented are the mean ± SEM (n = 3). ( C ) The relative expression of Mapk8α , Mapk8β , Mapk9α , and Mapk9β mRNA in epididymal adipocytes and hepatocytes was measured by RT-PCR analysis (mean ± SEM; n = 3). The numbers above the bars represents the α/β ratio. DOI: http://dx.doi.org/10.7554/eLife.17672.018
    Figure Legend Snippet: Design and validation of Taqman assays to detect inclusion of the mutually exclusive exons 7a and 7b in Mapk8 and Mapk9 mRNA. ( A ) Schematic illustration of the design of Taqman assays to detect expression of Mapk8α , Mapk8β , Mapk9α , and Mapk9β mRNA. ( B ) Taqman assays were performed using 1 ng of cDNA template ( Mapk8α , Mapk8β , Mapk9α , and Mapk9β cDNA) and probes designed to detect Mapk8α , Mapk8β , Mapk9α , and Mapk9β . The data presented are the mean ± SEM (n = 3). ( C ) The relative expression of Mapk8α , Mapk8β , Mapk9α , and Mapk9β mRNA in epididymal adipocytes and hepatocytes was measured by RT-PCR analysis (mean ± SEM; n = 3). The numbers above the bars represents the α/β ratio. DOI: http://dx.doi.org/10.7554/eLife.17672.018

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction

    37) Product Images from "MicroRNA Expression Changes during Interferon-Beta Treatment in the Peripheral Blood of Multiple Sclerosis Patients"

    Article Title: MicroRNA Expression Changes during Interferon-Beta Treatment in the Peripheral Blood of Multiple Sclerosis Patients

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms140816087

    Down-regulation of hsa-miR-29c-3p in response to IFN-beta therapy. The hsa-miR-29c-3p expression dynamics within the first month of IFN-beta treatment are presented. ( A ) TaqMan miRNA cards revealed reduced levels of this miRNA in the PBMC of 6 patients (Pat1-6, the main cohort); ( B ) Affymetrix miRNA arrays were then used to replicate the measurement for three of these patients (Pat1-3); ( C ) Finally, the down-regulation of hsa-miR-29c-3p was confirmed in an independent group of 12 patients (the validation cohort) using TaqMan single-tube assays. The Affymetrix analysis was based on hybridization of miRNA molecules to probes (probe set “ hsa-miR-29c_st ”), whereas the TaqMan analyses were based on real-time PCR. The TaqMan data are in linear scale, and the Affymetrix data are in log2 scale due to a different data preprocessing.
    Figure Legend Snippet: Down-regulation of hsa-miR-29c-3p in response to IFN-beta therapy. The hsa-miR-29c-3p expression dynamics within the first month of IFN-beta treatment are presented. ( A ) TaqMan miRNA cards revealed reduced levels of this miRNA in the PBMC of 6 patients (Pat1-6, the main cohort); ( B ) Affymetrix miRNA arrays were then used to replicate the measurement for three of these patients (Pat1-3); ( C ) Finally, the down-regulation of hsa-miR-29c-3p was confirmed in an independent group of 12 patients (the validation cohort) using TaqMan single-tube assays. The Affymetrix analysis was based on hybridization of miRNA molecules to probes (probe set “ hsa-miR-29c_st ”), whereas the TaqMan analyses were based on real-time PCR. The TaqMan data are in linear scale, and the Affymetrix data are in log2 scale due to a different data preprocessing.

    Techniques Used: Expressing, Hybridization, Real-time Polymerase Chain Reaction

    38) Product Images from "Genus Paracoccidioides: Species Recognition and Biogeographic Aspects"

    Article Title: Genus Paracoccidioides: Species Recognition and Biogeographic Aspects

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0037694

    Real Time PCR with TaqMan probes for SNP detection in isolates belonging to the different species from Paracoccidioides genus. Endpoint fluorescence intensity graphics for: SNP3- ARF (G for S1, PS3 and P. lutzii isolates, and A for PS2 isolates), SNP4- GP43, exon 2 (G for S1, PS2 and P. lutzii , and C for PS3) and SNP5-PRP8 intein (A for S1, PS2 and PS3, and G for P. lutzii ). Green dots: “heterozygote” additional controls, using two different DNA samples together; black squares: negative controls;“X”: undetermined samples.
    Figure Legend Snippet: Real Time PCR with TaqMan probes for SNP detection in isolates belonging to the different species from Paracoccidioides genus. Endpoint fluorescence intensity graphics for: SNP3- ARF (G for S1, PS3 and P. lutzii isolates, and A for PS2 isolates), SNP4- GP43, exon 2 (G for S1, PS2 and P. lutzii , and C for PS3) and SNP5-PRP8 intein (A for S1, PS2 and PS3, and G for P. lutzii ). Green dots: “heterozygote” additional controls, using two different DNA samples together; black squares: negative controls;“X”: undetermined samples.

    Techniques Used: Real-time Polymerase Chain Reaction, Fluorescence

    39) Product Images from "miR-99 regulates normal and malignant hematopoietic stem cell self-renewal"

    Article Title: miR-99 regulates normal and malignant hematopoietic stem cell self-renewal

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20161595

    miR-99 functionally suppresses human AML differentiation. (A) Normalized expression levels of miR-99a, miR-99b and miR-100 by quantitative PCR using miRNA TaqMan probes in human HSPCs, including hematopoietic stem cells (HSCs), multipotent progenitors (MPPs), common myeloid progenitors (CMPs), granulocyte-macrophage progenitors (GMPs), and megakaryocyte-erythroid progenitors (MEPs). Expression was normalized to sno-R2 . Data represent mean ± SEM and are representative of five independent experiments. (B) The colony-forming capacity of CD34 + human cord blood cells is reduced after miR-99 KD. CD34 + cells were transduced with lentiviral anti– miR-99 or scramble control. GFP + cells were isolated and cultured in complete methylcellulose, and the colonies were scored after 14 d. Data represent mean ± SEM (Student’s t test; n = 3) and are representative of two independent experiments. (C) Flow cytometric evaluation of myeloid differentiation marker expression on MonoMac6 AML cells 5 d after transduction with anti– miR-99 or scramble control. Data represent mean ± SEM (Student’s t test; n = 3) and are representative of three independent experiments. (D) Wright–Giemsa stains of cytospin preparations of MonoMac6 cells 8 d post-transduction with lentiviral anti– miR-99 or Scr reveals induction of differentiation upon miR-99 KD (bars, 25 µm). (E) Overview of the xenotransplantation experiment performed on MonoMac6 AMLs. Cells were transduced with anti– miR-99 or Scr. After 48 h, GFP + cells were flow sorted, and 800,000 cells were transplanted into sublethally irradiated NSGs. BM was analyzed 4 wk after the transplant. (F) miR-99 KD reduces the of GFP + engraftment of MonoMac6 cells in the BM of recipients 4 wk post-transplantation. Data represent mean percentage ± SEM (Student’s t test; n = 4) and are representative of two independent experiments. (G) Representative histogram and aggregated data from flow cytometric evaluation of CD14 expression on GFP + xenografted cells in the BM of the recipient animals 4 wk post-transplantation. Data represent mean percentage ± SEM (Student’s t test; n = 4) and are representative of two independent experiments. (H) Flow cytometry analysis of three AML patient samples after miR-99 KD. Patient samples were transduced with anti– miR-99 or scramble control and analyzed for the expression of differentiation markers 5–8 d later. Data represent mean percentage ± SEM (Student’s t test; n = 2) and are representative of two independent experiments. *, P
    Figure Legend Snippet: miR-99 functionally suppresses human AML differentiation. (A) Normalized expression levels of miR-99a, miR-99b and miR-100 by quantitative PCR using miRNA TaqMan probes in human HSPCs, including hematopoietic stem cells (HSCs), multipotent progenitors (MPPs), common myeloid progenitors (CMPs), granulocyte-macrophage progenitors (GMPs), and megakaryocyte-erythroid progenitors (MEPs). Expression was normalized to sno-R2 . Data represent mean ± SEM and are representative of five independent experiments. (B) The colony-forming capacity of CD34 + human cord blood cells is reduced after miR-99 KD. CD34 + cells were transduced with lentiviral anti– miR-99 or scramble control. GFP + cells were isolated and cultured in complete methylcellulose, and the colonies were scored after 14 d. Data represent mean ± SEM (Student’s t test; n = 3) and are representative of two independent experiments. (C) Flow cytometric evaluation of myeloid differentiation marker expression on MonoMac6 AML cells 5 d after transduction with anti– miR-99 or scramble control. Data represent mean ± SEM (Student’s t test; n = 3) and are representative of three independent experiments. (D) Wright–Giemsa stains of cytospin preparations of MonoMac6 cells 8 d post-transduction with lentiviral anti– miR-99 or Scr reveals induction of differentiation upon miR-99 KD (bars, 25 µm). (E) Overview of the xenotransplantation experiment performed on MonoMac6 AMLs. Cells were transduced with anti– miR-99 or Scr. After 48 h, GFP + cells were flow sorted, and 800,000 cells were transplanted into sublethally irradiated NSGs. BM was analyzed 4 wk after the transplant. (F) miR-99 KD reduces the of GFP + engraftment of MonoMac6 cells in the BM of recipients 4 wk post-transplantation. Data represent mean percentage ± SEM (Student’s t test; n = 4) and are representative of two independent experiments. (G) Representative histogram and aggregated data from flow cytometric evaluation of CD14 expression on GFP + xenografted cells in the BM of the recipient animals 4 wk post-transplantation. Data represent mean percentage ± SEM (Student’s t test; n = 4) and are representative of two independent experiments. (H) Flow cytometry analysis of three AML patient samples after miR-99 KD. Patient samples were transduced with anti– miR-99 or scramble control and analyzed for the expression of differentiation markers 5–8 d later. Data represent mean percentage ± SEM (Student’s t test; n = 2) and are representative of two independent experiments. *, P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Transduction, Isolation, Cell Culture, Flow Cytometry, Marker, Irradiation, Transplantation Assay, Cytometry

    miR-99 is highly expressed in hematopoietic stem and progenitors and suppresses myeloid differentiation in vitro . (A–C) Normalized expression levels of miR-99b , miR-99a , and miR-100 as determined by quantitative RT-PCR using miRNA TaqMan probes in mouse hematopoietic cell populations: hematopoietic stem cell (HSC), multipotent progenitor (MPP) Flk − , MPP Flk + , common lymphoid progenitor (CLP), common myeloid progenitor (CMP), granulocyte-macrophage progenitor (GMP), and megakaryocyte-erythroid progenitor (MEP) cells. Expression was normalized against mmu- mir-16 . Error bars denote SEM. Representative data from five independent experiments are shown. (D) miR-99 is down-regulated 48 h post-transduction of HSCs with the lentiviral anti– miR-99 vector as shown by quantitative RT-PCR. Expression was normalized against U6 (Student’s t test; n = 3). Representative data from two independent experiments are shown. (E) Comparable number of colonies form after miR-99 KD in first plating, with an increase in the number of CFU macrophage (CFU-M) colonies. 100 GFP + HSC cells were cultured in methylcellulose. The colonies were scored after 7 d. Data represent mean percentage ± SEM (Student’s t test; n = 3) and are representative of three independent experiments. (F) Smaller colonies were observed after second plating of GFP + cells derived from miR-99 KD HSCs. Representative data of three independent experiments are shown. (G) Colony-forming capacity of HSCs is reduced after miR-99 KD in a second plating. 15,000 GFP + cells were replated 7 d after the first plating. Colony types were scored after 7 to 10 d. Data represent mean count ± SEM (Student’s t test; n = 3) and are representative of three independent experiments. (H) miR-99 KD in HSCs induces granulocytic differentiation in methylcellulose colony assays. 7 d after plating, colonies were analyzed for expression of myeloid differentiation markers by flow cytometry. Mean percentage ± SEM (Student’s t test; n = 2). Representative data of three independent experiments are shown. (I) Flow cytometry analysis of LSK cells transduced with anti– miR-99 or Scr vectors and maintained in liquid culture for 8 d reveals a decrease in the absolute number of GFP + Lin − Sca-1 + c-Kit + CD150 + HSCs. FSCw denotes forward scatter-width. The data shown are gated on LSK cells. Data represent mean count ± SEM (Student’s t test; n = 3) and are representative of two independent experiments. *, P
    Figure Legend Snippet: miR-99 is highly expressed in hematopoietic stem and progenitors and suppresses myeloid differentiation in vitro . (A–C) Normalized expression levels of miR-99b , miR-99a , and miR-100 as determined by quantitative RT-PCR using miRNA TaqMan probes in mouse hematopoietic cell populations: hematopoietic stem cell (HSC), multipotent progenitor (MPP) Flk − , MPP Flk + , common lymphoid progenitor (CLP), common myeloid progenitor (CMP), granulocyte-macrophage progenitor (GMP), and megakaryocyte-erythroid progenitor (MEP) cells. Expression was normalized against mmu- mir-16 . Error bars denote SEM. Representative data from five independent experiments are shown. (D) miR-99 is down-regulated 48 h post-transduction of HSCs with the lentiviral anti– miR-99 vector as shown by quantitative RT-PCR. Expression was normalized against U6 (Student’s t test; n = 3). Representative data from two independent experiments are shown. (E) Comparable number of colonies form after miR-99 KD in first plating, with an increase in the number of CFU macrophage (CFU-M) colonies. 100 GFP + HSC cells were cultured in methylcellulose. The colonies were scored after 7 d. Data represent mean percentage ± SEM (Student’s t test; n = 3) and are representative of three independent experiments. (F) Smaller colonies were observed after second plating of GFP + cells derived from miR-99 KD HSCs. Representative data of three independent experiments are shown. (G) Colony-forming capacity of HSCs is reduced after miR-99 KD in a second plating. 15,000 GFP + cells were replated 7 d after the first plating. Colony types were scored after 7 to 10 d. Data represent mean count ± SEM (Student’s t test; n = 3) and are representative of three independent experiments. (H) miR-99 KD in HSCs induces granulocytic differentiation in methylcellulose colony assays. 7 d after plating, colonies were analyzed for expression of myeloid differentiation markers by flow cytometry. Mean percentage ± SEM (Student’s t test; n = 2). Representative data of three independent experiments are shown. (I) Flow cytometry analysis of LSK cells transduced with anti– miR-99 or Scr vectors and maintained in liquid culture for 8 d reveals a decrease in the absolute number of GFP + Lin − Sca-1 + c-Kit + CD150 + HSCs. FSCw denotes forward scatter-width. The data shown are gated on LSK cells. Data represent mean count ± SEM (Student’s t test; n = 3) and are representative of two independent experiments. *, P

    Techniques Used: In Vitro, Expressing, Quantitative RT-PCR, Transduction, Plasmid Preparation, Cell Culture, Derivative Assay, Flow Cytometry, Cytometry

    40) Product Images from "Increased MicroRNA-34b and -34c Predominantly Expressed in Stromal Tissues Is Associated with Poor Prognosis in Human Colon Cancer"

    Article Title: Increased MicroRNA-34b and -34c Predominantly Expressed in Stromal Tissues Is Associated with Poor Prognosis in Human Colon Cancer

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0124899

    miR-34 family tends to be expressed predominantly in stromal tissue. RNA samples from cancer epithelium, cancer stroma, normal adjacent epithelium and normal adjacent stroma were extracted separately using laser microdissection technique from 5 paired samples in the American cohort. Dot plots represent miR-34a/b/c threshold cycle values of tumor tissue from TaqMan qRT-PCR normalized to U48. Horizontal bars indicate median expression value. Un-paired t test was used.
    Figure Legend Snippet: miR-34 family tends to be expressed predominantly in stromal tissue. RNA samples from cancer epithelium, cancer stroma, normal adjacent epithelium and normal adjacent stroma were extracted separately using laser microdissection technique from 5 paired samples in the American cohort. Dot plots represent miR-34a/b/c threshold cycle values of tumor tissue from TaqMan qRT-PCR normalized to U48. Horizontal bars indicate median expression value. Un-paired t test was used.

    Techniques Used: Laser Capture Microdissection, Quantitative RT-PCR, Expressing

    TP53 mutation is not associated with the expression of miR-34 family. (A, B) TP53 mutational status was evaluated by immunohistochemistry using Formalin-Fixed Paraffin-Embedded (FFPE) tissues. Dot plots represent miR-34a/b/c threshold cycle values of tumor tissue from TaqMan qRT-PCR normalized to U66 in American cohort (A) and Chinese cohort (B). Horizontal bars indicate median expression value. Mann-Whitney test was used. WT: wild-type p53, Mut: mutant p53.
    Figure Legend Snippet: TP53 mutation is not associated with the expression of miR-34 family. (A, B) TP53 mutational status was evaluated by immunohistochemistry using Formalin-Fixed Paraffin-Embedded (FFPE) tissues. Dot plots represent miR-34a/b/c threshold cycle values of tumor tissue from TaqMan qRT-PCR normalized to U66 in American cohort (A) and Chinese cohort (B). Horizontal bars indicate median expression value. Mann-Whitney test was used. WT: wild-type p53, Mut: mutant p53.

    Techniques Used: Mutagenesis, Expressing, Immunohistochemistry, Formalin-fixed Paraffin-Embedded, Quantitative RT-PCR, MANN-WHITNEY

    The miR-34 family members significantly increase in colon tumors compared to adjacent non-tumor tissues. (A, B) Dot plots represent miR-34a/b/c threshold cycle values from TaqMan qRT-PCR normalized to U66 in American cohort (A) and Chinese cohort (B). Horizontal bars indicate median expression value. Wilcoxon matched-pairs test was used. MiR-34a was not detectable in one patient and this patient was excluded from all analyses.
    Figure Legend Snippet: The miR-34 family members significantly increase in colon tumors compared to adjacent non-tumor tissues. (A, B) Dot plots represent miR-34a/b/c threshold cycle values from TaqMan qRT-PCR normalized to U66 in American cohort (A) and Chinese cohort (B). Horizontal bars indicate median expression value. Wilcoxon matched-pairs test was used. MiR-34a was not detectable in one patient and this patient was excluded from all analyses.

    Techniques Used: Quantitative RT-PCR, Expressing

    The high expression of miR-34b/c is associated with advanced colon tumor and poor prognosis. (A, B) Tissues were ordered from TNM stage I to IV tumors in the American cohort (A) and the Chinese cohort (B). Dot plots represent miR-34a/b/c threshold cycle values from TaqMan qRT-PCR normalized to U66. Horizontal bars indicate median expression value. The Cuzick nonparametric test for trend was used to evaluate trends. (C) Kaplan-Meier survival analysis of all stage cases in the American and Chinese combined cohorts stratified by median miR-34a expression and combined miR-34b/c expression. *Cases with low miR-34b and/or low miR-34c. **Cases with both high miR-34b and high miR-34c.
    Figure Legend Snippet: The high expression of miR-34b/c is associated with advanced colon tumor and poor prognosis. (A, B) Tissues were ordered from TNM stage I to IV tumors in the American cohort (A) and the Chinese cohort (B). Dot plots represent miR-34a/b/c threshold cycle values from TaqMan qRT-PCR normalized to U66. Horizontal bars indicate median expression value. The Cuzick nonparametric test for trend was used to evaluate trends. (C) Kaplan-Meier survival analysis of all stage cases in the American and Chinese combined cohorts stratified by median miR-34a expression and combined miR-34b/c expression. *Cases with low miR-34b and/or low miR-34c. **Cases with both high miR-34b and high miR-34c.

    Techniques Used: Expressing, Quantitative RT-PCR

    41) Product Images from "Decreased severity of experimental autoimmune arthritis in peptidylarginine deiminase type 4 knockout mice"

    Article Title: Decreased severity of experimental autoimmune arthritis in peptidylarginine deiminase type 4 knockout mice

    Journal: BMC Musculoskeletal Disorders

    doi: 10.1186/s12891-016-1055-2

    Cytokine mRNA expression in bone marrow derived-macrophages. Bone marrow derived-macrophages were obtained from the bone marrow cells of wild-type ( n = 19) and Padi4 −/− CIA mice ( n = 17) 10 days after booster injection. The cells were then analyzed by real-time TaqMan RT-PCR for mRNA levels of ( a ) tumor necrosis factor alpha (TNF-α), b interleukin (IL)-1β, c Granulocyte-macrophage colony-stimulating factor (GM-CSF), and d IL-6. Relative units were obtained from the comparative ΔΔC T analysis. * P
    Figure Legend Snippet: Cytokine mRNA expression in bone marrow derived-macrophages. Bone marrow derived-macrophages were obtained from the bone marrow cells of wild-type ( n = 19) and Padi4 −/− CIA mice ( n = 17) 10 days after booster injection. The cells were then analyzed by real-time TaqMan RT-PCR for mRNA levels of ( a ) tumor necrosis factor alpha (TNF-α), b interleukin (IL)-1β, c Granulocyte-macrophage colony-stimulating factor (GM-CSF), and d IL-6. Relative units were obtained from the comparative ΔΔC T analysis. * P

    Techniques Used: Expressing, Derivative Assay, Mouse Assay, Injection, Reverse Transcription Polymerase Chain Reaction

    42) Product Images from "MAPPING OF BIGUANIDE TRANSPORTERS IN HUMAN FAT CELLS AND THEIR IMPACT ON LIPOLYSIS"

    Article Title: MAPPING OF BIGUANIDE TRANSPORTERS IN HUMAN FAT CELLS AND THEIR IMPACT ON LIPOLYSIS

    Journal: Diabetes, obesity & metabolism

    doi: 10.1111/dom.13395

    Gene expression of cationic transporters during adipocyte differentiation. Human adipose-derived stem cells were differentiated into adipocytes and RNA was collected before and at the indicated days post-induction. Quantitative RT-PCR was performed using TaqMan probes against A. SLC22A4 (OCTN1), B. SLC22A3 (OCT3), C. SLC29A4 (PMAT) and D. SLC47A1 (MATE1). Data are based on cells isolated from three independent experiments.
    Figure Legend Snippet: Gene expression of cationic transporters during adipocyte differentiation. Human adipose-derived stem cells were differentiated into adipocytes and RNA was collected before and at the indicated days post-induction. Quantitative RT-PCR was performed using TaqMan probes against A. SLC22A4 (OCTN1), B. SLC22A3 (OCT3), C. SLC29A4 (PMAT) and D. SLC47A1 (MATE1). Data are based on cells isolated from three independent experiments.

    Techniques Used: Expressing, Derivative Assay, Quantitative RT-PCR, Isolation

    43) Product Images from "MAPPING OF BIGUANIDE TRANSPORTERS IN HUMAN FAT CELLS AND THEIR IMPACT ON LIPOLYSIS"

    Article Title: MAPPING OF BIGUANIDE TRANSPORTERS IN HUMAN FAT CELLS AND THEIR IMPACT ON LIPOLYSIS

    Journal: Diabetes, obesity & metabolism

    doi: 10.1111/dom.13395

    Gene expression of cationic transporters during adipocyte differentiation. Human adipose-derived stem cells were differentiated into adipocytes and RNA was collected before and at the indicated days post-induction. Quantitative RT-PCR was performed using TaqMan probes against A. SLC22A4 (OCTN1), B. SLC22A3 (OCT3), C. SLC29A4 (PMAT) and D. SLC47A1 (MATE1). Data are based on cells isolated from three independent experiments.
    Figure Legend Snippet: Gene expression of cationic transporters during adipocyte differentiation. Human adipose-derived stem cells were differentiated into adipocytes and RNA was collected before and at the indicated days post-induction. Quantitative RT-PCR was performed using TaqMan probes against A. SLC22A4 (OCTN1), B. SLC22A3 (OCT3), C. SLC29A4 (PMAT) and D. SLC47A1 (MATE1). Data are based on cells isolated from three independent experiments.

    Techniques Used: Expressing, Derivative Assay, Quantitative RT-PCR, Isolation

    44) Product Images from "miR-489 is a tumour-suppressive miRNA target PTPN11 in hypopharyngeal squamous cell carcinoma (HSCC)"

    Article Title: miR-489 is a tumour-suppressive miRNA target PTPN11 in hypopharyngeal squamous cell carcinoma (HSCC)

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6605811

    Proliferation is inhibited by transfection with si-PTPN11 in FaDu cells. FaDu cells were transfected with 10 n si-PTPN11. Total RNA and proteins were isolated after 72-h incubation. ( A ) PTPN11 mRNA expression was analysed by TaqMan quantitative real-time PCR. The results are normalised to GAPDH expression and are presented as relative to control expression. * P
    Figure Legend Snippet: Proliferation is inhibited by transfection with si-PTPN11 in FaDu cells. FaDu cells were transfected with 10 n si-PTPN11. Total RNA and proteins were isolated after 72-h incubation. ( A ) PTPN11 mRNA expression was analysed by TaqMan quantitative real-time PCR. The results are normalised to GAPDH expression and are presented as relative to control expression. * P

    Techniques Used: Transfection, Isolation, Incubation, Expressing, Real-time Polymerase Chain Reaction

    PTPN11 overexpression in clinical HSCC specimens. ( A ) PTPN11 mRNA expression levels were analysed by TaqMan quantitative real-time PCR and normalised to 18S rRNA expression. PTPN11 mRNA expression was compared between matched HSCC and non-cancerous tissues in 16 patients. Data were analysed using the paired t -test. N, non-cancerous tissues; C, cancer tissues. ( B ) Correlation between PTPN11 and miR-489 expression in HSCC clinical specimens.
    Figure Legend Snippet: PTPN11 overexpression in clinical HSCC specimens. ( A ) PTPN11 mRNA expression levels were analysed by TaqMan quantitative real-time PCR and normalised to 18S rRNA expression. PTPN11 mRNA expression was compared between matched HSCC and non-cancerous tissues in 16 patients. Data were analysed using the paired t -test. N, non-cancerous tissues; C, cancer tissues. ( B ) Correlation between PTPN11 and miR-489 expression in HSCC clinical specimens.

    Techniques Used: Over Expression, Expressing, Real-time Polymerase Chain Reaction

    miR-489 negatively regulates PTPN11 expression. FaDu cells were transfected with miR-489. After incubation for 72 h, total RNA and proteins were isolated. ( A ) FaDu cells were treated with a miR-negative control (10 n) or miR-489 (10 n). After 72 h, miR-489 expression was measured by TaqMan quantitative real-time PCR. The results are normalised to RNU44 expression. ( B ) PTPN11 mRNA expression was analysed by TaqMan quantitative real-time PCR. The results are normalised to GAPDH expression and are presented relative to control expression. * P
    Figure Legend Snippet: miR-489 negatively regulates PTPN11 expression. FaDu cells were transfected with miR-489. After incubation for 72 h, total RNA and proteins were isolated. ( A ) FaDu cells were treated with a miR-negative control (10 n) or miR-489 (10 n). After 72 h, miR-489 expression was measured by TaqMan quantitative real-time PCR. The results are normalised to RNU44 expression. ( B ) PTPN11 mRNA expression was analysed by TaqMan quantitative real-time PCR. The results are normalised to GAPDH expression and are presented relative to control expression. * P

    Techniques Used: Expressing, Transfection, Incubation, Isolation, Negative Control, Real-time Polymerase Chain Reaction

    45) Product Images from "CCAAT/Enhancer binding protein β induces motility and invasion of glioblastoma cells through transcriptional regulation of the calcium binding protein S100A4"

    Article Title: CCAAT/Enhancer binding protein β induces motility and invasion of glioblastoma cells through transcriptional regulation of the calcium binding protein S100A4

    Journal: Oncotarget

    doi:

    Effect of C/EBPβ on S100A4 expression in glioblastoma murine GL261 cell line (A) Quantification of S100A4 mRNA levels in GL261 control cell line (C1) and C/EBPβ-depleted (I4, I5) cells by quantitative real time-PCR. As indicated in Methods, we used Taqman probes specifics to S100A4 and β-Actin mouse. The graphic shown the means of values 2 −ΔΔCt of S100A4/β-actin ± SD. *** p
    Figure Legend Snippet: Effect of C/EBPβ on S100A4 expression in glioblastoma murine GL261 cell line (A) Quantification of S100A4 mRNA levels in GL261 control cell line (C1) and C/EBPβ-depleted (I4, I5) cells by quantitative real time-PCR. As indicated in Methods, we used Taqman probes specifics to S100A4 and β-Actin mouse. The graphic shown the means of values 2 −ΔΔCt of S100A4/β-actin ± SD. *** p

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    46) Product Images from "Microarray analysis of gene expression in West Nile virus-infected human retinal pigment epithelium"

    Article Title: Microarray analysis of gene expression in West Nile virus-infected human retinal pigment epithelium

    Journal: Molecular Vision

    doi:

    Comparison of differential gene expression with microarray (red) and qPCR (blue). Genes are allocated to the graphs shown here, according to fold-change of expression after WNV infection, as determined by qPCR, with microarray values shown adjacent to these. A : qPCR fold change −10 to 20; (B) qPCR fold change 20 to 120, and (C) qPCR fold change > 120. qPCR reactions were performed in duplicate and both qPCR and microarray data used the same RNA as the source. Samples were isolated from 4 separate donors. Genes in qPCR were amplified using Taqman probes and Taqman Universal PCR master mix (Applied Biosystems). *p
    Figure Legend Snippet: Comparison of differential gene expression with microarray (red) and qPCR (blue). Genes are allocated to the graphs shown here, according to fold-change of expression after WNV infection, as determined by qPCR, with microarray values shown adjacent to these. A : qPCR fold change −10 to 20; (B) qPCR fold change 20 to 120, and (C) qPCR fold change > 120. qPCR reactions were performed in duplicate and both qPCR and microarray data used the same RNA as the source. Samples were isolated from 4 separate donors. Genes in qPCR were amplified using Taqman probes and Taqman Universal PCR master mix (Applied Biosystems). *p

    Techniques Used: Expressing, Microarray, Real-time Polymerase Chain Reaction, Infection, Isolation, Amplification, Polymerase Chain Reaction

    Fold changes in expression of genes not seen to change on the microarray, as shown by qPCR. All qPCR reactions were performed in duplicate on cDNA extracted from 4 separate donors. Genes were amplified using Taqman probes and Taqman Universal PCR master mix (Applied Biosystems). Genes were selected for further qPCR analysis, based on the immune and TGF-β gene groups of interest seen in the microarray analysis. Statistical analysis was undertaken using the REST program (Qiagen), which uses a pair-wise fixed reallocation randomization test to determine significance. Averaged values of duplicate samples from 4 separate donors were statistically analyzed. However, despite appreciable fold-changes in some samples, only TNF and TGF-β2 genes in WNV-infected RPE were statistically different from uninfected RPE. * represents p
    Figure Legend Snippet: Fold changes in expression of genes not seen to change on the microarray, as shown by qPCR. All qPCR reactions were performed in duplicate on cDNA extracted from 4 separate donors. Genes were amplified using Taqman probes and Taqman Universal PCR master mix (Applied Biosystems). Genes were selected for further qPCR analysis, based on the immune and TGF-β gene groups of interest seen in the microarray analysis. Statistical analysis was undertaken using the REST program (Qiagen), which uses a pair-wise fixed reallocation randomization test to determine significance. Averaged values of duplicate samples from 4 separate donors were statistically analyzed. However, despite appreciable fold-changes in some samples, only TNF and TGF-β2 genes in WNV-infected RPE were statistically different from uninfected RPE. * represents p

    Techniques Used: Expressing, Microarray, Real-time Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Infection

    47) Product Images from "Duplication and deletion upstream of LMNB1 in autosomal dominant adult-onset leukodystrophy"

    Article Title: Duplication and deletion upstream of LMNB1 in autosomal dominant adult-onset leukodystrophy

    Journal: Neurology: Genetics

    doi: 10.1212/NXG.0000000000000292

    Analysis of CNVs of LMNB1 and its upstream region (A) Gene dosages for exons 3, 6, and 10 of LMNB1 were determined by TaqMan-based real-time PCR assay. The copy numbers of 3 exons of LMNB1 in patients 1–4 were increased by approximately 1.5-fold compared with control subjects, suggesting the presence of duplication of LMNB1 in these patients. (B) The copy number variations of regions upstream of LMNB1 including GRAMD3 , ALDH7A1 , and PHAX were determined by TaqMan-based real-time PCR assay. The copy numbers of ALDH7A1 and PHAX were decreased approximately by half in patients 5 and 6, suggesting the presence of the upstream deletion of LMNB 1. (C) The genomic regions of duplication (blue) and deletion (red) were analyzed using an Affymetrix CytoScan HD array and are shown on the basis of information obtained from the UCSC genome browser (assembly GRCh37/hg19). The regions of duplication were 153 kb in pedigree I, 220 kb in pedigree II, and 221 kb in pedigree III. The deletion upstream of LMNB1 in a previous report is shown by a dotted line. 8 The positions of original enhancer A (Enh-A) and alternative enhancer B (Enh-B) for LMNB1 are indicated by arrowheads. ALDH7A1 = aldehyde dehydrogenase 7 family member A1; CNV = copy number variation; GRAMD3 = GRAM domain containing 3; LMNB1 = lamin B1; PHAX = phosphorylated adaptor for RNA export.
    Figure Legend Snippet: Analysis of CNVs of LMNB1 and its upstream region (A) Gene dosages for exons 3, 6, and 10 of LMNB1 were determined by TaqMan-based real-time PCR assay. The copy numbers of 3 exons of LMNB1 in patients 1–4 were increased by approximately 1.5-fold compared with control subjects, suggesting the presence of duplication of LMNB1 in these patients. (B) The copy number variations of regions upstream of LMNB1 including GRAMD3 , ALDH7A1 , and PHAX were determined by TaqMan-based real-time PCR assay. The copy numbers of ALDH7A1 and PHAX were decreased approximately by half in patients 5 and 6, suggesting the presence of the upstream deletion of LMNB 1. (C) The genomic regions of duplication (blue) and deletion (red) were analyzed using an Affymetrix CytoScan HD array and are shown on the basis of information obtained from the UCSC genome browser (assembly GRCh37/hg19). The regions of duplication were 153 kb in pedigree I, 220 kb in pedigree II, and 221 kb in pedigree III. The deletion upstream of LMNB1 in a previous report is shown by a dotted line. 8 The positions of original enhancer A (Enh-A) and alternative enhancer B (Enh-B) for LMNB1 are indicated by arrowheads. ALDH7A1 = aldehyde dehydrogenase 7 family member A1; CNV = copy number variation; GRAMD3 = GRAM domain containing 3; LMNB1 = lamin B1; PHAX = phosphorylated adaptor for RNA export.

    Techniques Used: Real-time Polymerase Chain Reaction

    48) Product Images from "Phosphomimetic cardiac myosin-binding protein C partially rescues a cardiomyopathy phenotype in murine engineered heart tissue"

    Article Title: Phosphomimetic cardiac myosin-binding protein C partially rescues a cardiomyopathy phenotype in murine engineered heart tissue

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-54665-2

    Molecular phenotype on mRNA and protein levels after Mybpc3 gene transfer. Single wild-type (WT) and knock-in (KI) EHTs either non-transduced (NT) or transduced with AAV6 (MOI 1,000 vg/cell) encoding wild-type cMyBP-C (S282) or phosphomimetic cMyBP-C (D282) were used to extract total RNA and were pooled (200 ng RNA/sample; 3 EHTs per group) prior to reverse transcription. ( a ) Representative agarose gel of RT-PCR with different primer pairs. Amplicon sizes are shown on the right. Few lanes of the gels were excluded (dotted line). ( b ) Total Mybpc3 mRNA levels were determined by RT-qPCR with SYBR Green. ( c–e ) The levels of wild-type and mutant Mybpc3 transcripts were determined by RT-qPCR with specific TaqMan probes. Schemes below show localization of primers (black triangle) and probes. ( f ) Heatmap showing expression of selected genes (threshold
    Figure Legend Snippet: Molecular phenotype on mRNA and protein levels after Mybpc3 gene transfer. Single wild-type (WT) and knock-in (KI) EHTs either non-transduced (NT) or transduced with AAV6 (MOI 1,000 vg/cell) encoding wild-type cMyBP-C (S282) or phosphomimetic cMyBP-C (D282) were used to extract total RNA and were pooled (200 ng RNA/sample; 3 EHTs per group) prior to reverse transcription. ( a ) Representative agarose gel of RT-PCR with different primer pairs. Amplicon sizes are shown on the right. Few lanes of the gels were excluded (dotted line). ( b ) Total Mybpc3 mRNA levels were determined by RT-qPCR with SYBR Green. ( c–e ) The levels of wild-type and mutant Mybpc3 transcripts were determined by RT-qPCR with specific TaqMan probes. Schemes below show localization of primers (black triangle) and probes. ( f ) Heatmap showing expression of selected genes (threshold

    Techniques Used: Knock-In, Transduction, Agarose Gel Electrophoresis, Reverse Transcription Polymerase Chain Reaction, Amplification, Quantitative RT-PCR, SYBR Green Assay, Mutagenesis, Expressing

    49) Product Images from "The p38alpha mitogen-activated protein kinase limits the CNS proinflammatory cytokine response to systemic lipopolysaccharide, potentially through an IL-10 dependent mechanism"

    Article Title: The p38alpha mitogen-activated protein kinase limits the CNS proinflammatory cytokine response to systemic lipopolysaccharide, potentially through an IL-10 dependent mechanism

    Journal: Journal of Neuroinflammation

    doi: 10.1186/s12974-014-0175-6

    Isolation of peritoneal macrophages (φ) and microglia (μglia) from adult mice shows enrichment of CCR2 and CX3CR1 cell populations, and loss of p38α in the isolated macrophages but not in the microglia fraction. RNA was extracted from peritoneal macrophages or microglia isolated from cortical tissue using a discontinuous Percoll gradient. qRT-PCR using TaqMAN Gene Expression Assays was used to determine CCR2, CX3CR1, and p38α (MAPK14) expression in the isolated cell populations. Data are presented as fold change of wild-type (WT) macrophages. The data are representative of two independent experiments.
    Figure Legend Snippet: Isolation of peritoneal macrophages (φ) and microglia (μglia) from adult mice shows enrichment of CCR2 and CX3CR1 cell populations, and loss of p38α in the isolated macrophages but not in the microglia fraction. RNA was extracted from peritoneal macrophages or microglia isolated from cortical tissue using a discontinuous Percoll gradient. qRT-PCR using TaqMAN Gene Expression Assays was used to determine CCR2, CX3CR1, and p38α (MAPK14) expression in the isolated cell populations. Data are presented as fold change of wild-type (WT) macrophages. The data are representative of two independent experiments.

    Techniques Used: Isolation, Mouse Assay, Quantitative RT-PCR, Expressing

    50) Product Images from "Curative Effect of 18?-Glycyrrhetinic Acid in Experimental Visceral Leishmaniasis Depends on Phosphatase-Dependent Modulation of Cellular MAP Kinases"

    Article Title: Curative Effect of 18?-Glycyrrhetinic Acid in Experimental Visceral Leishmaniasis Depends on Phosphatase-Dependent Modulation of Cellular MAP Kinases

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0029062

    Effect of GRA on the regulation of iNOS and Th1 cytokine by MAPK activation. ( A ) BMDM were treated with GRA (20 µM) for different time periods. The expression and phosphorylation of MAPKs were detected by Western blotting. ( B ) L. donovani -infected BMDM were treated with GRA (20 µM) for various time periods and the level of phosphorylated p38 was measured by Western blotting. ( C and D ) BMDM were treated (1 h) with either SB203580 (30 µM) or apigenin (40 µM) or both before stimulation with GRA (24 h). iNOS expression ( C ) by Taqman analysis and levels of IL-12 and TNF-α ( D ) by ELISA were determined. ( E ) RAW 264.7 cells were transiently transfected using Lipofectamine reagent with 1 µg of NF-κB luciferase reporter vector along with 0.5 µg pcMV-βgal. After 24 h, cells were stimulated with GRA (20 µM) for different time periods. In a separate set of experiment, transfected cells were pre-incubated with either SB203580 (30 µM) or apigenin (40 µM) or both for 1 h before stimulation with GRA (12 h). Cells were lysed and processed for luciferase activity. ( F ) BMDM were treated with GRA (20 µM) for different time periods or pre-incubated with either SB203580 (30 µM) or apigenin (40 µM) or both for 1 h before stimulation with GRA (2 h). Cell lysates were then immunoprecipitated with anti-MSK1 Ab and MSK1 activity was assayed using CREBTIDE as substrate. Bands were analyzed densitometrically. Error bars represent mean ± SD (n = 3). The data shown are representative of three independent experiments. ns, not significant; * p
    Figure Legend Snippet: Effect of GRA on the regulation of iNOS and Th1 cytokine by MAPK activation. ( A ) BMDM were treated with GRA (20 µM) for different time periods. The expression and phosphorylation of MAPKs were detected by Western blotting. ( B ) L. donovani -infected BMDM were treated with GRA (20 µM) for various time periods and the level of phosphorylated p38 was measured by Western blotting. ( C and D ) BMDM were treated (1 h) with either SB203580 (30 µM) or apigenin (40 µM) or both before stimulation with GRA (24 h). iNOS expression ( C ) by Taqman analysis and levels of IL-12 and TNF-α ( D ) by ELISA were determined. ( E ) RAW 264.7 cells were transiently transfected using Lipofectamine reagent with 1 µg of NF-κB luciferase reporter vector along with 0.5 µg pcMV-βgal. After 24 h, cells were stimulated with GRA (20 µM) for different time periods. In a separate set of experiment, transfected cells were pre-incubated with either SB203580 (30 µM) or apigenin (40 µM) or both for 1 h before stimulation with GRA (12 h). Cells were lysed and processed for luciferase activity. ( F ) BMDM were treated with GRA (20 µM) for different time periods or pre-incubated with either SB203580 (30 µM) or apigenin (40 µM) or both for 1 h before stimulation with GRA (2 h). Cell lysates were then immunoprecipitated with anti-MSK1 Ab and MSK1 activity was assayed using CREBTIDE as substrate. Bands were analyzed densitometrically. Error bars represent mean ± SD (n = 3). The data shown are representative of three independent experiments. ns, not significant; * p

    Techniques Used: Activation Assay, Expressing, Western Blot, Infection, Enzyme-linked Immunosorbent Assay, Transfection, Luciferase, Plasmid Preparation, Incubation, Activity Assay, Immunoprecipitation

    Antileishmanial activity of GRA. ( A ) Dose- and time-dependent expression of iNOS by Taqman analysis of the mRNA transcript in BMDM stimulated with GRA. mRNA levels were normalized to β-actin and expressed as a -fold change compared with control. ( B ) Percentages of infected cells and ( C ) number of parasites per macrophage were counted at various time periods following infection. ( D ) Effect of GRA on NO production (solid bar) and parasite suppression (open bar) in BMDM in presence or absence of AMT (10 µM). ( E ) Generation of NO (solid bar) and parasite suppression (open bar) in peritoneal macrophages isolated from mice which received GRA (10, 50 and 100 mg/kg) i.p. for 3 times 5 days apart. Macrophages were harvested 10 h after the last injection and infected with L. donovani . After 4 h infection and 20 h of incubation, the percentage of parasite suppression and the amount of NO 2 − in the medium were determined. ( F ) and ( G ) Levels of IL-12, TNF-α, IL-10 ,TGF-β, IL-6 and IL-1β in culture supernatants from infected and GRA (20 µM)-treated BMDM were determined by ELISA. ( H ) Mice were administered i.v. with 10 7 promastigotes, and after 10 days of infection, were treated with GRA (25 or 50/mg/kg) i.p. 3 times 5 days apart. Spleen parasite burdens were determined 6 wk after infection and are expressed as LDU ± SD. ( I ) Spleen parasite burden determined 2 and 6 wk following infection measured by limiting dilution assay expressed as log 10 parasite burden ± SD. Cultures were set in triplicate and experiments were done a minimum of three times. Animal experiments were done with five animals/group and the results are representative of three independent experiments. Data represent the mean ± SD. *** p
    Figure Legend Snippet: Antileishmanial activity of GRA. ( A ) Dose- and time-dependent expression of iNOS by Taqman analysis of the mRNA transcript in BMDM stimulated with GRA. mRNA levels were normalized to β-actin and expressed as a -fold change compared with control. ( B ) Percentages of infected cells and ( C ) number of parasites per macrophage were counted at various time periods following infection. ( D ) Effect of GRA on NO production (solid bar) and parasite suppression (open bar) in BMDM in presence or absence of AMT (10 µM). ( E ) Generation of NO (solid bar) and parasite suppression (open bar) in peritoneal macrophages isolated from mice which received GRA (10, 50 and 100 mg/kg) i.p. for 3 times 5 days apart. Macrophages were harvested 10 h after the last injection and infected with L. donovani . After 4 h infection and 20 h of incubation, the percentage of parasite suppression and the amount of NO 2 − in the medium were determined. ( F ) and ( G ) Levels of IL-12, TNF-α, IL-10 ,TGF-β, IL-6 and IL-1β in culture supernatants from infected and GRA (20 µM)-treated BMDM were determined by ELISA. ( H ) Mice were administered i.v. with 10 7 promastigotes, and after 10 days of infection, were treated with GRA (25 or 50/mg/kg) i.p. 3 times 5 days apart. Spleen parasite burdens were determined 6 wk after infection and are expressed as LDU ± SD. ( I ) Spleen parasite burden determined 2 and 6 wk following infection measured by limiting dilution assay expressed as log 10 parasite burden ± SD. Cultures were set in triplicate and experiments were done a minimum of three times. Animal experiments were done with five animals/group and the results are representative of three independent experiments. Data represent the mean ± SD. *** p

    Techniques Used: Activity Assay, Expressing, Infection, Isolation, Mouse Assay, Injection, Incubation, Enzyme-linked Immunosorbent Assay, Limiting Dilution Assay

    51) Product Images from "RARα2 and PML-RAR similarities in the control of basal and retinoic acid induced myeloid maturation of acute myeloid leukemia cells"

    Article Title: RARα2 and PML-RAR similarities in the control of basal and retinoic acid induced myeloid maturation of acute myeloid leukemia cells

    Journal: Oncotarget

    doi: 10.18632/oncotarget.10556

    Expression, ATRA-dependent proteolytic degradation and transcriptional activity of PML-RAR, RARα2 and RARα1 A . NB4 cells were treated with vehicle (DMSO) or ATRA (0.1 μM) for 48 hours. Total RNA was extracted and subjected to RT-PCR analysis using Taqman assays for the indicated mRNAs. The results are expressed as the mean±SD of 3 replicates. B . Upper: NB4 cells were treated with vehicle (DMSO) or ATRA (0.1 μM) for 40 hours before addition of the proteasome inhibitor, MG132 (40 μM) for 8 hours. Total protein extracts were subjected to Western blot analysis with an anti-RARα antibody [RP alpha (F)]. Actin was used as a loading control. Lower: NB4 cells were treated as above with vehicle (DMSO), ATRA (0.1 μM), the proteasome inhibitor, MG132 (20 and 40 μM) or ATRA+MG132. Cell extracts were immuno-precipitated with an anti-RARα2 antibody [Ab25alpha2(A2)] coupled to protein G-sepharose beads (IP = immuno-precipitation) and the immuno-precipitates were subjected to Western blot analysis with the same anti-RARα antibody used in the Upper panel. Equivalent amounts of protein extracts were used to immuno-precipitate RARα2, as indicated by the levels of actin in the extracts before addition of the anti-RARα2 antibody (input). COS-7 = Total extracts of COS-7 cells transfected with a pcDNA3-RARα2 plasmid. The calculated molecular weight (M.W.) of the indicated proteins is shown on the left. C . COS-7 cells were transfected with pcDNA3-RARα2 , pcDNA3-RARα1 and pSG5-PML-RAR plasmids and the retinoid dependent Luciferase reporter, β2RARE-Luc . Sixteen hours following transfection, cells were treated with DMSO or the indicated concentrations of ATRA for an extra 24 hours. Cell extracts were used for the measurement of luciferase activity and the indicated proteins by Western blot analysis. Luciferase activity data are expressed as the mean±SD of two replicates. D . COS-7 cells were transfected as in ( C ). Sixteen hours following transfection, cells were treated with vehicle (DMSO) or ATRA (1 μM ) for 16 hours and vehicle or MG132 (40 μM) for an extra 8 hours. Cell extracts were used for the measurement of luciferase activity and the indicated proteins by Western blot analysis. Luciferase activity data are expressed as the mean±SD of two replicates.
    Figure Legend Snippet: Expression, ATRA-dependent proteolytic degradation and transcriptional activity of PML-RAR, RARα2 and RARα1 A . NB4 cells were treated with vehicle (DMSO) or ATRA (0.1 μM) for 48 hours. Total RNA was extracted and subjected to RT-PCR analysis using Taqman assays for the indicated mRNAs. The results are expressed as the mean±SD of 3 replicates. B . Upper: NB4 cells were treated with vehicle (DMSO) or ATRA (0.1 μM) for 40 hours before addition of the proteasome inhibitor, MG132 (40 μM) for 8 hours. Total protein extracts were subjected to Western blot analysis with an anti-RARα antibody [RP alpha (F)]. Actin was used as a loading control. Lower: NB4 cells were treated as above with vehicle (DMSO), ATRA (0.1 μM), the proteasome inhibitor, MG132 (20 and 40 μM) or ATRA+MG132. Cell extracts were immuno-precipitated with an anti-RARα2 antibody [Ab25alpha2(A2)] coupled to protein G-sepharose beads (IP = immuno-precipitation) and the immuno-precipitates were subjected to Western blot analysis with the same anti-RARα antibody used in the Upper panel. Equivalent amounts of protein extracts were used to immuno-precipitate RARα2, as indicated by the levels of actin in the extracts before addition of the anti-RARα2 antibody (input). COS-7 = Total extracts of COS-7 cells transfected with a pcDNA3-RARα2 plasmid. The calculated molecular weight (M.W.) of the indicated proteins is shown on the left. C . COS-7 cells were transfected with pcDNA3-RARα2 , pcDNA3-RARα1 and pSG5-PML-RAR plasmids and the retinoid dependent Luciferase reporter, β2RARE-Luc . Sixteen hours following transfection, cells were treated with DMSO or the indicated concentrations of ATRA for an extra 24 hours. Cell extracts were used for the measurement of luciferase activity and the indicated proteins by Western blot analysis. Luciferase activity data are expressed as the mean±SD of two replicates. D . COS-7 cells were transfected as in ( C ). Sixteen hours following transfection, cells were treated with vehicle (DMSO) or ATRA (1 μM ) for 16 hours and vehicle or MG132 (40 μM) for an extra 8 hours. Cell extracts were used for the measurement of luciferase activity and the indicated proteins by Western blot analysis. Luciferase activity data are expressed as the mean±SD of two replicates.

    Techniques Used: Expressing, Activity Assay, Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunoprecipitation, Transfection, Plasmid Preparation, Molecular Weight, Luciferase

    52) Product Images from "Neuroprotective effect of 5-aminolevulinic acid against low inorganic phosphate in neuroblastoma SH-SY5Y cells"

    Article Title: Neuroprotective effect of 5-aminolevulinic acid against low inorganic phosphate in neuroblastoma SH-SY5Y cells

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-06406-6

    Effects of low Pi loading on type-III NaPiT mRNA expression. cDNA reverse transcribed from the mRNA of SH-SY5Y or A172 cells was used as a template for the RT-PCR and qRT-PCR assays. ( A ) Expression of NaPiT mRNA in SH-SY5Y or A172 cells. For each amplification reaction, positive control reactions (PC) were performed using cDNA templates from the kidney (except for SLC34A2 ) or lung (for SLC34A2 ). Negative control reactions lacking RT reactions (RT-) were also performed to exclude the possibility of genomic DNA contamination. The sequences of primer sets are shown in Table 1 . ( B ) The TaqMan-based qPCR assay using SLC20A1 and SLC20A2 probes. Data were normalized to the amount of 18s ribosomal RNA ( 18s rRNA ), and results are expressed as the fold increase compared with that in the SH-SY5Y cells (mean ± SEM; n = 3). ( C ) Effect of PFA on cytotoxicity. ( D , E ) At 24 h after low Pi loading treatment, mRNA expressions of SLC20A1 and SLC20A2 was analyzed using the TaqMan-based qPCR assay. ( F , G ) SH-SY5Y and A172 cells were transiently transfected with SLC20A1 or SLC20A2 siRNA. At 24 h after transfection, mRNA expressions of SLC20A1 and SLC20A2 were analyzed using the TaqMan-based qPCR assay. ( H , I ) The Pi uptake assay was carried out in SLC20A1 - and SLC20A2 -suppressed cells. Data were normalized to the amount of 18s rRNA , and results are expressed as the fold increase compared with that at 1 mM Pi ( D , E ) or in NC ( F – I ) (mean ± SEM; n = 3). The significance of any difference was determined using ANOVA followed by the Bonferroni/Dunn post-hoc test (* p
    Figure Legend Snippet: Effects of low Pi loading on type-III NaPiT mRNA expression. cDNA reverse transcribed from the mRNA of SH-SY5Y or A172 cells was used as a template for the RT-PCR and qRT-PCR assays. ( A ) Expression of NaPiT mRNA in SH-SY5Y or A172 cells. For each amplification reaction, positive control reactions (PC) were performed using cDNA templates from the kidney (except for SLC34A2 ) or lung (for SLC34A2 ). Negative control reactions lacking RT reactions (RT-) were also performed to exclude the possibility of genomic DNA contamination. The sequences of primer sets are shown in Table 1 . ( B ) The TaqMan-based qPCR assay using SLC20A1 and SLC20A2 probes. Data were normalized to the amount of 18s ribosomal RNA ( 18s rRNA ), and results are expressed as the fold increase compared with that in the SH-SY5Y cells (mean ± SEM; n = 3). ( C ) Effect of PFA on cytotoxicity. ( D , E ) At 24 h after low Pi loading treatment, mRNA expressions of SLC20A1 and SLC20A2 was analyzed using the TaqMan-based qPCR assay. ( F , G ) SH-SY5Y and A172 cells were transiently transfected with SLC20A1 or SLC20A2 siRNA. At 24 h after transfection, mRNA expressions of SLC20A1 and SLC20A2 were analyzed using the TaqMan-based qPCR assay. ( H , I ) The Pi uptake assay was carried out in SLC20A1 - and SLC20A2 -suppressed cells. Data were normalized to the amount of 18s rRNA , and results are expressed as the fold increase compared with that at 1 mM Pi ( D , E ) or in NC ( F – I ) (mean ± SEM; n = 3). The significance of any difference was determined using ANOVA followed by the Bonferroni/Dunn post-hoc test (* p

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Amplification, Positive Control, Negative Control, Real-time Polymerase Chain Reaction, Transfection

    53) Product Images from "Inherited IL-17RC deficiency in patients with chronic mucocutaneous candidiasis"

    Article Title: Inherited IL-17RC deficiency in patients with chronic mucocutaneous candidiasis

    Journal: The Journal of Experimental Medicine

    doi: 10.1084/jem.20141065

    Expression of IL-17RC in fibroblasts from controls and patients. (A and B) Amounts of IL17RC cDNA generated from SV40-immortalized fibroblasts from two controls and two patients (P1 and P2), as determined by full-length RT-PCR (A) and TaqMan assays (B). (C) Amounts of IL17RC cDNA obtained from the SV40 fibroblasts of P1 and P2 either left untransfected (NT) or transfected with pUNO1, either empty (MCS) or encoding the WT, Q138*, R376*, or R378* IL-17RC. Results are also shown for the SV40 fibroblasts of two controls tested in parallel (C1 and C2). Means ± SD (error bars) of three independent experiments, as detected by quantitative PCR, are shown. β-ACTIN and GUS were used as endogenous controls. The experiments were repeated at least three times. (D) IL-17RC expression in P1’s and P2’s SV40 fibroblasts transfected with WT or mutant IL17RC alleles, as assessed by Western blotting. IL-17RC protein levels in SV40 fibroblasts from P1 and P2 transfected with the empty pUNO1mcs plasmid (mock) or the pUNO1 plasmid, encoding the WT or one of the three mutant (Q138*, R376*, or R378*) IL-17RC proteins, as determined by Western blotting with an anti–IL-17RC antibody (directed against amino acids 113–258). The anti-GAPDH antibody was used as a control for protein loading. These experiments were repeated at least three times.
    Figure Legend Snippet: Expression of IL-17RC in fibroblasts from controls and patients. (A and B) Amounts of IL17RC cDNA generated from SV40-immortalized fibroblasts from two controls and two patients (P1 and P2), as determined by full-length RT-PCR (A) and TaqMan assays (B). (C) Amounts of IL17RC cDNA obtained from the SV40 fibroblasts of P1 and P2 either left untransfected (NT) or transfected with pUNO1, either empty (MCS) or encoding the WT, Q138*, R376*, or R378* IL-17RC. Results are also shown for the SV40 fibroblasts of two controls tested in parallel (C1 and C2). Means ± SD (error bars) of three independent experiments, as detected by quantitative PCR, are shown. β-ACTIN and GUS were used as endogenous controls. The experiments were repeated at least three times. (D) IL-17RC expression in P1’s and P2’s SV40 fibroblasts transfected with WT or mutant IL17RC alleles, as assessed by Western blotting. IL-17RC protein levels in SV40 fibroblasts from P1 and P2 transfected with the empty pUNO1mcs plasmid (mock) or the pUNO1 plasmid, encoding the WT or one of the three mutant (Q138*, R376*, or R378*) IL-17RC proteins, as determined by Western blotting with an anti–IL-17RC antibody (directed against amino acids 113–258). The anti-GAPDH antibody was used as a control for protein loading. These experiments were repeated at least three times.

    Techniques Used: Expressing, Generated, Reverse Transcription Polymerase Chain Reaction, Transfection, Real-time Polymerase Chain Reaction, Mutagenesis, Western Blot, Plasmid Preparation

    54) Product Images from "MicroRNA-9 controls dendritic development by targeting REST"

    Article Title: MicroRNA-9 controls dendritic development by targeting REST

    Journal: eLife

    doi: 10.7554/eLife.02755

    Characterization of miR-9-Sp Nestin-Cre mouse line. miR-9-Sp fl-Stop littermates were used as controls. The expression of the sponge construct was evaluated by ( A ) in situ hybridization using anti-GFP riboprobe and ( B ) qPCR. As an additional readout of the expression of the sponge, GFP protein content was determined by ( C ) Western blotting and ( D and E ) immunohistochemistry with anti-GFP antibodies. ( D ) Note that only a faint native GFP fluorescence is observed in miR-9-Sp Nestin-Cre brain sections, whereas a strong GFP signal can be detected after immunofluorescence, indicating that GFP protein levels are low but not completely down-regulated by miR-9. Scale bar: 100 μm. ( E ) Co-immunohistochemistry of GFP and NeuN, showing GFP expression in CA1 neurons. Scale bar: 50 μm. ( F ) Quantification of miR-9 levels in hippocampal and cortical samples by qPCR using Taqman probes. ( G ) Quantification of miR-9 precursors (miR-9-1, miR-9-2, and miR-9-3) in hippocampal and cortical samples by qPCR. Values represent mean + SEM, one-way ANOVA, and Bonferroni post-test, *p
    Figure Legend Snippet: Characterization of miR-9-Sp Nestin-Cre mouse line. miR-9-Sp fl-Stop littermates were used as controls. The expression of the sponge construct was evaluated by ( A ) in situ hybridization using anti-GFP riboprobe and ( B ) qPCR. As an additional readout of the expression of the sponge, GFP protein content was determined by ( C ) Western blotting and ( D and E ) immunohistochemistry with anti-GFP antibodies. ( D ) Note that only a faint native GFP fluorescence is observed in miR-9-Sp Nestin-Cre brain sections, whereas a strong GFP signal can be detected after immunofluorescence, indicating that GFP protein levels are low but not completely down-regulated by miR-9. Scale bar: 100 μm. ( E ) Co-immunohistochemistry of GFP and NeuN, showing GFP expression in CA1 neurons. Scale bar: 50 μm. ( F ) Quantification of miR-9 levels in hippocampal and cortical samples by qPCR using Taqman probes. ( G ) Quantification of miR-9 precursors (miR-9-1, miR-9-2, and miR-9-3) in hippocampal and cortical samples by qPCR. Values represent mean + SEM, one-way ANOVA, and Bonferroni post-test, *p

    Techniques Used: Expressing, Construct, In Situ Hybridization, Real-time Polymerase Chain Reaction, Western Blot, Immunohistochemistry, Fluorescence, Immunofluorescence

    55) Product Images from "Human and Mouse Hematopoietic Stem Cells Are a Depot for Dormant Mycobacterium tuberculosis"

    Article Title: Human and Mouse Hematopoietic Stem Cells Are a Depot for Dormant Mycobacterium tuberculosis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0169119

    Intratracheal transfer of Mtb infected human and murine pHSCs leads to Mtb growth and increased cellularity into the lungs in transplanted hosts. (A) Injection of Lin - CD34 + and Lin + cells from blood of IGRA + human donors (Donor 12–14) and mouse LT-pHSCs from bone marrow 28 days p.i. into the trachea of Rag2 –/– Il2rg /– mice (3 mice/population). Transfer of 10 2 CFUs Mtb was used as positive (n = 3), uninfected pHSCs and Lin + cells of an IGRA − donor (Donor 3; n = 1) as negative, control. Recipients were analyzed after 3 weeks. (B) Monitoring of Mtb infection by TaqMan PCR using probes that target MPB64 and IS6110 together on genomic DNA of 10 5 lung cells 3 weeks upon transfer. PCRs were performed in technical triplicates and normalized to murine GAPDH. (C) CFU Mtb growth on Middlebrook 7H11 agar in cells of lung, spleen, thymus and non-separated, 10 5 bone marrow cells 3 weeks upon transfer (n = 3/population). Shown are data from 3 independent experiments. (D) Histopathology of representative lung sections 3 weeks upon transfer. Lungs were stained with hematoxylin/eosin, screened with 5×objectives and verified using a light microscope. Shown are representative data from 3 independent experiments. Data are shown as median + interquartile. Scale bar: 100 μm.
    Figure Legend Snippet: Intratracheal transfer of Mtb infected human and murine pHSCs leads to Mtb growth and increased cellularity into the lungs in transplanted hosts. (A) Injection of Lin - CD34 + and Lin + cells from blood of IGRA + human donors (Donor 12–14) and mouse LT-pHSCs from bone marrow 28 days p.i. into the trachea of Rag2 –/– Il2rg /– mice (3 mice/population). Transfer of 10 2 CFUs Mtb was used as positive (n = 3), uninfected pHSCs and Lin + cells of an IGRA − donor (Donor 3; n = 1) as negative, control. Recipients were analyzed after 3 weeks. (B) Monitoring of Mtb infection by TaqMan PCR using probes that target MPB64 and IS6110 together on genomic DNA of 10 5 lung cells 3 weeks upon transfer. PCRs were performed in technical triplicates and normalized to murine GAPDH. (C) CFU Mtb growth on Middlebrook 7H11 agar in cells of lung, spleen, thymus and non-separated, 10 5 bone marrow cells 3 weeks upon transfer (n = 3/population). Shown are data from 3 independent experiments. (D) Histopathology of representative lung sections 3 weeks upon transfer. Lungs were stained with hematoxylin/eosin, screened with 5×objectives and verified using a light microscope. Shown are representative data from 3 independent experiments. Data are shown as median + interquartile. Scale bar: 100 μm.

    Techniques Used: Infection, Injection, Mouse Assay, Negative Control, Polymerase Chain Reaction, Histopathology, Staining, Light Microscopy

    Human peripheral Lin – CD34 + , Lin – CD34 + CD38 low CD90 + , SP + pHSCs as well as CD271 + CD45 - MSCs of IGRA + donors harbour Mtb DNA. Lin + , Lin – CD34 + , Lin – CD34 + CD38 low CD90 + , Lin – CD34 + CD38 + CD90 – , Lin – SP + and Lin + SP − cells (Donors 1, 6, 8, 9) were purified from blood of IGRA + (n = 8) and IGRA − donors (n = 7; S1A Fig ). CD271 + CD45 - MSCs (Donors 10 and 13) were purified from blood of IGRA + donors (n = 2; S1B Fig ). CD1c + , CD14 + , CD16 + , CD4 + /8 + , CD15 + , CD19 + , and CD56 + cells were prepared from blood of IGRA + donors (n = 3). Genomic DNA prepared from 10 3 hematopoietic progenitors and MSCs as well as 10 5 Lin + cells from IGRA + and IGRA - donors were tested for the presence of Mtb DNA by PCR. (A, E) Quantification of Mtb -specific DNA by real-time TaqMan PCR using probes that target MPB64 and IS6110 together ( S4 Fig ). (B) Genomic DNA of 10 3 hematopoietic progenitors from IGRA + and IGRA - donors were tested by PCR for a DNA fragment present in Mtb , but not in BCG. (C) Quantification of Mtb -specific DNA by limiting dilutions using a single-target PCR for IS6110 (Donor 13, 14; S2A Fig ). (D, E) Quantification of Mtb -specific DNA by real-time SYBR green PCR using primers that target MPB64 alone ( S4 Fig ). Real-time PCRs were performed in 2 independent runs in technical triplicates and normalized to human GAPDH. Known Mtb concentrations were used as reference. (F) CFU Mtb growth on Middlebrook 7H11 agar plates (n = 2–3). Data are shown as median + interquartile.
    Figure Legend Snippet: Human peripheral Lin – CD34 + , Lin – CD34 + CD38 low CD90 + , SP + pHSCs as well as CD271 + CD45 - MSCs of IGRA + donors harbour Mtb DNA. Lin + , Lin – CD34 + , Lin – CD34 + CD38 low CD90 + , Lin – CD34 + CD38 + CD90 – , Lin – SP + and Lin + SP − cells (Donors 1, 6, 8, 9) were purified from blood of IGRA + (n = 8) and IGRA − donors (n = 7; S1A Fig ). CD271 + CD45 - MSCs (Donors 10 and 13) were purified from blood of IGRA + donors (n = 2; S1B Fig ). CD1c + , CD14 + , CD16 + , CD4 + /8 + , CD15 + , CD19 + , and CD56 + cells were prepared from blood of IGRA + donors (n = 3). Genomic DNA prepared from 10 3 hematopoietic progenitors and MSCs as well as 10 5 Lin + cells from IGRA + and IGRA - donors were tested for the presence of Mtb DNA by PCR. (A, E) Quantification of Mtb -specific DNA by real-time TaqMan PCR using probes that target MPB64 and IS6110 together ( S4 Fig ). (B) Genomic DNA of 10 3 hematopoietic progenitors from IGRA + and IGRA - donors were tested by PCR for a DNA fragment present in Mtb , but not in BCG. (C) Quantification of Mtb -specific DNA by limiting dilutions using a single-target PCR for IS6110 (Donor 13, 14; S2A Fig ). (D, E) Quantification of Mtb -specific DNA by real-time SYBR green PCR using primers that target MPB64 alone ( S4 Fig ). Real-time PCRs were performed in 2 independent runs in technical triplicates and normalized to human GAPDH. Known Mtb concentrations were used as reference. (F) CFU Mtb growth on Middlebrook 7H11 agar plates (n = 2–3). Data are shown as median + interquartile.

    Techniques Used: Purification, Polymerase Chain Reaction, SYBR Green Assay

    Murine and human pHSCs are infected with Mtb expressing dormancy genes. (A) Expression analyses on RNA isolated from Mtb -infected mouse lung cells and purified LT-pHSCs (n = 8). (B) Expression analyses on RNA isolated from Lin – CD34 + pHSCs from IGRA + donors (n = 6) and Mtb -infected human monocytic leukemia cell line 96 h p.i. (n = 3). Expression analyses were done by real-time TaqMan PCR for SigA , DosR , c-lat and hspX . SigA was used as reference for Mtb . Real-time TaqMan PCRs were performed in 3 independent runs in technical triplicates. Data are shown as median + interquartile. * P ˂ 0.05, ** P ˂ 0.005, *** P ˂ 0.005 by Mann-Whitney test.
    Figure Legend Snippet: Murine and human pHSCs are infected with Mtb expressing dormancy genes. (A) Expression analyses on RNA isolated from Mtb -infected mouse lung cells and purified LT-pHSCs (n = 8). (B) Expression analyses on RNA isolated from Lin – CD34 + pHSCs from IGRA + donors (n = 6) and Mtb -infected human monocytic leukemia cell line 96 h p.i. (n = 3). Expression analyses were done by real-time TaqMan PCR for SigA , DosR , c-lat and hspX . SigA was used as reference for Mtb . Real-time TaqMan PCRs were performed in 3 independent runs in technical triplicates. Data are shown as median + interquartile. * P ˂ 0.05, ** P ˂ 0.005, *** P ˂ 0.005 by Mann-Whitney test.

    Techniques Used: Infection, Expressing, Isolation, Purification, Polymerase Chain Reaction, MANN-WHITNEY

    Detection of Mtb infection in different organs and hematopoietic cells of mice day 28 p.i. by Mtb DNA PCR and Mtb CFU. C57BL/6 mice were infected with 10 5 CFUs Mtb (H37Rv). (A) Quantification of Mtb -specific DNA by real-time TaqMan PCR using probes targeting MPB64 and IS6110 ( S4 Fig ) on genomic DNA of 10 5 lung cells (n = 8), 10 5 Gr1 + , CD11c + , CD19 + , Mac1 + , NK1.1 + , CD4 + /8 + cells (n = 4; S1C Fig ), and 10 3 LT-pHSCs, ST-pHSCs and MPPs (n = 16; S1B Fig ). (B) Quantification of Mtb -specific DNA by limiting dilutions using a single-target PCR for IS6110 (n = 3; S2B Fig ). (C) Real-time SYBR green PCR using primers targeting MPB64 (n = 4–8; S4 Fig ). Real-time PCRs were performed in 2 independent runs in technical triplicates and normalized to murine GAPDH. Known Mtb concentrations were used as reference. (D) CFU enumeration on Middlebrook 7H11 agar in cells of lung, spleen and thymus (n = 16). (E) CFU enumeration on Middlebrook 7H11 agar for Lin + cell populations (n = 8). (F) CFU enumeration on Middlebrook 7H11 agar for hematopoietic progenitors (n = 16). Shown are data of 4 independent experiments. Data are shown as median + interquartile. * P ˂ 0.05, ** P ˂ 0.005, *** P ˂ 0.0005, **** P ˂ 0.00005 by Mann-Whitney test.
    Figure Legend Snippet: Detection of Mtb infection in different organs and hematopoietic cells of mice day 28 p.i. by Mtb DNA PCR and Mtb CFU. C57BL/6 mice were infected with 10 5 CFUs Mtb (H37Rv). (A) Quantification of Mtb -specific DNA by real-time TaqMan PCR using probes targeting MPB64 and IS6110 ( S4 Fig ) on genomic DNA of 10 5 lung cells (n = 8), 10 5 Gr1 + , CD11c + , CD19 + , Mac1 + , NK1.1 + , CD4 + /8 + cells (n = 4; S1C Fig ), and 10 3 LT-pHSCs, ST-pHSCs and MPPs (n = 16; S1B Fig ). (B) Quantification of Mtb -specific DNA by limiting dilutions using a single-target PCR for IS6110 (n = 3; S2B Fig ). (C) Real-time SYBR green PCR using primers targeting MPB64 (n = 4–8; S4 Fig ). Real-time PCRs were performed in 2 independent runs in technical triplicates and normalized to murine GAPDH. Known Mtb concentrations were used as reference. (D) CFU enumeration on Middlebrook 7H11 agar in cells of lung, spleen and thymus (n = 16). (E) CFU enumeration on Middlebrook 7H11 agar for Lin + cell populations (n = 8). (F) CFU enumeration on Middlebrook 7H11 agar for hematopoietic progenitors (n = 16). Shown are data of 4 independent experiments. Data are shown as median + interquartile. * P ˂ 0.05, ** P ˂ 0.005, *** P ˂ 0.0005, **** P ˂ 0.00005 by Mann-Whitney test.

    Techniques Used: Infection, Mouse Assay, Polymerase Chain Reaction, SYBR Green Assay, MANN-WHITNEY

    56) Product Images from "Differential Activation of Human Gingival Epithelial Cells and Monocytes by Porphyromonas gingivalis Fimbriae ▿"

    Article Title: Differential Activation of Human Gingival Epithelial Cells and Monocytes by Porphyromonas gingivalis Fimbriae ▿

    Journal: Infection and Immunity

    doi: 10.1128/IAI.01604-06

    P. gingivalis FimA does not influence TLR1, -2, and -6 expression in human gingival epithelial cells. HGECs were challenged with either P. gingivalis (P.g; MOI, 100:1) or FimA (10 μg/ml) for 4 h at 37°C. Real-time PCR was performed with an ABI 7500 system (Applied Biosystems). TaqMan probes and sense and antisense primers for gene expression of human TLR1, -2, and -6 were purchased from Applied Biosystems along with probes and primers for the human endogenous control, GAPDH. Using a Universal PCR Master Mix (Applied Biosystems), the reactions were carried out according to the manufacturer's protocol. The ratio of TLR2 (A), TLR1 (B), and TLR6 (C) mRNAs was normalized to GAPDH mRNA. Data are presented as the means ± standard deviations of triplicate determinations. NS, not statistically significant.
    Figure Legend Snippet: P. gingivalis FimA does not influence TLR1, -2, and -6 expression in human gingival epithelial cells. HGECs were challenged with either P. gingivalis (P.g; MOI, 100:1) or FimA (10 μg/ml) for 4 h at 37°C. Real-time PCR was performed with an ABI 7500 system (Applied Biosystems). TaqMan probes and sense and antisense primers for gene expression of human TLR1, -2, and -6 were purchased from Applied Biosystems along with probes and primers for the human endogenous control, GAPDH. Using a Universal PCR Master Mix (Applied Biosystems), the reactions were carried out according to the manufacturer's protocol. The ratio of TLR2 (A), TLR1 (B), and TLR6 (C) mRNAs was normalized to GAPDH mRNA. Data are presented as the means ± standard deviations of triplicate determinations. NS, not statistically significant.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    57) Product Images from "A Remote Cis-Acting Variant at 3q Links Glomerular NCK1 to Diabetic Nephropathy"

    Article Title: A Remote Cis-Acting Variant at 3q Links Glomerular NCK1 to Diabetic Nephropathy

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0056414

    Glomerular expression analysis of four nearby genes. (A) Immunofluorescence staining of mouse kidney sections. Positive signals of staining and locations of glomeruli are indicated by arrows and arrowheads, respectively. (B) Positive and negative controls of mouse kidney immunofluorescence staining for IL-20rb. LPS-treated mouse kidney was used as a positive control. Staining without primary antibody to IL-20rb was used as a negative control. (C) Western blotting analysis. Nck1 and calnexin, an internal control, are shown in the left side. Stag1, Tmem22, IL-20rb and β-action, an internal control, are shown in the right side. Glo, the glomerular lysate; ROK, the rest of kidney, indicating lysates from kidney that lacks glomeruli fractions. Molecular weight is indicated by number of kDa. (D) Double immunostaining of mouse kidney sections with a podocyte marker nephrin (green) and Nck1 (red). Yellow color pointed by arrows indicates partial colocaliztion of staining of Nck1 and nephrin staining. (E) qPCR analysis. mRNA expression of four genes from isolated glomeruli of adult C57BL/6 mouse kidney was quantified using the TaqMan method.
    Figure Legend Snippet: Glomerular expression analysis of four nearby genes. (A) Immunofluorescence staining of mouse kidney sections. Positive signals of staining and locations of glomeruli are indicated by arrows and arrowheads, respectively. (B) Positive and negative controls of mouse kidney immunofluorescence staining for IL-20rb. LPS-treated mouse kidney was used as a positive control. Staining without primary antibody to IL-20rb was used as a negative control. (C) Western blotting analysis. Nck1 and calnexin, an internal control, are shown in the left side. Stag1, Tmem22, IL-20rb and β-action, an internal control, are shown in the right side. Glo, the glomerular lysate; ROK, the rest of kidney, indicating lysates from kidney that lacks glomeruli fractions. Molecular weight is indicated by number of kDa. (D) Double immunostaining of mouse kidney sections with a podocyte marker nephrin (green) and Nck1 (red). Yellow color pointed by arrows indicates partial colocaliztion of staining of Nck1 and nephrin staining. (E) qPCR analysis. mRNA expression of four genes from isolated glomeruli of adult C57BL/6 mouse kidney was quantified using the TaqMan method.

    Techniques Used: Expressing, Immunofluorescence, Staining, Positive Control, Negative Control, Western Blot, Molecular Weight, Double Immunostaining, Marker, Real-time Polymerase Chain Reaction, Isolation

    58) Product Images from "A Crucial Role of Bone Morphogenetic Protein Signaling in the Wound Healing Response in Acute Liver Injury Induced by Carbon Tetrachloride"

    Article Title: A Crucial Role of Bone Morphogenetic Protein Signaling in the Wound Healing Response in Acute Liver Injury Induced by Carbon Tetrachloride

    Journal: International Journal of Hepatology

    doi: 10.1155/2012/476820

    Time course of gene expressions in the liver of mice treated with CCl 4 . (a) RT-PCR analyses of BMP2, BMP4 and albumin were performed using the primer sets shown in Section 2 . Albumin expression is decreased at 3–36 h and recovers at 48 h. BMP4 is transiently expressed at 3–6 h after CCl 4 injection. (b) Real-time PCR analyses of albumin and BMP4 were performed using primer sets and TaqMan probes provided by Applied Biosystems Co. All data are shown as the means ± SE from three independent experiments.
    Figure Legend Snippet: Time course of gene expressions in the liver of mice treated with CCl 4 . (a) RT-PCR analyses of BMP2, BMP4 and albumin were performed using the primer sets shown in Section 2 . Albumin expression is decreased at 3–36 h and recovers at 48 h. BMP4 is transiently expressed at 3–6 h after CCl 4 injection. (b) Real-time PCR analyses of albumin and BMP4 were performed using primer sets and TaqMan probes provided by Applied Biosystems Co. All data are shown as the means ± SE from three independent experiments.

    Techniques Used: Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Expressing, Injection, Real-time Polymerase Chain Reaction

    59) Product Images from "Identification of a serum-induced transcriptional signature associated with metastatic cervical cancer"

    Article Title: Identification of a serum-induced transcriptional signature associated with metastatic cervical cancer

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0181242

    miRNA expression levels in serum from cervical cancer patients with local or metastatic disease. Expression levels of four candidate miRNAs were determined via Taqman-based qPCR using RNA extracted from the serum of patients with local (n = 25) or metastatic (n = 24) cervical cancer. Serum expression levels of miR-23b-3p were significantly lower in the metastatic group (B; *p
    Figure Legend Snippet: miRNA expression levels in serum from cervical cancer patients with local or metastatic disease. Expression levels of four candidate miRNAs were determined via Taqman-based qPCR using RNA extracted from the serum of patients with local (n = 25) or metastatic (n = 24) cervical cancer. Serum expression levels of miR-23b-3p were significantly lower in the metastatic group (B; *p

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    60) Product Images from "Upregulation of Mitf by Phenolic Compounds-Rich Cymbopogon schoenanthus Treatment Promotes Melanogenesis in B16 Melanoma Cells and Human Epidermal Melanocytes"

    Article Title: Upregulation of Mitf by Phenolic Compounds-Rich Cymbopogon schoenanthus Treatment Promotes Melanogenesis in B16 Melanoma Cells and Human Epidermal Melanocytes

    Journal: BioMed Research International

    doi: 10.1155/2017/8303671

    Effect of Cymbopogon schoenanthus ethanol extract on the mRNA expression level of melanogenic enzymes: (a) tyrosinase (Tyr) , (b) tyrosinase-related protein 1 (Trp1) , and (c) dopachrome tautomerase (Dct) determined using TaqMan real-time quantitative PCR. B16 cells were cultured in 100 mm dish (3 × 10 6 cells/dish) and treated without (CON) or with 1/1000 (v/v) C. schoenanthus ethanol extract (CYM), using 400 nm alpha-melanocyte-stimulating hormone ( α -MSH) as a positive control and incubated for 4 h after which RNA was extracted, and then reverse transcription PCR was carried out to obtain cDNAs that were used for real-time PCR (ABI 7500 Fast Real-time PCR system). Results represent the mean ± SD of three independent experiments. ∗ Statistically significant ( P ≤ 0.05) difference between control and treated cells.
    Figure Legend Snippet: Effect of Cymbopogon schoenanthus ethanol extract on the mRNA expression level of melanogenic enzymes: (a) tyrosinase (Tyr) , (b) tyrosinase-related protein 1 (Trp1) , and (c) dopachrome tautomerase (Dct) determined using TaqMan real-time quantitative PCR. B16 cells were cultured in 100 mm dish (3 × 10 6 cells/dish) and treated without (CON) or with 1/1000 (v/v) C. schoenanthus ethanol extract (CYM), using 400 nm alpha-melanocyte-stimulating hormone ( α -MSH) as a positive control and incubated for 4 h after which RNA was extracted, and then reverse transcription PCR was carried out to obtain cDNAs that were used for real-time PCR (ABI 7500 Fast Real-time PCR system). Results represent the mean ± SD of three independent experiments. ∗ Statistically significant ( P ≤ 0.05) difference between control and treated cells.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Cell Culture, Positive Control, Incubation, Polymerase Chain Reaction

    Effect of Cymbopogon schoenanthus ethanol extract on the mRNA expression level of microphthalmia-associated transcription factor (Mitf) determined using TaqMan real-time quantitative PCR. B16 cells were cultured in 100 mm dish (3 × 10 6 cells/dish) and treated without (CON) or with 1/1000 (v/v) C. schoenanthus ethanol extract (CYM), using 400 nm alpha-melanocyte-stimulating hormone ( α -MSH) as a positive control, and incubated for 4 h after which RNA was extracted, and then reverse transcription PCR was carried out to obtain cDNAs that were used for real-time PCR (ABI 7500 Fast Real-time PCR system). Results represent the mean ± SD of three independent experiments. ∗ Statistically significant ( P ≤ 0.05) difference between control and treated cells.
    Figure Legend Snippet: Effect of Cymbopogon schoenanthus ethanol extract on the mRNA expression level of microphthalmia-associated transcription factor (Mitf) determined using TaqMan real-time quantitative PCR. B16 cells were cultured in 100 mm dish (3 × 10 6 cells/dish) and treated without (CON) or with 1/1000 (v/v) C. schoenanthus ethanol extract (CYM), using 400 nm alpha-melanocyte-stimulating hormone ( α -MSH) as a positive control, and incubated for 4 h after which RNA was extracted, and then reverse transcription PCR was carried out to obtain cDNAs that were used for real-time PCR (ABI 7500 Fast Real-time PCR system). Results represent the mean ± SD of three independent experiments. ∗ Statistically significant ( P ≤ 0.05) difference between control and treated cells.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Cell Culture, Positive Control, Incubation, Polymerase Chain Reaction

    61) Product Images from "Autotaxin Inhibition with PF-8380 Enhances the Radiosensitivity of Human and Murine Glioblastoma Cell Lines"

    Article Title: Autotaxin Inhibition with PF-8380 Enhances the Radiosensitivity of Human and Murine Glioblastoma Cell Lines

    Journal: Frontiers in Oncology

    doi: 10.3389/fonc.2013.00236

    ATX expression in endothelial and GBM cell lines . (A) The mRNA from endothelial cells (HUVEC and bEnd.3) as well as tumor cells (U87-MG and GL261) were analyzed by quantitative PCR using TaqMan probes specific for ATX. The bar graph showing the mean Δ C t values of expression of ATX normalized to actin is shown. (B) A representative gel indicating the mRNA levels of ATX, actin, and GAPDH is shown. (C) The conditioned medium from endothelial cells (HUVEC and bEnd.3) and tumor cells (U87-MG and GL261) was concentrated and then were immunoblotted and probed with an anti ATX antibody.
    Figure Legend Snippet: ATX expression in endothelial and GBM cell lines . (A) The mRNA from endothelial cells (HUVEC and bEnd.3) as well as tumor cells (U87-MG and GL261) were analyzed by quantitative PCR using TaqMan probes specific for ATX. The bar graph showing the mean Δ C t values of expression of ATX normalized to actin is shown. (B) A representative gel indicating the mRNA levels of ATX, actin, and GAPDH is shown. (C) The conditioned medium from endothelial cells (HUVEC and bEnd.3) and tumor cells (U87-MG and GL261) was concentrated and then were immunoblotted and probed with an anti ATX antibody.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    62) Product Images from "Dysregulation of miR-155-5p and miR-200-3p and the Anti-Non-Bilayer Phospholipid Arrangement Antibodies Favor the Development of Lupus in Three Novel Murine Lupus Models"

    Article Title: Dysregulation of miR-155-5p and miR-200-3p and the Anti-Non-Bilayer Phospholipid Arrangement Antibodies Favor the Development of Lupus in Three Novel Murine Lupus Models

    Journal: Journal of Immunology Research

    doi: 10.1155/2017/8751642

    qRT-PCR validation of deregulated miRNAs in the three murine lupus-like models. (a) The validation of the six deregulated miRNAs found by PCR array, together with miR-342-3p because of its importance in human lupus [ 13 , 14 ], was made using specific TaqMan-directed qRT-PCR. Each miRNA expression level was normalized against endogenous RNU6 by the 2 −∆∆CT method and control mice (injected with smooth liposomes). Statistical significance was determined using the Holm-Sidak method. ∗ p ≤ 0.05, ∗∗∗ p ≤ 0.001. Asterisks indicate statistical significance between normalized fold changes from each murine lupus-like model versus the control group. (b) miRNA validation data as a Venn representation. Arrow colors indicate miRNA statistical significance (black for significant and grey for nonsignificant), and their direction shows upregulation or downregulation (inverted).
    Figure Legend Snippet: qRT-PCR validation of deregulated miRNAs in the three murine lupus-like models. (a) The validation of the six deregulated miRNAs found by PCR array, together with miR-342-3p because of its importance in human lupus [ 13 , 14 ], was made using specific TaqMan-directed qRT-PCR. Each miRNA expression level was normalized against endogenous RNU6 by the 2 −∆∆CT method and control mice (injected with smooth liposomes). Statistical significance was determined using the Holm-Sidak method. ∗ p ≤ 0.05, ∗∗∗ p ≤ 0.001. Asterisks indicate statistical significance between normalized fold changes from each murine lupus-like model versus the control group. (b) miRNA validation data as a Venn representation. Arrow colors indicate miRNA statistical significance (black for significant and grey for nonsignificant), and their direction shows upregulation or downregulation (inverted).

    Techniques Used: Quantitative RT-PCR, Polymerase Chain Reaction, Expressing, Mouse Assay, Injection

    63) Product Images from "Redox signaling and splicing dependent change in myosin phosphatase underlie early versus late changes in NO vasodilator reserve in a mouse LPS model of sepsis"

    Article Title: Redox signaling and splicing dependent change in myosin phosphatase underlie early versus late changes in NO vasodilator reserve in a mouse LPS model of sepsis

    Journal: American Journal of Physiology - Heart and Circulatory Physiology

    doi: 10.1152/ajpheart.00912.2014

    Changes in MP subunits and other contractile mRNAs after LPS. RNA samples ( A and B ) after 20 mg/kg LPS, as described in , or after LPS dose response (1–20 mg/kg; C and D ) were analyzed by quantitative PCR using Taqman probes and normalized
    Figure Legend Snippet: Changes in MP subunits and other contractile mRNAs after LPS. RNA samples ( A and B ) after 20 mg/kg LPS, as described in , or after LPS dose response (1–20 mg/kg; C and D ) were analyzed by quantitative PCR using Taqman probes and normalized

    Techniques Used: Real-time Polymerase Chain Reaction

    64) Product Images from "Plasmid pAMS1-Encoded, Bacteriocin-Related "Siblicide" in Enterococcus faecalis ▿"

    Article Title: Plasmid pAMS1-Encoded, Bacteriocin-Related "Siblicide" in Enterococcus faecalis ▿

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.00147-09

    RT-QPCR analyses. TaqMan primer sequences were designed to target the middle third of the bacB open reading frame, the second (downstream) gene of the bacAB operon (BACB-F, GCAAGTCTATAAAAAAATAGATAGCGAAAAATATCCA, and BACB-R, CTCCCAATTCAATTAATAACTTTTCATCATTTCCT), and the 16S rRNA gene (EF16S-F, GAAACAGGTGCTAATACCGCATAAC, and EF16S-R, CAGCGACACCCGAAAGC). Probe sequences were as follows: BACB FAM, CAATGTAGATATAGTTCACCAATTTA, and EF16S FAM, CATGCGGCATAAACT. Forty-five cycles were performed using an ABI Prism 7500 sequence detection system, bacAB expression was normalized to 16S rRNA gene expression, and changes ( n -fold) in transcript levels relative to those at early exponential phase (A) and baseline (B) were determined using the threshold cycle (ΔΔ C T ) method with software from Applied Biosystems. Experiments were performed in quadruplicate on two separate occasions. (A) Comparisons of different stages of growth. Results from experiments with hosts that are gelatinase negative (SFJ1 and SFTX3) and gelatinase positive (MC4, SFOS2, and SFOR2) are shown. The data are expressed as changes ( n -fold; means ± standard errors of the means) in bacAB transcript levels at late exponential and stationary stages of growth relative to those at early exponential stage (set at 1). Strains were grown in 50 ml of Todd-Hewitt broth with gentle shaking, and aliquots were obtained at early exponential phase (optical density at 650 nm, 0.1), late exponential phase (optical density at 650 nm, 0.8), and 2 h into stationary phase and at 24 h. Transcript levels at late exponential phase were significantly higher than those at other stages in SFJ1, SFTX3, SFOS2, and SFOR2 ( P
    Figure Legend Snippet: RT-QPCR analyses. TaqMan primer sequences were designed to target the middle third of the bacB open reading frame, the second (downstream) gene of the bacAB operon (BACB-F, GCAAGTCTATAAAAAAATAGATAGCGAAAAATATCCA, and BACB-R, CTCCCAATTCAATTAATAACTTTTCATCATTTCCT), and the 16S rRNA gene (EF16S-F, GAAACAGGTGCTAATACCGCATAAC, and EF16S-R, CAGCGACACCCGAAAGC). Probe sequences were as follows: BACB FAM, CAATGTAGATATAGTTCACCAATTTA, and EF16S FAM, CATGCGGCATAAACT. Forty-five cycles were performed using an ABI Prism 7500 sequence detection system, bacAB expression was normalized to 16S rRNA gene expression, and changes ( n -fold) in transcript levels relative to those at early exponential phase (A) and baseline (B) were determined using the threshold cycle (ΔΔ C T ) method with software from Applied Biosystems. Experiments were performed in quadruplicate on two separate occasions. (A) Comparisons of different stages of growth. Results from experiments with hosts that are gelatinase negative (SFJ1 and SFTX3) and gelatinase positive (MC4, SFOS2, and SFOR2) are shown. The data are expressed as changes ( n -fold; means ± standard errors of the means) in bacAB transcript levels at late exponential and stationary stages of growth relative to those at early exponential stage (set at 1). Strains were grown in 50 ml of Todd-Hewitt broth with gentle shaking, and aliquots were obtained at early exponential phase (optical density at 650 nm, 0.1), late exponential phase (optical density at 650 nm, 0.8), and 2 h into stationary phase and at 24 h. Transcript levels at late exponential phase were significantly higher than those at other stages in SFJ1, SFTX3, SFOS2, and SFOR2 ( P

    Techniques Used: Quantitative RT-PCR, Sequencing, Expressing, Software

    65) Product Images from "Apoptosis Induced by the UV Filter Benzophenone-3 in Mouse Neuronal Cells Is Mediated via Attenuation of Erα/Pparγ and Stimulation of Erβ/Gpr30 Signaling"

    Article Title: Apoptosis Induced by the UV Filter Benzophenone-3 in Mouse Neuronal Cells Is Mediated via Attenuation of Erα/Pparγ and Stimulation of Erβ/Gpr30 Signaling

    Journal: Molecular Neurobiology

    doi: 10.1007/s12035-017-0480-z

    Effect of BP-3 (25 μM) on the mRNA expression levels of Erα , Erβ , Gpr30 , and Pparγ in neocortical cultures at 7 DIV. The extraction of total RNA at 3, 6, and 24 h post-treatment from the neocortical cells was followed by reverse transcription and quantitative polymerase chain reaction (qPCR). The products of the reverse transcription reaction were amplified using TaqMan probes and primers corresponding to the specific genes. Hprt was used as a reference gene. Each bar represents the mean ± SEM of three independent experiments. The number of replicates for each experiment ranged from 2 to 3, ** p
    Figure Legend Snippet: Effect of BP-3 (25 μM) on the mRNA expression levels of Erα , Erβ , Gpr30 , and Pparγ in neocortical cultures at 7 DIV. The extraction of total RNA at 3, 6, and 24 h post-treatment from the neocortical cells was followed by reverse transcription and quantitative polymerase chain reaction (qPCR). The products of the reverse transcription reaction were amplified using TaqMan probes and primers corresponding to the specific genes. Hprt was used as a reference gene. Each bar represents the mean ± SEM of three independent experiments. The number of replicates for each experiment ranged from 2 to 3, ** p

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Amplification

    66) Product Images from "Histone H3K9 methyltransferase G9a represses PPAR? expression and adipogenesis"

    Article Title: Histone H3K9 methyltransferase G9a represses PPAR? expression and adipogenesis

    Journal: The EMBO Journal

    doi: 10.1038/emboj.2012.306

    H3K9me2 and G9a levels decrease during adipogenesis. ( A ) ChIP analyses of H3K4me3, H3K9me2 and H3K27me3 on PPAR γ 1 and PPAR γ 2 promoters before (day 0) and after (day 6) 3T3-L1 adipogenesis. The schematic of PPAR γ 1 and PPAR γ 2 promoters and the locations of Taqman probes for PCR quantitation of ChIP are shown at the top. Wnt10a promoter serves as a control. ( B ) ChIP-Seq profiles of H3K9me2 on PPAR γ locus (highlighted) before (day 0) and after (day 7) 3T3-L1 adipogenesis. ( C ) qRT–PCR analysis of PPAR γ and G9a expression before and after 3T3-L1 adipogenesis. ( D ) Western blot analysis of G9a, PPARγ and H3K9me2 levels during 3T3-L1 adipogenesis. The 54.5-kDa PPARγ1 and 57.5-kDa PPARγ2 bands as well as the 30-kDa and 42-kDa C/EBPα isoforms are indicated. The p85α subunit of phosphoinositol-3-phosphate kinase is used as a loading control. ( E ) Western blot analysis of protein levels in preadipocytes and adipocytes isolated from mouse inguinal white adipose tissue. Source data for this figure is available on the online supplementary information page.
    Figure Legend Snippet: H3K9me2 and G9a levels decrease during adipogenesis. ( A ) ChIP analyses of H3K4me3, H3K9me2 and H3K27me3 on PPAR γ 1 and PPAR γ 2 promoters before (day 0) and after (day 6) 3T3-L1 adipogenesis. The schematic of PPAR γ 1 and PPAR γ 2 promoters and the locations of Taqman probes for PCR quantitation of ChIP are shown at the top. Wnt10a promoter serves as a control. ( B ) ChIP-Seq profiles of H3K9me2 on PPAR γ locus (highlighted) before (day 0) and after (day 7) 3T3-L1 adipogenesis. ( C ) qRT–PCR analysis of PPAR γ and G9a expression before and after 3T3-L1 adipogenesis. ( D ) Western blot analysis of G9a, PPARγ and H3K9me2 levels during 3T3-L1 adipogenesis. The 54.5-kDa PPARγ1 and 57.5-kDa PPARγ2 bands as well as the 30-kDa and 42-kDa C/EBPα isoforms are indicated. The p85α subunit of phosphoinositol-3-phosphate kinase is used as a loading control. ( E ) Western blot analysis of protein levels in preadipocytes and adipocytes isolated from mouse inguinal white adipose tissue. Source data for this figure is available on the online supplementary information page.

    Techniques Used: Chromatin Immunoprecipitation, Polymerase Chain Reaction, Quantitation Assay, Quantitative RT-PCR, Expressing, Western Blot, Isolation, Polyacrylamide Gel Electrophoresis

    67) Product Images from "Joint cytokine quantification in two rodent arthritis models: kinetics of expression, correlation of mRNA and protein levels and response to prednisolone treatment"

    Article Title: Joint cytokine quantification in two rodent arthritis models: kinetics of expression, correlation of mRNA and protein levels and response to prednisolone treatment

    Journal: Clinical and Experimental Immunology

    doi: 10.1111/j.1365-2249.2004.02499.x

    Effect of prednisolone on (a) inflammation and cytokine (protein and mRNA) levels in rat joints in the SCW-induced arthritis model. Animals were sacrificed on day 3 after i.v challenge. Naïve (non injected animals), PBS (animals injected with PBS), Vehicle (animals injected with SW and administered methylcellulose), Pred (animals injected with SCW and daily administered prednisolone 1 mg/kg, p.o). The inflammatory response is expressed as the increase on ankle diameter (mm) after the initial injection of SCW suspension. Protein (□) and mRNA (▪) levels for (b) IL-1β, (c) IL-6 or (d) TNF-α were measured by ELISA and real-time RT-PCR TaqMan®, respectively. Data represent means ± S.E.M. ( n = 6 animals/group). Protein data are expressed as pg protein/ml and mRNA results, normalized against the housekeeping gene Ubiquitin, are expressed as copy No/50 ng cDNA. * P
    Figure Legend Snippet: Effect of prednisolone on (a) inflammation and cytokine (protein and mRNA) levels in rat joints in the SCW-induced arthritis model. Animals were sacrificed on day 3 after i.v challenge. Naïve (non injected animals), PBS (animals injected with PBS), Vehicle (animals injected with SW and administered methylcellulose), Pred (animals injected with SCW and daily administered prednisolone 1 mg/kg, p.o). The inflammatory response is expressed as the increase on ankle diameter (mm) after the initial injection of SCW suspension. Protein (□) and mRNA (▪) levels for (b) IL-1β, (c) IL-6 or (d) TNF-α were measured by ELISA and real-time RT-PCR TaqMan®, respectively. Data represent means ± S.E.M. ( n = 6 animals/group). Protein data are expressed as pg protein/ml and mRNA results, normalized against the housekeeping gene Ubiquitin, are expressed as copy No/50 ng cDNA. * P

    Techniques Used: Injection, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR

    68) Product Images from "Mice maintain predominantly maternal Gαs expression throughout life in brown fat tissue (BAT), but not other tissues"

    Article Title: Mice maintain predominantly maternal Gαs expression throughout life in brown fat tissue (BAT), but not other tissues

    Journal: Bone

    doi: 10.1016/j.bone.2017.07.001

    Gαs and Ucp1 mRNA expression in BAT from newborn E1 mat− (panel A) and E1 pat− mice (panel B). Gαs levels were measured using TaqMan and were normalized for the expression of β-actin, and expressed as percentage of the wild-type littermates (lower panel A and B). Ucp1 levels were normalized for expression of β2-microglobulin (β2M) and expressed as percentage of the wild-type littermates (upper panels A and B). White columns represent E1 mat− and E1 pat− transcript levels; black columns represent wild-type littermates transcript levels. Each column is presented as mean ± SEM derived from BAT of 3 different animals. *, p
    Figure Legend Snippet: Gαs and Ucp1 mRNA expression in BAT from newborn E1 mat− (panel A) and E1 pat− mice (panel B). Gαs levels were measured using TaqMan and were normalized for the expression of β-actin, and expressed as percentage of the wild-type littermates (lower panel A and B). Ucp1 levels were normalized for expression of β2-microglobulin (β2M) and expressed as percentage of the wild-type littermates (upper panels A and B). White columns represent E1 mat− and E1 pat− transcript levels; black columns represent wild-type littermates transcript levels. Each column is presented as mean ± SEM derived from BAT of 3 different animals. *, p

    Techniques Used: Expressing, Mouse Assay, Derivative Assay

    69) Product Images from "Concentrated Conditioned Media from Adipose Tissue Derived Mesenchymal Stem Cells Mitigates Visual Deficits and Retinal Inflammation Following Mild Traumatic Brain Injury"

    Article Title: Concentrated Conditioned Media from Adipose Tissue Derived Mesenchymal Stem Cells Mitigates Visual Deficits and Retinal Inflammation Following Mild Traumatic Brain Injury

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms19072016

    ASC-CCM reduces retinal inflammation in blast injury mice. ASC-CCM reduces retinal inflammation in blast injury mice. Assessment of gene expression by TaqMan qPCR and expressed as fold change normalized to internal control (18s rRNA) in the study groups. Data represent Mean ± SEM from n = 3–4 animals/group performed in duplicates repeated two additional times with similar data. #, p > 0.05; *, p
    Figure Legend Snippet: ASC-CCM reduces retinal inflammation in blast injury mice. ASC-CCM reduces retinal inflammation in blast injury mice. Assessment of gene expression by TaqMan qPCR and expressed as fold change normalized to internal control (18s rRNA) in the study groups. Data represent Mean ± SEM from n = 3–4 animals/group performed in duplicates repeated two additional times with similar data. #, p > 0.05; *, p

    Techniques Used: Mouse Assay, Expressing, Real-time Polymerase Chain Reaction

    70) Product Images from "The superoxide dismutase mimetic tempol does not alleviate glucocorticoid‐mediated rarefaction of rat skeletal muscle capillaries. The superoxide dismutase mimetic tempol does not alleviate glucocorticoid‐mediated rarefaction of rat skeletal muscle capillaries"

    Article Title: The superoxide dismutase mimetic tempol does not alleviate glucocorticoid‐mediated rarefaction of rat skeletal muscle capillaries. The superoxide dismutase mimetic tempol does not alleviate glucocorticoid‐mediated rarefaction of rat skeletal muscle capillaries

    Journal: Physiological Reports

    doi: 10.14814/phy2.13243

    CORT promotes a vasoconstrictor profile within skeletal muscle. RNA was isolated from the TA muscle of control or 9D CORT ‐treated rats and quantified by Taqman qPCR to assess the mRNA levels of eNOS (A), ET ‐1 (B), and the α 1Α‐adrenergic receptor (C), expressed as 2 −ΔCt relative to the housekeeping gene hypoxanthine‐guanine phosphoribosyltransferase‐1 ( HPRT 1). * P
    Figure Legend Snippet: CORT promotes a vasoconstrictor profile within skeletal muscle. RNA was isolated from the TA muscle of control or 9D CORT ‐treated rats and quantified by Taqman qPCR to assess the mRNA levels of eNOS (A), ET ‐1 (B), and the α 1Α‐adrenergic receptor (C), expressed as 2 −ΔCt relative to the housekeeping gene hypoxanthine‐guanine phosphoribosyltransferase‐1 ( HPRT 1). * P

    Techniques Used: Isolation, Real-time Polymerase Chain Reaction

    71) Product Images from "Microprocessor-dependent processing of splice site overlapping microRNA exons does not result in changes in alternative splicing"

    Article Title: Microprocessor-dependent processing of splice site overlapping microRNA exons does not result in changes in alternative splicing

    Journal: RNA

    doi: 10.1261/rna.063438.117

    mRNAs’ and SO-miRNAs’ expression level during keratinocytes differentiation. qRT-PCR analysis of ( A ) COL17A1 , LAMB3 , and involucrin (used as keratinocyte differentiation marker) transcripts, and ( B ) miR-936, miR-4260, miR-330 expression by TaqMan assay and Drosha transcript abundance in proliferating keratinocytes (t0) and calcium-treated differentiated cells (t1 to t5). Graphs show expression fold changes in t1–t5 cells, relative to t0 cells set to one. Data were normalized against the geometric mean of TBP , RPLP0, and RPL13A genes. Error bars represent SD between three independent calcium-induced differentiation experiments. P -values were calculated using two-way ANOVA test. (*) P
    Figure Legend Snippet: mRNAs’ and SO-miRNAs’ expression level during keratinocytes differentiation. qRT-PCR analysis of ( A ) COL17A1 , LAMB3 , and involucrin (used as keratinocyte differentiation marker) transcripts, and ( B ) miR-936, miR-4260, miR-330 expression by TaqMan assay and Drosha transcript abundance in proliferating keratinocytes (t0) and calcium-treated differentiated cells (t1 to t5). Graphs show expression fold changes in t1–t5 cells, relative to t0 cells set to one. Data were normalized against the geometric mean of TBP , RPLP0, and RPL13A genes. Error bars represent SD between three independent calcium-induced differentiation experiments. P -values were calculated using two-way ANOVA test. (*) P

    Techniques Used: Expressing, Quantitative RT-PCR, Marker, TaqMan Assay

    72) Product Images from "Lymphocytic Choriomeningitis Virus Differentially Affects the Virus-Induced Type I Interferon Response and Mitochondrial Apoptosis Mediated by RIG-I/MAVS"

    Article Title: Lymphocytic Choriomeningitis Virus Differentially Affects the Virus-Induced Type I Interferon Response and Mitochondrial Apoptosis Mediated by RIG-I/MAVS

    Journal: Journal of Virology

    doi: 10.1128/JVI.00610-15

    Virus-induced IFN-I response and mitochondrial apoptosis are RIG-I dependent. (A) Depletion of RIG-I by RNAi. A549 cells were first reverse transfected with siRNA for RIG-I or control siRNA (C), followed by forward transfection 24 h later. Efficiency of depletion was assessed 72 h after the first transfection by Western blotting using specific antibody against RIG-I. (B) Depletion of RIG-I prevents induction of IFN-I by VSV and SeV. Cells depleted of RIG-I, as described for panel A, were infected with VSV (MOI of 3) and SeV (80 hemagglutinin units/ml) for 16 h or left uninfected (u). Cells were lysed, total RNA was extracted, and cDNA was synthesized by reverse transcription. IFN-β mRNA was detected by RT-qPCR using specific TaqMan probes for IFN-β and GAPDH. Gene expression levels relative to GAPDH were determined according to the 2 −ΔΔ CT method. Data represent fold induction relative to levels in uninfected cells ( n = 3; means ± standard deviations). (C) Induction of apoptosis by SeV and VSV is dependent on RIG-I. Cells depleted for RIG-I, as described for panel A, were infected with VSV (MOI of 3) or SeV (80 hemagglutinin units/ml). Cleavage of PARP was assessed by Western blotting using a specific antibody. Tubulin expression was used as a loading control.
    Figure Legend Snippet: Virus-induced IFN-I response and mitochondrial apoptosis are RIG-I dependent. (A) Depletion of RIG-I by RNAi. A549 cells were first reverse transfected with siRNA for RIG-I or control siRNA (C), followed by forward transfection 24 h later. Efficiency of depletion was assessed 72 h after the first transfection by Western blotting using specific antibody against RIG-I. (B) Depletion of RIG-I prevents induction of IFN-I by VSV and SeV. Cells depleted of RIG-I, as described for panel A, were infected with VSV (MOI of 3) and SeV (80 hemagglutinin units/ml) for 16 h or left uninfected (u). Cells were lysed, total RNA was extracted, and cDNA was synthesized by reverse transcription. IFN-β mRNA was detected by RT-qPCR using specific TaqMan probes for IFN-β and GAPDH. Gene expression levels relative to GAPDH were determined according to the 2 −ΔΔ CT method. Data represent fold induction relative to levels in uninfected cells ( n = 3; means ± standard deviations). (C) Induction of apoptosis by SeV and VSV is dependent on RIG-I. Cells depleted for RIG-I, as described for panel A, were infected with VSV (MOI of 3) or SeV (80 hemagglutinin units/ml). Cleavage of PARP was assessed by Western blotting using a specific antibody. Tubulin expression was used as a loading control.

    Techniques Used: Transfection, Western Blot, Infection, Synthesized, Quantitative RT-PCR, Expressing

    73) Product Images from "Cellular responses to ionising radiation of AT heterozygotes: differences between missense and truncating mutation carriers"

    Article Title: Cellular responses to ionising radiation of AT heterozygotes: differences between missense and truncating mutation carriers

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6601549

    ATM-mRNA level in the six normal, three AT (AT6, AT11, AT14), 11 AT hets trunc and three AT hets mis LCLs. The mRNA level, expressed as the ratio 100/DCT, was obtained by TaqMan analysis and correction for RNA content using β -actin. Data points represent the mean value from at least three experiments for each of the cell lines studied ( n =number of lines in each group), except for AT6 and AT14, which were assayed twice.
    Figure Legend Snippet: ATM-mRNA level in the six normal, three AT (AT6, AT11, AT14), 11 AT hets trunc and three AT hets mis LCLs. The mRNA level, expressed as the ratio 100/DCT, was obtained by TaqMan analysis and correction for RNA content using β -actin. Data points represent the mean value from at least three experiments for each of the cell lines studied ( n =number of lines in each group), except for AT6 and AT14, which were assayed twice.

    Techniques Used:

    74) Product Images from "Retrohoming of a Mobile Group II Intron in Human Cells Suggests How Eukaryotes Limit Group II Intron Proliferation"

    Article Title: Retrohoming of a Mobile Group II Intron in Human Cells Suggests How Eukaryotes Limit Group II Intron Proliferation

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1005422

    Selection of Ll.LtrB group II intron for retrohoming within HEK-293 cells at different MgCl 2 concentrations. (A) Diagram of plasmid-based selection for retrohoming in human cells. The three Ll.LtrB expression plasmids, including a derivative of pLl.LtrB in which the expressed intron carries a phage T7 promoter sequence in DIVb, were transfected into HEK-293 cells along with recipient plasmid pBRRQ, which contains the wild-type Ll.LtrB target site cloned upstream of a promoterless tet R gene. After incubating the cells in culture medium supplemented with 80 or 40 mM Mg 2+ for 24 h, plasmids were isolated and electroporated into E . coli HMS174(λDE3), which was then plated on LB-agar containing tetracycline. Plasmids were isolated from scraped E . coli colonies, and introns that had retrohomed into the target site were amplified by PCR using primers that flank the intron and recloned into pLl.LtrB for the next round of selection. (B) Ll.LtrB introns carrying a phage T7 promoter in DIVb have ~70% wild-type retrohoming efficiency in plasmid targeting assays in HEK-293 cells. The bar graphs show retrohoming frequencies assayed by Taqman qPCR of 5’- (blue) or 3’- (red) integration junctions in DNA extracted from adherent HEK-293 cells after 24-h incubation in culture medium supplemented with 80 mM Mg 2+ . Values are the mean for two or three separate transfections on the same day, with the error bars indicating the SEM. (C) The Ll.LtrB intron was evolved for retrohoming into plasmid targets within HEK-293 cells via eight cycles of selection at 80 mM MgCl 2 with addition of three new mutations per kb between each cycle (rounds 1–8). After round 8, intron variants were selected for an additional four cycles in HEK-293 cells in culture medium supplemented 40 mM MgCl 2 without mutagenesis (rounds 9–12) to enrich for variants that enhance retrohoming within HEK-293 cells. The retrohoming frequencies for the wild-type Ll.LtrB intron and libraries for rounds 1 to 12 were assayed in parallel by Taqman qPCR for three separate transfections on the same day. The values plotted are the mean with the error bars indicating the SEM.
    Figure Legend Snippet: Selection of Ll.LtrB group II intron for retrohoming within HEK-293 cells at different MgCl 2 concentrations. (A) Diagram of plasmid-based selection for retrohoming in human cells. The three Ll.LtrB expression plasmids, including a derivative of pLl.LtrB in which the expressed intron carries a phage T7 promoter sequence in DIVb, were transfected into HEK-293 cells along with recipient plasmid pBRRQ, which contains the wild-type Ll.LtrB target site cloned upstream of a promoterless tet R gene. After incubating the cells in culture medium supplemented with 80 or 40 mM Mg 2+ for 24 h, plasmids were isolated and electroporated into E . coli HMS174(λDE3), which was then plated on LB-agar containing tetracycline. Plasmids were isolated from scraped E . coli colonies, and introns that had retrohomed into the target site were amplified by PCR using primers that flank the intron and recloned into pLl.LtrB for the next round of selection. (B) Ll.LtrB introns carrying a phage T7 promoter in DIVb have ~70% wild-type retrohoming efficiency in plasmid targeting assays in HEK-293 cells. The bar graphs show retrohoming frequencies assayed by Taqman qPCR of 5’- (blue) or 3’- (red) integration junctions in DNA extracted from adherent HEK-293 cells after 24-h incubation in culture medium supplemented with 80 mM Mg 2+ . Values are the mean for two or three separate transfections on the same day, with the error bars indicating the SEM. (C) The Ll.LtrB intron was evolved for retrohoming into plasmid targets within HEK-293 cells via eight cycles of selection at 80 mM MgCl 2 with addition of three new mutations per kb between each cycle (rounds 1–8). After round 8, intron variants were selected for an additional four cycles in HEK-293 cells in culture medium supplemented 40 mM MgCl 2 without mutagenesis (rounds 9–12) to enrich for variants that enhance retrohoming within HEK-293 cells. The retrohoming frequencies for the wild-type Ll.LtrB intron and libraries for rounds 1 to 12 were assayed in parallel by Taqman qPCR for three separate transfections on the same day. The values plotted are the mean with the error bars indicating the SEM.

    Techniques Used: Selection, Plasmid Preparation, Expressing, Sequencing, Transfection, Clone Assay, Isolation, Amplification, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Incubation, Mutagenesis

    Synthetic shuffling of positively selected mutations identifies Ll.LtrB variants with enhanced retrohoming into plasmid and chromosomal target sites in human cells. Optimal combinations of mutations were identified by the recombination-based technique of synthetic shuffling. A synthetic shuffling library of Ll.LtrB variants was constructed in which mutations at 18 positions that were under positive selection ( > 80% of one nucleotide type in > 5% of the population in selection rounds 8 or 12 (subsets of the nucleotides indicated by green triangles or green or black arrows in Fig 7 ) were doped fifty percent against the wild-type nucleotide and position 642 was randomized. Sanger sequencing showed that the starting frequency of each nucleotide in the initial library was as expected for the degree of doping or randomization. The introns were selected in HEK-293 cells for four cycles of retrohoming ( S7 Fig ) with either 80 or 40 mM MgCl 2 added to the culture medium. Pacific Biosciences RS circular consensus sequencing was used to identify the mutations present in the populations with 4,770 and 4,768 reads obtained for the selections at 80 and 40 mM MgCl 2 , respectively. (A) Sequence logos depicting nucleotide percentages in the population at the indicated positions after four rounds of selection at 80 and 40 mM Mg 2+ , and (B) sequence logos depicting the nucleotide percentages in variants that appear > 3 times in the PacBio sequencing in the same selections. The size of the nucleotide indicates its frequency in the population. The wild-type (WT) nucleotide is indicated above the logo, and nucleotide position number is indicated beneath the logo. A green dot indicates that the mutant nucleotide increased in frequency to at least 60% of the population. (C) and (D) Retrohoming frequencies measured by Taqman qPCR for variants identified by synthetic shuffling. The bar graphs in (C) show retrohoming frequencies for four variants from the 80 mM MgCl 2 selection and two from the 40 mM MgCl 2 (sequences shown below) into a plasmid target site in HEK-293 cells with 80 mM MgCl 2 added to the culture medium. The wild-type intron and the best variant from Fig 8 , which contained only the prevalent EBS1 and DIVb mutations (G282A, U642A, G651A, U652C), were assayed in parallel. The bar graphs in (D) show retrohoming frequencies into the genomic HEK-293 cell target site with 80 mM MgCl 2 added to the culture medium for the best four variants from panel (C) compared to wild-type and the best variant from Fig 8 . The values are the average for three experiments, with the error bars indicating the SD. The retrohoming frequency of the wild-type intron ranged from 0.034–0.050% in the assays of panel (C) and from 0.017–0.026% in the assays of panel (D). (E) The most prevalent variants identified by PacBio sequencing from synthetic shuffling after four rounds of selection in HEK-293 cells with 80 and 40 mM MgCl 2 added to the culture medium. The nucleotide position in the Ll.LtrB intron is indicated at the top, and the table shows the nucleotide sequence at that position in the variants. Upper case letters indicate the wild-type nucleotide, and lower case letters indicate mutant nucleotides.
    Figure Legend Snippet: Synthetic shuffling of positively selected mutations identifies Ll.LtrB variants with enhanced retrohoming into plasmid and chromosomal target sites in human cells. Optimal combinations of mutations were identified by the recombination-based technique of synthetic shuffling. A synthetic shuffling library of Ll.LtrB variants was constructed in which mutations at 18 positions that were under positive selection ( > 80% of one nucleotide type in > 5% of the population in selection rounds 8 or 12 (subsets of the nucleotides indicated by green triangles or green or black arrows in Fig 7 ) were doped fifty percent against the wild-type nucleotide and position 642 was randomized. Sanger sequencing showed that the starting frequency of each nucleotide in the initial library was as expected for the degree of doping or randomization. The introns were selected in HEK-293 cells for four cycles of retrohoming ( S7 Fig ) with either 80 or 40 mM MgCl 2 added to the culture medium. Pacific Biosciences RS circular consensus sequencing was used to identify the mutations present in the populations with 4,770 and 4,768 reads obtained for the selections at 80 and 40 mM MgCl 2 , respectively. (A) Sequence logos depicting nucleotide percentages in the population at the indicated positions after four rounds of selection at 80 and 40 mM Mg 2+ , and (B) sequence logos depicting the nucleotide percentages in variants that appear > 3 times in the PacBio sequencing in the same selections. The size of the nucleotide indicates its frequency in the population. The wild-type (WT) nucleotide is indicated above the logo, and nucleotide position number is indicated beneath the logo. A green dot indicates that the mutant nucleotide increased in frequency to at least 60% of the population. (C) and (D) Retrohoming frequencies measured by Taqman qPCR for variants identified by synthetic shuffling. The bar graphs in (C) show retrohoming frequencies for four variants from the 80 mM MgCl 2 selection and two from the 40 mM MgCl 2 (sequences shown below) into a plasmid target site in HEK-293 cells with 80 mM MgCl 2 added to the culture medium. The wild-type intron and the best variant from Fig 8 , which contained only the prevalent EBS1 and DIVb mutations (G282A, U642A, G651A, U652C), were assayed in parallel. The bar graphs in (D) show retrohoming frequencies into the genomic HEK-293 cell target site with 80 mM MgCl 2 added to the culture medium for the best four variants from panel (C) compared to wild-type and the best variant from Fig 8 . The values are the average for three experiments, with the error bars indicating the SD. The retrohoming frequency of the wild-type intron ranged from 0.034–0.050% in the assays of panel (C) and from 0.017–0.026% in the assays of panel (D). (E) The most prevalent variants identified by PacBio sequencing from synthetic shuffling after four rounds of selection in HEK-293 cells with 80 and 40 mM MgCl 2 added to the culture medium. The nucleotide position in the Ll.LtrB intron is indicated at the top, and the table shows the nucleotide sequence at that position in the variants. Upper case letters indicate the wild-type nucleotide, and lower case letters indicate mutant nucleotides.

    Techniques Used: Plasmid Preparation, Construct, Selection, Sequencing, Mutagenesis, Real-time Polymerase Chain Reaction, Variant Assay

    The group II intron Ll.LtrB can retrohome into genomic and plasmid target sites in human cells after addition of Mg 2+ to the cell culture medium. (A) Diagram of Taqman qPCR assays used to measure retrohoming efficiency. The wild-type Ll.LtrB target site was inserted into the genome of HEK-293 Flp-In cells and cloned in recipient plasmid pFRT for assays of genomic and plasmid retrohoming, respectively. Striped regions indicate DNA from the plasmid used in generating the Flp-In cell line. Arrows and starred bars indicate primers and Taqman probes used for qPCR, respectively. Green and red stars of Taqman probes correspond to fluorophore and quencher moieties, respectively. Frequencies of 5’- and 3’-integration junctions were measured relative to number of copies of the hygromycin-resistance marker ( hyg R ) present upstream of the Ll.LtrB target site. (B) and (C) Taqman qPCR assays. HEK-293 Flp-In cells containing the integrated Ll.LtrB target site were transfected with Ll.LtrB expression plasmids plus recipient plasmid pFRT for plasmid assays, as indicated below the bar graphs, and incubated in culture medium supplemented with 80 mM MgCl 2 for 24 h, prior to recovering total cells (adherent and non-adherent) and isolating total DNA for qPCR assays. Blue and red bars show frequencies of 5’- and 3’-integration junctions (note different scales), respectively, relative to copies of a sequence within the hyg R marker. The bar graphs show the average for three experiments with the error bars indicating the SD. (D) Retrohoming frequencies in adherent versus non-adherent cells after 24 h with 80 mM MgCl 2 added to the culture medium. The values shown are the range of retrohoming frequencies in ≥4 experimental trials based on qPCR assays of 5’- and 3’- integration junctions in genomic or plasmid target sites. Later experiments typically used only adherent cells.
    Figure Legend Snippet: The group II intron Ll.LtrB can retrohome into genomic and plasmid target sites in human cells after addition of Mg 2+ to the cell culture medium. (A) Diagram of Taqman qPCR assays used to measure retrohoming efficiency. The wild-type Ll.LtrB target site was inserted into the genome of HEK-293 Flp-In cells and cloned in recipient plasmid pFRT for assays of genomic and plasmid retrohoming, respectively. Striped regions indicate DNA from the plasmid used in generating the Flp-In cell line. Arrows and starred bars indicate primers and Taqman probes used for qPCR, respectively. Green and red stars of Taqman probes correspond to fluorophore and quencher moieties, respectively. Frequencies of 5’- and 3’-integration junctions were measured relative to number of copies of the hygromycin-resistance marker ( hyg R ) present upstream of the Ll.LtrB target site. (B) and (C) Taqman qPCR assays. HEK-293 Flp-In cells containing the integrated Ll.LtrB target site were transfected with Ll.LtrB expression plasmids plus recipient plasmid pFRT for plasmid assays, as indicated below the bar graphs, and incubated in culture medium supplemented with 80 mM MgCl 2 for 24 h, prior to recovering total cells (adherent and non-adherent) and isolating total DNA for qPCR assays. Blue and red bars show frequencies of 5’- and 3’-integration junctions (note different scales), respectively, relative to copies of a sequence within the hyg R marker. The bar graphs show the average for three experiments with the error bars indicating the SD. (D) Retrohoming frequencies in adherent versus non-adherent cells after 24 h with 80 mM MgCl 2 added to the culture medium. The values shown are the range of retrohoming frequencies in ≥4 experimental trials based on qPCR assays of 5’- and 3’- integration junctions in genomic or plasmid target sites. Later experiments typically used only adherent cells.

    Techniques Used: Plasmid Preparation, Cell Culture, Real-time Polymerase Chain Reaction, Clone Assay, Marker, Transfection, Expressing, Incubation, Sequencing

    Retrohoming frequencies of Ll.LtrB variants containing positively selected mutations identified by PacBio sequencing. The prominent mutations in EBS1 (G282A) and DIVb (position 642) were combined with other positively selected mutations that showed covariation and tested for retrohoming into a plasmid target site in HEK-293 cells in culture medium supplemented with 80 mM MgCl 2 . Retrohoming frequencies were measured at 24 h after transfection of the expression plasmids in adherent HEK-293 cells by Taqman qPCR assays of the 5’- and 3’-integration junctions relative to the hyg R marker adjacent to the target site. The bar graphs show retrohoming frequencies of the variants relative to that of the wild-type intron. Values with error bars are the mean ± SD for at least three experimental trials. Values without error bars were tested once. The negative control WT(-) is the wild-type intron tested without additional MgCl 2 in the culture medium. Retrohoming frequencies for the wild-type intron measured by Taqman qPCR of 3’-integration junctions ranged from 0.06–0.11% in this series of experiments.
    Figure Legend Snippet: Retrohoming frequencies of Ll.LtrB variants containing positively selected mutations identified by PacBio sequencing. The prominent mutations in EBS1 (G282A) and DIVb (position 642) were combined with other positively selected mutations that showed covariation and tested for retrohoming into a plasmid target site in HEK-293 cells in culture medium supplemented with 80 mM MgCl 2 . Retrohoming frequencies were measured at 24 h after transfection of the expression plasmids in adherent HEK-293 cells by Taqman qPCR assays of the 5’- and 3’-integration junctions relative to the hyg R marker adjacent to the target site. The bar graphs show retrohoming frequencies of the variants relative to that of the wild-type intron. Values with error bars are the mean ± SD for at least three experimental trials. Values without error bars were tested once. The negative control WT(-) is the wild-type intron tested without additional MgCl 2 in the culture medium. Retrohoming frequencies for the wild-type intron measured by Taqman qPCR of 3’-integration junctions ranged from 0.06–0.11% in this series of experiments.

    Techniques Used: Sequencing, Plasmid Preparation, Transfection, Expressing, Real-time Polymerase Chain Reaction, Marker, Negative Control

    75) Product Images from "Intra-amniotic LPS causes acute neuroinflammation in preterm rhesus macaques"

    Article Title: Intra-amniotic LPS causes acute neuroinflammation in preterm rhesus macaques

    Journal: Journal of Neuroinflammation

    doi: 10.1186/s12974-016-0706-4

    mRNA quantitation of pro-inflammatory cytokines by RT-PCR in the brain. Total mRNA was extracted from snap frozen areas of the brain. mRNA quantitation was performed by RT-PCR using rhesus specific Taqman probes. The mRNA levels are expressed as fold change relative to control after internal normalization to 18s RNA. Exposure to intra-amniotic (IA) LPS increases the expression of IL-1β in the PVWM and thalamus, COX-2 in the cerebellum and thalamus, and CCL2 in the thalamus. * p
    Figure Legend Snippet: mRNA quantitation of pro-inflammatory cytokines by RT-PCR in the brain. Total mRNA was extracted from snap frozen areas of the brain. mRNA quantitation was performed by RT-PCR using rhesus specific Taqman probes. The mRNA levels are expressed as fold change relative to control after internal normalization to 18s RNA. Exposure to intra-amniotic (IA) LPS increases the expression of IL-1β in the PVWM and thalamus, COX-2 in the cerebellum and thalamus, and CCL2 in the thalamus. * p

    Techniques Used: Quantitation Assay, Reverse Transcription Polymerase Chain Reaction, IA, Expressing

    Related Articles

    Amplification:

    Article Title: Identification, Classification and Differential Expression of Oleosin Genes in Tung Tree (Vernicia fordii)
    Article Snippet: qPCR Primers and Probes PCR primers and TaqMan probes were designed using Primer Express software (Applied Biosystems, Foster City, CA, USA). .. The amplicon sizes and the nucleotide sequences (5′ to 3′) of the forward primers, TaqMan probes (TET–BHQ1) and reverse primers of OLE are described in .

    Article Title: Myocarditis in CD8-Depleted SIV-Infected Rhesus Macaques after Short-Term Dual Therapy with Nucleoside and Nucleotide Reverse Transcriptase Inhibitors
    Article Snippet: TaqMan real time RT-PCR The absolute quantification of SIV Gag, TNF-α and RPL13A transcripts in total RNA from left ventricle and spleen specimens was conducted using TaqMan probes and TaqMan One-Step RT-PCR master mix reagents (Applied Biosystems, Foster City, CA) on an ABI Prism 7700 thermal cycler (Applied Biosystems). .. Amplification data were analyzed using Sequence Detection Version 1 software (Applied Biosystems).

    Article Title: Intraamniotic LPS modulates expression of antimicrobial peptides in the fetal sheep lung
    Article Snippet: .. The genes IL-1β, TNF-α, MCP-1, Il-6, IL-8, IL-10, IL-1α, SBD1, SBD2, MAP29, Dodecapeptide, Lactoferrin, HMGB1, RAGE, and HSP70 were amplified using the cDNA template and sheep-specific primers along with Taqman probes (Applied Biosystems, Foster City, CA). .. The mRNA expression for each gene was normalized to the mRNA for the ribosomal protein 18s as internal standard.

    Article Title: Adipose stem cells and their paracrine factors are therapeutic for early retinal complications of diabetes in the Ins2Akita mouse
    Article Snippet: The resulting cDNA sample served as a template for real-time qPCR using TaqMan probes (Table ) and accompanying Master Mix (Applied Biosystems, Foster City, CA). .. PCR amplification was carried out using Quantstudio3 (Applied Biosystems).

    Synthesized:

    Article Title: Thymic regulatory T cell niche size is dictated by limiting interleukin 2 from antigen-bearing dendritic cells and feedback competition
    Article Snippet: Reverse transcription was performed using the Quatitect RT Kit (Qiagen) and cDNA was utilized to run qPCR reactions using Taqman probes along with TaqMan Real-Time PCR master mix (Life Technologies). .. PrimeTime probes, (Mm.PT.58.11478202 (IL-2) and Mm.PT.39a.1 (GAPDH)), were synthesized by IDT.

    Cytometry:

    Article Title: Thymic regulatory T cell niche size is dictated by limiting interleukin 2 from antigen-bearing dendritic cells and feedback competition
    Article Snippet: Some sample was reserved for RNA isolation (“whole thymocyte” samples), and the remainder was used for DC enrichment using MACS CD11c microbeads according to manufacturer’s instructions (Miltenyi), followed by flow cytometry to reach a final purity > 85% CD11c+ F4/80− population (“thymic DC” samples). .. Reverse transcription was performed using the Quatitect RT Kit (Qiagen) and cDNA was utilized to run qPCR reactions using Taqman probes along with TaqMan Real-Time PCR master mix (Life Technologies).

    Quantitative RT-PCR:

    Article Title: Adult onset cardiac dilatation in a transgenic mouse line with Gal?1,3GalNAc ?2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy
    Article Snippet: The amounts of ST3Gal-II and δ-sarcoglycan (SGCD) mRNA in tissues of 3-month-old mice were examined by quantitative RT-PCR analyses with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA as an internal control. .. Amounts of transcripts were measured by real-time PCR using 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, U.S.A.) with QuantiTect Probe PCR Kits (QIAGEN, Hilden, Germany) and TaqMan probes (Applied Biosystems) for three genes.

    Article Title: Identification of Direct Thyroid Hormone Response Genes Reveals the Earliest Gene Regulation Programs during Frog Metamorphosis *
    Article Snippet: .. For quantitative reverse transcription (qRT)-PCR using TaqMan probes, 4 μl of cDNA was used in each reaction using Applied Biosystems 2× PCR Master mix and 20× or 60× TaqMan probe mix. ..

    Article Title: Myocarditis in CD8-Depleted SIV-Infected Rhesus Macaques after Short-Term Dual Therapy with Nucleoside and Nucleotide Reverse Transcriptase Inhibitors
    Article Snippet: .. TaqMan real time RT-PCR The absolute quantification of SIV Gag, TNF-α and RPL13A transcripts in total RNA from left ventricle and spleen specimens was conducted using TaqMan probes and TaqMan One-Step RT-PCR master mix reagents (Applied Biosystems, Foster City, CA) on an ABI Prism 7700 thermal cycler (Applied Biosystems). .. Total RNA from myocardial tissues (100 ng per specimen) was combined with 200 nM each of forward and reverse primers, 1x One-Step RT-PCR master mix and, 100 nM of TaqMan probe in a 50 µl reaction.

    Article Title: Deletion of 12/15-Lipoxygenase Alters Macrophage and Islet Function in NOD-Alox15null Mice, Leading to Protection against Type 1 Diabetes Development
    Article Snippet: Paragraph title: qRT-PCR ... For quantitative measurement of most RT-PCR products, TaqMan probes (Applied Biosciences, Carlsbad, CA, USA) were used with Jump Start Taq Polymerase (Sigma-Aldrich).

    SYBR Green Assay:

    Article Title: Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition
    Article Snippet: .. For real-time PCR, we used TaqMan Fast Universal Master Mix and TaqMan probes (Applied Biosystems) or Fast SYBR Green Master Mix and primers ( ). .. RNA Interference Rat ESCs were transfected with siRNA at a final concentration of 40 nM using Dharmafect 1 (Dharmacon, cat. T-2001-01) and then replated at a concentration of 30,000 cells per well in 12-well plates.

    Article Title: Identification of Direct Thyroid Hormone Response Genes Reveals the Earliest Gene Regulation Programs during Frog Metamorphosis *
    Article Snippet: Paragraph title: Real-time qRT-PCR Assays Using SYBR Green Dye and TaqMan Probes ... For quantitative reverse transcription (qRT)-PCR using TaqMan probes, 4 μl of cDNA was used in each reaction using Applied Biosystems 2× PCR Master mix and 20× or 60× TaqMan probe mix.

    Quantitation Assay:

    Article Title: Intraamniotic LPS modulates expression of antimicrobial peptides in the fetal sheep lung
    Article Snippet: Paragraph title: Relative mRNA Quantitation ... The genes IL-1β, TNF-α, MCP-1, Il-6, IL-8, IL-10, IL-1α, SBD1, SBD2, MAP29, Dodecapeptide, Lactoferrin, HMGB1, RAGE, and HSP70 were amplified using the cDNA template and sheep-specific primers along with Taqman probes (Applied Biosystems, Foster City, CA).

    Formalin-fixed Paraffin-Embedded:

    Article Title: Combining genomic analyses with tumour-derived slice cultures for the characterization of an EGFR-activating kinase mutation in a case of glioblastoma
    Article Snippet: The EGFR c.2582 T > A (p.L861Q) mutation was detected by allelic discrimination with TaqMan probes and primers (Life Technologies). .. The droplet-based digital PCR (ddPCR) assay of plasma DNA and FFPE DNA has been described and validated elsewhere [ ].

    Expressing:

    Article Title: Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition
    Article Snippet: Paragraph title: Gene Expression Analysis by Quantitative Real-Time PCR ... For real-time PCR, we used TaqMan Fast Universal Master Mix and TaqMan probes (Applied Biosystems) or Fast SYBR Green Master Mix and primers ( ).

    Article Title: Altered expression of neuropeptides in FoxG1-null heterozygous mutant mice
    Article Snippet: Real-time PCR analysis was performed using commercial TaqMan probes (Applied Biosystem, ). .. Standard thermal cycling conditions were used (Applied Biosytems): 2 min at 50 °C and 10 min at 95 °C followed by 40 cycles at 95 °C for 15 s and 60 °C for 1 min. Gene expression values were normalized to expression of Glucuronidase β (GUSB, assay id: Mm00446956_m1).

    Article Title: Thymic regulatory T cell niche size is dictated by limiting interleukin 2 from antigen-bearing dendritic cells and feedback competition
    Article Snippet: Reverse transcription was performed using the Quatitect RT Kit (Qiagen) and cDNA was utilized to run qPCR reactions using Taqman probes along with TaqMan Real-Time PCR master mix (Life Technologies). .. IL-2 expression data were normalized to GAPDH and expressed as fold increase over the background values from Il2 −/− bone marrow-derived DCs using ΔΔCt values. (For Il2 −/− DCs, no IL2 signal was observed after 40 cycles of PCR, therefore values reported are upper estimates (indicated by grey shading), and were used to determine the lower limit of detection of the assay.

    Article Title: Intraamniotic LPS modulates expression of antimicrobial peptides in the fetal sheep lung
    Article Snippet: The genes IL-1β, TNF-α, MCP-1, Il-6, IL-8, IL-10, IL-1α, SBD1, SBD2, MAP29, Dodecapeptide, Lactoferrin, HMGB1, RAGE, and HSP70 were amplified using the cDNA template and sheep-specific primers along with Taqman probes (Applied Biosystems, Foster City, CA). .. The mRNA expression for each gene was normalized to the mRNA for the ribosomal protein 18s as internal standard.

    Article Title: Adipose stem cells and their paracrine factors are therapeutic for early retinal complications of diabetes in the Ins2Akita mouse
    Article Snippet: Paragraph title: Gene expression analysis ... The resulting cDNA sample served as a template for real-time qPCR using TaqMan probes (Table ) and accompanying Master Mix (Applied Biosystems, Foster City, CA).

    Article Title: Comparing gene expression data from formalin-fixed, paraffin embedded tissues and qPCR with that from snap-frozen tissue and microarrays for modeling outcomes of patients with ovarian carcinoma
    Article Snippet: However there are technology-specific differences between the Affymetrix and TaqMan probes. .. We also normalized the TaqMan qPCR expression values by scaling and centering using the observed probe average and standard deviation (Additional file : Table S3).

    Article Title: E-Cadherin and FGFR1 Expression in Mouse Osteoblastogenesis in Normoxic Cultures
    Article Snippet: TaqMan analysis Quantification of COL1A2, Runx2, osteocalcin, FGFR1 and E-cadherin mRNA were performed using TaqMan probes for COL1A2, Runx2, osteocalcin, FGFR and E-cadherin, respectively, with TaqMan Universal master Mix II (Applied biosystems, UK). .. ABI PRISM > 900 sequence detector was used to quantify the expression of COL1A2, Runx2, osteocalcin, FGFR1 and E-cadherin during primary osteoblasts differentiation.

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: PCR reactions were carried out using Taqman universal PCR mastermix and TaqMan probes specific to mAbcc6 and GAPDH for reference gene normalization (Applied Biosystems). .. Because the transfection efficiency also determine the level of target mRNAs, we used the level of expression of the neomycine-resistance gene encoded by the expression vector bearing the transcription factor of interest to account for deviation in the measurement of mRNA levels with the following oligonuleotides mNeo: 5′-gaacaagatggattgcacgcagg-3′ and aNeo: 5′-cgctgacagccggaacacg-3′.

    Flow Cytometry:

    Article Title: Thymic regulatory T cell niche size is dictated by limiting interleukin 2 from antigen-bearing dendritic cells and feedback competition
    Article Snippet: Some sample was reserved for RNA isolation (“whole thymocyte” samples), and the remainder was used for DC enrichment using MACS CD11c microbeads according to manufacturer’s instructions (Miltenyi), followed by flow cytometry to reach a final purity > 85% CD11c+ F4/80− population (“thymic DC” samples). .. Reverse transcription was performed using the Quatitect RT Kit (Qiagen) and cDNA was utilized to run qPCR reactions using Taqman probes along with TaqMan Real-Time PCR master mix (Life Technologies).

    Digital PCR:

    Article Title: Combining genomic analyses with tumour-derived slice cultures for the characterization of an EGFR-activating kinase mutation in a case of glioblastoma
    Article Snippet: Paragraph title: Droplet-based digital PCR ... The EGFR c.2582 T > A (p.L861Q) mutation was detected by allelic discrimination with TaqMan probes and primers (Life Technologies).

    Polymerase Chain Reaction:

    Article Title: Adult onset cardiac dilatation in a transgenic mouse line with Gal?1,3GalNAc ?2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy
    Article Snippet: .. Amounts of transcripts were measured by real-time PCR using 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, U.S.A.) with QuantiTect Probe PCR Kits (QIAGEN, Hilden, Germany) and TaqMan probes (Applied Biosystems) for three genes. ..

    Article Title: Identification of Direct Thyroid Hormone Response Genes Reveals the Earliest Gene Regulation Programs during Frog Metamorphosis *
    Article Snippet: .. For quantitative reverse transcription (qRT)-PCR using TaqMan probes, 4 μl of cDNA was used in each reaction using Applied Biosystems 2× PCR Master mix and 20× or 60× TaqMan probe mix. ..

    Article Title: Altered expression of neuropeptides in FoxG1-null heterozygous mutant mice
    Article Snippet: Real-time PCR analysis was performed using commercial TaqMan probes (Applied Biosystem, ). .. PCR was carried out in single-plex reactions in a 96-well optical plate with TaqMan Universal PCR Master Mix (Applied Biosystem) on ABI Prism 7700 Sequence Detection System (Applied Biosystems).

    Article Title: Thymic regulatory T cell niche size is dictated by limiting interleukin 2 from antigen-bearing dendritic cells and feedback competition
    Article Snippet: Reverse transcription was performed using the Quatitect RT Kit (Qiagen) and cDNA was utilized to run qPCR reactions using Taqman probes along with TaqMan Real-Time PCR master mix (Life Technologies). .. IL-2 expression data were normalized to GAPDH and expressed as fold increase over the background values from Il2 −/− bone marrow-derived DCs using ΔΔCt values. (For Il2 −/− DCs, no IL2 signal was observed after 40 cycles of PCR, therefore values reported are upper estimates (indicated by grey shading), and were used to determine the lower limit of detection of the assay.

    Article Title: Identification, Classification and Differential Expression of Oleosin Genes in Tung Tree (Vernicia fordii)
    Article Snippet: .. qPCR Primers and Probes PCR primers and TaqMan probes were designed using Primer Express software (Applied Biosystems, Foster City, CA, USA). ..

    Article Title: Adipose stem cells and their paracrine factors are therapeutic for early retinal complications of diabetes in the Ins2Akita mouse
    Article Snippet: The resulting cDNA sample served as a template for real-time qPCR using TaqMan probes (Table ) and accompanying Master Mix (Applied Biosystems, Foster City, CA). .. PCR amplification was carried out using Quantstudio3 (Applied Biosystems).

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: .. PCR reactions were carried out using Taqman universal PCR mastermix and TaqMan probes specific to mAbcc6 and GAPDH for reference gene normalization (Applied Biosystems). .. Because the transfection efficiency also determine the level of target mRNAs, we used the level of expression of the neomycine-resistance gene encoded by the expression vector bearing the transcription factor of interest to account for deviation in the measurement of mRNA levels with the following oligonuleotides mNeo: 5′-gaacaagatggattgcacgcagg-3′ and aNeo: 5′-cgctgacagccggaacacg-3′.

    Sequencing:

    Article Title: Altered expression of neuropeptides in FoxG1-null heterozygous mutant mice
    Article Snippet: Real-time PCR analysis was performed using commercial TaqMan probes (Applied Biosystem, ). .. PCR was carried out in single-plex reactions in a 96-well optical plate with TaqMan Universal PCR Master Mix (Applied Biosystem) on ABI Prism 7700 Sequence Detection System (Applied Biosystems).

    Article Title: Nucleosome and transcription activator antagonism at human ?-globin locus control region DNase I hypersensitive sites
    Article Snippet: Real-time PCR analysis, primers and TaqMan probes Purified DNA was analyzed by quantitative real-time PCR (ABI Prism 7900) using TaqMan probes and primers (Primer Express 1.0, PE Applied Biosystems). .. In cross-linked ChIP assays, the relative enrichment for each primer pair was determined by comparing the amount of target sequence in 1.25% of immunoprecipitated DNA to the amount of target sequence in 0.1% of input DNA.

    Article Title: Myocarditis in CD8-Depleted SIV-Infected Rhesus Macaques after Short-Term Dual Therapy with Nucleoside and Nucleotide Reverse Transcriptase Inhibitors
    Article Snippet: TaqMan real time RT-PCR The absolute quantification of SIV Gag, TNF-α and RPL13A transcripts in total RNA from left ventricle and spleen specimens was conducted using TaqMan probes and TaqMan One-Step RT-PCR master mix reagents (Applied Biosystems, Foster City, CA) on an ABI Prism 7700 thermal cycler (Applied Biosystems). .. Amplification data were analyzed using Sequence Detection Version 1 software (Applied Biosystems).

    Article Title: E-Cadherin and FGFR1 Expression in Mouse Osteoblastogenesis in Normoxic Cultures
    Article Snippet: TaqMan analysis Quantification of COL1A2, Runx2, osteocalcin, FGFR1 and E-cadherin mRNA were performed using TaqMan probes for COL1A2, Runx2, osteocalcin, FGFR and E-cadherin, respectively, with TaqMan Universal master Mix II (Applied biosystems, UK). .. ABI PRISM > 900 sequence detector was used to quantify the expression of COL1A2, Runx2, osteocalcin, FGFR1 and E-cadherin during primary osteoblasts differentiation.

    Magnetic Cell Separation:

    Article Title: Thymic regulatory T cell niche size is dictated by limiting interleukin 2 from antigen-bearing dendritic cells and feedback competition
    Article Snippet: Some sample was reserved for RNA isolation (“whole thymocyte” samples), and the remainder was used for DC enrichment using MACS CD11c microbeads according to manufacturer’s instructions (Miltenyi), followed by flow cytometry to reach a final purity > 85% CD11c+ F4/80− population (“thymic DC” samples). .. Reverse transcription was performed using the Quatitect RT Kit (Qiagen) and cDNA was utilized to run qPCR reactions using Taqman probes along with TaqMan Real-Time PCR master mix (Life Technologies).

    Mutagenesis:

    Article Title: Combining genomic analyses with tumour-derived slice cultures for the characterization of an EGFR-activating kinase mutation in a case of glioblastoma
    Article Snippet: .. The EGFR c.2582 T > A (p.L861Q) mutation was detected by allelic discrimination with TaqMan probes and primers (Life Technologies). .. The droplet-based digital PCR (ddPCR) assay of plasma DNA and FFPE DNA has been described and validated elsewhere [ ].

    Isolation:

    Article Title: Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition
    Article Snippet: Gene Expression Analysis by Quantitative Real-Time PCR Total RNA was isolated using the RNeasy Kit (QIAGEN) and complementary DNA prepared using SuperScriptIII (Invitrogen) and 3′RACE adaptor primers. .. For real-time PCR, we used TaqMan Fast Universal Master Mix and TaqMan probes (Applied Biosystems) or Fast SYBR Green Master Mix and primers ( ).

    Article Title: Thymic regulatory T cell niche size is dictated by limiting interleukin 2 from antigen-bearing dendritic cells and feedback competition
    Article Snippet: The thymus sample after removal of CD11c+ cells was also used for RNA isolation (“CD11c depleted” samples). .. Reverse transcription was performed using the Quatitect RT Kit (Qiagen) and cDNA was utilized to run qPCR reactions using Taqman probes along with TaqMan Real-Time PCR master mix (Life Technologies).

    Article Title: Intraamniotic LPS modulates expression of antimicrobial peptides in the fetal sheep lung
    Article Snippet: Relative mRNA Quantitation Total RNA was isolated from frozen lungs after homogenization with TRIzol (Invitrogen, Carlsbad, CA) as previously describe ( ). .. The genes IL-1β, TNF-α, MCP-1, Il-6, IL-8, IL-10, IL-1α, SBD1, SBD2, MAP29, Dodecapeptide, Lactoferrin, HMGB1, RAGE, and HSP70 were amplified using the cDNA template and sheep-specific primers along with Taqman probes (Applied Biosystems, Foster City, CA).

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: Total RNA was isolated from TIB-73 cells using the Qiagen RNeasy purification kit and reverse-transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). .. PCR reactions were carried out using Taqman universal PCR mastermix and TaqMan probes specific to mAbcc6 and GAPDH for reference gene normalization (Applied Biosystems).

    Transfection:

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: PCR reactions were carried out using Taqman universal PCR mastermix and TaqMan probes specific to mAbcc6 and GAPDH for reference gene normalization (Applied Biosystems). .. Because the transfection efficiency also determine the level of target mRNAs, we used the level of expression of the neomycine-resistance gene encoded by the expression vector bearing the transcription factor of interest to account for deviation in the measurement of mRNA levels with the following oligonuleotides mNeo: 5′-gaacaagatggattgcacgcagg-3′ and aNeo: 5′-cgctgacagccggaacacg-3′.

    Mouse Assay:

    Article Title: Adult onset cardiac dilatation in a transgenic mouse line with Gal?1,3GalNAc ?2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy
    Article Snippet: The amounts of ST3Gal-II and δ-sarcoglycan (SGCD) mRNA in tissues of 3-month-old mice were examined by quantitative RT-PCR analyses with glyceraldehyde-3-phosphate dehydrogenase (GAPDH) mRNA as an internal control. .. Amounts of transcripts were measured by real-time PCR using 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, U.S.A.) with QuantiTect Probe PCR Kits (QIAGEN, Hilden, Germany) and TaqMan probes (Applied Biosystems) for three genes.

    Article Title: Thymic regulatory T cell niche size is dictated by limiting interleukin 2 from antigen-bearing dendritic cells and feedback competition
    Article Snippet: Quantitative PCR Thymi from wild-type mice were dissociated using collagenase (Sigma-Aldrich.) digestion for 1 h at 37°C. .. Reverse transcription was performed using the Quatitect RT Kit (Qiagen) and cDNA was utilized to run qPCR reactions using Taqman probes along with TaqMan Real-Time PCR master mix (Life Technologies).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Thymic regulatory T cell niche size is dictated by limiting interleukin 2 from antigen-bearing dendritic cells and feedback competition
    Article Snippet: Reverse transcription was performed using the Quatitect RT Kit (Qiagen) and cDNA was utilized to run qPCR reactions using Taqman probes along with TaqMan Real-Time PCR master mix (Life Technologies). .. All reactions were run on an Applied Biosystems 7300 RT PCR machine.

    Article Title: Myocarditis in CD8-Depleted SIV-Infected Rhesus Macaques after Short-Term Dual Therapy with Nucleoside and Nucleotide Reverse Transcriptase Inhibitors
    Article Snippet: .. TaqMan real time RT-PCR The absolute quantification of SIV Gag, TNF-α and RPL13A transcripts in total RNA from left ventricle and spleen specimens was conducted using TaqMan probes and TaqMan One-Step RT-PCR master mix reagents (Applied Biosystems, Foster City, CA) on an ABI Prism 7700 thermal cycler (Applied Biosystems). .. Total RNA from myocardial tissues (100 ng per specimen) was combined with 200 nM each of forward and reverse primers, 1x One-Step RT-PCR master mix and, 100 nM of TaqMan probe in a 50 µl reaction.

    Article Title: Deletion of 12/15-Lipoxygenase Alters Macrophage and Islet Function in NOD-Alox15null Mice, Leading to Protection against Type 1 Diabetes Development
    Article Snippet: .. For quantitative measurement of most RT-PCR products, TaqMan probes (Applied Biosciences, Carlsbad, CA, USA) were used with Jump Start Taq Polymerase (Sigma-Aldrich). ..

    Purification:

    Article Title: Nucleosome and transcription activator antagonism at human ?-globin locus control region DNase I hypersensitive sites
    Article Snippet: .. Real-time PCR analysis, primers and TaqMan probes Purified DNA was analyzed by quantitative real-time PCR (ABI Prism 7900) using TaqMan probes and primers (Primer Express 1.0, PE Applied Biosystems). .. Real-time PCR was carried out with 200 nmol of TaqMan probes and 900 nmol of primers in a 25 µl reaction volume.

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: Total RNA was isolated from TIB-73 cells using the Qiagen RNeasy purification kit and reverse-transcribed with the Superscript III reverse transcriptase kit primed with Oligo(dT) (Invitrogen). .. PCR reactions were carried out using Taqman universal PCR mastermix and TaqMan probes specific to mAbcc6 and GAPDH for reference gene normalization (Applied Biosystems).

    Chromatin Immunoprecipitation:

    Article Title: Nucleosome and transcription activator antagonism at human ?-globin locus control region DNase I hypersensitive sites
    Article Snippet: Real-time PCR analysis, primers and TaqMan probes Purified DNA was analyzed by quantitative real-time PCR (ABI Prism 7900) using TaqMan probes and primers (Primer Express 1.0, PE Applied Biosystems). .. In cross-linked ChIP assays, the relative enrichment for each primer pair was determined by comparing the amount of target sequence in 1.25% of immunoprecipitated DNA to the amount of target sequence in 0.1% of input DNA.

    Plasmid Preparation:

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: PCR reactions were carried out using Taqman universal PCR mastermix and TaqMan probes specific to mAbcc6 and GAPDH for reference gene normalization (Applied Biosystems). .. Because the transfection efficiency also determine the level of target mRNAs, we used the level of expression of the neomycine-resistance gene encoded by the expression vector bearing the transcription factor of interest to account for deviation in the measurement of mRNA levels with the following oligonuleotides mNeo: 5′-gaacaagatggattgcacgcagg-3′ and aNeo: 5′-cgctgacagccggaacacg-3′.

    Software:

    Article Title: Identification, Classification and Differential Expression of Oleosin Genes in Tung Tree (Vernicia fordii)
    Article Snippet: .. qPCR Primers and Probes PCR primers and TaqMan probes were designed using Primer Express software (Applied Biosystems, Foster City, CA, USA). ..

    Article Title: Myocarditis in CD8-Depleted SIV-Infected Rhesus Macaques after Short-Term Dual Therapy with Nucleoside and Nucleotide Reverse Transcriptase Inhibitors
    Article Snippet: TaqMan real time RT-PCR The absolute quantification of SIV Gag, TNF-α and RPL13A transcripts in total RNA from left ventricle and spleen specimens was conducted using TaqMan probes and TaqMan One-Step RT-PCR master mix reagents (Applied Biosystems, Foster City, CA) on an ABI Prism 7700 thermal cycler (Applied Biosystems). .. Amplification data were analyzed using Sequence Detection Version 1 software (Applied Biosystems).

    Real-time Polymerase Chain Reaction:

    Article Title: Adult onset cardiac dilatation in a transgenic mouse line with Gal?1,3GalNAc ?2,3-sialyltransferase II (ST3Gal-II) transgenes: a new model for dilated cardiomyopathy
    Article Snippet: .. Amounts of transcripts were measured by real-time PCR using 7900HT Fast Real-Time PCR System (Applied Biosystems, Foster City, CA, U.S.A.) with QuantiTect Probe PCR Kits (QIAGEN, Hilden, Germany) and TaqMan probes (Applied Biosystems) for three genes. ..

    Article Title: Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition
    Article Snippet: .. For real-time PCR, we used TaqMan Fast Universal Master Mix and TaqMan probes (Applied Biosystems) or Fast SYBR Green Master Mix and primers ( ). .. RNA Interference Rat ESCs were transfected with siRNA at a final concentration of 40 nM using Dharmafect 1 (Dharmacon, cat. T-2001-01) and then replated at a concentration of 30,000 cells per well in 12-well plates.

    Article Title: Altered expression of neuropeptides in FoxG1-null heterozygous mutant mice
    Article Snippet: .. Real-time PCR analysis was performed using commercial TaqMan probes (Applied Biosystem, ). .. PCR was carried out in single-plex reactions in a 96-well optical plate with TaqMan Universal PCR Master Mix (Applied Biosystem) on ABI Prism 7700 Sequence Detection System (Applied Biosystems).

    Article Title: Thymic regulatory T cell niche size is dictated by limiting interleukin 2 from antigen-bearing dendritic cells and feedback competition
    Article Snippet: .. Reverse transcription was performed using the Quatitect RT Kit (Qiagen) and cDNA was utilized to run qPCR reactions using Taqman probes along with TaqMan Real-Time PCR master mix (Life Technologies). .. PrimeTime probes, (Mm.PT.58.11478202 (IL-2) and Mm.PT.39a.1 (GAPDH)), were synthesized by IDT.

    Article Title: Identification, Classification and Differential Expression of Oleosin Genes in Tung Tree (Vernicia fordii)
    Article Snippet: .. qPCR Primers and Probes PCR primers and TaqMan probes were designed using Primer Express software (Applied Biosystems, Foster City, CA, USA). ..

    Article Title: Nucleosome and transcription activator antagonism at human ?-globin locus control region DNase I hypersensitive sites
    Article Snippet: .. Real-time PCR analysis, primers and TaqMan probes Purified DNA was analyzed by quantitative real-time PCR (ABI Prism 7900) using TaqMan probes and primers (Primer Express 1.0, PE Applied Biosystems). .. Real-time PCR was carried out with 200 nmol of TaqMan probes and 900 nmol of primers in a 25 µl reaction volume.

    Article Title: Adipose stem cells and their paracrine factors are therapeutic for early retinal complications of diabetes in the Ins2Akita mouse
    Article Snippet: .. The resulting cDNA sample served as a template for real-time qPCR using TaqMan probes (Table ) and accompanying Master Mix (Applied Biosystems, Foster City, CA). .. PCR amplification was carried out using Quantstudio3 (Applied Biosystems).

    Article Title: Comparing gene expression data from formalin-fixed, paraffin embedded tissues and qPCR with that from snap-frozen tissue and microarrays for modeling outcomes of patients with ovarian carcinoma
    Article Snippet: Calibration and PSRP 91 gene computation Each TaqMan qPCR assay is normalized so it requires no control outside of its own assay. .. However there are technology-specific differences between the Affymetrix and TaqMan probes.

    Article Title: HNF4? and NF-E2 are key transcriptional regulators of the murine Abcc6 gene expression
    Article Snippet: Paragraph title: Quantitative PCR (qPCR) ... PCR reactions were carried out using Taqman universal PCR mastermix and TaqMan probes specific to mAbcc6 and GAPDH for reference gene normalization (Applied Biosystems).

    RNA Extraction:

    Article Title: Robust Self-Renewal of Rat Embryonic Stem Cells Requires Fine-Tuning of Glycogen Synthase Kinase-3 Inhibition
    Article Snippet: For rat embryos, a pool of 14 embryonic day 5.5 rat blastocysts was harvested and homogenized using QIAshredder (QIAGEN) prior to total RNA extraction. .. For real-time PCR, we used TaqMan Fast Universal Master Mix and TaqMan probes (Applied Biosystems) or Fast SYBR Green Master Mix and primers ( ).

    Homogenization:

    Article Title: Intraamniotic LPS modulates expression of antimicrobial peptides in the fetal sheep lung
    Article Snippet: Relative mRNA Quantitation Total RNA was isolated from frozen lungs after homogenization with TRIzol (Invitrogen, Carlsbad, CA) as previously describe ( ). .. The genes IL-1β, TNF-α, MCP-1, Il-6, IL-8, IL-10, IL-1α, SBD1, SBD2, MAP29, Dodecapeptide, Lactoferrin, HMGB1, RAGE, and HSP70 were amplified using the cDNA template and sheep-specific primers along with Taqman probes (Applied Biosystems, Foster City, CA).

    Immunoprecipitation:

    Article Title: Nucleosome and transcription activator antagonism at human ?-globin locus control region DNase I hypersensitive sites
    Article Snippet: Real-time PCR analysis, primers and TaqMan probes Purified DNA was analyzed by quantitative real-time PCR (ABI Prism 7900) using TaqMan probes and primers (Primer Express 1.0, PE Applied Biosystems). .. In cross-linked ChIP assays, the relative enrichment for each primer pair was determined by comparing the amount of target sequence in 1.25% of immunoprecipitated DNA to the amount of target sequence in 0.1% of input DNA.

    Standard Deviation:

    Article Title: Comparing gene expression data from formalin-fixed, paraffin embedded tissues and qPCR with that from snap-frozen tissue and microarrays for modeling outcomes of patients with ovarian carcinoma
    Article Snippet: However there are technology-specific differences between the Affymetrix and TaqMan probes. .. We accounted for this in a calibration step: In deriving the array-based measurements we relied on mean zero, standard deviation one (scaled and centered) values for constructing the risk indexes that comprise the Patient-Specific Risk Profile (PSRP)1 .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher taqman mirna specific probe
    ). Pri-miRNAs, with the mature miRNAs shown in red, were cloned between the XhoI and EcoRI sites present inside the intron 5′ of Thy1.1. <t>miRNA</t> expression was driven from an antisense tet-inducible minimal CMV promoter (TetO/CMV). pTREX also contains an ubiquitin C promoter (UBC) promoter that drives the constitutive expression of the reverse tetracycline transactivator 3 (rtTA3) protein as well as a puromycin (Puro) selectable marker located 3′ to an internal ribosome entry site (IRES). (C) Mature BHRF1 miRNA expression was analyzed by miRNA-specific <t>Taqman</t> qPCR. Expression levels in Δ123 LCLs transduced with the pTREX–based miR-BHRF1-123 expression vector was normalized to the matched WT LCL donor. Average of three donors with SD indicated. No miR-BHRF1 miRNAs were detected in Δ123 LCLs transduced with the parental pTREX vector. (D) LCLs were transduced with either the empty pTREX vector or the miR-BHRF1-123 expressing pTREX vector. After puromycin selection, total Thy1.1+ cells were counted every 3 days and normalized to the WT cell total. Average of three donors. Significance determined by two-way ANOVA with multiple comparisons. *p
    Taqman Mirna Specific Probe, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman mirna specific probe/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    taqman mirna specific probe - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    95
    Thermo Fisher taqman probes nd3
    ROS-derived pAKT drives mitochondrial transfer. ( A ) C57BL/6 mice were subjected to LPS or control PBS i.p. injections. After 2 h the mice were killed, and the BM extracted. BMSCs ( A ) and HSCs ( B ) were analyzed by flow cytometry for pAKT. ( C ) C57BL/6 mice were subjected to BSO or control PBS i.p. injections. After 2 h the mice were killed, and the BM was extracted. BMSCs and HSCs were analyzed by flow cytometry for pAKT. ( D ) Western bot analysis of lineage-negative cells cocultured with mBMSCs. The cocultures were treated with 10 µM H 2 O 2 for 30 min, and the lineage-negative cells were removed and analyzed for pAKT expression. ( E and F ) Flow cytometry-based analysis of lineage-negative cells cocultured with mBMSCs stained with calcein. The cocultures were treated with 10 µM H 2 O 2 or CAL-101 and H 2 O 2 for 24 h, and the lineage-negative cells were removed and analyzed for calcein MFI ( E ) or ( F ) for SNP mtDNA in CBA lineage-negative cells by <t>TaqMan</t> PCR using <t>ND3</t> probes. ( G ) C57BL/6 mice were subjected to LPS with or without pretreatment with CAL-101 or control PBS i.p. injections. After 2 h the mice were killed, and the BM was extracted. HSCs were analyzed for mitochondrial content using MTG. ( H and I ) C57/Bl6 mice were infected with S. typhimurium and then split into 2 groups. The first group received vehicle control and the test group received a daily dose of CAL-101 (30 mg/kg) by oral gavage. Animals were killed on day 5, and livers were isolated and analyzed for CFUs/mg of tissue and sectioned and stained with hematoxylin and eosin. (Magnification: H , 63×.) * P
    Taqman Probes Nd3, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman probes nd3/product/Thermo Fisher
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    taqman probes nd3 - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    90
    Thermo Fisher taqman assay probes
    High-density SNP mapping in the HBB locus. (a) Distribution of 103 <t>SNPs</t> in the HBB locus interrogated by the Illumina Omni1-Quad chip and <t>TaqMan</t> assay. Globin genes are indicated by boxes. The schematic is not drawn to scale. Abbreviations: LCR, locus
    Taqman Assay Probes, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman assay probes/product/Thermo Fisher
    Average 90 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    taqman assay probes - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    ). Pri-miRNAs, with the mature miRNAs shown in red, were cloned between the XhoI and EcoRI sites present inside the intron 5′ of Thy1.1. miRNA expression was driven from an antisense tet-inducible minimal CMV promoter (TetO/CMV). pTREX also contains an ubiquitin C promoter (UBC) promoter that drives the constitutive expression of the reverse tetracycline transactivator 3 (rtTA3) protein as well as a puromycin (Puro) selectable marker located 3′ to an internal ribosome entry site (IRES). (C) Mature BHRF1 miRNA expression was analyzed by miRNA-specific Taqman qPCR. Expression levels in Δ123 LCLs transduced with the pTREX–based miR-BHRF1-123 expression vector was normalized to the matched WT LCL donor. Average of three donors with SD indicated. No miR-BHRF1 miRNAs were detected in Δ123 LCLs transduced with the parental pTREX vector. (D) LCLs were transduced with either the empty pTREX vector or the miR-BHRF1-123 expressing pTREX vector. After puromycin selection, total Thy1.1+ cells were counted every 3 days and normalized to the WT cell total. Average of three donors. Significance determined by two-way ANOVA with multiple comparisons. *p

    Journal: Virology

    Article Title: The Epstein-Barr Virus miR-BHRF1 microRNAs Regulate Viral Gene Expression in cis

    doi: 10.1016/j.virol.2017.09.015

    Figure Lengend Snippet: ). Pri-miRNAs, with the mature miRNAs shown in red, were cloned between the XhoI and EcoRI sites present inside the intron 5′ of Thy1.1. miRNA expression was driven from an antisense tet-inducible minimal CMV promoter (TetO/CMV). pTREX also contains an ubiquitin C promoter (UBC) promoter that drives the constitutive expression of the reverse tetracycline transactivator 3 (rtTA3) protein as well as a puromycin (Puro) selectable marker located 3′ to an internal ribosome entry site (IRES). (C) Mature BHRF1 miRNA expression was analyzed by miRNA-specific Taqman qPCR. Expression levels in Δ123 LCLs transduced with the pTREX–based miR-BHRF1-123 expression vector was normalized to the matched WT LCL donor. Average of three donors with SD indicated. No miR-BHRF1 miRNAs were detected in Δ123 LCLs transduced with the parental pTREX vector. (D) LCLs were transduced with either the empty pTREX vector or the miR-BHRF1-123 expressing pTREX vector. After puromycin selection, total Thy1.1+ cells were counted every 3 days and normalized to the WT cell total. Average of three donors. Significance determined by two-way ANOVA with multiple comparisons. *p

    Article Snippet: Reverse transcription (RT) was performed using the TaqMan miRNA reverse transcription kit (Applied Biosystems), 10 ng total RNA, and stem-loop miRNA specific primers (ThermoFisher Scientific, Inc.). qPCR was then performed using 10 μl TaqMan universal PCR Master Mix No AmpErase UNG (Applied Biosystems), 4 μl of a 1:3 dilution of the 15 μl RT, 0.8 μl TaqMan miRNA specific probe, and 5.2 μl water on a StepOnePlus real-time PCR System (ThermoFisher Scientific, Inc.).

    Techniques: Clone Assay, Expressing, Marker, Real-time Polymerase Chain Reaction, Transduction, Plasmid Preparation, Selection

    ROS-derived pAKT drives mitochondrial transfer. ( A ) C57BL/6 mice were subjected to LPS or control PBS i.p. injections. After 2 h the mice were killed, and the BM extracted. BMSCs ( A ) and HSCs ( B ) were analyzed by flow cytometry for pAKT. ( C ) C57BL/6 mice were subjected to BSO or control PBS i.p. injections. After 2 h the mice were killed, and the BM was extracted. BMSCs and HSCs were analyzed by flow cytometry for pAKT. ( D ) Western bot analysis of lineage-negative cells cocultured with mBMSCs. The cocultures were treated with 10 µM H 2 O 2 for 30 min, and the lineage-negative cells were removed and analyzed for pAKT expression. ( E and F ) Flow cytometry-based analysis of lineage-negative cells cocultured with mBMSCs stained with calcein. The cocultures were treated with 10 µM H 2 O 2 or CAL-101 and H 2 O 2 for 24 h, and the lineage-negative cells were removed and analyzed for calcein MFI ( E ) or ( F ) for SNP mtDNA in CBA lineage-negative cells by TaqMan PCR using ND3 probes. ( G ) C57BL/6 mice were subjected to LPS with or without pretreatment with CAL-101 or control PBS i.p. injections. After 2 h the mice were killed, and the BM was extracted. HSCs were analyzed for mitochondrial content using MTG. ( H and I ) C57/Bl6 mice were infected with S. typhimurium and then split into 2 groups. The first group received vehicle control and the test group received a daily dose of CAL-101 (30 mg/kg) by oral gavage. Animals were killed on day 5, and livers were isolated and analyzed for CFUs/mg of tissue and sectioned and stained with hematoxylin and eosin. (Magnification: H , 63×.) * P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: ROS-mediated PI3K activation drives mitochondrial transfer from stromal cells to hematopoietic stem cells in response to infection

    doi: 10.1073/pnas.1913278116

    Figure Lengend Snippet: ROS-derived pAKT drives mitochondrial transfer. ( A ) C57BL/6 mice were subjected to LPS or control PBS i.p. injections. After 2 h the mice were killed, and the BM extracted. BMSCs ( A ) and HSCs ( B ) were analyzed by flow cytometry for pAKT. ( C ) C57BL/6 mice were subjected to BSO or control PBS i.p. injections. After 2 h the mice were killed, and the BM was extracted. BMSCs and HSCs were analyzed by flow cytometry for pAKT. ( D ) Western bot analysis of lineage-negative cells cocultured with mBMSCs. The cocultures were treated with 10 µM H 2 O 2 for 30 min, and the lineage-negative cells were removed and analyzed for pAKT expression. ( E and F ) Flow cytometry-based analysis of lineage-negative cells cocultured with mBMSCs stained with calcein. The cocultures were treated with 10 µM H 2 O 2 or CAL-101 and H 2 O 2 for 24 h, and the lineage-negative cells were removed and analyzed for calcein MFI ( E ) or ( F ) for SNP mtDNA in CBA lineage-negative cells by TaqMan PCR using ND3 probes. ( G ) C57BL/6 mice were subjected to LPS with or without pretreatment with CAL-101 or control PBS i.p. injections. After 2 h the mice were killed, and the BM was extracted. HSCs were analyzed for mitochondrial content using MTG. ( H and I ) C57/Bl6 mice were infected with S. typhimurium and then split into 2 groups. The first group received vehicle control and the test group received a daily dose of CAL-101 (30 mg/kg) by oral gavage. Animals were killed on day 5, and livers were isolated and analyzed for CFUs/mg of tissue and sectioned and stained with hematoxylin and eosin. (Magnification: H , 63×.) * P

    Article Snippet: For the C57NSG model and coculture experiments, relative quantitative real-time PCR using the Taqman probes ND3 and COX3 (ThermoFisher) was performed on the purified DNA.

    Techniques: Derivative Assay, Mouse Assay, Flow Cytometry, Cytometry, Western Blot, Expressing, Staining, Crocin Bleaching Assay, Polymerase Chain Reaction, Infection, Isolation

    Connexin channels regulate mitochondrial movement from BMSCs to HSCs. ( A ) Flow cytometry-based analysis of lineage-negative cells cocultured with mBMSC stained with calcein. The cocultures were treated with 10 µM H 2 O 2 or carbenoxolone and 10 µM H 2 O 2 for 24 h, and the lineage-negative cells were removed and analyzed for calcein mean fluorescence intensity (MFI). ( B ) CBA-derived lineage-negative cells and PepCboy-derived BMSCs were cocultured with H 2 O 2 or carbenoxolone and 10 µM H 2 O 2 for 24 h. The lineage-negative cells were removed and analyzed for C57BL/6 SNP mtDNA in CBA lineage-negative cells by TaqMan PCR using ND3 probes. ( C ) C57BL/6 mice were subjected to carbenoxolone (CBX) pretreatment before LPS or control PBS i.p. injections. After 2 h the mice were killed, and the BM was extracted. The populations were analyzed by flow cytometry for mean MTG fluorescence intensity within each population. ( D ) Immunofluorescent staining of CX43 of lineage-negative cells and BMSCs cocultured with 10 µM H 2 O 2 with and without pretreatment with GAP27 (100 µM). (Magnification: D , 63×.) ( E ) Quantification of images shown in E numbers of lineage-negative cells positive for mito-9 mCherry. ( F ) CBA lineage-negative cells cocultured with C57 mBMSC. The cocultures were treated with 10 µM H 2 O 2 or GAP27 (100 µM) for 24 h, and the lineage-negative cells were removed and analyzed for SNP mtDNA in CBA lineage-negative cells by TaqMan PCR using ND3 probes. * P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: ROS-mediated PI3K activation drives mitochondrial transfer from stromal cells to hematopoietic stem cells in response to infection

    doi: 10.1073/pnas.1913278116

    Figure Lengend Snippet: Connexin channels regulate mitochondrial movement from BMSCs to HSCs. ( A ) Flow cytometry-based analysis of lineage-negative cells cocultured with mBMSC stained with calcein. The cocultures were treated with 10 µM H 2 O 2 or carbenoxolone and 10 µM H 2 O 2 for 24 h, and the lineage-negative cells were removed and analyzed for calcein mean fluorescence intensity (MFI). ( B ) CBA-derived lineage-negative cells and PepCboy-derived BMSCs were cocultured with H 2 O 2 or carbenoxolone and 10 µM H 2 O 2 for 24 h. The lineage-negative cells were removed and analyzed for C57BL/6 SNP mtDNA in CBA lineage-negative cells by TaqMan PCR using ND3 probes. ( C ) C57BL/6 mice were subjected to carbenoxolone (CBX) pretreatment before LPS or control PBS i.p. injections. After 2 h the mice were killed, and the BM was extracted. The populations were analyzed by flow cytometry for mean MTG fluorescence intensity within each population. ( D ) Immunofluorescent staining of CX43 of lineage-negative cells and BMSCs cocultured with 10 µM H 2 O 2 with and without pretreatment with GAP27 (100 µM). (Magnification: D , 63×.) ( E ) Quantification of images shown in E numbers of lineage-negative cells positive for mito-9 mCherry. ( F ) CBA lineage-negative cells cocultured with C57 mBMSC. The cocultures were treated with 10 µM H 2 O 2 or GAP27 (100 µM) for 24 h, and the lineage-negative cells were removed and analyzed for SNP mtDNA in CBA lineage-negative cells by TaqMan PCR using ND3 probes. * P

    Article Snippet: For the C57NSG model and coculture experiments, relative quantitative real-time PCR using the Taqman probes ND3 and COX3 (ThermoFisher) was performed on the purified DNA.

    Techniques: Flow Cytometry, Cytometry, Staining, Fluorescence, Crocin Bleaching Assay, Derivative Assay, Polymerase Chain Reaction, Mouse Assay

    BMSCs supply mitochondria to HSCs in response to infection. ( A ) Schematic diagram of experimental design. CBA lineage-negative cells (recipient) were cocultured with C57BL/6 bone marrow-derived macrophage cells, BM osteoblasts, and BMSCs (donor) for 24 h with and without H 2 O 2 . The lineage-negative cells were removed and analyzed for PepCboy SNP mtDNA in CBA lineage-negative cells by TaqMan PCR using ND3 probes. ( B – D ) The percentage of PepCboy mtDNA in CBA lineage-negative cells after 24 h treatment with H 2 O 2 versus control (untreated) cells using the ND3 TaqMan probe. CBA gDNA was used to standardize mtDNA copy number. ( E ) Representative fluorescent microscopy images of lineage-negative cells (white arrow) lentivirally transduced with the rLV.EF1.AcGFP-Mem9 virus cultured with mBMSCs transduced with rLV.EF1.mCherry-Mito-9 in the absence or presence of 10 µM H 2 O 2 for 24 h. ( F ) Quantification of rLV.EF1.mCherry-Mito-9 in lineage-negative cells from images presented is taken from 3 independent experiments and 20 lineage cells from each experiment ( E ). ( G ) Lineage-negative cells cultured with mBMSCs transduced in the absence or presence of 10 µM H 2 O 2 for 24 h and then stained for Annexin V and analyzed by flow cytometry. ( H ) Flow cytometry-based analysis of BMSC. ( I ) Relative ROS in BMSC as measured by H2DCFDA fluorescence. ( J ) Mitochondrial content in BMSC as measured by MTG after treatment with NAC and LPS or LPS alone. Data shown are means ± SD of n = 5 mice. * P

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: ROS-mediated PI3K activation drives mitochondrial transfer from stromal cells to hematopoietic stem cells in response to infection

    doi: 10.1073/pnas.1913278116

    Figure Lengend Snippet: BMSCs supply mitochondria to HSCs in response to infection. ( A ) Schematic diagram of experimental design. CBA lineage-negative cells (recipient) were cocultured with C57BL/6 bone marrow-derived macrophage cells, BM osteoblasts, and BMSCs (donor) for 24 h with and without H 2 O 2 . The lineage-negative cells were removed and analyzed for PepCboy SNP mtDNA in CBA lineage-negative cells by TaqMan PCR using ND3 probes. ( B – D ) The percentage of PepCboy mtDNA in CBA lineage-negative cells after 24 h treatment with H 2 O 2 versus control (untreated) cells using the ND3 TaqMan probe. CBA gDNA was used to standardize mtDNA copy number. ( E ) Representative fluorescent microscopy images of lineage-negative cells (white arrow) lentivirally transduced with the rLV.EF1.AcGFP-Mem9 virus cultured with mBMSCs transduced with rLV.EF1.mCherry-Mito-9 in the absence or presence of 10 µM H 2 O 2 for 24 h. ( F ) Quantification of rLV.EF1.mCherry-Mito-9 in lineage-negative cells from images presented is taken from 3 independent experiments and 20 lineage cells from each experiment ( E ). ( G ) Lineage-negative cells cultured with mBMSCs transduced in the absence or presence of 10 µM H 2 O 2 for 24 h and then stained for Annexin V and analyzed by flow cytometry. ( H ) Flow cytometry-based analysis of BMSC. ( I ) Relative ROS in BMSC as measured by H2DCFDA fluorescence. ( J ) Mitochondrial content in BMSC as measured by MTG after treatment with NAC and LPS or LPS alone. Data shown are means ± SD of n = 5 mice. * P

    Article Snippet: For the C57NSG model and coculture experiments, relative quantitative real-time PCR using the Taqman probes ND3 and COX3 (ThermoFisher) was performed on the purified DNA.

    Techniques: Infection, Crocin Bleaching Assay, Derivative Assay, Polymerase Chain Reaction, Microscopy, Transduction, Cell Culture, Staining, Flow Cytometry, Cytometry, Fluorescence, Mouse Assay

    High-density SNP mapping in the HBB locus. (a) Distribution of 103 SNPs in the HBB locus interrogated by the Illumina Omni1-Quad chip and TaqMan assay. Globin genes are indicated by boxes. The schematic is not drawn to scale. Abbreviations: LCR, locus

    Journal: Experimental Biology and Medicine

    Article Title: Original Research: A case-control genome-wide association study identifies genetic modifiers of fetal hemoglobin in sickle cell disease

    doi: 10.1177/1535370216642047

    Figure Lengend Snippet: High-density SNP mapping in the HBB locus. (a) Distribution of 103 SNPs in the HBB locus interrogated by the Illumina Omni1-Quad chip and TaqMan assay. Globin genes are indicated by boxes. The schematic is not drawn to scale. Abbreviations: LCR, locus

    Article Snippet: For the HBB locus haplotype analysis, genotype data for SNPs rs2855121 and rs2855122 were confirmed using TaqMan® assay probes (ThermoFisher Scientific, Grand Island, NY) for real-time PCR detection.

    Techniques: Chromatin Immunoprecipitation, TaqMan Assay