taqman gene expression assays  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    TaqMan Gene Expression Assay
    Description:
    Applied Biosystems TaqMan Gene Expression Assays VIC primer limited are used for quantitative real time PCR analysis of gene expression and consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label VIC on the 5 end and a minor groove binder MGB and nonfluorescent quencher NFQ on the 3 end These assays are primer limited and ideal for multiplex reactions looking at two different gene targets in the same qPCR well Features include • Easy to use just add cDNA and master mix and run the qPCR no melt curves required • Specific TaqMan assays use proprietary MGB containing probes that can be up to 15 bases shorter than non MGB probes improving the specificity of the assay • Sensitive TaqMan assays are ideal for measuring low levels of expression or low abundance targets • Accurate identify small fold changes with high accuracy of quantitation • Extensive content over 1 8 million predesigned assays available for over 25 different species • Gold standard TaqMan qPCR chemistry TaqMan assays draw on Thermo Fisher Scientific s bioinformatics assay design pipeline to help ensure high specificity and minimal cross reactivity even for gene variants with high sequence homology • Ideal for multiplexing combine one FAM labeled and one VIC labeled assay to create a duplex assay for two different gene targets in the same qPCR well • Ideal for control assays use a VIC primer limited assay for high expressing endogenous control genes Approximate ship time Made to order 4 6 days in North America 6 10 days in Europe TaqMan Gene Expression assays are the gold standard in real time PCR gene expression studies built on more than 20 years of experience Each assay includes target primers and a sequence specific probe optimized for the best functional performance No additional design optimization or melt curve analysis is needed Available in a wide variety of formats and species new assay designs are constantly added to help meet your research needs TaqMan assays have been cited in over 40 000 publications and are backed by more than 350 patents All of our predesigned TaqMan Gene Expression assays are covered by the TaqMan Assays qPCR Guarantee Recommended master mix TaqMan Fast Advanced Master Mix Subject to terms and conditions For complete details go to www thermofisher com taqmanguarantee
    Catalog Number:
    4448484
    Price:
    None
    Applications:
    PCR & Real-Time PCR|Real Time PCR (qPCR)|Real Time PCR-Based Gene Expression Profiling|Gene Expression Analysis & Genotyping
    Category:
    Oligos Primers Probes Nucleotides
    Buy from Supplier


    Structured Review

    Thermo Fisher taqman gene expression assays
    PPARα is activated in the intestine of AEG-1KO mice. A–D , expression of the indicated genes by <t>Taqman</t> quantitative <t>RT-PCR</t> in chow- and HFD-fed small intestine ( A and C ) and chow- and HFD-fed liver ( B and D ). The data represent mean ±
    Applied Biosystems TaqMan Gene Expression Assays VIC primer limited are used for quantitative real time PCR analysis of gene expression and consist of a pair of unlabeled PCR primers and a TaqMan probe with a dye label VIC on the 5 end and a minor groove binder MGB and nonfluorescent quencher NFQ on the 3 end These assays are primer limited and ideal for multiplex reactions looking at two different gene targets in the same qPCR well Features include • Easy to use just add cDNA and master mix and run the qPCR no melt curves required • Specific TaqMan assays use proprietary MGB containing probes that can be up to 15 bases shorter than non MGB probes improving the specificity of the assay • Sensitive TaqMan assays are ideal for measuring low levels of expression or low abundance targets • Accurate identify small fold changes with high accuracy of quantitation • Extensive content over 1 8 million predesigned assays available for over 25 different species • Gold standard TaqMan qPCR chemistry TaqMan assays draw on Thermo Fisher Scientific s bioinformatics assay design pipeline to help ensure high specificity and minimal cross reactivity even for gene variants with high sequence homology • Ideal for multiplexing combine one FAM labeled and one VIC labeled assay to create a duplex assay for two different gene targets in the same qPCR well • Ideal for control assays use a VIC primer limited assay for high expressing endogenous control genes Approximate ship time Made to order 4 6 days in North America 6 10 days in Europe TaqMan Gene Expression assays are the gold standard in real time PCR gene expression studies built on more than 20 years of experience Each assay includes target primers and a sequence specific probe optimized for the best functional performance No additional design optimization or melt curve analysis is needed Available in a wide variety of formats and species new assay designs are constantly added to help meet your research needs TaqMan assays have been cited in over 40 000 publications and are backed by more than 350 patents All of our predesigned TaqMan Gene Expression assays are covered by the TaqMan Assays qPCR Guarantee Recommended master mix TaqMan Fast Advanced Master Mix Subject to terms and conditions For complete details go to www thermofisher com taqmanguarantee
    https://www.bioz.com/result/taqman gene expression assays/product/Thermo Fisher
    Average 99 stars, based on 9223 article reviews
    Price from $9.99 to $1999.99
    taqman gene expression assays - by Bioz Stars, 2020-10
    99/100 stars

    Images

    1) Product Images from "Astrocyte Elevated Gene-1 (AEG-1) Regulates Lipid Homeostasis *"

    Article Title: Astrocyte Elevated Gene-1 (AEG-1) Regulates Lipid Homeostasis *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M115.661801

    PPARα is activated in the intestine of AEG-1KO mice. A–D , expression of the indicated genes by Taqman quantitative RT-PCR in chow- and HFD-fed small intestine ( A and C ) and chow- and HFD-fed liver ( B and D ). The data represent mean ±
    Figure Legend Snippet: PPARα is activated in the intestine of AEG-1KO mice. A–D , expression of the indicated genes by Taqman quantitative RT-PCR in chow- and HFD-fed small intestine ( A and C ) and chow- and HFD-fed liver ( B and D ). The data represent mean ±

    Techniques Used: Mouse Assay, Expressing, Quantitative RT-PCR

    2) Product Images from "MicroRNA-27a decreases the level and efficiency of the LDL receptor and contributes to the dysregulation of cholesterol homeostasis"

    Article Title: MicroRNA-27a decreases the level and efficiency of the LDL receptor and contributes to the dysregulation of cholesterol homeostasis

    Journal: Atherosclerosis

    doi: 10.1016/j.atherosclerosis.2015.08.023

    Regulation of LDLRAP1 by miR-27a (A) Predicted annealing of human miR-27a to two sites on the LDLRAP1 3′UTR. (B and C) HepG2 cells were transfected with either 50 nM of LNA anti-miR-27a, 50 nM LNA NC, 30 nM of miR-27a mimic or 30 nM NC mimic, in the absence (B) or presence (C) of plasmid pLDLRAP1-3′UTR. The effect of miR-27a on the levels of LDLRAP1 mRNA was assessed by TaqMan qPCR (B), while luciferase activity was measured to determine the effect of miR-27a on protein levels (C). (D and E) The expression of LDLRAP1 protein in cells transfected with LNA anti-miR-27a or LNA NC was assessed by western-blot (D) , and the intensity of the protein bands was measured by densitometry (E) . Data are mean of three independent experiments ± S.D. LNA, locked nucleic acids; NC, negative control; LDLRAP1 , LDLR-adapter protein 1. The significance is indicated only for samples that are significantly different from all the others. * P
    Figure Legend Snippet: Regulation of LDLRAP1 by miR-27a (A) Predicted annealing of human miR-27a to two sites on the LDLRAP1 3′UTR. (B and C) HepG2 cells were transfected with either 50 nM of LNA anti-miR-27a, 50 nM LNA NC, 30 nM of miR-27a mimic or 30 nM NC mimic, in the absence (B) or presence (C) of plasmid pLDLRAP1-3′UTR. The effect of miR-27a on the levels of LDLRAP1 mRNA was assessed by TaqMan qPCR (B), while luciferase activity was measured to determine the effect of miR-27a on protein levels (C). (D and E) The expression of LDLRAP1 protein in cells transfected with LNA anti-miR-27a or LNA NC was assessed by western-blot (D) , and the intensity of the protein bands was measured by densitometry (E) . Data are mean of three independent experiments ± S.D. LNA, locked nucleic acids; NC, negative control; LDLRAP1 , LDLR-adapter protein 1. The significance is indicated only for samples that are significantly different from all the others. * P

    Techniques Used: Transfection, Plasmid Preparation, Real-time Polymerase Chain Reaction, Luciferase, Activity Assay, Expressing, Western Blot, Negative Control

    Effect of miR-27a on the levels of PCSK9 HepG2 cells were transfected with different concentrations of either LNA anti-miR-27a or LNA NC (A) or with either 30 nM miR-27a or NC mimic (B) . The level of PCSK9 mRNA was quantified by TaqMan qPCR and the secreted PCSK9 protein by ELISA. Data are mean of three independent experiments ± S.D. LNA, locked nucleic acids; NC, negative control; PCSK9 , proprotein convertase subtilisin/kexin type 9. The significance is indicated only for samples that are significantly different from all the others. * P
    Figure Legend Snippet: Effect of miR-27a on the levels of PCSK9 HepG2 cells were transfected with different concentrations of either LNA anti-miR-27a or LNA NC (A) or with either 30 nM miR-27a or NC mimic (B) . The level of PCSK9 mRNA was quantified by TaqMan qPCR and the secreted PCSK9 protein by ELISA. Data are mean of three independent experiments ± S.D. LNA, locked nucleic acids; NC, negative control; PCSK9 , proprotein convertase subtilisin/kexin type 9. The significance is indicated only for samples that are significantly different from all the others. * P

    Techniques Used: Transfection, Real-time Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay, Negative Control

    Effect of miR-27a on the expression of LDLR in HepG2 cells ( A ) Predicted annealing of human miR-27a to two sites on the LDLR 3′UTR. HepG2 cells were transfected with different concentrations of either LNA anti-miR-27a or LNA NC. ( B ) Cells were transfected with either 30 nM miR-27a, 30 nM NC mimic, 50 nM LNA anti-miR-27a or 50 nM LNA NC. The level of LDLR mRNA was quantified by TaqMan qPCR and the LDLR protein by ELISA. ( C and D ) Cells were co-transfected with 1 μg of reporter constructs pLDLR-3′UTR, pmiR-27a or mutated pmiR-27aM in the presence or absence of either 50 nM LNA anti-miR-27a, 50 nM LNA NC, 30 nM miR-27a or 30 nM NC mimic. ( E ) LDLR activity was assessed in HepG2 cells transfected with either 30 nM miR-27a or NC mimics and incubated overnight with LDL conjugated to DyLight ™ 549, a fluorescent probe for detection of LDL uptake. The degree of LDL uptake was examined in an Evos Digital Inverted Fluorescence Microscope (AMG, Fisher Scientific) with filters for excitation at 540 nm and emission at 570 nm. ( F ) The intensity of fluorescence was quantified at 540/570 nm excitation/emission using a Synergy MX plate reader (Biotek). Data are mean of three independent experiments ± S.D. LNA, locked nucleic acids; NC, negative control; LDLR , LDL receptor. The significance is indicated only for samples that are significantly different from all the others. * P
    Figure Legend Snippet: Effect of miR-27a on the expression of LDLR in HepG2 cells ( A ) Predicted annealing of human miR-27a to two sites on the LDLR 3′UTR. HepG2 cells were transfected with different concentrations of either LNA anti-miR-27a or LNA NC. ( B ) Cells were transfected with either 30 nM miR-27a, 30 nM NC mimic, 50 nM LNA anti-miR-27a or 50 nM LNA NC. The level of LDLR mRNA was quantified by TaqMan qPCR and the LDLR protein by ELISA. ( C and D ) Cells were co-transfected with 1 μg of reporter constructs pLDLR-3′UTR, pmiR-27a or mutated pmiR-27aM in the presence or absence of either 50 nM LNA anti-miR-27a, 50 nM LNA NC, 30 nM miR-27a or 30 nM NC mimic. ( E ) LDLR activity was assessed in HepG2 cells transfected with either 30 nM miR-27a or NC mimics and incubated overnight with LDL conjugated to DyLight ™ 549, a fluorescent probe for detection of LDL uptake. The degree of LDL uptake was examined in an Evos Digital Inverted Fluorescence Microscope (AMG, Fisher Scientific) with filters for excitation at 540 nm and emission at 570 nm. ( F ) The intensity of fluorescence was quantified at 540/570 nm excitation/emission using a Synergy MX plate reader (Biotek). Data are mean of three independent experiments ± S.D. LNA, locked nucleic acids; NC, negative control; LDLR , LDL receptor. The significance is indicated only for samples that are significantly different from all the others. * P

    Techniques Used: Expressing, Transfection, Real-time Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay, Construct, Activity Assay, Incubation, Fluorescence, Microscopy, Negative Control

    Regulation of miR-27a in HepG2 cells The level of miR-27a was assessed by TaqMan qPCR in HepG2 cells treated for 24 h with (A) Bay-11 (an inhibitor of NF-KB), LDL-C, simvastatin (commonly used statin that inhibits cholesterol synthesis), insulin and glucose; (B) 200 μM fatty acids (Sigma) conjugated with 0.2% BSA (30 mM) in 1% ethanol; different concentrations of simvastatin (C) or human LDL-C (D) . Data are mean of three independent experiments ± S.D. The significance is indicated only for samples that are significantly different from all the others. * P
    Figure Legend Snippet: Regulation of miR-27a in HepG2 cells The level of miR-27a was assessed by TaqMan qPCR in HepG2 cells treated for 24 h with (A) Bay-11 (an inhibitor of NF-KB), LDL-C, simvastatin (commonly used statin that inhibits cholesterol synthesis), insulin and glucose; (B) 200 μM fatty acids (Sigma) conjugated with 0.2% BSA (30 mM) in 1% ethanol; different concentrations of simvastatin (C) or human LDL-C (D) . Data are mean of three independent experiments ± S.D. The significance is indicated only for samples that are significantly different from all the others. * P

    Techniques Used: Real-time Polymerase Chain Reaction

    3) Product Images from "Altered machinery of protein synthesis is region- and stage-dependent and is associated with α-synuclein oligomers in Parkinson’s disease"

    Article Title: Altered machinery of protein synthesis is region- and stage-dependent and is associated with α-synuclein oligomers in Parkinson’s disease

    Journal: Acta Neuropathologica Communications

    doi: 10.1186/s40478-015-0257-4

    Altered mRNA expression levels of 16 ribosomal proteins in the angular gyrus in middle-aged (MA) and PD cases determined by TaqMan PCR assays using GUS-β for normalization. Student’s t test * p
    Figure Legend Snippet: Altered mRNA expression levels of 16 ribosomal proteins in the angular gyrus in middle-aged (MA) and PD cases determined by TaqMan PCR assays using GUS-β for normalization. Student’s t test * p

    Techniques Used: Expressing, Polymerase Chain Reaction

    Altered mRNA expression levels of 16 ribosomal proteins in the precuneus in middle-aged (MA) and PD cases determined by TaqMan PCR assays using GUS-β for normalization. Student’s t test * p
    Figure Legend Snippet: Altered mRNA expression levels of 16 ribosomal proteins in the precuneus in middle-aged (MA) and PD cases determined by TaqMan PCR assays using GUS-β for normalization. Student’s t test * p

    Techniques Used: Expressing, Polymerase Chain Reaction

    Altered mRNA expression levels of nucleolar proteins nucleophosmin ( NPM1/B23 ), nucleoplasmin 3 ( NPM3 ), nucleolin ( NCL ), and upstream binding transcription factor ( UBTF ) in the substantia nigra, frontal cortex area 8, and angular gyrus in middle-aged (MA) and PD as determined by TaqMan PCR assays using GUS-β for normalization. Reduced expression of NPM1 and UBTF mRNAs is found in the substantia nigra at stages 3–4, but reduced NPM1 , NPM3 , NCL, and UBTF expression levels are found at stages 5–6. Only NPM1 and NCL mRNAs are decreased in the frontal cortex at advanced stages of the disease. UBTF gene expression is transiently decreased at stages 3–4 in the angular gyrus. Student’s t test * p
    Figure Legend Snippet: Altered mRNA expression levels of nucleolar proteins nucleophosmin ( NPM1/B23 ), nucleoplasmin 3 ( NPM3 ), nucleolin ( NCL ), and upstream binding transcription factor ( UBTF ) in the substantia nigra, frontal cortex area 8, and angular gyrus in middle-aged (MA) and PD as determined by TaqMan PCR assays using GUS-β for normalization. Reduced expression of NPM1 and UBTF mRNAs is found in the substantia nigra at stages 3–4, but reduced NPM1 , NPM3 , NCL, and UBTF expression levels are found at stages 5–6. Only NPM1 and NCL mRNAs are decreased in the frontal cortex at advanced stages of the disease. UBTF gene expression is transiently decreased at stages 3–4 in the angular gyrus. Student’s t test * p

    Techniques Used: Expressing, Binding Assay, Polymerase Chain Reaction

    Altered expression levels of rRNA28S and rRNA18S in substantia nigra, frontal cortex area 8, angular gyrus, precuneus, and putamen in middle-aged (MA) and PD as determined by TaqMan PCR assays using GUS-β for normalization. Student’s t test * p
    Figure Legend Snippet: Altered expression levels of rRNA28S and rRNA18S in substantia nigra, frontal cortex area 8, angular gyrus, precuneus, and putamen in middle-aged (MA) and PD as determined by TaqMan PCR assays using GUS-β for normalization. Student’s t test * p

    Techniques Used: Expressing, Polymerase Chain Reaction

    Altered mRNA expression levels of 16 ribosomal proteins in the frontal cortex area 8 in middle-aged (MA) and PD cases determined by TaqMan PCR assays using GUS-β for normalization. Student’s t test * p
    Figure Legend Snippet: Altered mRNA expression levels of 16 ribosomal proteins in the frontal cortex area 8 in middle-aged (MA) and PD cases determined by TaqMan PCR assays using GUS-β for normalization. Student’s t test * p

    Techniques Used: Expressing, Polymerase Chain Reaction

    Altered mRNA expression levels of 16 ribosomal proteins in the substantia nigra in middle-aged (MA) and PD cases determined by TaqMan PCR assays using GUS-β for normalization. Student’s t test * p
    Figure Legend Snippet: Altered mRNA expression levels of 16 ribosomal proteins in the substantia nigra in middle-aged (MA) and PD cases determined by TaqMan PCR assays using GUS-β for normalization. Student’s t test * p

    Techniques Used: Expressing, Polymerase Chain Reaction

    4) Product Images from "Functional Evolution of Influenza Virus NS1 Protein in Currently Circulating Human 2009 Pandemic H1N1 Viruses"

    Article Title: Functional Evolution of Influenza Virus NS1 Protein in Currently Circulating Human 2009 Pandemic H1N1 Viruses

    Journal: Journal of Virology

    doi: 10.1128/JVI.00721-17

    Induction of IFN and proinflammatory cytokine responses by pH1N1/NSs-wt, pH1N1/NSs-6mut, and pH1N1/NSs-3mut viruses. Human A549 cells were infected (MOI = 5) with the pH1N1/NSs-wt, pH1N1/NSs-6mut, or pH1N1/NSs-3mut virus. (A, B, D, and E) At 12 hpi, the levels of mRNAs for IFN-β (A), IFIT2 (B), CXCL10 (D), and TNF (E) were determined by qRT-PCR, using specific TaqMan assays. Data represent the means and standard deviations for one representative experiment of three performed in triplicate. P values obtained using Student's t test are indicated. (C) TCS of previously infected A549 cells were collected and, after UV inactivation, were used to treat fresh A549 cells. After 24 h of incubation, cells were infected (MOI = 0.1) with the IFN-sensitive virus rVSV-GFP. At 16 hpi, GFP expression in rVSV-GFP-infected cells was quantified in a microplate reader. Experiments were repeated 3 times in triplicate wells, with similar results.
    Figure Legend Snippet: Induction of IFN and proinflammatory cytokine responses by pH1N1/NSs-wt, pH1N1/NSs-6mut, and pH1N1/NSs-3mut viruses. Human A549 cells were infected (MOI = 5) with the pH1N1/NSs-wt, pH1N1/NSs-6mut, or pH1N1/NSs-3mut virus. (A, B, D, and E) At 12 hpi, the levels of mRNAs for IFN-β (A), IFIT2 (B), CXCL10 (D), and TNF (E) were determined by qRT-PCR, using specific TaqMan assays. Data represent the means and standard deviations for one representative experiment of three performed in triplicate. P values obtained using Student's t test are indicated. (C) TCS of previously infected A549 cells were collected and, after UV inactivation, were used to treat fresh A549 cells. After 24 h of incubation, cells were infected (MOI = 0.1) with the IFN-sensitive virus rVSV-GFP. At 16 hpi, GFP expression in rVSV-GFP-infected cells was quantified in a microplate reader. Experiments were repeated 3 times in triplicate wells, with similar results.

    Techniques Used: Infection, Quantitative RT-PCR, Incubation, Expressing

    5) Product Images from "Targeting Sphingosine Kinase Isoforms Effectively Reduces Growth and Survival of Neoplastic Mast Cells With D816V-KIT"

    Article Title: Targeting Sphingosine Kinase Isoforms Effectively Reduces Growth and Survival of Neoplastic Mast Cells With D816V-KIT

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2018.00631

    Effects of SPHK1 and SPHK2 inhibition in the expression of cell cycle genes. (A) Relative changes in the mRNA levels of the indicated cyclins in HMC-1.2 after 24 h treatment with 5 µM SPHK1-I or 50 µM SPHK2-I. Changes in the expression of cyclins were initially determined using a RT 2 Profiler PCR Array and confirmed by Taqman gene expression assays. (B) Heat map of the canonical pathways affected by the treatment of HMC-1.2 with 5 µM SPHK1-I or 50 µM SPHK2-I for 24 h. Changes in expression of 84 genes involved in the cell cycle induced by SPHK1-I or SPHK2-I treatment were determined using a RT 2 Profiler PCR Array. Fold changes in the genes induced by either inhibitor were then analyzed using the ingenuity pathway analysis (IPA) with 1.5-fold as a cutoff. Shown is a comparison analysis done by IPA of the canonical pathways most significantly affected by either inhibitor and sorted by the activation Z score (blue: predicted inhibited and red: predicted activated). In bold, pathways related to DNA damage response cascade.
    Figure Legend Snippet: Effects of SPHK1 and SPHK2 inhibition in the expression of cell cycle genes. (A) Relative changes in the mRNA levels of the indicated cyclins in HMC-1.2 after 24 h treatment with 5 µM SPHK1-I or 50 µM SPHK2-I. Changes in the expression of cyclins were initially determined using a RT 2 Profiler PCR Array and confirmed by Taqman gene expression assays. (B) Heat map of the canonical pathways affected by the treatment of HMC-1.2 with 5 µM SPHK1-I or 50 µM SPHK2-I for 24 h. Changes in expression of 84 genes involved in the cell cycle induced by SPHK1-I or SPHK2-I treatment were determined using a RT 2 Profiler PCR Array. Fold changes in the genes induced by either inhibitor were then analyzed using the ingenuity pathway analysis (IPA) with 1.5-fold as a cutoff. Shown is a comparison analysis done by IPA of the canonical pathways most significantly affected by either inhibitor and sorted by the activation Z score (blue: predicted inhibited and red: predicted activated). In bold, pathways related to DNA damage response cascade.

    Techniques Used: Inhibition, Expressing, Polymerase Chain Reaction, Indirect Immunoperoxidase Assay, Activation Assay

    6) Product Images from "Functional and genomic characterisation of a xenograft model system for the study of metastasis in triple-negative breast cancer"

    Article Title: Functional and genomic characterisation of a xenograft model system for the study of metastasis in triple-negative breast cancer

    Journal: Disease Models & Mechanisms

    doi: 10.1242/dmm.032250

    Analysis of BMP4 and CST6 mRNA levels following treatment with demethylating agent and histone deacetylase inhibitor. (A) A CpG island (506 bp) spans the transcription start site of the human BMP4 gene. (B) Relative BMP4 mRNA levels in vehicle (DMSO)-treated 231_ATCC and 231_HM.LNm5 cells by TaqMan qRT-PCR. Expression in 231_ATCC was set to 1. Mean±s.d. ( n =3). (C) TaqMan qRT-PCR analysis of BMP4 mRNA expression levels in 5-Aza-2′-deoxycytidine (5azadC)- and Trichostatin A (TSA)-treated 231_ATCC and 231_HM.LNm5 cells. Expression in vehicle-treated cells was set to 1. Mean±s.d. ( n =3). (D) A CpG island (370 bp) spans the transcription start site of the human CST6 gene. (E) Relative CST6 mRNA levels in vehicle (DMSO)-treated 231_ATCC and 231_HM.LNm5 cells by TaqMan qRT-PCR. Expression in 231_ATCC was set to 1. Mean±s.d. ( n =3). (F) TaqMan qRT-PCR analysis of CST6 mRNA expression levels in 5azadC- and TSA-treated 231_ATCC and 231_HM.LNm5 cells. Expression in vehicle-treated cells was set to 1. Mean±s.d. ( n =3).
    Figure Legend Snippet: Analysis of BMP4 and CST6 mRNA levels following treatment with demethylating agent and histone deacetylase inhibitor. (A) A CpG island (506 bp) spans the transcription start site of the human BMP4 gene. (B) Relative BMP4 mRNA levels in vehicle (DMSO)-treated 231_ATCC and 231_HM.LNm5 cells by TaqMan qRT-PCR. Expression in 231_ATCC was set to 1. Mean±s.d. ( n =3). (C) TaqMan qRT-PCR analysis of BMP4 mRNA expression levels in 5-Aza-2′-deoxycytidine (5azadC)- and Trichostatin A (TSA)-treated 231_ATCC and 231_HM.LNm5 cells. Expression in vehicle-treated cells was set to 1. Mean±s.d. ( n =3). (D) A CpG island (370 bp) spans the transcription start site of the human CST6 gene. (E) Relative CST6 mRNA levels in vehicle (DMSO)-treated 231_ATCC and 231_HM.LNm5 cells by TaqMan qRT-PCR. Expression in 231_ATCC was set to 1. Mean±s.d. ( n =3). (F) TaqMan qRT-PCR analysis of CST6 mRNA expression levels in 5azadC- and TSA-treated 231_ATCC and 231_HM.LNm5 cells. Expression in vehicle-treated cells was set to 1. Mean±s.d. ( n =3).

    Techniques Used: Histone Deacetylase Assay, Quantitative RT-PCR, Expressing

    7) Product Images from "V?24-invariant NKT cells mediate antitumor activity via killing of tumor-associated macrophages"

    Article Title: V?24-invariant NKT cells mediate antitumor activity via killing of tumor-associated macrophages

    Journal: The Journal of Clinical Investigation

    doi: 10.1172/JCI37869

    TAMs express CD1d in primary neuroblastoma. ( A ) RNA expression of monocyte/macrophage markers was quantified in primary stage 4 MYCN non-amplified neuroblastomas ( n = 129) as a part of multi-gene TLDA analysis and plotted as ΔCt values. Samples with the highest and lowest levels of both gene expressions ( n = 10 per group, triangles) were labeled as TAM-high (low Ct values) and TAM-low (high Ct values) and used in B for quantification of CD1d RNA expression by TaqMan RT-PCR. Data are mean ± SD; P
    Figure Legend Snippet: TAMs express CD1d in primary neuroblastoma. ( A ) RNA expression of monocyte/macrophage markers was quantified in primary stage 4 MYCN non-amplified neuroblastomas ( n = 129) as a part of multi-gene TLDA analysis and plotted as ΔCt values. Samples with the highest and lowest levels of both gene expressions ( n = 10 per group, triangles) were labeled as TAM-high (low Ct values) and TAM-low (high Ct values) and used in B for quantification of CD1d RNA expression by TaqMan RT-PCR. Data are mean ± SD; P

    Techniques Used: RNA Expression, Amplification, TLDA Assay, Labeling, Reverse Transcription Polymerase Chain Reaction

    8) Product Images from "Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling"

    Article Title: Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling

    Journal: Cell Host & Microbe

    doi: 10.1016/j.chom.2018.10.007

    Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.
    Figure Legend Snippet: Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.

    Techniques Used: Expressing, Western Blot, Transduction, Plasmid Preparation, Infection, Real-time Polymerase Chain Reaction, Flow Cytometry, Cytometry, Fluorescence

    N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.
    Figure Legend Snippet: N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.

    Techniques Used: Expressing, Infection, Flow Cytometry, Cytometry, Fluorescence, Construct, Real-time Polymerase Chain Reaction, Plasmid Preparation

    9) Product Images from "Paradoxical effect of lenalidomide on cytokine/growth factor profiles in multiple myeloma"

    Article Title: Paradoxical effect of lenalidomide on cytokine/growth factor profiles in multiple myeloma

    Journal: British Journal of Cancer

    doi: 10.1038/bjc.2013.186

    Cytokine profile modifications in LEN-resistant cell lines obtained after long-term culture with increasing doses of LEN. ( A ) Cell cycle analysis of LP1-LR-resistant cell line. LP1-LR cells were cultured in RMPI-1640 with 5% foetal calf serum (FCS) in the presence or absence of LEN for 72 h. 5-Bromo-2′-deoxyuridine (BrdU) was incorporated into cells, which were then labelled with propidium iodide before cell cycle analysis by flow cytometry. One representative experiment is shown. ( B ) Cytokine and growth factor expression levels in resistant cell lines. The NCI-H929 10-4- and LP1-LR-resistant cell lines were cultured for 7 days without LEN before RNA extraction. The relative expression of the different mRNA was calculated according to the equation of Pfaffl and normalised to LP1. The TaqMan probe used for IL-8 mRNA detection was Hs 00174103-m1. Graphs represent the mean±s.d. of mRNA levels from two independent experiments performed in duplicate.
    Figure Legend Snippet: Cytokine profile modifications in LEN-resistant cell lines obtained after long-term culture with increasing doses of LEN. ( A ) Cell cycle analysis of LP1-LR-resistant cell line. LP1-LR cells were cultured in RMPI-1640 with 5% foetal calf serum (FCS) in the presence or absence of LEN for 72 h. 5-Bromo-2′-deoxyuridine (BrdU) was incorporated into cells, which were then labelled with propidium iodide before cell cycle analysis by flow cytometry. One representative experiment is shown. ( B ) Cytokine and growth factor expression levels in resistant cell lines. The NCI-H929 10-4- and LP1-LR-resistant cell lines were cultured for 7 days without LEN before RNA extraction. The relative expression of the different mRNA was calculated according to the equation of Pfaffl and normalised to LP1. The TaqMan probe used for IL-8 mRNA detection was Hs 00174103-m1. Graphs represent the mean±s.d. of mRNA levels from two independent experiments performed in duplicate.

    Techniques Used: Cell Cycle Assay, Cell Culture, Flow Cytometry, Cytometry, Expressing, RNA Extraction

    Lenalidomide modulates cytokines and IGF-1 profiles in myeloma cells. ( A ) Expression of TNF- α mRNA in myeloma cells and BMSC. ( B ) Modulation of TNF- α mRNA induced by LEN treatment in myeloma cells and BMSC. Human myeloma cell lines, primary CD138+ MM cells and BMSCs were incubated with or without 10 μ ℳ LEN for 24 h. Total RNA was extracted and reverse-transcribed as described previously. Tumour necrosis factor- α mRNA levels were evaluated by real-time PCR using the TaqMan probe Hs00174128-m1 (Applied Biosystem). The relative expression of TNF- α mRNA was calculated according to the equation of Pfaffl and normalised to LP1. Graphs represent the mean±s.d. of mRNA levels from two independent experiments performed in duplicate. ( C ) Increase of TNF- α production by LEN in myeloma cell lines. ( D ) Expression of IGF-1 mRNA in myeloma cells and BMSCs. ( E ) Increase in IGF-1 mRNA levels under LEN treatment. Insulin-like growth factor-1 mRNA levels were evaluated as above using the TaqMan gene expression assay Hs 00153126-m1. Graphs represent the mean±s.d. of mRNA levels from two independent experiments performed in duplicate.
    Figure Legend Snippet: Lenalidomide modulates cytokines and IGF-1 profiles in myeloma cells. ( A ) Expression of TNF- α mRNA in myeloma cells and BMSC. ( B ) Modulation of TNF- α mRNA induced by LEN treatment in myeloma cells and BMSC. Human myeloma cell lines, primary CD138+ MM cells and BMSCs were incubated with or without 10 μ ℳ LEN for 24 h. Total RNA was extracted and reverse-transcribed as described previously. Tumour necrosis factor- α mRNA levels were evaluated by real-time PCR using the TaqMan probe Hs00174128-m1 (Applied Biosystem). The relative expression of TNF- α mRNA was calculated according to the equation of Pfaffl and normalised to LP1. Graphs represent the mean±s.d. of mRNA levels from two independent experiments performed in duplicate. ( C ) Increase of TNF- α production by LEN in myeloma cell lines. ( D ) Expression of IGF-1 mRNA in myeloma cells and BMSCs. ( E ) Increase in IGF-1 mRNA levels under LEN treatment. Insulin-like growth factor-1 mRNA levels were evaluated as above using the TaqMan gene expression assay Hs 00153126-m1. Graphs represent the mean±s.d. of mRNA levels from two independent experiments performed in duplicate.

    Techniques Used: Expressing, Incubation, Real-time Polymerase Chain Reaction

    10) Product Images from "Lgr6 is a stem cell marker in mouse skin squamous carcinomas"

    Article Title: Lgr6 is a stem cell marker in mouse skin squamous carcinomas

    Journal: Nature genetics

    doi: 10.1038/ng.3957

    Lgr5 is expressed in rare single BCC cells but not in SCC cells / Lgr6, and not Lgr5, is an SCC CSC marker ( a ) Taqman analysis showing the expression of Lgr4-6 in a panel of BCC (Asz001), immortalised keratinocyte (C5N, NK), papilloma (P6), SCC (B9-2, E4) and spindle carcinoma (D3, H11, CarB) cell lines, and control normal back skin samples. Data are presented as mean ± s.e. n = 3. Arrow indicates Lgr5 expression in Asz001. ( b ) rt-PCR analysis showing the expression of Lgr4-6 in RNA extracted from a Asz001 sample (above) and a NK sample (below). Lgr4-6 multiplex in situ hybridisation was performed in Asz001 BCC cells. Repeat rt-PCR using biological replicates of Asz001 and NK samples shows the same results. ( c ), immortalised keratinocytes (C5N) ( d ) and E4 SCC cells ( e ). The Lgr4 (purple) expression pattern is shown in the left panel, while both Lgr5 (green) and Lgr6 (red) expression patterns are shown in the right panels. Yellow asterisks point to cells of interest in each cell line. ( f ) PCR-activated cell sorting (PACS) analysis of Lgr4-6 expression in dorsal back skin, NK cells, E4 SCC cells and Asz001 BCC cells, n=3. Scale bar = 50 µm.
    Figure Legend Snippet: Lgr5 is expressed in rare single BCC cells but not in SCC cells / Lgr6, and not Lgr5, is an SCC CSC marker ( a ) Taqman analysis showing the expression of Lgr4-6 in a panel of BCC (Asz001), immortalised keratinocyte (C5N, NK), papilloma (P6), SCC (B9-2, E4) and spindle carcinoma (D3, H11, CarB) cell lines, and control normal back skin samples. Data are presented as mean ± s.e. n = 3. Arrow indicates Lgr5 expression in Asz001. ( b ) rt-PCR analysis showing the expression of Lgr4-6 in RNA extracted from a Asz001 sample (above) and a NK sample (below). Lgr4-6 multiplex in situ hybridisation was performed in Asz001 BCC cells. Repeat rt-PCR using biological replicates of Asz001 and NK samples shows the same results. ( c ), immortalised keratinocytes (C5N) ( d ) and E4 SCC cells ( e ). The Lgr4 (purple) expression pattern is shown in the left panel, while both Lgr5 (green) and Lgr6 (red) expression patterns are shown in the right panels. Yellow asterisks point to cells of interest in each cell line. ( f ) PCR-activated cell sorting (PACS) analysis of Lgr4-6 expression in dorsal back skin, NK cells, E4 SCC cells and Asz001 BCC cells, n=3. Scale bar = 50 µm.

    Techniques Used: Marker, Expressing, Reverse Transcription Polymerase Chain Reaction, Multiplex Assay, In Situ, Hybridization, Polymerase Chain Reaction, FACS

    Lgr6 deficiency increases proliferation in the epidermis and leads to expanded Lgr6 lineage tracing into the epidermis Adult Lgr6 KD +/− mice were administered doxycycline water or vehicle for 10 days. The animals were then intraperitoneally injected with BrdU and skin samples were harvested 3 h later. ( a ) Cartoon depicting mechanism of Lgr6 knockdown induced by doxycycline treatment of Lgr6 KD +/− mice. In the absence of doxycycline, the tet repressor sits on the H1-tetO promoter 80 and prevents the transcription of the Lgr6 shRNA. In the presence of doxycycline, the tet repressor is bound by the drug and prevented from associating with the H1-tetO promoter; this in turn allows for the transcription of the Lgr6 shRNA. ( b ) Lgr4-6 mRNA levels in back skin samples were determined through Taqman analysis. ( c ) Top, example sections showing anti-BrdU immunofluorescence staining in back skin of Lgr6 KD +/− mice administered either vehicle (left) or doxycycline water (right). White arrowheads point to BrdU + cells. Quantitation of anti-BrdU staining in vehicle- or doxycycline-treated Lgr6 KD +/− mice was also performed with 20 different fields of skin sections examined for each mouse. n ≥ 5 mice in each treatment group for ( b ) and ( c ). ( d ) Adult Lgr6 KD +/− /Lgr6-EGFP-IRES-CreERT2 +/− /R26RLacZ +/− mice were administered either doxycycline water or vehicle. 10 days later, lineage tracing was induced with a topical dose of 4OHT; 7 days thereafter, skin samples were harvested and stained with X-Gal. ( d ) Representative sections showing X-Gal staining of skins from vehicle-treated (left) or doxycycline-treated (right) mice, n = 3 mice in each treatment group. ( e-g ) 20 different fields of skin sections were examined for each mouse to determine the number of traced cells per unit epidermal length ( e ), the number of Lgr6 clones per unit epidermal length ( f ) and the clone size distribution ( g ). Values lying further than 1.5 times the interquartile range in the box-and-whisker plots are plotted as dots. ( h ) A panel of normal and transformed epidermal cell lines was first transduced with an Lgr6 expression construct. Then, Lgr6 expression in these cells was either induced or left unperturbed through administering doxycycline or vehicle, respectively. After 2 days, Wnt activity was assessed using the TOPFlash luciferase reporter assay. n = 3. Adult Lgr6 +/+ and Lgr6 −/− mice were initiated with a single dose of DMBA, then biweekly treatments of TPA for 20 weeks. ( i ) Papilloma burden by Lgr6 genotype. Box-and-whisker plot depicting papilloma burden at 2 week intervals from week 10 to week 20 during DMBA/TPA mediated carcinogenesis. Mice are grouped and coloured by Lgr6 genotype. The Lgr6 +/+ group consisted of 19 mice, and the Lgr6 −/− group of 13 mice. Values lying further than 1.5 times the interquartile range are plotted as dots. Genotype is significantly associated with papilloma burden across all timepoints (p
    Figure Legend Snippet: Lgr6 deficiency increases proliferation in the epidermis and leads to expanded Lgr6 lineage tracing into the epidermis Adult Lgr6 KD +/− mice were administered doxycycline water or vehicle for 10 days. The animals were then intraperitoneally injected with BrdU and skin samples were harvested 3 h later. ( a ) Cartoon depicting mechanism of Lgr6 knockdown induced by doxycycline treatment of Lgr6 KD +/− mice. In the absence of doxycycline, the tet repressor sits on the H1-tetO promoter 80 and prevents the transcription of the Lgr6 shRNA. In the presence of doxycycline, the tet repressor is bound by the drug and prevented from associating with the H1-tetO promoter; this in turn allows for the transcription of the Lgr6 shRNA. ( b ) Lgr4-6 mRNA levels in back skin samples were determined through Taqman analysis. ( c ) Top, example sections showing anti-BrdU immunofluorescence staining in back skin of Lgr6 KD +/− mice administered either vehicle (left) or doxycycline water (right). White arrowheads point to BrdU + cells. Quantitation of anti-BrdU staining in vehicle- or doxycycline-treated Lgr6 KD +/− mice was also performed with 20 different fields of skin sections examined for each mouse. n ≥ 5 mice in each treatment group for ( b ) and ( c ). ( d ) Adult Lgr6 KD +/− /Lgr6-EGFP-IRES-CreERT2 +/− /R26RLacZ +/− mice were administered either doxycycline water or vehicle. 10 days later, lineage tracing was induced with a topical dose of 4OHT; 7 days thereafter, skin samples were harvested and stained with X-Gal. ( d ) Representative sections showing X-Gal staining of skins from vehicle-treated (left) or doxycycline-treated (right) mice, n = 3 mice in each treatment group. ( e-g ) 20 different fields of skin sections were examined for each mouse to determine the number of traced cells per unit epidermal length ( e ), the number of Lgr6 clones per unit epidermal length ( f ) and the clone size distribution ( g ). Values lying further than 1.5 times the interquartile range in the box-and-whisker plots are plotted as dots. ( h ) A panel of normal and transformed epidermal cell lines was first transduced with an Lgr6 expression construct. Then, Lgr6 expression in these cells was either induced or left unperturbed through administering doxycycline or vehicle, respectively. After 2 days, Wnt activity was assessed using the TOPFlash luciferase reporter assay. n = 3. Adult Lgr6 +/+ and Lgr6 −/− mice were initiated with a single dose of DMBA, then biweekly treatments of TPA for 20 weeks. ( i ) Papilloma burden by Lgr6 genotype. Box-and-whisker plot depicting papilloma burden at 2 week intervals from week 10 to week 20 during DMBA/TPA mediated carcinogenesis. Mice are grouped and coloured by Lgr6 genotype. The Lgr6 +/+ group consisted of 19 mice, and the Lgr6 −/− group of 13 mice. Values lying further than 1.5 times the interquartile range are plotted as dots. Genotype is significantly associated with papilloma burden across all timepoints (p

    Techniques Used: Mouse Assay, Injection, shRNA, Immunofluorescence, Staining, Quantitation Assay, BrdU Staining, Clone Assay, Whisker Assay, Transformation Assay, Transduction, Expressing, Construct, Activity Assay, Luciferase, Reporter Assay

    11) Product Images from "DNA methylation transcriptionally regulates the putative tumor cell growth suppressor ZNF677 in non-small cell lung cancers"

    Article Title: DNA methylation transcriptionally regulates the putative tumor cell growth suppressor ZNF677 in non-small cell lung cancers

    Journal: Oncotarget

    doi:

    ZNF677 expression and ZNF677 methylation in NHBECs and in NSCLC cells (A) ZNF677 expression was determined by RT-PCR using Taqman assays and normalised to GAPDH . (B) ZNF677 methylation determined by MS-HRM analyses in NHBECs and in 6 NSCLC cell lines. All NSCLC cell lines found to be negative for ZNF677 expression were found to be ZNF677 methylated. (C) A549, NCI-H1993, Calu6 and NCI-H2073 cells were treated with a combination of Aza-dC and TSA. ZNF677 expression was found to be upregulated in all drug treated cells determined by RT-PCR. The fold change in expression of drug treated cells compared to untreated cells is shown. (D) Results from BGS of a part of the ZNF677 5´ region in NHBECs and in A549, Calu6 and NCI-H2073 cells are demonstrated. Overall, 50 CpG sites (pink bars) were analysed for methylation. The transcription start site is shown as blue bar. Four clones per sample were sequenced. Black squares indicate methylated cytosines at CpG sites, white squares indicate unmethylated cytosines at CpG sites and grey squares indicate CpG sites which were not evaluable.
    Figure Legend Snippet: ZNF677 expression and ZNF677 methylation in NHBECs and in NSCLC cells (A) ZNF677 expression was determined by RT-PCR using Taqman assays and normalised to GAPDH . (B) ZNF677 methylation determined by MS-HRM analyses in NHBECs and in 6 NSCLC cell lines. All NSCLC cell lines found to be negative for ZNF677 expression were found to be ZNF677 methylated. (C) A549, NCI-H1993, Calu6 and NCI-H2073 cells were treated with a combination of Aza-dC and TSA. ZNF677 expression was found to be upregulated in all drug treated cells determined by RT-PCR. The fold change in expression of drug treated cells compared to untreated cells is shown. (D) Results from BGS of a part of the ZNF677 5´ region in NHBECs and in A549, Calu6 and NCI-H2073 cells are demonstrated. Overall, 50 CpG sites (pink bars) were analysed for methylation. The transcription start site is shown as blue bar. Four clones per sample were sequenced. Black squares indicate methylated cytosines at CpG sites, white squares indicate unmethylated cytosines at CpG sites and grey squares indicate CpG sites which were not evaluable.

    Techniques Used: Expressing, Methylation, Reverse Transcription Polymerase Chain Reaction, Mass Spectrometry, BGS-A, Clone Assay

    12) Product Images from "The Immune Response to Picornavirus Infection and the Effect of Immune Manipulation on Acute Seizures"

    Article Title: The Immune Response to Picornavirus Infection and the Effect of Immune Manipulation on Acute Seizures

    Journal: Journal of neurovirology

    doi: 10.1007/s13365-018-0636-2

    Time course of IL-6 gene expression in the brains of TMEV-infected mice. Brains were harvested at 6, 12, 18, 24, 48 and 72 hours post infection from TMEV-infected mice and at 72 hours post injection from mock-infected mice. Real time PCR for the detection of IL-6 was performed using TaqMan PCR as described in the Methods. Data are presented as the mean + SEM with 3 mice per group
    Figure Legend Snippet: Time course of IL-6 gene expression in the brains of TMEV-infected mice. Brains were harvested at 6, 12, 18, 24, 48 and 72 hours post infection from TMEV-infected mice and at 72 hours post injection from mock-infected mice. Real time PCR for the detection of IL-6 was performed using TaqMan PCR as described in the Methods. Data are presented as the mean + SEM with 3 mice per group

    Techniques Used: Expressing, Infection, Mouse Assay, Injection, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    Gene expression analysis of IL-6 (a) and TNF-α (b) in the hippocampi of TMEV-infected mice treated with control liposomes or clodronate-containing liposomes. Mice were treated with control or clodronate-containing liposomes as described in the Methods and hippocampi were harvested at days 2 and 3 post infection (6 mice per group). Real time PCR for the detection of IL-6 (a) and TNF-α (b) was performed using TaqMan PCR as described in the Methods. Fold changes were calculated using the ΔΔCT method, in which fold change data are represented as 2−ΔΔCT. Error bars depict the SEM ΔCT values
    Figure Legend Snippet: Gene expression analysis of IL-6 (a) and TNF-α (b) in the hippocampi of TMEV-infected mice treated with control liposomes or clodronate-containing liposomes. Mice were treated with control or clodronate-containing liposomes as described in the Methods and hippocampi were harvested at days 2 and 3 post infection (6 mice per group). Real time PCR for the detection of IL-6 (a) and TNF-α (b) was performed using TaqMan PCR as described in the Methods. Fold changes were calculated using the ΔΔCT method, in which fold change data are represented as 2−ΔΔCT. Error bars depict the SEM ΔCT values

    Techniques Used: Expressing, Infection, Mouse Assay, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction

    13) Product Images from "Enhanced beta cell proliferation in mice overexpressing a constitutively active form of Akt and one allele of p21Cip *"

    Article Title: Enhanced beta cell proliferation in mice overexpressing a constitutively active form of Akt and one allele of p21Cip *

    Journal: Diabetologia

    doi: 10.1007/s00125-012-2465-9

    Akt regulates p21 Cip levels by transcriptional regulation and protein stability. a Assessment of p21 Cip mRNA levels in MIN6 GFP and MIN6 caAkt cells using TaqMan RT-PCR. b p21 Cip mRNA stability assays from MIN6 and MIN6 caAkt cells treated with 5 μg/ml
    Figure Legend Snippet: Akt regulates p21 Cip levels by transcriptional regulation and protein stability. a Assessment of p21 Cip mRNA levels in MIN6 GFP and MIN6 caAkt cells using TaqMan RT-PCR. b p21 Cip mRNA stability assays from MIN6 and MIN6 caAkt cells treated with 5 μg/ml

    Techniques Used: Reverse Transcription Polymerase Chain Reaction

    14) Product Images from "Penetrance of Congenital Heart Disease in a Mouse Model of Down Syndrome Depends on a Trisomic Potentiator of a Disomic Modifier"

    Article Title: Penetrance of Congenital Heart Disease in a Mouse Model of Down Syndrome Depends on a Trisomic Potentiator of a Disomic Modifier

    Journal: Genetics

    doi: 10.1534/genetics.116.188045

    Real-time PCR showing the relative RNA expression level of Jam2 in mice with different genotypes. (A) TaqMan assay showed about 1.5-fold increase of Jam2 expression in Ts65Dn mice compared to WT. (B) TaqMan assay showed about 40% decrease of Jam2 expression
    Figure Legend Snippet: Real-time PCR showing the relative RNA expression level of Jam2 in mice with different genotypes. (A) TaqMan assay showed about 1.5-fold increase of Jam2 expression in Ts65Dn mice compared to WT. (B) TaqMan assay showed about 40% decrease of Jam2 expression

    Techniques Used: Real-time Polymerase Chain Reaction, RNA Expression, Mouse Assay, TaqMan Assay, Expressing

    15) Product Images from "IL-27 suppresses antimicrobial activity in human leprosy"

    Article Title: IL-27 suppresses antimicrobial activity in human leprosy

    Journal: The Journal of investigative dermatology

    doi: 10.1038/jid.2015.195

    IFN-β induces both IL-27 and IL-10. Total mRNA was isolated from L-lep (n=6), T-lep (n=10) and RR (n=7) skin lesions, and the (a) IL-27p28 and (b) IL-27 EBI3 mRNA levels were analyzed by microarray. (c) Correlation of IL-27p28 and IL-10 detected by microarray (arbitrary units (AU)). (d) No correlation was seen between IL-27 EBI3 and IL-10 by microarray (AU). (e) Total mRNA was isolated from L-lep (n=10), Tlep (n=10) and RR (n=10) skin lesions, IL-27p28 and IL-10 mRNA levels were analyzed by TaqMan qPCR. The levels of IL-27p28 were normalized to GAPDH levels in the same tissue. (f) Correlation between IL- 27p28 and IL-10 measured by qPCR. Statistical significance was calculated by One way ANOVA with Kruskal-Wallis post hoc analysis; **, p ≤ 0.01; *, p ≤ 0.05
    Figure Legend Snippet: IFN-β induces both IL-27 and IL-10. Total mRNA was isolated from L-lep (n=6), T-lep (n=10) and RR (n=7) skin lesions, and the (a) IL-27p28 and (b) IL-27 EBI3 mRNA levels were analyzed by microarray. (c) Correlation of IL-27p28 and IL-10 detected by microarray (arbitrary units (AU)). (d) No correlation was seen between IL-27 EBI3 and IL-10 by microarray (AU). (e) Total mRNA was isolated from L-lep (n=10), Tlep (n=10) and RR (n=10) skin lesions, IL-27p28 and IL-10 mRNA levels were analyzed by TaqMan qPCR. The levels of IL-27p28 were normalized to GAPDH levels in the same tissue. (f) Correlation between IL- 27p28 and IL-10 measured by qPCR. Statistical significance was calculated by One way ANOVA with Kruskal-Wallis post hoc analysis; **, p ≤ 0.01; *, p ≤ 0.05

    Techniques Used: Isolation, Microarray, Real-time Polymerase Chain Reaction

    16) Product Images from "Specific-detection of clinical samples, systematic functional investigations, and transcriptome analysis reveals that splice variant MUC4/Y contributes to the malignant progression of pancreatic cancer by triggering malignancy-related positive feedback loops signaling"

    Article Title: Specific-detection of clinical samples, systematic functional investigations, and transcriptome analysis reveals that splice variant MUC4/Y contributes to the malignant progression of pancreatic cancer by triggering malignancy-related positive feedback loops signaling

    Journal: Journal of Translational Medicine

    doi: 10.1186/s12967-014-0309-8

    MUC4/Y expression and subcellular localization in PANC-1 cells. (A) Real-time PCR using specific primers and TaqMan probe to examine MUC4/Y transcript expression in PANC-1-EV cells and PANC-1-MUC4/Y cells. The level of target gene expression in the PANC-1-MUC4/Y cells was 9912-fold and 9808-fold higher than that of the blank control and negative control, respectively. (B) Western blot confirmation of MUC4/Y protein expression. Total protein from cell extracts was resolved on precast gels. The signal was detected using an electrochemiluminescence reagent kit. (C) Immunofluorescence demonstrating MUC4/Y subcellular localization similar to that of wild-type MUC4. The pancreatic cancer cell lines of HPAC and BXPC-3 is MUC4 positive-expression as positive control for specific antibody.
    Figure Legend Snippet: MUC4/Y expression and subcellular localization in PANC-1 cells. (A) Real-time PCR using specific primers and TaqMan probe to examine MUC4/Y transcript expression in PANC-1-EV cells and PANC-1-MUC4/Y cells. The level of target gene expression in the PANC-1-MUC4/Y cells was 9912-fold and 9808-fold higher than that of the blank control and negative control, respectively. (B) Western blot confirmation of MUC4/Y protein expression. Total protein from cell extracts was resolved on precast gels. The signal was detected using an electrochemiluminescence reagent kit. (C) Immunofluorescence demonstrating MUC4/Y subcellular localization similar to that of wild-type MUC4. The pancreatic cancer cell lines of HPAC and BXPC-3 is MUC4 positive-expression as positive control for specific antibody.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Negative Control, Western Blot, Electrochemiluminescence, Immunofluorescence, Positive Control

    17) Product Images from "Molecular diversity in ductal carcinoma in situ (DCIS) and early invasive breast cancer), Molecular diversity in ductal carcinoma in situ (DCIS) and early invasive breast cancer"

    Article Title: Molecular diversity in ductal carcinoma in situ (DCIS) and early invasive breast cancer), Molecular diversity in ductal carcinoma in situ (DCIS) and early invasive breast cancer

    Journal: Molecular Oncology

    doi: 10.1016/j.molonc.2010.06.007

    Validation of microarray gene expression by real‐time PCR. A–D: Relative expression levels of genes identified by SAM; FOXA1, TRAF3IP3, HCST and CYP1B1, measured by TaqMan qRT‐PCR in 22 type II and 6 type I DCIS cases. E–G: Relative expression level of EMT‐related genes identified by SAM; SNAI1, S100A8 and CXCL1, measured by TaqMan qRT‐PCR in 22 DCIS type II and 6 DCIS type I cases. Black horizontal bars represent median value for each DCIS phenotype.
    Figure Legend Snippet: Validation of microarray gene expression by real‐time PCR. A–D: Relative expression levels of genes identified by SAM; FOXA1, TRAF3IP3, HCST and CYP1B1, measured by TaqMan qRT‐PCR in 22 type II and 6 type I DCIS cases. E–G: Relative expression level of EMT‐related genes identified by SAM; SNAI1, S100A8 and CXCL1, measured by TaqMan qRT‐PCR in 22 DCIS type II and 6 DCIS type I cases. Black horizontal bars represent median value for each DCIS phenotype.

    Techniques Used: Microarray, Expressing, Real-time Polymerase Chain Reaction, Quantitative RT-PCR

    18) Product Images from "Utilization of arsenic trioxide as a treatment of cisplatin-resistant non-small cell lung cancer PC-9/CDDP and PC-14/CDDP cells"

    Article Title: Utilization of arsenic trioxide as a treatment of cisplatin-resistant non-small cell lung cancer PC-9/CDDP and PC-14/CDDP cells

    Journal: Oncology Letters

    doi: 10.3892/ol.2015.3352

    Expression levels of ABCC transporter mRNA in PC-9/CDDP and PC-9 cell lines. The relative expression of ABCC transporter mRNA in PC-9 and PC-9/CDDP cells was determined by quantitative real-time polymerase chain reaction, which was performed using TaqMan probes. GAPDH mRNA was also quantified and used to normalize the mRNA levels of the transporters. Each bar represents the mean ± standard deviation of triplicate independent experiments. ABCC, adenosine triphosphate-binding cassette subfamily C; ABCC1-5, ABCC, members 1–5.
    Figure Legend Snippet: Expression levels of ABCC transporter mRNA in PC-9/CDDP and PC-9 cell lines. The relative expression of ABCC transporter mRNA in PC-9 and PC-9/CDDP cells was determined by quantitative real-time polymerase chain reaction, which was performed using TaqMan probes. GAPDH mRNA was also quantified and used to normalize the mRNA levels of the transporters. Each bar represents the mean ± standard deviation of triplicate independent experiments. ABCC, adenosine triphosphate-binding cassette subfamily C; ABCC1-5, ABCC, members 1–5.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Standard Deviation, Binding Assay

    19) Product Images from "HDAC1 and HDAC2 are Differentially Expressed in Endometriosis"

    Article Title: HDAC1 and HDAC2 are Differentially Expressed in Endometriosis

    Journal: Reproductive Sciences

    doi: 10.1177/1933719111432870

    Basal gene expression of class I histone deacetylases (HDACs) in human endometrial and endometriotic cell lines. Quantitative polymerase chain reaction (qPCR) quantification of class I HDACs (HDAC1 and HDAC2) was conducted using TaqMan gene expression
    Figure Legend Snippet: Basal gene expression of class I histone deacetylases (HDACs) in human endometrial and endometriotic cell lines. Quantitative polymerase chain reaction (qPCR) quantification of class I HDACs (HDAC1 and HDAC2) was conducted using TaqMan gene expression

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    20) Product Images from "Integrated analysis of microRNA and mRNA expression profiles in physiological myelopoiesis: role of hsa-mir-299-5p in CD34+ progenitor cells commitment"

    Article Title: Integrated analysis of microRNA and mRNA expression profiles in physiological myelopoiesis: role of hsa-mir-299-5p in CD34+ progenitor cells commitment

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2010.5

    Anti-miRNA inhibitor molecule transfections. ( a ) TaqMan real-time PCR evaluation of mature hsa-miR-299-5p microRNA expression after 24, 72 and 96 h of cell culture in the presence of TPO (100 ng/ml). Data were obtained using as calibrator the RNA of the same sample extracted immediately after CD34 HPC purification and RNU6b as endogenous control. Cells were electroporated with hsa-miR-299-5p inhibitor after 3 days of culture. ( b ) TaqMan real-time PCR mature hsa-miR-299-5p expression after single transient transfection of its inhibitor molecule, through single nucleoporation with the Amaxa Nucleofector device. Expression withdrawal was monitored after one and ten days from nucleofection. Data were obtained using as calibrator the nucleofection solution-treated sample (nuc) and RNU6b as endogenous control. ( c ) Colony-forming capacity of HPCs transfected with hsa-miR-299-5p Anti-miR miRNA inhibitor (anti-299-5p), compared with Anti-miR miRNA inhibitor-negative control #1 (anti-NC1)-transfected cells and cells electroporated with the nucleofection solution only (nuc). Mean±S.D. from three independent experiments. Asterisk indicates a t -test P -value⩽0.001. BFU-E: erythrocyte burst-forming unit; CFU-E: erythrocyte colony-forming unit; GM-CFU: granulo-monocyte colony-forming unit; G-CFU: granulocyte colony-forming unit; M-CFU: monocyte colony-forming unit; GEMM-CFU: granulocyte-erythrocyte-monocyte-macrophage colony-forming unit. ( d ) Megakaryocytic colony-forming capacity of HPCs transfected with hsa-miR-299-5p Anti-miR miRNA Inhibitor (anti-299-5p), compared with anti-miR miRNA inhibitor-negative control #1 (anti-NC1)-transfected cells and cells electroporated with the nucleofection solution only (nuc). Mean±S.D. from three independent experiments. Asterisk indicates a t -test P -value⩽0.001
    Figure Legend Snippet: Anti-miRNA inhibitor molecule transfections. ( a ) TaqMan real-time PCR evaluation of mature hsa-miR-299-5p microRNA expression after 24, 72 and 96 h of cell culture in the presence of TPO (100 ng/ml). Data were obtained using as calibrator the RNA of the same sample extracted immediately after CD34 HPC purification and RNU6b as endogenous control. Cells were electroporated with hsa-miR-299-5p inhibitor after 3 days of culture. ( b ) TaqMan real-time PCR mature hsa-miR-299-5p expression after single transient transfection of its inhibitor molecule, through single nucleoporation with the Amaxa Nucleofector device. Expression withdrawal was monitored after one and ten days from nucleofection. Data were obtained using as calibrator the nucleofection solution-treated sample (nuc) and RNU6b as endogenous control. ( c ) Colony-forming capacity of HPCs transfected with hsa-miR-299-5p Anti-miR miRNA inhibitor (anti-299-5p), compared with Anti-miR miRNA inhibitor-negative control #1 (anti-NC1)-transfected cells and cells electroporated with the nucleofection solution only (nuc). Mean±S.D. from three independent experiments. Asterisk indicates a t -test P -value⩽0.001. BFU-E: erythrocyte burst-forming unit; CFU-E: erythrocyte colony-forming unit; GM-CFU: granulo-monocyte colony-forming unit; G-CFU: granulocyte colony-forming unit; M-CFU: monocyte colony-forming unit; GEMM-CFU: granulocyte-erythrocyte-monocyte-macrophage colony-forming unit. ( d ) Megakaryocytic colony-forming capacity of HPCs transfected with hsa-miR-299-5p Anti-miR miRNA Inhibitor (anti-299-5p), compared with anti-miR miRNA inhibitor-negative control #1 (anti-NC1)-transfected cells and cells electroporated with the nucleofection solution only (nuc). Mean±S.D. from three independent experiments. Asterisk indicates a t -test P -value⩽0.001

    Techniques Used: Transfection, Real-time Polymerase Chain Reaction, Expressing, Cell Culture, Purification, Negative Control

    Pre-miR miRNA Precursor Molecule transfections. ( a ) TaqMan real-time PCR of mature hsa-miR-299-5p expression after single transient transfection of its precursor molecule through the Amaxa Nucleofector device. Hsa-miR-299-5p expression was monitored at different time points during in vitro culture using the nucleofection solution-treated sample (nuc) as calibrator and RNU6b as endogenous control. ( b ) Cytofluorimetric evaluation of the differentiation surface markers' expression: CD235a for erythroid differentiation, CD41a as indicator of megakaryocytic commitment, CD14 distinguishing monocytic differentiation and CD66b reflecting granulocytic cell fate. The surface markers' expression was checked after seven days of culture and each bar represents the fold change of the percentage of positivity normalized onto the pre-miR miRNA precursor molecule-negative control # 1 (NC1)-treated sample. Asterisk indicates a t -test P -value ⩽0.001. ( c ) Colony-forming capacity of HPCs transfected with pre-miR miRNA precursor molecule (299-5p), when compared with Pre-miR miRNA Precursor molecule-negative control # 1 (NC1)-transfected cells and with cells electroporated with the nucleofection solution only (nuc). Mean±S.D. from four independent experiments. BFU-E: erythrocyte burst-forming unit; CFU-E: erythrocyte colony-forming unit; GM-CFU: granulo-monocyte colony-forming unit; G-CFU: granulocyte colony-forming unit; M-CFU: monocyte colony-forming unit; GEMM-CFU: granulocyte-erythrocyte-monocyte-macrophage colony-forming unit. Asterisk indicates a t -test P -value ⩽0.001. ( d ) Megakaryocytic colony-forming capacity of HPCs transfected with pre-miR miRNA precursor molecule (299-5p), when compared with pre-miR miRNA precursor molecule-negative control # 1 (NC1)-transfected cells and cells electroporated with the nucleofection solution only (nuc). Mean±S.D. from four independent experiments. Asterisk indicates a t -test P -value ⩽0.001
    Figure Legend Snippet: Pre-miR miRNA Precursor Molecule transfections. ( a ) TaqMan real-time PCR of mature hsa-miR-299-5p expression after single transient transfection of its precursor molecule through the Amaxa Nucleofector device. Hsa-miR-299-5p expression was monitored at different time points during in vitro culture using the nucleofection solution-treated sample (nuc) as calibrator and RNU6b as endogenous control. ( b ) Cytofluorimetric evaluation of the differentiation surface markers' expression: CD235a for erythroid differentiation, CD41a as indicator of megakaryocytic commitment, CD14 distinguishing monocytic differentiation and CD66b reflecting granulocytic cell fate. The surface markers' expression was checked after seven days of culture and each bar represents the fold change of the percentage of positivity normalized onto the pre-miR miRNA precursor molecule-negative control # 1 (NC1)-treated sample. Asterisk indicates a t -test P -value ⩽0.001. ( c ) Colony-forming capacity of HPCs transfected with pre-miR miRNA precursor molecule (299-5p), when compared with Pre-miR miRNA Precursor molecule-negative control # 1 (NC1)-transfected cells and with cells electroporated with the nucleofection solution only (nuc). Mean±S.D. from four independent experiments. BFU-E: erythrocyte burst-forming unit; CFU-E: erythrocyte colony-forming unit; GM-CFU: granulo-monocyte colony-forming unit; G-CFU: granulocyte colony-forming unit; M-CFU: monocyte colony-forming unit; GEMM-CFU: granulocyte-erythrocyte-monocyte-macrophage colony-forming unit. Asterisk indicates a t -test P -value ⩽0.001. ( d ) Megakaryocytic colony-forming capacity of HPCs transfected with pre-miR miRNA precursor molecule (299-5p), when compared with pre-miR miRNA precursor molecule-negative control # 1 (NC1)-transfected cells and cells electroporated with the nucleofection solution only (nuc). Mean±S.D. from four independent experiments. Asterisk indicates a t -test P -value ⩽0.001

    Techniques Used: Transfection, Real-time Polymerase Chain Reaction, Expressing, In Vitro, Negative Control

    MicroRNAs oppositely regulated during myeloid differentiation. Twenty-three microRNAs (indicated with the prefix miR-) show either up- or downregulation greater than four in at least one precursor population when compared with the CD34 HPCs; 17 showed a significant increased expression with an RQ higher than four, 15 a significant decreased expression with an RQ lower than −4 and concomitantly a counter-regulation in at least one other precursor cell context. TaqMan real-time PCR reactions were carried out using the TaqMan MicroRNA Assays Human Panel Early Access Kit. Delta-delta-CTs and RQs were calculated for each detector using the CD34 HPC sample as the calibrator and hsa-miR-let-7a as the endogenous control
    Figure Legend Snippet: MicroRNAs oppositely regulated during myeloid differentiation. Twenty-three microRNAs (indicated with the prefix miR-) show either up- or downregulation greater than four in at least one precursor population when compared with the CD34 HPCs; 17 showed a significant increased expression with an RQ higher than four, 15 a significant decreased expression with an RQ lower than −4 and concomitantly a counter-regulation in at least one other precursor cell context. TaqMan real-time PCR reactions were carried out using the TaqMan MicroRNA Assays Human Panel Early Access Kit. Delta-delta-CTs and RQs were calculated for each detector using the CD34 HPC sample as the calibrator and hsa-miR-let-7a as the endogenous control

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    21) Product Images from "MicroRNA-224 is associated with colorectal cancer progression and response to 5-fluorouracil-based chemotherapy by KRAS-dependent and -independent mechanisms"

    Article Title: MicroRNA-224 is associated with colorectal cancer progression and response to 5-fluorouracil-based chemotherapy by KRAS-dependent and -independent mechanisms

    Journal: British Journal of Cancer

    doi: 10.1038/bjc.2015.125

    Identification of miRNAs differentially expressed in isogeneic KRAS WT and mutant HCT116 colorectal cell lines. qRT–PCR analysis (TaqMan low-density array A cards, n =377 unique miRNA targets) was used, as described in Materials and Methods, to identify miRNAs differentially expressed in isogeneic KRAS WT and mutant HCT116 colorectal cell lines. ( A ) Heatmap summarising differentially expressed miRNAs, highlighting miR-224 (*), the expression of which was also increased in both colorectal adenomas and colorectal cancers ( Figure 1B ). qRT–PCR analysis was also used to confirm increased miR-224 expression in ( B ) KRAS WT HCT116 colorectal cancer cells, ( C ) colorectal cancers relative to normal mucosae ( n =12) and ( D ) an extended colorectal cancer series ( n =41) subdivided according to KRAS and BRAF genotype, using an independent TaqMan small RNA assay, as described in Materials and Methods. MicroRNA-224 expression is illustrated relative to the expression of the invariant miRNA let-7a; all samples were analysed in triplicate, with experimental errors calculated as previously described ( Smith et al , 2012 ).
    Figure Legend Snippet: Identification of miRNAs differentially expressed in isogeneic KRAS WT and mutant HCT116 colorectal cell lines. qRT–PCR analysis (TaqMan low-density array A cards, n =377 unique miRNA targets) was used, as described in Materials and Methods, to identify miRNAs differentially expressed in isogeneic KRAS WT and mutant HCT116 colorectal cell lines. ( A ) Heatmap summarising differentially expressed miRNAs, highlighting miR-224 (*), the expression of which was also increased in both colorectal adenomas and colorectal cancers ( Figure 1B ). qRT–PCR analysis was also used to confirm increased miR-224 expression in ( B ) KRAS WT HCT116 colorectal cancer cells, ( C ) colorectal cancers relative to normal mucosae ( n =12) and ( D ) an extended colorectal cancer series ( n =41) subdivided according to KRAS and BRAF genotype, using an independent TaqMan small RNA assay, as described in Materials and Methods. MicroRNA-224 expression is illustrated relative to the expression of the invariant miRNA let-7a; all samples were analysed in triplicate, with experimental errors calculated as previously described ( Smith et al , 2012 ).

    Techniques Used: Mutagenesis, Quantitative RT-PCR, TLDA Assay, Expressing

    22) Product Images from "Gene expression profiling of substantia nigra dopamine neurons: further insights into Parkinson's disease pathology"

    Article Title: Gene expression profiling of substantia nigra dopamine neurons: further insights into Parkinson's disease pathology

    Journal:

    doi: 10.1093/brain/awn323

    Validation of gene expression using TaqMan® real-time PCR on three control and three Parkinson's disease samples (). The following genes were selected: tyrosine hydroxylase (TH), dopamine transporter (DAT), Girk2 (KCNJ6), SNCA (PARK1),
    Figure Legend Snippet: Validation of gene expression using TaqMan® real-time PCR on three control and three Parkinson's disease samples (). The following genes were selected: tyrosine hydroxylase (TH), dopamine transporter (DAT), Girk2 (KCNJ6), SNCA (PARK1),

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction

    TaqMan® real-time PCR assay validation
    Figure Legend Snippet: TaqMan® real-time PCR assay validation

    Techniques Used: Real-time Polymerase Chain Reaction

    23) Product Images from "MicroRNA-101 negatively regulates Ezh2 and its expression is modulated by androgen receptor and HIF-1?/HIF-1?"

    Article Title: MicroRNA-101 negatively regulates Ezh2 and its expression is modulated by androgen receptor and HIF-1?/HIF-1?

    Journal: Molecular Cancer

    doi: 10.1186/1476-4598-9-108

    Analysis of miR-101 and miR-26a expression in prostate cancer cell lines . RT-PCR was conducted using RNAs extracted individually from PWR-1E, LNCaP, DU-145 and PC-3 cells with a stem-loop primer specific to miR-101 or miR-26a. The generated cDNAs were subjected to further analysis by Taqman Real-Time PCR using FAM-labeled miR-101 or miR-26a probes (Applied BioSystems). Each sample was analyzed in triplicates. The data are presented as an average of two experiments and normalized to the expression of the endogenous U6 RNA using the ΔΔC T method [ 28 ] as described in Materials and Methods. Student T-test was used to determine statistical significance and the asterisks indicate that the p values are not higher than 0.05.
    Figure Legend Snippet: Analysis of miR-101 and miR-26a expression in prostate cancer cell lines . RT-PCR was conducted using RNAs extracted individually from PWR-1E, LNCaP, DU-145 and PC-3 cells with a stem-loop primer specific to miR-101 or miR-26a. The generated cDNAs were subjected to further analysis by Taqman Real-Time PCR using FAM-labeled miR-101 or miR-26a probes (Applied BioSystems). Each sample was analyzed in triplicates. The data are presented as an average of two experiments and normalized to the expression of the endogenous U6 RNA using the ΔΔC T method [ 28 ] as described in Materials and Methods. Student T-test was used to determine statistical significance and the asterisks indicate that the p values are not higher than 0.05.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Generated, Real-time Polymerase Chain Reaction, Labeling

    24) Product Images from "Ropinirole alters gene expression profiles in SH-SY5Y cells: a whole genome microarray study"

    Article Title: Ropinirole alters gene expression profiles in SH-SY5Y cells: a whole genome microarray study

    Journal: Brazilian Journal of Medical and Biological Research

    doi: 10.1590/1414-431X20154857

    TaqMan¯ real-time PCR confirmation of microarray data in SH-SY5Y cells. CALM3 , EPS15 , RIPK5 , and PIK3C2B underwent TaqMan real-time PCR in SH-SY5Y cells. The y-axis represents the fold-change in expression after ROP treatment, and microarray and TaqMan data are plotted on the x-axis. There were no significant differences between the microarray and TaqMan data (P > 0.05; Student's t- test).
    Figure Legend Snippet: TaqMan¯ real-time PCR confirmation of microarray data in SH-SY5Y cells. CALM3 , EPS15 , RIPK5 , and PIK3C2B underwent TaqMan real-time PCR in SH-SY5Y cells. The y-axis represents the fold-change in expression after ROP treatment, and microarray and TaqMan data are plotted on the x-axis. There were no significant differences between the microarray and TaqMan data (P > 0.05; Student's t- test).

    Techniques Used: Real-time Polymerase Chain Reaction, Microarray, Expressing

    Validation of microarray data in HeLa cells. A , CALM3 , EPS15 , RIPK5 , and PIK3C2B underwent TaqMan ¯ real-time PCR in HeLa cells. The y-axis represents the fold-change in expression after ROP treatment, and microarray and TaqMan data are plotted on the x-axis. *P
    Figure Legend Snippet: Validation of microarray data in HeLa cells. A , CALM3 , EPS15 , RIPK5 , and PIK3C2B underwent TaqMan ¯ real-time PCR in HeLa cells. The y-axis represents the fold-change in expression after ROP treatment, and microarray and TaqMan data are plotted on the x-axis. *P

    Techniques Used: Microarray, Real-time Polymerase Chain Reaction, Expressing

    25) Product Images from "MicroRNA-1908-5p contributes to the oncogenic function of the splicing factor SRSF3"

    Article Title: MicroRNA-1908-5p contributes to the oncogenic function of the splicing factor SRSF3

    Journal: Oncotarget

    doi: 10.18632/oncotarget.14184

    Knockdown of SRSF3 decreased the expression of miR-1908 and its host gene, FADS1 A . Microarray data showing decreased expression of FADS1 in SRSF3-silenced U2OS cells with three different siRNAs. B . U2OS cells were transfected with control (CTRL) or SRSF3-specific siRNA for 48 h and then the expression level of FADS1 mRNA was determined by RT-qPCR analysis. C-D . The levels of pri-miR-1908 and mature miR-1908-3p/5p were assessed by RT-qPCR analysis using pri-miR-1908-specific primers and TaqMan miRNA primers, respectively. E . Cells were transfected with control (CTRL) or FADS1-specific siRNA for 48 h and then the levels of pri-miR-1908 and mature miR-1908-3p/5p were assessed by RT-qPCR as described above. F . Cells were transfected with control (CTRL) or Sp1-specific siRNA for 48 h. The expression level of FADS1 mRNA was determined by RT-qPCR analysis and the levels of pri-miR-1908 and mature miR-1908 (3p/5p) were assessed by RT-qPCR analysis as described above. All experiments are performed more than three times and data represent the mean ± S.D. Asterisk (*) indicates statistical significance of p
    Figure Legend Snippet: Knockdown of SRSF3 decreased the expression of miR-1908 and its host gene, FADS1 A . Microarray data showing decreased expression of FADS1 in SRSF3-silenced U2OS cells with three different siRNAs. B . U2OS cells were transfected with control (CTRL) or SRSF3-specific siRNA for 48 h and then the expression level of FADS1 mRNA was determined by RT-qPCR analysis. C-D . The levels of pri-miR-1908 and mature miR-1908-3p/5p were assessed by RT-qPCR analysis using pri-miR-1908-specific primers and TaqMan miRNA primers, respectively. E . Cells were transfected with control (CTRL) or FADS1-specific siRNA for 48 h and then the levels of pri-miR-1908 and mature miR-1908-3p/5p were assessed by RT-qPCR as described above. F . Cells were transfected with control (CTRL) or Sp1-specific siRNA for 48 h. The expression level of FADS1 mRNA was determined by RT-qPCR analysis and the levels of pri-miR-1908 and mature miR-1908 (3p/5p) were assessed by RT-qPCR analysis as described above. All experiments are performed more than three times and data represent the mean ± S.D. Asterisk (*) indicates statistical significance of p

    Techniques Used: Expressing, Microarray, Transfection, Quantitative RT-PCR

    NF-κB is involved in SRSF3-regulated miR-1908 expression A . U2OS cells were transfected with control (CTRL) or SRSF3-specific siRNA. Transfected cells were resuspended into 12-well plates and then transfected with the NF-κB reporter vector. Transactivation of NF-κB was assessed by calculating the luciferase activity. B . To check whether NF-κB regulates the expression of miR-1908, cells were treated with the NF-κB-specific inhibitor BAY11-7082 (10 μM) for 24 h. The level of miR-1908-3p/5p was determined by RT-qPCR analysis using TaqMan primers. C . Cells were transfected with control (CTRL) or SRSF3-specific siRNA for 48 h and then whole cell lysates were prepared. Western blot analyses were performed using adequate specific antibodies. D . Cells were transfected as described above and then cellular fractionation was performed. Western blot analysis was performed to determine the localization of NF-κB (p65) and α-tubulin and lamin B was checked for cytoplasmic and nuclear markers, respectively. E-F . Cells were transfected with control (CTRL) or TAK1-specific siRNA and then the levels of TAK1 and phosphorylated IKKα/β and NF-κB were assessed by Western blot analysis. The level of miR-1908-5p was determined by RT-qPCR analysis. G-H . The protein and mRNA expression levels of NF-κB target genes including HIF1-α, cyclin D1, and slug, were determined by western blot and RT-qPCR analysis, respectively. All experiments are performed more than three times and data represent the mean ± S.D. Asterisk (*) indicates statistical significance of p
    Figure Legend Snippet: NF-κB is involved in SRSF3-regulated miR-1908 expression A . U2OS cells were transfected with control (CTRL) or SRSF3-specific siRNA. Transfected cells were resuspended into 12-well plates and then transfected with the NF-κB reporter vector. Transactivation of NF-κB was assessed by calculating the luciferase activity. B . To check whether NF-κB regulates the expression of miR-1908, cells were treated with the NF-κB-specific inhibitor BAY11-7082 (10 μM) for 24 h. The level of miR-1908-3p/5p was determined by RT-qPCR analysis using TaqMan primers. C . Cells were transfected with control (CTRL) or SRSF3-specific siRNA for 48 h and then whole cell lysates were prepared. Western blot analyses were performed using adequate specific antibodies. D . Cells were transfected as described above and then cellular fractionation was performed. Western blot analysis was performed to determine the localization of NF-κB (p65) and α-tubulin and lamin B was checked for cytoplasmic and nuclear markers, respectively. E-F . Cells were transfected with control (CTRL) or TAK1-specific siRNA and then the levels of TAK1 and phosphorylated IKKα/β and NF-κB were assessed by Western blot analysis. The level of miR-1908-5p was determined by RT-qPCR analysis. G-H . The protein and mRNA expression levels of NF-κB target genes including HIF1-α, cyclin D1, and slug, were determined by western blot and RT-qPCR analysis, respectively. All experiments are performed more than three times and data represent the mean ± S.D. Asterisk (*) indicates statistical significance of p

    Techniques Used: Expressing, Transfection, Plasmid Preparation, Luciferase, Activity Assay, Quantitative RT-PCR, Western Blot, Cell Fractionation

    26) Product Images from "CXCR3 modulates glial accumulation and activation in cuprizone-induced demyelination of the central nervous system"

    Article Title: CXCR3 modulates glial accumulation and activation in cuprizone-induced demyelination of the central nervous system

    Journal: Journal of Neuroinflammation

    doi: 10.1186/1742-2094-11-109

    Cuprizone intoxication induces a robust demyelination of different brain regions in wild type (WT) and CXCR3-/-mice. A . Sagittal brain sections of WT and CXCR3-/- were analyzed for the degree of (de-)myelination at regions of the corpus callosum (Cc), thalamus (Th) and cerebellum (Cb) using immunofluorescence detection for myelin basic protein (MBP) and Luxol fast blue staining (LFB, bright field). Cuprizone-fed mice showed decreased MBP + fluorescence signal in the frontal corpus callosum (Cc), thalamus (Th) and the nucleus of the cerebellum (Cb) in WT and CXCR3-/- mice after 5 weeks. No significant differences in the degree of demyelination were visible between WT and CXCR3-/- mice after LFB stainings. Pictures are representative of 4 to 5 mice per group at each location and condition. B . Quantification for Mbp, Plp1 and Cnp transcripts using TaqMan assays document equal level in WT and CXCR3-/- mice at all dissected time points of the experiment. The most rapid drop of myelinogenic gene expression has been documented at the acute stage of demyelination after 3 weeks of cuprizone diet. Upregulation of the level of myelinogenic transcripts were found after withdrawal of cuprizone for 4 days (5.5 weeks). Data represent mean ± SEM, n = 4 to 5 for each genotype and time point.
    Figure Legend Snippet: Cuprizone intoxication induces a robust demyelination of different brain regions in wild type (WT) and CXCR3-/-mice. A . Sagittal brain sections of WT and CXCR3-/- were analyzed for the degree of (de-)myelination at regions of the corpus callosum (Cc), thalamus (Th) and cerebellum (Cb) using immunofluorescence detection for myelin basic protein (MBP) and Luxol fast blue staining (LFB, bright field). Cuprizone-fed mice showed decreased MBP + fluorescence signal in the frontal corpus callosum (Cc), thalamus (Th) and the nucleus of the cerebellum (Cb) in WT and CXCR3-/- mice after 5 weeks. No significant differences in the degree of demyelination were visible between WT and CXCR3-/- mice after LFB stainings. Pictures are representative of 4 to 5 mice per group at each location and condition. B . Quantification for Mbp, Plp1 and Cnp transcripts using TaqMan assays document equal level in WT and CXCR3-/- mice at all dissected time points of the experiment. The most rapid drop of myelinogenic gene expression has been documented at the acute stage of demyelination after 3 weeks of cuprizone diet. Upregulation of the level of myelinogenic transcripts were found after withdrawal of cuprizone for 4 days (5.5 weeks). Data represent mean ± SEM, n = 4 to 5 for each genotype and time point.

    Techniques Used: Mouse Assay, Immunofluorescence, Staining, Fluorescence, Expressing

    Substantially reduced transcripts for proinflammatory cytokines and chemokines in CXCR3-/- brains. Total RNA was isolated from freshly prepared brain homogenates using Trizol before cDNA was synthesized using Superscript III enzyme. TaqMan gene expression assays revealed a strongly reduction of various inflammatory transcripts after three weeks of cuprizone diet in CXCR3-deficient brain. Note the early induction of Cxcl9, Cxcl10, Ccl5 and Ccl2 mRNA expression levels after three weeks of cuprizone diet, correlating with the high levels of Tnf, Il6 and Ifng in WT brains. In contrast, in CXCR3-/- brains, transcript levels only slightly increased compared to control levels (0 weeks). Values were normalized against a housekeeping gene Gapdh (* P
    Figure Legend Snippet: Substantially reduced transcripts for proinflammatory cytokines and chemokines in CXCR3-/- brains. Total RNA was isolated from freshly prepared brain homogenates using Trizol before cDNA was synthesized using Superscript III enzyme. TaqMan gene expression assays revealed a strongly reduction of various inflammatory transcripts after three weeks of cuprizone diet in CXCR3-deficient brain. Note the early induction of Cxcl9, Cxcl10, Ccl5 and Ccl2 mRNA expression levels after three weeks of cuprizone diet, correlating with the high levels of Tnf, Il6 and Ifng in WT brains. In contrast, in CXCR3-/- brains, transcript levels only slightly increased compared to control levels (0 weeks). Values were normalized against a housekeeping gene Gapdh (* P

    Techniques Used: Isolation, Synthesized, Expressing

    27) Product Images from "Distinct molecular mechanisms underlying clinically relevant subtypes of breast cancer: gene expression analyses across three different platforms"

    Article Title: Distinct molecular mechanisms underlying clinically relevant subtypes of breast cancer: gene expression analyses across three different platforms

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-7-127

    Validation of potential prognostic markers by Taqman ® assay-based real-time PCR . 85 marker genes including the minimal set of 54 genes identified to best distinguish the luminal A and the basal-like subtypes were validated by TaqMan ® Gene Expression assays. Profile correlation analysis showed the expression profile across the 20 tumor samples determined by the three microarray platforms and by TaqMan ® Gene Expression assays are highly correlated with median correlation coefficient R > 0.9 and a rate of good correlation (R > 0.8) of 81–88%.
    Figure Legend Snippet: Validation of potential prognostic markers by Taqman ® assay-based real-time PCR . 85 marker genes including the minimal set of 54 genes identified to best distinguish the luminal A and the basal-like subtypes were validated by TaqMan ® Gene Expression assays. Profile correlation analysis showed the expression profile across the 20 tumor samples determined by the three microarray platforms and by TaqMan ® Gene Expression assays are highly correlated with median correlation coefficient R > 0.9 and a rate of good correlation (R > 0.8) of 81–88%.

    Techniques Used: TaqMan Assay, Real-time Polymerase Chain Reaction, Marker, Expressing, Microarray

    28) Product Images from "Suppressors of Cytokine Signaling (SOCS)1 and SOCS3 Proteins Are Mediators of Interleukin-10 Modulation of Inflammatory Responses Induced by Chlamydia muridarum and Its Major Outer Membrane Protein (MOMP) in Mouse J774 Macrophages"

    Article Title: Suppressors of Cytokine Signaling (SOCS)1 and SOCS3 Proteins Are Mediators of Interleukin-10 Modulation of Inflammatory Responses Induced by Chlamydia muridarum and Its Major Outer Membrane Protein (MOMP) in Mouse J774 Macrophages

    Journal: Mediators of Inflammation

    doi: 10.1155/2020/7461742

    Impact of macrophage polarization on TNF expression, macrophage phenotypes as well as SOCS ratios in rMOMP cultures. Macrophages (10 6 /mL) were pre-incubated with IL-4 or IFN- γ (each at 10 ng/mL) for 1 h followed by stimulation with either Cm or its rMOMP in the presence and absence of IL-10 for an additional 24 h. Cell-free culture supernatants were collected to quantify TNF by ELISA (A-B). Macrophages were pre-incubated with IL-4, IL-10, IL-13, or IFN- γ for 1 h followed by stimulation with rMOMP for an additional 24 h. The mRNA gene transcripts for nos2, mrc1, socs1 and socs3 (C-E) were quantified via TaqMan qRT-PCR. An asterisk indicates significant differences ( P
    Figure Legend Snippet: Impact of macrophage polarization on TNF expression, macrophage phenotypes as well as SOCS ratios in rMOMP cultures. Macrophages (10 6 /mL) were pre-incubated with IL-4 or IFN- γ (each at 10 ng/mL) for 1 h followed by stimulation with either Cm or its rMOMP in the presence and absence of IL-10 for an additional 24 h. Cell-free culture supernatants were collected to quantify TNF by ELISA (A-B). Macrophages were pre-incubated with IL-4, IL-10, IL-13, or IFN- γ for 1 h followed by stimulation with rMOMP for an additional 24 h. The mRNA gene transcripts for nos2, mrc1, socs1 and socs3 (C-E) were quantified via TaqMan qRT-PCR. An asterisk indicates significant differences ( P

    Techniques Used: Expressing, Incubation, Enzyme-linked Immunosorbent Assay, Quantitative RT-PCR

    Skewing of the chlamydial M1 pro-inflammatory phenotype to an M2 anti-inflammatory phenotype by exogenous and endogenously produced IL-10. Macrophages (10 6 cells/mL) were stimulated with rMOMP (0.1, 1 and 10 μ g/mL) (A-C) or infected with Cm (MOI of 0.5, 1 and 2) (D-F) in the presence and absence of IL-10 (10 ng/mL). Macrophages were stimulated with rMOMP (1 μ g/mL; G-I) or Cm (MOI of 2; J-L) in the presence and absence of IL-10 (0.1, 1, and 10 ng/mL). At 24 h post-stimulation, the mRNA transcripts of the m1 marker; nos2 and m2 markers; arg1 and mrc1 were quantified using TaqMan qRT-PCR. The m1/m2 (M) and m2/m1 (N) ratios were calculated from macrophages exposed to rMOMP or Cm in the presence and absence of IL-10. Protein expressions of nos2 and mrc1 were evaluated from stimulated cells employing flow cytometry (O-T). Macrophages pre-incubated with neutralizing Abs to IL-10, IL-6, and TNF were stimulated with rMOMP or Cm for an additional 24 h. Normal rat IgG1 Ab served as the isotype control (ISO). Post-stimulation, RNA was isolated to quantify the gene transcripts of nos2 and mrc1 (U-X) by TaqMan qRT-PCR. An asterisk indicates significant differences ( P
    Figure Legend Snippet: Skewing of the chlamydial M1 pro-inflammatory phenotype to an M2 anti-inflammatory phenotype by exogenous and endogenously produced IL-10. Macrophages (10 6 cells/mL) were stimulated with rMOMP (0.1, 1 and 10 μ g/mL) (A-C) or infected with Cm (MOI of 0.5, 1 and 2) (D-F) in the presence and absence of IL-10 (10 ng/mL). Macrophages were stimulated with rMOMP (1 μ g/mL; G-I) or Cm (MOI of 2; J-L) in the presence and absence of IL-10 (0.1, 1, and 10 ng/mL). At 24 h post-stimulation, the mRNA transcripts of the m1 marker; nos2 and m2 markers; arg1 and mrc1 were quantified using TaqMan qRT-PCR. The m1/m2 (M) and m2/m1 (N) ratios were calculated from macrophages exposed to rMOMP or Cm in the presence and absence of IL-10. Protein expressions of nos2 and mrc1 were evaluated from stimulated cells employing flow cytometry (O-T). Macrophages pre-incubated with neutralizing Abs to IL-10, IL-6, and TNF were stimulated with rMOMP or Cm for an additional 24 h. Normal rat IgG1 Ab served as the isotype control (ISO). Post-stimulation, RNA was isolated to quantify the gene transcripts of nos2 and mrc1 (U-X) by TaqMan qRT-PCR. An asterisk indicates significant differences ( P

    Techniques Used: Produced, Infection, Marker, Quantitative RT-PCR, Flow Cytometry, Incubation, Isolation

    29) Product Images from "Functional Characterization of the Plasmacytoma Variant Translocation 1 Gene (PVT1) in Diabetic Nephropathy"

    Article Title: Functional Characterization of the Plasmacytoma Variant Translocation 1 Gene (PVT1) in Diabetic Nephropathy

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0018671

    Effect of glucose on expression of PVT1 , FN1 , and COL4A1 in normal human mesangial cells (MC). Prior to treatment with high glucose, MC, at approximately 70% confluence, were cultured in serum-free MsBM medium for 24 hours to arrest and synchronize cell growth. After this time period, MC were grown for 24, 48, 72 or 96 h in MsBM medium supplemented with 5% FBS, containing either normal glucose (NG; 5.6 mM), NG+3-O-methyl-D-glucose (3-O-MG) to control for osmotic effects (OC: 5.6 mM glucose+24.4 mM 3-O-MG) or high glucose (HG: 30 mM). ( A ) Relative quantification of PVT1 , FN1 and COL4A1 mRNA by TaqMan qPCR. The mRNA level for all the genes was arbitrary set to 1 under NG conditions at each time point. Data are presented as mRNA fold-increase incubated under HG or NG conditions. Quantification of secreted FN1 ( B ) and COL4A1 ( C ) proteins by ELISA. Data are expressed as nanograms of FN1 or COL4A1 per total soluble protein (TSP). Results represent average of three independent experiments. Data are means ± SD. A.U.: arbitrary units. * P
    Figure Legend Snippet: Effect of glucose on expression of PVT1 , FN1 , and COL4A1 in normal human mesangial cells (MC). Prior to treatment with high glucose, MC, at approximately 70% confluence, were cultured in serum-free MsBM medium for 24 hours to arrest and synchronize cell growth. After this time period, MC were grown for 24, 48, 72 or 96 h in MsBM medium supplemented with 5% FBS, containing either normal glucose (NG; 5.6 mM), NG+3-O-methyl-D-glucose (3-O-MG) to control for osmotic effects (OC: 5.6 mM glucose+24.4 mM 3-O-MG) or high glucose (HG: 30 mM). ( A ) Relative quantification of PVT1 , FN1 and COL4A1 mRNA by TaqMan qPCR. The mRNA level for all the genes was arbitrary set to 1 under NG conditions at each time point. Data are presented as mRNA fold-increase incubated under HG or NG conditions. Quantification of secreted FN1 ( B ) and COL4A1 ( C ) proteins by ELISA. Data are expressed as nanograms of FN1 or COL4A1 per total soluble protein (TSP). Results represent average of three independent experiments. Data are means ± SD. A.U.: arbitrary units. * P

    Techniques Used: Expressing, Cell Culture, Real-time Polymerase Chain Reaction, Incubation, Enzyme-linked Immunosorbent Assay

    Effect of glucose on TGFB1 and PAI-1 expression in MC. ( A ) Relative quantification of TGFB1 and PAI-1 mRNA by TaqMan qPCR. The mRNA level for all the genes was arbitrary set to 1 under NG conditions at each time point. Data are presented as mRNA fold-increase in MC incubated in HG or NG OC conditions. Quantification of secreted TGFB1 ( B ) and PAI-1 ( C ) proteins by sandwich ELISA. Data are expressed as picograms of PAI-1 or TGFB1 per total soluble protein (TSP). Results represent average of three independent experiments. Data are means ± SD. A.U.: arbitrary units. * P
    Figure Legend Snippet: Effect of glucose on TGFB1 and PAI-1 expression in MC. ( A ) Relative quantification of TGFB1 and PAI-1 mRNA by TaqMan qPCR. The mRNA level for all the genes was arbitrary set to 1 under NG conditions at each time point. Data are presented as mRNA fold-increase in MC incubated in HG or NG OC conditions. Quantification of secreted TGFB1 ( B ) and PAI-1 ( C ) proteins by sandwich ELISA. Data are expressed as picograms of PAI-1 or TGFB1 per total soluble protein (TSP). Results represent average of three independent experiments. Data are means ± SD. A.U.: arbitrary units. * P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Incubation, Sandwich ELISA

    30) Product Images from "Standards for Deriving Nonhuman Primate-Induced Pluripotent Stem Cells, Neural Stem Cells and Dopaminergic Lineage"

    Article Title: Standards for Deriving Nonhuman Primate-Induced Pluripotent Stem Cells, Neural Stem Cells and Dopaminergic Lineage

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms19092788

    TaqMan quantitative RT-PCR analysis of dopamine-differentiated neural stem cells (NSCs). ( A ) Expression level of genes markers of NSCs and their progeny ( NESTIN , SOX1 , SOX2 PAX6 , β-Tub-III , MBP , Olig-2 , GFAP ) under control media (orange) and DIF1 media derived dopaminergic differentiation (green) and from pluripotent undifferentiated CJ01 iPSC (blue); ( B ) expression level of genes markers of the midbrain dopaminergic lineage ( TH , LMX1A , EN1 , NURR1 , PITX3 , and dopamine decarboxylase ( DDC ) enzyme that convert L-DOPA to dopamine) in NSC differentiated under control media (orange) or DIF1 media (green) and from undifferentiated CJ01 iPSC (blue), confirming the increase in the dopaminergic neuronal differentiation. * p
    Figure Legend Snippet: TaqMan quantitative RT-PCR analysis of dopamine-differentiated neural stem cells (NSCs). ( A ) Expression level of genes markers of NSCs and their progeny ( NESTIN , SOX1 , SOX2 PAX6 , β-Tub-III , MBP , Olig-2 , GFAP ) under control media (orange) and DIF1 media derived dopaminergic differentiation (green) and from pluripotent undifferentiated CJ01 iPSC (blue); ( B ) expression level of genes markers of the midbrain dopaminergic lineage ( TH , LMX1A , EN1 , NURR1 , PITX3 , and dopamine decarboxylase ( DDC ) enzyme that convert L-DOPA to dopamine) in NSC differentiated under control media (orange) or DIF1 media (green) and from undifferentiated CJ01 iPSC (blue), confirming the increase in the dopaminergic neuronal differentiation. * p

    Techniques Used: Quantitative RT-PCR, Expressing, Derivative Assay

    31) Product Images from "Human mesenchymal stem cell-replicative senescence and oxidative stress are closely linked to aneuploidy"

    Article Title: Human mesenchymal stem cell-replicative senescence and oxidative stress are closely linked to aneuploidy

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2013.211

    Characterization of hMSCs replicative senescence. ( a ) Growth curves of five independent primary hMSC samples (black) and four hMSC samples transduced with hTERT lentiviral vector (hTERT-MSC) at passage 5 (gray). Neither the proliferation rate nor the morphology of hMSCs was significantly changed after 15 passages. No evidence of spontaneous immortalization was observed in any primary cell sample over 23 passages. ( b ) Percentage of SA- β -gal-positive cells in non-transduced hMSCs at different passages and in transduced hMSCs at passage 20. Upper panels show representative images of SA- β -gal-positive cells. ( c ) P53 , P21 and P16 mRNA gene expression by Taqman Assays at early ( P ≤5), middle ( P > 5– P ≤10) and late ( P ≥15) passages in hMSCs, and passage > 20 in hTERT-MSCs. ( d ) Representative images of western blot for P53 , P21 and P16 protein levels of one hMSC sample (FT34hMSC) at early, middle and late passages, and one hTERT-MSC line at passage > 20. β -actin was detected as a loading control. All independent hMSC cultures followed the same protein profile expression. All above experiments were performed with four independent hMSC samples and their respective transduced hTERT-MSC counterparts. Data are means±S.E.M. (* P
    Figure Legend Snippet: Characterization of hMSCs replicative senescence. ( a ) Growth curves of five independent primary hMSC samples (black) and four hMSC samples transduced with hTERT lentiviral vector (hTERT-MSC) at passage 5 (gray). Neither the proliferation rate nor the morphology of hMSCs was significantly changed after 15 passages. No evidence of spontaneous immortalization was observed in any primary cell sample over 23 passages. ( b ) Percentage of SA- β -gal-positive cells in non-transduced hMSCs at different passages and in transduced hMSCs at passage 20. Upper panels show representative images of SA- β -gal-positive cells. ( c ) P53 , P21 and P16 mRNA gene expression by Taqman Assays at early ( P ≤5), middle ( P > 5– P ≤10) and late ( P ≥15) passages in hMSCs, and passage > 20 in hTERT-MSCs. ( d ) Representative images of western blot for P53 , P21 and P16 protein levels of one hMSC sample (FT34hMSC) at early, middle and late passages, and one hTERT-MSC line at passage > 20. β -actin was detected as a loading control. All independent hMSC cultures followed the same protein profile expression. All above experiments were performed with four independent hMSC samples and their respective transduced hTERT-MSC counterparts. Data are means±S.E.M. (* P

    Techniques Used: Transduction, Plasmid Preparation, Expressing, Western Blot

    Replicative senescence in hMSCs alters the expression of ploidy-controlling genes. ( a ) Taqman qRT-PCR quantification of mRNA transcripts for SCIN , EDN1 , AKAP9 , CD70 , CXCL1 and CXCL12 in hMSCs at passage 22 versus passage 2 (control). SCIN , EDN1 and AKAP9 were significantly upregulated at passage 22 compared with passage 2 (10.46±3.65, 3.90±0.72 and 2.64±0.39-fold increases, respectively), whereas CXCL1 and CD70 were significantly downregulated (−6.22±2.99 and −7.31±2.68, respectively) ( P
    Figure Legend Snippet: Replicative senescence in hMSCs alters the expression of ploidy-controlling genes. ( a ) Taqman qRT-PCR quantification of mRNA transcripts for SCIN , EDN1 , AKAP9 , CD70 , CXCL1 and CXCL12 in hMSCs at passage 22 versus passage 2 (control). SCIN , EDN1 and AKAP9 were significantly upregulated at passage 22 compared with passage 2 (10.46±3.65, 3.90±0.72 and 2.64±0.39-fold increases, respectively), whereas CXCL1 and CD70 were significantly downregulated (−6.22±2.99 and −7.31±2.68, respectively) ( P

    Techniques Used: Expressing, Quantitative RT-PCR

    32) Product Images from "Ocular infection of mice with an avirulent recombinant HSV-1 expressing IL-4 and an attenuated HSV-1 strain generates virulent recombinants in vivo"

    Article Title: Ocular infection of mice with an avirulent recombinant HSV-1 expressing IL-4 and an attenuated HSV-1 strain generates virulent recombinants in vivo

    Journal: Molecular Vision

    doi:

    Level of IL-4 and HSV-1 gB transcripts in RS cells infected with different recombinant viruses. Subconfluent monolayers of RS cells were infected with 10 PFU/cell of HSV-IL-4, vEye2, vEye3, vTG2, or vTG3. Total RNA was isolated 24 and 48hr post infection and TaqMan RT–PCR was performed using IL-4 - and gB -specific primers as described in the Methods. In each experiment, an estimated relative copy number of IL-4 and gB were calculated using standard curves generated from pVR1055-IL-4 and pVR1055-gB, respectively. Briefly, DNA template was serially diluted 10-fold such that 5 μl contained from 10 3 to 10 11 copies of IL-4 or gB , then subjected to TaqMan PCR with the same set of primers. By comparing the normalized threshold cycle of each sample to the threshold cycle of the standard, the copy number for each reaction was determined. GAPDH was used as internal control. Each point represents the mean±SEM (n=4). Panel A indicated gB and panel B indicates IL-4.
    Figure Legend Snippet: Level of IL-4 and HSV-1 gB transcripts in RS cells infected with different recombinant viruses. Subconfluent monolayers of RS cells were infected with 10 PFU/cell of HSV-IL-4, vEye2, vEye3, vTG2, or vTG3. Total RNA was isolated 24 and 48hr post infection and TaqMan RT–PCR was performed using IL-4 - and gB -specific primers as described in the Methods. In each experiment, an estimated relative copy number of IL-4 and gB were calculated using standard curves generated from pVR1055-IL-4 and pVR1055-gB, respectively. Briefly, DNA template was serially diluted 10-fold such that 5 μl contained from 10 3 to 10 11 copies of IL-4 or gB , then subjected to TaqMan PCR with the same set of primers. By comparing the normalized threshold cycle of each sample to the threshold cycle of the standard, the copy number for each reaction was determined. GAPDH was used as internal control. Each point represents the mean±SEM (n=4). Panel A indicated gB and panel B indicates IL-4.

    Techniques Used: Infection, Recombinant, Isolation, Reverse Transcription Polymerase Chain Reaction, Generated, Polymerase Chain Reaction

    Level of IL-12p35 and IL-12p40 transcripts in macrophages infected with HSV-IL-4. Subconfluent monolayers of macrophages were infected with 10 PFU/cell of HSV-IL-4 or parental virus. Total RNA was isolated 12 and 24 h post infection and TaqMan RT–PCR was performed using IL-12p35 - and IL-12p40 -specific primers as described in the Methods. IL-12p35 and IL-12p40 mRNA levels were normalized in comparison to each transcript in mock-infected cells. GAPDH was used as internal control. Each point represents the mean±SEM (n=8).
    Figure Legend Snippet: Level of IL-12p35 and IL-12p40 transcripts in macrophages infected with HSV-IL-4. Subconfluent monolayers of macrophages were infected with 10 PFU/cell of HSV-IL-4 or parental virus. Total RNA was isolated 12 and 24 h post infection and TaqMan RT–PCR was performed using IL-12p35 - and IL-12p40 -specific primers as described in the Methods. IL-12p35 and IL-12p40 mRNA levels were normalized in comparison to each transcript in mock-infected cells. GAPDH was used as internal control. Each point represents the mean±SEM (n=8).

    Techniques Used: Infection, Isolation, Reverse Transcription Polymerase Chain Reaction

    33) Product Images from "Standards for Deriving Nonhuman Primate-Induced Pluripotent Stem Cells, Neural Stem Cells and Dopaminergic Lineage"

    Article Title: Standards for Deriving Nonhuman Primate-Induced Pluripotent Stem Cells, Neural Stem Cells and Dopaminergic Lineage

    Journal: International Journal of Molecular Sciences

    doi: 10.3390/ijms19092788

    TaqMan quantitative RT-PCR analysis of dopamine-differentiated neural stem cells (NSCs). ( A ) Expression level of genes markers of NSCs and their progeny ( NESTIN , SOX1 , SOX2 PAX6 , β-Tub-III , MBP , Olig-2 , GFAP ) under control media (orange) and DIF1 media derived dopaminergic differentiation (green) and from pluripotent undifferentiated CJ01 iPSC (blue); ( B ) expression level of genes markers of the midbrain dopaminergic lineage ( TH , LMX1A , EN1 , NURR1 , PITX3 , and dopamine decarboxylase ( DDC ) enzyme that convert L-DOPA to dopamine) in NSC differentiated under control media (orange) or DIF1 media (green) and from undifferentiated CJ01 iPSC (blue), confirming the increase in the dopaminergic neuronal differentiation. * p
    Figure Legend Snippet: TaqMan quantitative RT-PCR analysis of dopamine-differentiated neural stem cells (NSCs). ( A ) Expression level of genes markers of NSCs and their progeny ( NESTIN , SOX1 , SOX2 PAX6 , β-Tub-III , MBP , Olig-2 , GFAP ) under control media (orange) and DIF1 media derived dopaminergic differentiation (green) and from pluripotent undifferentiated CJ01 iPSC (blue); ( B ) expression level of genes markers of the midbrain dopaminergic lineage ( TH , LMX1A , EN1 , NURR1 , PITX3 , and dopamine decarboxylase ( DDC ) enzyme that convert L-DOPA to dopamine) in NSC differentiated under control media (orange) or DIF1 media (green) and from undifferentiated CJ01 iPSC (blue), confirming the increase in the dopaminergic neuronal differentiation. * p

    Techniques Used: Quantitative RT-PCR, Expressing, Derivative Assay

    34) Product Images from "Regulation of Estrogen Sulfotransferase Expression by Confluence of MCF10A Breast Epithelial Cells: Role of the Aryl Hydrocarbon Receptor"

    Article Title: Regulation of Estrogen Sulfotransferase Expression by Confluence of MCF10A Breast Epithelial Cells: Role of the Aryl Hydrocarbon Receptor

    Journal: The Journal of Pharmacology and Experimental Therapeutics

    doi: 10.1124/jpet.111.185173

    SULT1E1 expression in preconfluent and confluent MCF10A cells. MCF10A cells were harvested at approximately 70 and 100% confluence. A, SULT1E1 mRNA levels were measured in six independent experiments using a TaqMan Gene Expression Assay. B, SULT1E1 immunoreactive
    Figure Legend Snippet: SULT1E1 expression in preconfluent and confluent MCF10A cells. MCF10A cells were harvested at approximately 70 and 100% confluence. A, SULT1E1 mRNA levels were measured in six independent experiments using a TaqMan Gene Expression Assay. B, SULT1E1 immunoreactive

    Techniques Used: Expressing

    Indices of AhR activity in preconfluent and confluent MCF10A cells. A, MCF10A cells were harvested at approximately 70 and 100% confluence, and CYP1A1 mRNA levels were measured using a TaqMan Gene Expression Assay. Data are expressed as the mean ±
    Figure Legend Snippet: Indices of AhR activity in preconfluent and confluent MCF10A cells. A, MCF10A cells were harvested at approximately 70 and 100% confluence, and CYP1A1 mRNA levels were measured using a TaqMan Gene Expression Assay. Data are expressed as the mean ±

    Techniques Used: Activity Assay, Expressing

    Expression of AhR and ARNT in preconfluent and confluent MCF10A cells. A, MCF10A cells were harvested at approximately 70 and 100% confluence. AhR and ARNT mRNA levels were measured in six independent experiments using TaqMan Gene Expression Assays. Data
    Figure Legend Snippet: Expression of AhR and ARNT in preconfluent and confluent MCF10A cells. A, MCF10A cells were harvested at approximately 70 and 100% confluence. AhR and ARNT mRNA levels were measured in six independent experiments using TaqMan Gene Expression Assays. Data

    Techniques Used: Expressing

    35) Product Images from "Large scale real-time PCR validation on gene expression measurements from two commercial long-oligonucleotide microarrays"

    Article Title: Large scale real-time PCR validation on gene expression measurements from two commercial long-oligonucleotide microarrays

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-7-59

    Correlation of fold change in pair-wise tissues determined by microarray platforms and TaqMan ® Gene Expression Assay based real-time PCR . y-axis, fold change determined by microarrays which is defined as: For Applied Biosystems Arrays, log2 (MedianSignal_tissue1/MedianSignal_tissue2); for Agilent arrays, log2(MedianSignal_tissue1/MedianSignal_UHR)- log2(medianSignal_tissue2/MedianSignal_UHR); x-axis, fold change determined by real-time PCR, which is defined as ΔΔCt = (Ct_tissue2-Ct_PPIA)-(Ct_tissue1-Ct_PPIA). For each pair-wise comparison, genes were filtered based on real-time PCR detection thresholds (detectable in at least 3 out of 4 technical replicates in each tissue and detectable in both tissues, the number of genes are shown in the parentheses). A robust linear regression fitting and the corresponding R 2 value are presented in each plot.
    Figure Legend Snippet: Correlation of fold change in pair-wise tissues determined by microarray platforms and TaqMan ® Gene Expression Assay based real-time PCR . y-axis, fold change determined by microarrays which is defined as: For Applied Biosystems Arrays, log2 (MedianSignal_tissue1/MedianSignal_tissue2); for Agilent arrays, log2(MedianSignal_tissue1/MedianSignal_UHR)- log2(medianSignal_tissue2/MedianSignal_UHR); x-axis, fold change determined by real-time PCR, which is defined as ΔΔCt = (Ct_tissue2-Ct_PPIA)-(Ct_tissue1-Ct_PPIA). For each pair-wise comparison, genes were filtered based on real-time PCR detection thresholds (detectable in at least 3 out of 4 technical replicates in each tissue and detectable in both tissues, the number of genes are shown in the parentheses). A robust linear regression fitting and the corresponding R 2 value are presented in each plot.

    Techniques Used: Microarray, Expressing, Real-time Polymerase Chain Reaction

    36) Product Images from "Cellular response to influenza virus infection: a potential role for autophagy in CXCL10 and interferon-alpha induction"

    Article Title: Cellular response to influenza virus infection: a potential role for autophagy in CXCL10 and interferon-alpha induction

    Journal: Cellular and Molecular Immunology

    doi: 10.1038/cmi.2010.25

    H9N2/G1 induced higher CXCL10 and IFN-α levels than H1N1. Macrophages were either mock-infected or infected with H1N1 or H9N2/G1. ( a ) At 3 h.p.i., CXCL10 levels were examined by TaqMan gene expression assay; n =6. ( b ) CXCL10 levels in culture
    Figure Legend Snippet: H9N2/G1 induced higher CXCL10 and IFN-α levels than H1N1. Macrophages were either mock-infected or infected with H1N1 or H9N2/G1. ( a ) At 3 h.p.i., CXCL10 levels were examined by TaqMan gene expression assay; n =6. ( b ) CXCL10 levels in culture

    Techniques Used: Infection, Expressing

    37) Product Images from "The effects of 17?-estradiol and a selective estrogen receptor modulator, bazedoxifene, on ovarian carcinogenesis"

    Article Title: The effects of 17?-estradiol and a selective estrogen receptor modulator, bazedoxifene, on ovarian carcinogenesis

    Journal: Gynecologic oncology

    doi: 10.1016/j.ygyno.2011.08.026

    K-ras/Pten mouse OvCa cell line hormone receptor characterization. (A) The K-ras/Pten mouse OvCa cell line expresses ERα and ERβ. Cell blocks were made from the K-ras/Pten mouse OvCa cell line and stained by immunohistochemistry for ERα and ERβ. Inset positive control = mouse uterus (ERα) and mouse ovarian follicle (ERβ). (B) The K-ras/Pten mouse OvCa cell line was treated for 24 or 48 hours with hormones in charcoal stripped phenol red free complete media, followed by western blots for ERα and β-actin. Protein expression was quantitated and normalized to β-actin using NIH Image J software. Columns, fold-change in ERα optical density (OD) compared to placebo. (C) The K-ras/Pten cell line was treated with the indicated hormones for 24 hours then total RNA was extracted and the relative expression of ERα normalized to glyceraldehyde-3-phosphate dehydrogenase was measured using TaqMan quantitative real-time RT-PCR. Groups: Ctrl= vehicle control, E2= 17β-estradiol, E2+ B= 17β-estradiol plus bazedoxifene, B= bazedoxifene alone
    Figure Legend Snippet: K-ras/Pten mouse OvCa cell line hormone receptor characterization. (A) The K-ras/Pten mouse OvCa cell line expresses ERα and ERβ. Cell blocks were made from the K-ras/Pten mouse OvCa cell line and stained by immunohistochemistry for ERα and ERβ. Inset positive control = mouse uterus (ERα) and mouse ovarian follicle (ERβ). (B) The K-ras/Pten mouse OvCa cell line was treated for 24 or 48 hours with hormones in charcoal stripped phenol red free complete media, followed by western blots for ERα and β-actin. Protein expression was quantitated and normalized to β-actin using NIH Image J software. Columns, fold-change in ERα optical density (OD) compared to placebo. (C) The K-ras/Pten cell line was treated with the indicated hormones for 24 hours then total RNA was extracted and the relative expression of ERα normalized to glyceraldehyde-3-phosphate dehydrogenase was measured using TaqMan quantitative real-time RT-PCR. Groups: Ctrl= vehicle control, E2= 17β-estradiol, E2+ B= 17β-estradiol plus bazedoxifene, B= bazedoxifene alone

    Techniques Used: Staining, Immunohistochemistry, Positive Control, Western Blot, Expressing, Software, Quantitative RT-PCR

    38) Product Images from "Functional characterization of lysine-specific demethylase 2 (LSD2/KDM1B) in breast cancer progression"

    Article Title: Functional characterization of lysine-specific demethylase 2 (LSD2/KDM1B) in breast cancer progression

    Journal: Oncotarget

    doi: 10.18632/oncotarget.19387

    Effect of LSD2 on expression of key epigenetic modifiers A. RNA was extracted from MDA-MB-231 EV and LSD2-OE cells and cDNA was synthesized and subjected to quantitative real-time PCR for the indicated genes using TaqMan probes. GAPDH expression was used as an internal standard. B. mRNA expression of chromatin modifying factors in MDA-MB-231 cells stably transfected with scramble (SCR) or LSD2 shRNA (LSD2-KD). GAPDH expression was used as an internal standard. C. Indicated chromatin modifying factors were analyzed for their protein levels by western blots in MDA-MB-231 EV, LSD2-OE, scramble shRNA and LSD2-KD cells. GAPDH was used as a loading control. D. Histograms represent the average protein levels of indicated chromatin modifiers in three independent experiments relative to GAPDH protein ± s.d. as determined by quantitative immunoblots. E. MDA-MB-231 EV and LSD2-OE cells were transfected with scramble or LSD1 targeting siRNA for 96 h followed by growth assay using fluorometric dsDNA quantitation. Column with error bar represents mean ± s.d. from three independent experiments. * p
    Figure Legend Snippet: Effect of LSD2 on expression of key epigenetic modifiers A. RNA was extracted from MDA-MB-231 EV and LSD2-OE cells and cDNA was synthesized and subjected to quantitative real-time PCR for the indicated genes using TaqMan probes. GAPDH expression was used as an internal standard. B. mRNA expression of chromatin modifying factors in MDA-MB-231 cells stably transfected with scramble (SCR) or LSD2 shRNA (LSD2-KD). GAPDH expression was used as an internal standard. C. Indicated chromatin modifying factors were analyzed for their protein levels by western blots in MDA-MB-231 EV, LSD2-OE, scramble shRNA and LSD2-KD cells. GAPDH was used as a loading control. D. Histograms represent the average protein levels of indicated chromatin modifiers in three independent experiments relative to GAPDH protein ± s.d. as determined by quantitative immunoblots. E. MDA-MB-231 EV and LSD2-OE cells were transfected with scramble or LSD1 targeting siRNA for 96 h followed by growth assay using fluorometric dsDNA quantitation. Column with error bar represents mean ± s.d. from three independent experiments. * p

    Techniques Used: Expressing, Multiple Displacement Amplification, Synthesized, Real-time Polymerase Chain Reaction, Stable Transfection, Transfection, shRNA, Western Blot, Growth Assay, Quantitation Assay

    39) Product Images from "Up-regulation of CDK9 kinase activity and Mcl-1 stability contributes to the acquired resistance to cyclin-dependent kinase inhibitors in leukemia"

    Article Title: Up-regulation of CDK9 kinase activity and Mcl-1 stability contributes to the acquired resistance to cyclin-dependent kinase inhibitors in leukemia

    Journal: Oncotarget

    doi:

    Mcl-1 protein levels are more stable to antagonize the flavopiridol-mediated depletion in Flavo-R (A) Cells were treated with continues exposure of 0.3μM flavopiridol or 2-hour exposure of 2μM flavopiridol with washout (w/o) and harvested for lysates and RNA preparation at pre (0 hr), 1, 2 and 4hr post treatment. Quantitative real-time PCR with TaqMan probes for Mcl-1 was used to measure its transcript abundance after treatment. Flavo-R showed significantly more Mcl-1 transcripts with both doses of flavopiridol at 6-hr time point. (B) Immunoblotting was applied to detect Mcl-1 protein levels in protein lysates collected from cells treated with 2μM flavopiridol for 4 hours and washout (w/o). (C) Densitometry is utilized to quantify the intensity of immunoreactive bands for Mcl-1 that is normalized to GAPDH and the bar graph shows the average of densitometry measurement of three independent experiments. Mcl-1 protein expression is more stable with the flavopiridol treatment in these resistant cells. (D) Cells were treated with 100μg/ml cycloheximide (CHX) to inhibit overall protein translation and compared with Mcl-1 protein stability between parental cells and Flavo-R. Treated cells were collected at pre (0h), 2, 4, and 6hr to assay short-life Mcl-1 protein levels by immunoblotting. (E) The bar graph shows the average of densitometry measurement of the intensity of immunoreactive bands for Mcl-1, which was normalized to GAPDH in three independent experiments. Levels of Mcl-1 protein expression are more stable in Flavo-R.
    Figure Legend Snippet: Mcl-1 protein levels are more stable to antagonize the flavopiridol-mediated depletion in Flavo-R (A) Cells were treated with continues exposure of 0.3μM flavopiridol or 2-hour exposure of 2μM flavopiridol with washout (w/o) and harvested for lysates and RNA preparation at pre (0 hr), 1, 2 and 4hr post treatment. Quantitative real-time PCR with TaqMan probes for Mcl-1 was used to measure its transcript abundance after treatment. Flavo-R showed significantly more Mcl-1 transcripts with both doses of flavopiridol at 6-hr time point. (B) Immunoblotting was applied to detect Mcl-1 protein levels in protein lysates collected from cells treated with 2μM flavopiridol for 4 hours and washout (w/o). (C) Densitometry is utilized to quantify the intensity of immunoreactive bands for Mcl-1 that is normalized to GAPDH and the bar graph shows the average of densitometry measurement of three independent experiments. Mcl-1 protein expression is more stable with the flavopiridol treatment in these resistant cells. (D) Cells were treated with 100μg/ml cycloheximide (CHX) to inhibit overall protein translation and compared with Mcl-1 protein stability between parental cells and Flavo-R. Treated cells were collected at pre (0h), 2, 4, and 6hr to assay short-life Mcl-1 protein levels by immunoblotting. (E) The bar graph shows the average of densitometry measurement of the intensity of immunoreactive bands for Mcl-1, which was normalized to GAPDH in three independent experiments. Levels of Mcl-1 protein expression are more stable in Flavo-R.

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    40) Product Images from "An Exonic Switch Regulates Differential Accession of microRNAs to the Cd34 Transcript in Atherosclerosis Progression"

    Article Title: An Exonic Switch Regulates Differential Accession of microRNAs to the Cd34 Transcript in Atherosclerosis Progression

    Journal: Genes

    doi: 10.3390/genes10010070

    Detailed structure of the Cd34 region harboring the predicted miRNA binding sites. ( A ) Diagram of 1 kb of sequence at the 3’end of Cd34 . Shown is the position of the two stop codons (TGA1 and TGA2), the internal/cryptic splice site (I/CSS) and the position of the miRNA binding sites. Expanded is the sequence of the 70 bp, which concentrate the miRNA binding sites. Boxed, the seed sequences of the miRNAs and the comparison among those of miR-125 and miR-351. ( B ) Expression of the miRNAs targeting Cd34 at different experimental conditions. Data shown after normalization to U6-snRNA. Expression data extracted from the original Taqman Low Density Array card (TLDA) experiment [ 25 ]. (*) Only one sample could be analyzed.
    Figure Legend Snippet: Detailed structure of the Cd34 region harboring the predicted miRNA binding sites. ( A ) Diagram of 1 kb of sequence at the 3’end of Cd34 . Shown is the position of the two stop codons (TGA1 and TGA2), the internal/cryptic splice site (I/CSS) and the position of the miRNA binding sites. Expanded is the sequence of the 70 bp, which concentrate the miRNA binding sites. Boxed, the seed sequences of the miRNAs and the comparison among those of miR-125 and miR-351. ( B ) Expression of the miRNAs targeting Cd34 at different experimental conditions. Data shown after normalization to U6-snRNA. Expression data extracted from the original Taqman Low Density Array card (TLDA) experiment [ 25 ]. (*) Only one sample could be analyzed.

    Techniques Used: Binding Assay, Sequencing, Expressing, TLDA Assay

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: MicroRNA-27a decreases the level and efficiency of the LDL receptor and contributes to the dysregulation of cholesterol homeostasis
    Article Snippet: .. Quantitative real time RT-PCR (qPCR) was performed using commercial TaqMan Gene Expression Assays (Life Technologies) in conjunction with the ABI Prism 7900 HT Sequence Detector apparatus (Applied Biosystems). ..

    Article Title: Functional and genomic characterisation of a xenograft model system for the study of metastasis in triple-negative breast cancer
    Article Snippet: .. Two-step qPCR was completed (50-250 ng cDNA template/reaction) using either TaqMan gene expression assays (CTSC, ENG, TIE1, BMP2, BMP4, RPL37A) with Fast Universal PCR Master Mix, no AmpErase™ UNG (Thermo Fisher Scientific) or Fast SYBR™ Green Master Mix (50-250 ng cDNA template/reaction) and the following oligonucleotide primers (Integrated DNA Technologies, Singapore). ..

    Article Title: Astrocyte Elevated Gene-1 (AEG-1) Regulates Lipid Homeostasis *
    Article Snippet: .. RT-PCR was performed using an ABI ViiA7 fast real-time PCR system and Taqman gene expression assays according to the manufacturer's protocol (Applied Biosystems). .. The expression level of each gene was determined by the ΔΔ CT method and was normalized by the level of GAPDH.

    Amplification:

    Article Title: Altered machinery of protein synthesis is region- and stage-dependent and is associated with α-synuclein oligomers in Parkinson’s disease
    Article Snippet: .. Parallel amplification reactions were carried out using 20x TaqMan Gene Expression Assays and 2x TaqMan Universal PCR Master Mix (Applied Biosystems). ..

    Sequencing:

    Article Title: MicroRNA-27a decreases the level and efficiency of the LDL receptor and contributes to the dysregulation of cholesterol homeostasis
    Article Snippet: .. Quantitative real time RT-PCR (qPCR) was performed using commercial TaqMan Gene Expression Assays (Life Technologies) in conjunction with the ABI Prism 7900 HT Sequence Detector apparatus (Applied Biosystems). ..

    Article Title: V?24-invariant NKT cells mediate antitumor activity via killing of tumor-associated macrophages
    Article Snippet: .. Quantitative RT-PCR was performed with TaqMan gene expression assays using the ABI 7900 Sequence Detection System (Applied Biosystems). .. Briefly, the probes and primers were ordered from Applied Biosystems Custom TaqMan Gene Expression Assays (Table ); those for Vα24-Jα18 TCR have been previously described ( ).

    Quantitative RT-PCR:

    Article Title: MicroRNA-27a decreases the level and efficiency of the LDL receptor and contributes to the dysregulation of cholesterol homeostasis
    Article Snippet: .. Quantitative real time RT-PCR (qPCR) was performed using commercial TaqMan Gene Expression Assays (Life Technologies) in conjunction with the ABI Prism 7900 HT Sequence Detector apparatus (Applied Biosystems). ..

    Article Title: Identification of thioridazine, an antipsychotic drug, as an antiglioblastoma and anticancer stem cell agent using public gene expression data
    Article Snippet: .. Gene expression was quantified by real-time quantitative RT-PCR using TaqMan probe (Life Technologies). ..

    Article Title: V?24-invariant NKT cells mediate antitumor activity via killing of tumor-associated macrophages
    Article Snippet: .. Quantitative RT-PCR was performed with TaqMan gene expression assays using the ABI 7900 Sequence Detection System (Applied Biosystems). .. Briefly, the probes and primers were ordered from Applied Biosystems Custom TaqMan Gene Expression Assays (Table ); those for Vα24-Jα18 TCR have been previously described ( ).

    SYBR Green Assay:

    Article Title: Functional and genomic characterisation of a xenograft model system for the study of metastasis in triple-negative breast cancer
    Article Snippet: .. Two-step qPCR was completed (50-250 ng cDNA template/reaction) using either TaqMan gene expression assays (CTSC, ENG, TIE1, BMP2, BMP4, RPL37A) with Fast Universal PCR Master Mix, no AmpErase™ UNG (Thermo Fisher Scientific) or Fast SYBR™ Green Master Mix (50-250 ng cDNA template/reaction) and the following oligonucleotide primers (Integrated DNA Technologies, Singapore). ..

    Polymerase Chain Reaction:

    Article Title: Functional and genomic characterisation of a xenograft model system for the study of metastasis in triple-negative breast cancer
    Article Snippet: .. Two-step qPCR was completed (50-250 ng cDNA template/reaction) using either TaqMan gene expression assays (CTSC, ENG, TIE1, BMP2, BMP4, RPL37A) with Fast Universal PCR Master Mix, no AmpErase™ UNG (Thermo Fisher Scientific) or Fast SYBR™ Green Master Mix (50-250 ng cDNA template/reaction) and the following oligonucleotide primers (Integrated DNA Technologies, Singapore). ..

    Article Title: Altered machinery of protein synthesis is region- and stage-dependent and is associated with α-synuclein oligomers in Parkinson’s disease
    Article Snippet: .. Parallel amplification reactions were carried out using 20x TaqMan Gene Expression Assays and 2x TaqMan Universal PCR Master Mix (Applied Biosystems). ..

    Expressing:

    Article Title: MicroRNA-27a decreases the level and efficiency of the LDL receptor and contributes to the dysregulation of cholesterol homeostasis
    Article Snippet: .. Quantitative real time RT-PCR (qPCR) was performed using commercial TaqMan Gene Expression Assays (Life Technologies) in conjunction with the ABI Prism 7900 HT Sequence Detector apparatus (Applied Biosystems). ..

    Article Title: Functional and genomic characterisation of a xenograft model system for the study of metastasis in triple-negative breast cancer
    Article Snippet: .. Two-step qPCR was completed (50-250 ng cDNA template/reaction) using either TaqMan gene expression assays (CTSC, ENG, TIE1, BMP2, BMP4, RPL37A) with Fast Universal PCR Master Mix, no AmpErase™ UNG (Thermo Fisher Scientific) or Fast SYBR™ Green Master Mix (50-250 ng cDNA template/reaction) and the following oligonucleotide primers (Integrated DNA Technologies, Singapore). ..

    Article Title: The Absence of DHHC3 Affects Primary and Latent Herpes Simplex Virus 1 Infection
    Article Snippet: .. The expression levels of gB, gK, UL20, and LAT, as well as the expression of the endogenous control GAPDH gene, were evaluated using a commercially available TaqMan gene expression assay kit (Applied Biosystems, Foster City, CA) containing optimized primer and probe concentrations. .. In each experiment, estimated relative copy numbers for gB, gK, UL20, and LAT were calculated using standard curves generated from pAc-gB1 (for gB), pGem-gK1040 (for gK), pcDNA-UL20 (for UL20), and pGem-LAT5300 (for LAT).

    Article Title: Altered machinery of protein synthesis is region- and stage-dependent and is associated with α-synuclein oligomers in Parkinson’s disease
    Article Snippet: .. Parallel amplification reactions were carried out using 20x TaqMan Gene Expression Assays and 2x TaqMan Universal PCR Master Mix (Applied Biosystems). ..

    Article Title: Astrocyte Elevated Gene-1 (AEG-1) Regulates Lipid Homeostasis *
    Article Snippet: .. RT-PCR was performed using an ABI ViiA7 fast real-time PCR system and Taqman gene expression assays according to the manufacturer's protocol (Applied Biosystems). .. The expression level of each gene was determined by the ΔΔ CT method and was normalized by the level of GAPDH.

    Article Title: Identification of thioridazine, an antipsychotic drug, as an antiglioblastoma and anticancer stem cell agent using public gene expression data
    Article Snippet: .. Gene expression was quantified by real-time quantitative RT-PCR using TaqMan probe (Life Technologies). ..

    Article Title: IL-27 suppresses antimicrobial activity in human leprosy
    Article Snippet: .. TaqMan gene expression assays were used for detection of IFN-β, IL-10, IL-27 and GAPDH (glyceraldehyde-3-phosphate dehydrogenase; Applied Biosystems, Foster City, CA). ..

    Article Title: V?24-invariant NKT cells mediate antitumor activity via killing of tumor-associated macrophages
    Article Snippet: .. Quantitative RT-PCR was performed with TaqMan gene expression assays using the ABI 7900 Sequence Detection System (Applied Biosystems). .. Briefly, the probes and primers were ordered from Applied Biosystems Custom TaqMan Gene Expression Assays (Table ); those for Vα24-Jα18 TCR have been previously described ( ).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Astrocyte Elevated Gene-1 (AEG-1) Regulates Lipid Homeostasis *
    Article Snippet: .. RT-PCR was performed using an ABI ViiA7 fast real-time PCR system and Taqman gene expression assays according to the manufacturer's protocol (Applied Biosystems). .. The expression level of each gene was determined by the ΔΔ CT method and was normalized by the level of GAPDH.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher gene exp cdk4 hs00364847 m1
    SCCOHT patient tumors expressed reduced levels of cyclin D1 mRNA and protein. a , b SCCOHT tumors expressed significantly lower CCND1 mRNA levels compared to ovarian high-grade serous carcinomas (HGSCs). Heatmaps ( a ) and boxplots ( b ) showing CCND1 and <t>CDK4</t> mRNA levels obtained from a NanoString gene expression study in SCCOHT patient tumors ( n = 17) relative to HGSCs ( n = 6). Two-tailed t test, * p
    Gene Exp Cdk4 Hs00364847 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp cdk4 hs00364847 m1/product/Thermo Fisher
    Average 94 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    gene exp cdk4 hs00364847 m1 - by Bioz Stars, 2020-10
    94/100 stars
      Buy from Supplier

    99
    Thermo Fisher gene exp nos2 hs01075529 m1
    Influence of quercetin on <t>iNOS</t> mRNA expression in HNEpCs after IL-4 stimulation in vitro . HNEpCs at 1 x 10 5 cells/ml are cultured with 10.0 ng/ml of IL-4 for 24 hours in the presence and absence of various concentrations of quercetin. iNOS mRNA expression is measured using quantitative real-time RT-PCR, and the results are expressed as the mean RQ ± SE of the triplicate cultures. The experiments are performed twice with similar results. Med. alone: medium alone; IL-4: interleukin-4; HNEpCs: human nasal epithelial cells; iNOS: inducible nitric oxide synthase; RQ: relative quantification.
    Gene Exp Nos2 Hs01075529 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp nos2 hs01075529 m1/product/Thermo Fisher
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    gene exp nos2 hs01075529 m1 - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    86
    Thermo Fisher gene exp dpp4 mm00494549 m1
    Effects of <t>dpp4</t> silencing on hepatic histology and lipid metabolism in db/db mice. ( A ) H E images of liver depicting lipid accumulation (steatosis) in hepatocytes. All images at 100x magnification; pv = portal vein. (B) Quantitative analysis of the total lipid area, sub-analyzed for the small and large droplet area. (C) Circulating concentrations of triglycerides, cholesterol and adiponectin. Each solid circle represents liver sample from an individual mouse for each group (n = 5–8). Data are mean values ± standard deviation (SD), n = 5–8, * p
    Gene Exp Dpp4 Mm00494549 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp dpp4 mm00494549 m1/product/Thermo Fisher
    Average 86 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    gene exp dpp4 mm00494549 m1 - by Bioz Stars, 2020-10
    86/100 stars
      Buy from Supplier

    Image Search Results


    SCCOHT patient tumors expressed reduced levels of cyclin D1 mRNA and protein. a , b SCCOHT tumors expressed significantly lower CCND1 mRNA levels compared to ovarian high-grade serous carcinomas (HGSCs). Heatmaps ( a ) and boxplots ( b ) showing CCND1 and CDK4 mRNA levels obtained from a NanoString gene expression study in SCCOHT patient tumors ( n = 17) relative to HGSCs ( n = 6). Two-tailed t test, * p

    Journal: Nature Communications

    Article Title: CDK4/6 inhibitors target SMARCA4-determined cyclin D1 deficiency in hypercalcemic small cell carcinoma of the ovary

    doi: 10.1038/s41467-018-06958-9

    Figure Lengend Snippet: SCCOHT patient tumors expressed reduced levels of cyclin D1 mRNA and protein. a , b SCCOHT tumors expressed significantly lower CCND1 mRNA levels compared to ovarian high-grade serous carcinomas (HGSCs). Heatmaps ( a ) and boxplots ( b ) showing CCND1 and CDK4 mRNA levels obtained from a NanoString gene expression study in SCCOHT patient tumors ( n = 17) relative to HGSCs ( n = 6). Two-tailed t test, * p

    Article Snippet: The sequences of the primers for assays using SYBR® Green master mix (Roche) are as follows: GAPDH _Forward, AAGGTGAAGGTCGGAGTCAA; GAPDH _Reverse, AATGAAGGGGTCATTGATGG; CCND1 _Forward, GGCGGATTGGAAATGAACTT; CCND1 _Reverse, TCCTCTCCAAAATGCCAGAG; CCND2 _Forward, ACGGTACTGCTGCAGGCTAT; CCND2 _Reverse, AGCTGCTGGCTAAGATCACC; CCND3 _Forward, TTGAGCTTCCCTAGGACCAG; CCND3 _Reverse, TGACCATCGAAAAACTGTGC; CDK4 _Forward, GTCGGCTTCAGAGTTTCCAC; CDK4 _Reverse, TGCAGTCCACATATGCAACA; CDKN2A Exon 1a _Forward, CATAGATGCCGCGGAAGGT; CDKN2A Exon 1a _Reverse, CCCGAGGTTTCTCAGAGCCT; CCNE1 _Forward, TCTTTGTCAGGTGTGGGGA; CCNE1 _Reverse, GAAATGGCCAAAATCGACAG; CDKN1B _Forward, AACGTGCGAGTGTCTAACGG; CDKN1B _Reverse, CCCTCTAGGGGTTTGTGATTCT; CDKN1A _Forward, CCTGTCACTGTCTTGTACCCT; CDKN1A _Reverse, GCGTTTGGAGTGGTAGAAATCT; ESR1 _Forward, CAGGATCTCTAGCCAGGCAC; ESR1 _Reverse, ATGATCAACTGGGCGAAGAG; TaqMan® Gene Expression Assays probes CDK 4 (Hs00364847_m1) and CDK6 (Hs01026371_m1) were purchased from Thermo Fisher Scientific.

    Techniques: Expressing, Two Tailed Test

    SMARCA4-deficient SCCOHT cells are vulnerable to inhibition of CDK4/6 kinase activities. a Schematic outline of the shRNA screens for kinases whose inhibition is selectively lethal to SMARCA4-deficient SCCOHT cells (BIN-67) but not to SMARCA4-proficient control cells (IOSE80, OVCAR4). Cells were infected with the lentiviral shRNA library (T0) and cultured for selection for 14 days (T1). The relative abundance of shRNAs in the cell populations was determined by next-generation sequencing. b . CDK6 (magenta) and CDK4 (blue) are the first two ranked genes that were negatively selected in BIN-67 cells. All genes were ranked based on their RRA (robust rank aggregation, top) or raw p values (bottom) generated from the MAGeCK analysis. c , d Validation of CDK6 and CDK4 in SCCOHT cells (BIN-67, SCCOHT-1, COV434) and SMARCA4-proficient controls (IOSE80, OVCAR4). c Colony-formation assay of the indicated cell lines expressing pLKO control or shRNAs targeting CDK6 or CDK4 after 10–15 days of culturing. For each cell line, all dishes were fixed at the same time, stained, and photographed. d Western blot analysis of CDK6 and CDK4 and phosphorylated RB at serine 795 (pRB-S795) in the cells described in c . HSP90 was used as a loading control. e – j SCCOHT cells are more vulnerable to inhibition of CDK4/6 kinase activities, compared to SMARCA4-proficient control cells. e BIN-67 cells stably expressing pLX304- GFP , pLX304- CDK6 , or pLX304- CDK6 D163N were infected with viruses containing pLKO control or a shRNA targeting the 3’UTR of CDK6 , selected for integration, and cultured for 14 days. All dishes were fixed at the same time. f Western blot analysis for CDK6, pRB-S795, and HSP90 in the cells described above. g , i BIN-67 ( g ) and OVCAR-4 ( i ) cells expressing pLX317- GFP , pLX317- CDK4 , or pLX317- CDK4 D158N were infected with viruses containing pLKO control or a shRNA vector targeting the 3’UTR of CDK4 , selected for integration, and cultured for 14 days. For each cell line, all dishes were fixed at the same time. h , j Western blot analysis for CDK4, pRB-S795, and HSP90 in the cells described above

    Journal: Nature Communications

    Article Title: CDK4/6 inhibitors target SMARCA4-determined cyclin D1 deficiency in hypercalcemic small cell carcinoma of the ovary

    doi: 10.1038/s41467-018-06958-9

    Figure Lengend Snippet: SMARCA4-deficient SCCOHT cells are vulnerable to inhibition of CDK4/6 kinase activities. a Schematic outline of the shRNA screens for kinases whose inhibition is selectively lethal to SMARCA4-deficient SCCOHT cells (BIN-67) but not to SMARCA4-proficient control cells (IOSE80, OVCAR4). Cells were infected with the lentiviral shRNA library (T0) and cultured for selection for 14 days (T1). The relative abundance of shRNAs in the cell populations was determined by next-generation sequencing. b . CDK6 (magenta) and CDK4 (blue) are the first two ranked genes that were negatively selected in BIN-67 cells. All genes were ranked based on their RRA (robust rank aggregation, top) or raw p values (bottom) generated from the MAGeCK analysis. c , d Validation of CDK6 and CDK4 in SCCOHT cells (BIN-67, SCCOHT-1, COV434) and SMARCA4-proficient controls (IOSE80, OVCAR4). c Colony-formation assay of the indicated cell lines expressing pLKO control or shRNAs targeting CDK6 or CDK4 after 10–15 days of culturing. For each cell line, all dishes were fixed at the same time, stained, and photographed. d Western blot analysis of CDK6 and CDK4 and phosphorylated RB at serine 795 (pRB-S795) in the cells described in c . HSP90 was used as a loading control. e – j SCCOHT cells are more vulnerable to inhibition of CDK4/6 kinase activities, compared to SMARCA4-proficient control cells. e BIN-67 cells stably expressing pLX304- GFP , pLX304- CDK6 , or pLX304- CDK6 D163N were infected with viruses containing pLKO control or a shRNA targeting the 3’UTR of CDK6 , selected for integration, and cultured for 14 days. All dishes were fixed at the same time. f Western blot analysis for CDK6, pRB-S795, and HSP90 in the cells described above. g , i BIN-67 ( g ) and OVCAR-4 ( i ) cells expressing pLX317- GFP , pLX317- CDK4 , or pLX317- CDK4 D158N were infected with viruses containing pLKO control or a shRNA vector targeting the 3’UTR of CDK4 , selected for integration, and cultured for 14 days. For each cell line, all dishes were fixed at the same time. h , j Western blot analysis for CDK4, pRB-S795, and HSP90 in the cells described above

    Article Snippet: The sequences of the primers for assays using SYBR® Green master mix (Roche) are as follows: GAPDH _Forward, AAGGTGAAGGTCGGAGTCAA; GAPDH _Reverse, AATGAAGGGGTCATTGATGG; CCND1 _Forward, GGCGGATTGGAAATGAACTT; CCND1 _Reverse, TCCTCTCCAAAATGCCAGAG; CCND2 _Forward, ACGGTACTGCTGCAGGCTAT; CCND2 _Reverse, AGCTGCTGGCTAAGATCACC; CCND3 _Forward, TTGAGCTTCCCTAGGACCAG; CCND3 _Reverse, TGACCATCGAAAAACTGTGC; CDK4 _Forward, GTCGGCTTCAGAGTTTCCAC; CDK4 _Reverse, TGCAGTCCACATATGCAACA; CDKN2A Exon 1a _Forward, CATAGATGCCGCGGAAGGT; CDKN2A Exon 1a _Reverse, CCCGAGGTTTCTCAGAGCCT; CCNE1 _Forward, TCTTTGTCAGGTGTGGGGA; CCNE1 _Reverse, GAAATGGCCAAAATCGACAG; CDKN1B _Forward, AACGTGCGAGTGTCTAACGG; CDKN1B _Reverse, CCCTCTAGGGGTTTGTGATTCT; CDKN1A _Forward, CCTGTCACTGTCTTGTACCCT; CDKN1A _Reverse, GCGTTTGGAGTGGTAGAAATCT; ESR1 _Forward, CAGGATCTCTAGCCAGGCAC; ESR1 _Reverse, ATGATCAACTGGGCGAAGAG; TaqMan® Gene Expression Assays probes CDK 4 (Hs00364847_m1) and CDK6 (Hs01026371_m1) were purchased from Thermo Fisher Scientific.

    Techniques: Inhibition, shRNA, Infection, Cell Culture, Selection, Next-Generation Sequencing, Generated, Colony Assay, Expressing, Staining, Western Blot, Stable Transfection, Plasmid Preparation

    SCCOHT cells are highly sensitive to CDK4/6 inhibitors. a – c SMARCA4-deficient SCCOHT cells are highly sensitive to palbociclib treatment, similar to ER + breast cancer cells. a Colony-formation assays in SCCOHT (BIN-67, SCCOHT-1, and COV434), SMARCA4-proficient ovarian (IOSE80, OVCAR4, and OVCAR8), and ER + breast cancer (MCF7 and CAMA-1) cell lines. Cells were cultured in the absence or presence of palbociclib at the indicated concentrations for 10–21 days. For each cell line, all dishes were fixed at the same time. b Cell viability assay of the same cell line panel. Cells were treated with increasing concentrations of palbociclib for 5–10 days, and cell viability using CellTiter-Blue was determined by measuring the fluorescence (560/590 nm) in a microplate reader. Error bars: mean ± standard deviation (s.d.) of biological replicates ( n = 4). c Palbociclib treatment suppresses RB phosphorylation in SCCOHT cells similar to ER + breast cancer cells but not in IOSE80 and OVCAR4 cells. Levels of pRB-S795 in cells treated with 0, 100, and 300 nM of palbociclib for 24 h were documented by western blot analysis. d , e Transcriptome profiling in SCCOHT cells show that top ranked pathways affected upon palbociclib treatment are related to cell cycle regulation. RNA-Seq was performed in BIN-67 and SCCOHT-1 cells treated with 100 nM of palbociclib for 24 h. Common genes that significantly changed ( p

    Journal: Nature Communications

    Article Title: CDK4/6 inhibitors target SMARCA4-determined cyclin D1 deficiency in hypercalcemic small cell carcinoma of the ovary

    doi: 10.1038/s41467-018-06958-9

    Figure Lengend Snippet: SCCOHT cells are highly sensitive to CDK4/6 inhibitors. a – c SMARCA4-deficient SCCOHT cells are highly sensitive to palbociclib treatment, similar to ER + breast cancer cells. a Colony-formation assays in SCCOHT (BIN-67, SCCOHT-1, and COV434), SMARCA4-proficient ovarian (IOSE80, OVCAR4, and OVCAR8), and ER + breast cancer (MCF7 and CAMA-1) cell lines. Cells were cultured in the absence or presence of palbociclib at the indicated concentrations for 10–21 days. For each cell line, all dishes were fixed at the same time. b Cell viability assay of the same cell line panel. Cells were treated with increasing concentrations of palbociclib for 5–10 days, and cell viability using CellTiter-Blue was determined by measuring the fluorescence (560/590 nm) in a microplate reader. Error bars: mean ± standard deviation (s.d.) of biological replicates ( n = 4). c Palbociclib treatment suppresses RB phosphorylation in SCCOHT cells similar to ER + breast cancer cells but not in IOSE80 and OVCAR4 cells. Levels of pRB-S795 in cells treated with 0, 100, and 300 nM of palbociclib for 24 h were documented by western blot analysis. d , e Transcriptome profiling in SCCOHT cells show that top ranked pathways affected upon palbociclib treatment are related to cell cycle regulation. RNA-Seq was performed in BIN-67 and SCCOHT-1 cells treated with 100 nM of palbociclib for 24 h. Common genes that significantly changed ( p

    Article Snippet: The sequences of the primers for assays using SYBR® Green master mix (Roche) are as follows: GAPDH _Forward, AAGGTGAAGGTCGGAGTCAA; GAPDH _Reverse, AATGAAGGGGTCATTGATGG; CCND1 _Forward, GGCGGATTGGAAATGAACTT; CCND1 _Reverse, TCCTCTCCAAAATGCCAGAG; CCND2 _Forward, ACGGTACTGCTGCAGGCTAT; CCND2 _Reverse, AGCTGCTGGCTAAGATCACC; CCND3 _Forward, TTGAGCTTCCCTAGGACCAG; CCND3 _Reverse, TGACCATCGAAAAACTGTGC; CDK4 _Forward, GTCGGCTTCAGAGTTTCCAC; CDK4 _Reverse, TGCAGTCCACATATGCAACA; CDKN2A Exon 1a _Forward, CATAGATGCCGCGGAAGGT; CDKN2A Exon 1a _Reverse, CCCGAGGTTTCTCAGAGCCT; CCNE1 _Forward, TCTTTGTCAGGTGTGGGGA; CCNE1 _Reverse, GAAATGGCCAAAATCGACAG; CDKN1B _Forward, AACGTGCGAGTGTCTAACGG; CDKN1B _Reverse, CCCTCTAGGGGTTTGTGATTCT; CDKN1A _Forward, CCTGTCACTGTCTTGTACCCT; CDKN1A _Reverse, GCGTTTGGAGTGGTAGAAATCT; ESR1 _Forward, CAGGATCTCTAGCCAGGCAC; ESR1 _Reverse, ATGATCAACTGGGCGAAGAG; TaqMan® Gene Expression Assays probes CDK 4 (Hs00364847_m1) and CDK6 (Hs01026371_m1) were purchased from Thermo Fisher Scientific.

    Techniques: Cell Culture, Viability Assay, Fluorescence, Standard Deviation, Western Blot, RNA Sequencing Assay

    Cyclin D1 deficiency in SCCOHT cells results in vulnerability to CDK4/6 inhibition. a SMARCA4 loss in SCCOHT is associated with cyclin D1 deficiency and reduced CDK4 expression. Western blot analysis of key cell cycle regulators in a cell line panel: non-transformed ovarian epithelial (IOSE80), ovarian carcinoma (OVCAR4, OVCAR8), SCCOHT (BIN-67, SCCOHT-1, COV434), and ER + breast cancer (CAMA-1, MCF7). l.e. long exposure. b SCCOHT cells express low levels of CCND1 mRNA. Relative CCND1 expression (normalized to GAPDH ) in the cell panel described above were measured by qRT-PCR. Error bars: mean ± s.d. of biological replicates ( n = 3). c SCCOHT cells have lower total CDK4 kinase activities compared to SMARCA4-proficient control cells. Normalized amount of immunoprecipitated CDK4 kinase complexes from IOSE80 and SCCOHT cell lines were subjected to in vitro kinase assays using recombinant RB. Upper, western blot analysis of immunoprecipitated CDK4 input; lower, kinase assay radiography. d – i Ectopic cyclin D1 expression increases RB phosphorylation and confers resistance to palbociclib in SCCOHT cells. d , e Western blot analysis of immunoprecipitations using an antibody against CDK4 or IgG in SCCOHT-1 ( d ) and BIN-67 ( e ) cells stably expressing GFP or CCND1 . f , g Western blot analysis of SCCOHT-1 ( f ) and BIN-67 ( g ) cells with stable ectopic expression of GFP , CDK4 , or CCND1 . h , i Colony-formation assay of SCCOHT-1 ( h ) and BIN-67 ( i ) cells (described in f , g ) treated with palbociclib. j , k Spontaneously palbociclib-resistant clones of SCCOHT-1 expressed elevated cyclin D1 and RB phosphorylation. j Cell viability assay of SCCOHT-1 parental cells and resistant clones (R1 and R2) treated with palbociclib for 9 days. Error bars: mean ± standard deviation (s.d.) of biological replicates ( n = 4). k Western blot analysis for the indicated proteins in the cells described above. l , m Cyclin D1 knockdown in palbociclib-resistant SCCOHT-1 cells resensitizes them to palbociclib. l Cell viability assay of SCCOHT-1 R1 cells expressing pLKO control or two independent shRNAs targeting cyclin D1 treated with palbociclib for 9 days. Error bars: mean ± standard deviation (s.d.) of biological replicates ( n = 4). m Western blot analysis for the indicated proteins in the cells described above

    Journal: Nature Communications

    Article Title: CDK4/6 inhibitors target SMARCA4-determined cyclin D1 deficiency in hypercalcemic small cell carcinoma of the ovary

    doi: 10.1038/s41467-018-06958-9

    Figure Lengend Snippet: Cyclin D1 deficiency in SCCOHT cells results in vulnerability to CDK4/6 inhibition. a SMARCA4 loss in SCCOHT is associated with cyclin D1 deficiency and reduced CDK4 expression. Western blot analysis of key cell cycle regulators in a cell line panel: non-transformed ovarian epithelial (IOSE80), ovarian carcinoma (OVCAR4, OVCAR8), SCCOHT (BIN-67, SCCOHT-1, COV434), and ER + breast cancer (CAMA-1, MCF7). l.e. long exposure. b SCCOHT cells express low levels of CCND1 mRNA. Relative CCND1 expression (normalized to GAPDH ) in the cell panel described above were measured by qRT-PCR. Error bars: mean ± s.d. of biological replicates ( n = 3). c SCCOHT cells have lower total CDK4 kinase activities compared to SMARCA4-proficient control cells. Normalized amount of immunoprecipitated CDK4 kinase complexes from IOSE80 and SCCOHT cell lines were subjected to in vitro kinase assays using recombinant RB. Upper, western blot analysis of immunoprecipitated CDK4 input; lower, kinase assay radiography. d – i Ectopic cyclin D1 expression increases RB phosphorylation and confers resistance to palbociclib in SCCOHT cells. d , e Western blot analysis of immunoprecipitations using an antibody against CDK4 or IgG in SCCOHT-1 ( d ) and BIN-67 ( e ) cells stably expressing GFP or CCND1 . f , g Western blot analysis of SCCOHT-1 ( f ) and BIN-67 ( g ) cells with stable ectopic expression of GFP , CDK4 , or CCND1 . h , i Colony-formation assay of SCCOHT-1 ( h ) and BIN-67 ( i ) cells (described in f , g ) treated with palbociclib. j , k Spontaneously palbociclib-resistant clones of SCCOHT-1 expressed elevated cyclin D1 and RB phosphorylation. j Cell viability assay of SCCOHT-1 parental cells and resistant clones (R1 and R2) treated with palbociclib for 9 days. Error bars: mean ± standard deviation (s.d.) of biological replicates ( n = 4). k Western blot analysis for the indicated proteins in the cells described above. l , m Cyclin D1 knockdown in palbociclib-resistant SCCOHT-1 cells resensitizes them to palbociclib. l Cell viability assay of SCCOHT-1 R1 cells expressing pLKO control or two independent shRNAs targeting cyclin D1 treated with palbociclib for 9 days. Error bars: mean ± standard deviation (s.d.) of biological replicates ( n = 4). m Western blot analysis for the indicated proteins in the cells described above

    Article Snippet: The sequences of the primers for assays using SYBR® Green master mix (Roche) are as follows: GAPDH _Forward, AAGGTGAAGGTCGGAGTCAA; GAPDH _Reverse, AATGAAGGGGTCATTGATGG; CCND1 _Forward, GGCGGATTGGAAATGAACTT; CCND1 _Reverse, TCCTCTCCAAAATGCCAGAG; CCND2 _Forward, ACGGTACTGCTGCAGGCTAT; CCND2 _Reverse, AGCTGCTGGCTAAGATCACC; CCND3 _Forward, TTGAGCTTCCCTAGGACCAG; CCND3 _Reverse, TGACCATCGAAAAACTGTGC; CDK4 _Forward, GTCGGCTTCAGAGTTTCCAC; CDK4 _Reverse, TGCAGTCCACATATGCAACA; CDKN2A Exon 1a _Forward, CATAGATGCCGCGGAAGGT; CDKN2A Exon 1a _Reverse, CCCGAGGTTTCTCAGAGCCT; CCNE1 _Forward, TCTTTGTCAGGTGTGGGGA; CCNE1 _Reverse, GAAATGGCCAAAATCGACAG; CDKN1B _Forward, AACGTGCGAGTGTCTAACGG; CDKN1B _Reverse, CCCTCTAGGGGTTTGTGATTCT; CDKN1A _Forward, CCTGTCACTGTCTTGTACCCT; CDKN1A _Reverse, GCGTTTGGAGTGGTAGAAATCT; ESR1 _Forward, CAGGATCTCTAGCCAGGCAC; ESR1 _Reverse, ATGATCAACTGGGCGAAGAG; TaqMan® Gene Expression Assays probes CDK 4 (Hs00364847_m1) and CDK6 (Hs01026371_m1) were purchased from Thermo Fisher Scientific.

    Techniques: Inhibition, Expressing, Western Blot, Transformation Assay, Quantitative RT-PCR, Immunoprecipitation, In Vitro, Recombinant, Kinase Assay, Stable Transfection, Colony Assay, Clone Assay, Viability Assay, Standard Deviation

    Influence of quercetin on iNOS mRNA expression in HNEpCs after IL-4 stimulation in vitro . HNEpCs at 1 x 10 5 cells/ml are cultured with 10.0 ng/ml of IL-4 for 24 hours in the presence and absence of various concentrations of quercetin. iNOS mRNA expression is measured using quantitative real-time RT-PCR, and the results are expressed as the mean RQ ± SE of the triplicate cultures. The experiments are performed twice with similar results. Med. alone: medium alone; IL-4: interleukin-4; HNEpCs: human nasal epithelial cells; iNOS: inducible nitric oxide synthase; RQ: relative quantification.

    Journal: Evidence-based Complementary and Alternative Medicine : eCAM

    Article Title: Suppressive Effect of Quercetin on Nitric Oxide Production from Nasal Epithelial Cells In Vitro

    doi: 10.1155/2018/6097625

    Figure Lengend Snippet: Influence of quercetin on iNOS mRNA expression in HNEpCs after IL-4 stimulation in vitro . HNEpCs at 1 x 10 5 cells/ml are cultured with 10.0 ng/ml of IL-4 for 24 hours in the presence and absence of various concentrations of quercetin. iNOS mRNA expression is measured using quantitative real-time RT-PCR, and the results are expressed as the mean RQ ± SE of the triplicate cultures. The experiments are performed twice with similar results. Med. alone: medium alone; IL-4: interleukin-4; HNEpCs: human nasal epithelial cells; iNOS: inducible nitric oxide synthase; RQ: relative quantification.

    Article Snippet: The cDNA templates were then amplified by PCR using TaqMan Gene Expression Assays, PCR primers (iNOS; TaqMan Gene Expression Assays; No. Hs01075529_m1 and GAPDH; TaqMan Gene Expression Assays; No. Hs02786624_g1) and RT master mix.

    Techniques: Expressing, In Vitro, Cell Culture, Quantitative RT-PCR

    Effects of dpp4 silencing on hepatic histology and lipid metabolism in db/db mice. ( A ) H E images of liver depicting lipid accumulation (steatosis) in hepatocytes. All images at 100x magnification; pv = portal vein. (B) Quantitative analysis of the total lipid area, sub-analyzed for the small and large droplet area. (C) Circulating concentrations of triglycerides, cholesterol and adiponectin. Each solid circle represents liver sample from an individual mouse for each group (n = 5–8). Data are mean values ± standard deviation (SD), n = 5–8, * p

    Journal: PLoS ONE

    Article Title: A siRNA mediated hepatic dpp4 knockdown affects lipid, but not glucose metabolism in diabetic mice

    doi: 10.1371/journal.pone.0225835

    Figure Lengend Snippet: Effects of dpp4 silencing on hepatic histology and lipid metabolism in db/db mice. ( A ) H E images of liver depicting lipid accumulation (steatosis) in hepatocytes. All images at 100x magnification; pv = portal vein. (B) Quantitative analysis of the total lipid area, sub-analyzed for the small and large droplet area. (C) Circulating concentrations of triglycerides, cholesterol and adiponectin. Each solid circle represents liver sample from an individual mouse for each group (n = 5–8). Data are mean values ± standard deviation (SD), n = 5–8, * p

    Article Snippet: Animal tissues were immediately snap-frozen in liquid nitrogen after collection The target gene dpp4 (TaqMan® Gene Expression Assay: Mm00494549_m1) was measured by real time quantitative PCR.

    Techniques: Mouse Assay, Standard Deviation

    : Liver-specific dpp4 silencing does not improve whole-body glucose metabolism. ( A ) Body weight and ( B ) food intake was measured during the study. ( C ) Fasting blood glucose and ( D ) fasting insulin was measured after study termination. ( E ) Oral glucose tolerance test was preformed 7 days after the 5th injection on day 28. ( F ) Baseline-corrected area under the curve during the oral glucose tolerance test. ( G ) Insulin concentrations before (-30 min) and after the oral glucose load (15 min).

    Journal: PLoS ONE

    Article Title: A siRNA mediated hepatic dpp4 knockdown affects lipid, but not glucose metabolism in diabetic mice

    doi: 10.1371/journal.pone.0225835

    Figure Lengend Snippet: : Liver-specific dpp4 silencing does not improve whole-body glucose metabolism. ( A ) Body weight and ( B ) food intake was measured during the study. ( C ) Fasting blood glucose and ( D ) fasting insulin was measured after study termination. ( E ) Oral glucose tolerance test was preformed 7 days after the 5th injection on day 28. ( F ) Baseline-corrected area under the curve during the oral glucose tolerance test. ( G ) Insulin concentrations before (-30 min) and after the oral glucose load (15 min).

    Article Snippet: Animal tissues were immediately snap-frozen in liquid nitrogen after collection The target gene dpp4 (TaqMan® Gene Expression Assay: Mm00494549_m1) was measured by real time quantitative PCR.

    Techniques: Injection

    Liver-specific dpp4 silencing does not improve glucose metabolism. ( A ) Dose-response curve upon transfection of PC3 cells with siRNA (n = 3). ( B ) Pilot mouse study to evaluate the siRNA efficacy. Wild-type C57BL/6J mice were injected three-times with dpp4 siRNA (siDpp4, 1 mg/kg), negative control siRNA (luciferase; siRNA-NT) or factor VII siRNA (siFVII) and dpp4 mRNA expression in the liver was analyzed by RT-PCR 7 days after treatment (n = 3; **p

    Journal: PLoS ONE

    Article Title: A siRNA mediated hepatic dpp4 knockdown affects lipid, but not glucose metabolism in diabetic mice

    doi: 10.1371/journal.pone.0225835

    Figure Lengend Snippet: Liver-specific dpp4 silencing does not improve glucose metabolism. ( A ) Dose-response curve upon transfection of PC3 cells with siRNA (n = 3). ( B ) Pilot mouse study to evaluate the siRNA efficacy. Wild-type C57BL/6J mice were injected three-times with dpp4 siRNA (siDpp4, 1 mg/kg), negative control siRNA (luciferase; siRNA-NT) or factor VII siRNA (siFVII) and dpp4 mRNA expression in the liver was analyzed by RT-PCR 7 days after treatment (n = 3; **p

    Article Snippet: Animal tissues were immediately snap-frozen in liquid nitrogen after collection The target gene dpp4 (TaqMan® Gene Expression Assay: Mm00494549_m1) was measured by real time quantitative PCR.

    Techniques: Transfection, Mouse Assay, Injection, Negative Control, Luciferase, Expressing, Reverse Transcription Polymerase Chain Reaction

    siRNA-mediated knock-down of hepatic dpp4 in db/db mice. ( A ) Schematic illustration of the study design. ( B , C and D ) Liver samples were taken after study termination at day 30. ( B ) dpp4 mRNA expression was analyzed by real-time PCR after indicated treatment. ( C ) Quantification of dpp4 protein abundance. ( D ) Representative Western Blot images show dpp4 protein levels after indicated treatment. ( E ) Circulating dpp4 protein levels as well as ( F ) circulating dpp4 activity was measured three days after last dosing at day 30. ( G ) Quantification of active GLP-1 and ( H ) GIP at day 30. Data are mean values ± SEM, n = 6–8, *p

    Journal: PLoS ONE

    Article Title: A siRNA mediated hepatic dpp4 knockdown affects lipid, but not glucose metabolism in diabetic mice

    doi: 10.1371/journal.pone.0225835

    Figure Lengend Snippet: siRNA-mediated knock-down of hepatic dpp4 in db/db mice. ( A ) Schematic illustration of the study design. ( B , C and D ) Liver samples were taken after study termination at day 30. ( B ) dpp4 mRNA expression was analyzed by real-time PCR after indicated treatment. ( C ) Quantification of dpp4 protein abundance. ( D ) Representative Western Blot images show dpp4 protein levels after indicated treatment. ( E ) Circulating dpp4 protein levels as well as ( F ) circulating dpp4 activity was measured three days after last dosing at day 30. ( G ) Quantification of active GLP-1 and ( H ) GIP at day 30. Data are mean values ± SEM, n = 6–8, *p

    Article Snippet: Animal tissues were immediately snap-frozen in liquid nitrogen after collection The target gene dpp4 (TaqMan® Gene Expression Assay: Mm00494549_m1) was measured by real time quantitative PCR.

    Techniques: Mouse Assay, Expressing, Real-time Polymerase Chain Reaction, Western Blot, Activity Assay