taqman fast advanced master mix  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    TaqMan Fast Advanced Master Mix
    Description:
    TaqMan Fast Advanced Master Mix has been designed to match or exceed the performance of standard master mixes delivering shorter run times 40 minutes with results equal to or better than what is achieved today TaqMan Fast Advanced Master Mix contains AmpliTaq Fast DNA Polymerase uracil N glycosylase UNG dNTPs with dUTP ROX dye passive reference and optimized buffer components It is supplied at a 2X concentration Features of the TaqMan Fast Advanced Master Mix include • Best in class performance superior sensitivity accuracy dynamic range and specificity compared to standard mixes in standard mode• Engineered for enhanced benchtop stability stable at room temperature for up to 72 hours in preassembled reactions• Optimized for multiplexing validated for duplexing with exogenous and endogenous internal positive control assays• Reduced run times on fast and standard instrumentation optimized for fast mode on fast instruments and fast cycling conditions on standard instruments• Seamlessly transitions into your experiments validated with Applied Biosystems TaqMan Assays for Gene Expression and microRNAs and TaqMan Array Micro Fluidic CardsBest in Class PerformanceTaqMan Fast Advanced Master Mix has been designed to provide performance equal to or better than the results you currently expect from your standard master mix The master mix has been benchmarked against the leading suppliers standard and fast master mixes to help ensure that it succeeds in providing best in class sensitivity accuracy dynamic range and specificity The impressive sensitivity of the mix showcased in Figure 1 compares the Ct values of TaqMan Fast Advanced Master Mix and TaqMan Universal PCR Master Mix across a panel of gene expression assays Benchtop Stability for High Throughput Handling and ConvenienceTaqMan Fast Advanced Master Mix has been engineered to retain a high level of performance in preassembled reactions for up to 72 hours The stability of this mix provides users of high throughput liquid handling systems the assurance that the results on the first plate will mimic those of the last plate Figure 2 shows an assay that was run upon assembly time 0 and after 72 hours of incubation at 30°C simulating the most extreme room temperature scenario For those with less extreme throughput needs the enhanced stability of this master mix provides an overall added convenience to your workflow as you are no longer constrained to immediately running your plates upon assembly Optimized for MultiplexingWe realize that confidence is paramount when it comes to your results For added confidence in the results you see in every well TaqMan Fast Advanced Master Mix has been designed to help deliver accurate results for duplex reactions using an internal positive control IPC Figure 3 shows results for the experimental target β actin gene name ACTB which was serially diluted and amplified in single target reactions and duplex reactions Validated for MicroRNA AssaysTaqMan Fast Advanced Master Mix has been validated for use with multiple real time PCR applications including microRNA assays The formulation provides high specificity and dynamic range the two most critical performance attributes that define successful results when working with microRNAs The data in Figure 4 demonstrate excellent PCR linearity over a 6 log range of input template Reduced Run Times on Standard InstrumentationTaqMan Fast Advanced Master Mix has been optimized for use with both fast and standard instrumentation enabling researchers who currently own standard instruments to also reap the performance benefits and time savings this mix provides Figure 5 showcases the impressive results achieved when using TaqMan Fast Advanced Master Mix under fast thermal cycling conditions on Applied Biosystems 7300 Real Time PCR System The mix has been tested with all Applied Biosystems standard real time PCR instrumentation 7900HT 7500 and 7300 systems to enable success independent of whether or not you own a fast enabled instrument
    Catalog Number:
    4444556
    Price:
    None
    Applications:
    Enzymes & Master Mixes for Real-Time PCR|Fast Real-Time PCR|PCR & Real-Time PCR|Real Time PCR (qPCR)|Real Time PCR-Based Gene Expression Profiling|Gene Expression Analysis & Genotyping
    Category:
    Kits and Assays
    Buy from Supplier


    Structured Review

    Thermo Fisher taqman fast advanced master mix
    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for <t>Taqman</t> PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman <t>qPCR</t> assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    TaqMan Fast Advanced Master Mix has been designed to match or exceed the performance of standard master mixes delivering shorter run times 40 minutes with results equal to or better than what is achieved today TaqMan Fast Advanced Master Mix contains AmpliTaq Fast DNA Polymerase uracil N glycosylase UNG dNTPs with dUTP ROX dye passive reference and optimized buffer components It is supplied at a 2X concentration Features of the TaqMan Fast Advanced Master Mix include • Best in class performance superior sensitivity accuracy dynamic range and specificity compared to standard mixes in standard mode• Engineered for enhanced benchtop stability stable at room temperature for up to 72 hours in preassembled reactions• Optimized for multiplexing validated for duplexing with exogenous and endogenous internal positive control assays• Reduced run times on fast and standard instrumentation optimized for fast mode on fast instruments and fast cycling conditions on standard instruments• Seamlessly transitions into your experiments validated with Applied Biosystems TaqMan Assays for Gene Expression and microRNAs and TaqMan Array Micro Fluidic CardsBest in Class PerformanceTaqMan Fast Advanced Master Mix has been designed to provide performance equal to or better than the results you currently expect from your standard master mix The master mix has been benchmarked against the leading suppliers standard and fast master mixes to help ensure that it succeeds in providing best in class sensitivity accuracy dynamic range and specificity The impressive sensitivity of the mix showcased in Figure 1 compares the Ct values of TaqMan Fast Advanced Master Mix and TaqMan Universal PCR Master Mix across a panel of gene expression assays Benchtop Stability for High Throughput Handling and ConvenienceTaqMan Fast Advanced Master Mix has been engineered to retain a high level of performance in preassembled reactions for up to 72 hours The stability of this mix provides users of high throughput liquid handling systems the assurance that the results on the first plate will mimic those of the last plate Figure 2 shows an assay that was run upon assembly time 0 and after 72 hours of incubation at 30°C simulating the most extreme room temperature scenario For those with less extreme throughput needs the enhanced stability of this master mix provides an overall added convenience to your workflow as you are no longer constrained to immediately running your plates upon assembly Optimized for MultiplexingWe realize that confidence is paramount when it comes to your results For added confidence in the results you see in every well TaqMan Fast Advanced Master Mix has been designed to help deliver accurate results for duplex reactions using an internal positive control IPC Figure 3 shows results for the experimental target β actin gene name ACTB which was serially diluted and amplified in single target reactions and duplex reactions Validated for MicroRNA AssaysTaqMan Fast Advanced Master Mix has been validated for use with multiple real time PCR applications including microRNA assays The formulation provides high specificity and dynamic range the two most critical performance attributes that define successful results when working with microRNAs The data in Figure 4 demonstrate excellent PCR linearity over a 6 log range of input template Reduced Run Times on Standard InstrumentationTaqMan Fast Advanced Master Mix has been optimized for use with both fast and standard instrumentation enabling researchers who currently own standard instruments to also reap the performance benefits and time savings this mix provides Figure 5 showcases the impressive results achieved when using TaqMan Fast Advanced Master Mix under fast thermal cycling conditions on Applied Biosystems 7300 Real Time PCR System The mix has been tested with all Applied Biosystems standard real time PCR instrumentation 7900HT 7500 and 7300 systems to enable success independent of whether or not you own a fast enabled instrument
    https://www.bioz.com/result/taqman fast advanced master mix/product/Thermo Fisher
    Average 99 stars, based on 1087 article reviews
    Price from $9.99 to $1999.99
    taqman fast advanced master mix - by Bioz Stars, 2020-08
    99/100 stars

    Images

    1) Product Images from "Exposure to galactic cosmic radiation compromises DNA repair and increases the potential for oncogenic chromosomal rearrangement in bronchial epithelial cells"

    Article Title: Exposure to galactic cosmic radiation compromises DNA repair and increases the potential for oncogenic chromosomal rearrangement in bronchial epithelial cells

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-29350-5

    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for Taqman PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman qPCR assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Figure Legend Snippet: Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for Taqman PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman qPCR assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.

    Techniques Used: Polymerase Chain Reaction, Hybridization, Amplification, Real-time Polymerase Chain Reaction, Irradiation, Fluorescence, Software

    Effect of irradiation on the frequency of Cas9/sgRNA-induced EML4-ALK rearrangement. ( A ) Effect of 108 keV/μm or 200 keV/μm 48 Ti on response to Cas9/sgRNA challenge. Triplicate cultures were irradiated as indicated, challenged by transduction with lentiviral Cas9/sgRNA vectors, and DNA was analysed by Taqman qPCR using RNase P as an internal standard. Significance was evaluated by ANOVA followed by 2-sided Dunnett t-tests *P
    Figure Legend Snippet: Effect of irradiation on the frequency of Cas9/sgRNA-induced EML4-ALK rearrangement. ( A ) Effect of 108 keV/μm or 200 keV/μm 48 Ti on response to Cas9/sgRNA challenge. Triplicate cultures were irradiated as indicated, challenged by transduction with lentiviral Cas9/sgRNA vectors, and DNA was analysed by Taqman qPCR using RNase P as an internal standard. Significance was evaluated by ANOVA followed by 2-sided Dunnett t-tests *P

    Techniques Used: Irradiation, Transduction, Real-time Polymerase Chain Reaction

    2) Product Images from "Circular RNA CpG island hypermethylation-associated silencing in human cancer"

    Article Title: Circular RNA CpG island hypermethylation-associated silencing in human cancer

    Journal: Oncotarget

    doi: 10.18632/oncotarget.25673

    circRNA effects on linear transcripts, miRNAs and tumor growth ( A ) Upon efficient transduction of TUSC3 circ104557 in HCT-116 cells (harboring a methylated CpG island), the TUSC3 linear RNA levels did not change: it was not detected in any of the conditions tested. ( B ) TUSC3 circ104557 transduction in DKO cells (harboring an unmethylated CpG island) did not affect the levels of TUSC3 linear RNA. RNA levels were determined using circular or linear specific qRT-PCR primers. The lentiviral transduction of the empty vector (Mock condition) was used as a control. Experiments were performed in technical triplicates. ( C ) Expression of candidate miRNAs putatively targeted by ATRNL1 circ100686 (miR-378a-3p), SAMD4A circ101356 (miR-660-5p and miR-330-3p) and TUSC3 circ104557 (miR-330-3p) was significantly downregulated in DKO cells, evaluated in three biological replicates by real-time quantitative PCR using TaqMan Advanced MicroRNA Assays. Expression levels were normalized using hsa-miR-345-5p, hsa-miR-191-5p and hsa-miR-423-3p advanced Control miRNA Assays. ( D ) Using the same strategy, expression of miR-330-3p, putatively targeted by TUSC3 circ104557, was also assessed in the gain-of-function cellular model. A significant downregulation of miR-330-3p was detected upon TUSC3 circ104557 transduction in HCT116 cells. ( E ) HCT116-Mock and HCT116-TUSC3 circular cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time (left panel) and tumor weight upon sacrifice (right panel) are shown. Tumor growth was significantly reduced upon TUSC3 circular ectopic expression. ns, nonsignificant; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001, using Student’s t -test. Error bars show means ± s.d.
    Figure Legend Snippet: circRNA effects on linear transcripts, miRNAs and tumor growth ( A ) Upon efficient transduction of TUSC3 circ104557 in HCT-116 cells (harboring a methylated CpG island), the TUSC3 linear RNA levels did not change: it was not detected in any of the conditions tested. ( B ) TUSC3 circ104557 transduction in DKO cells (harboring an unmethylated CpG island) did not affect the levels of TUSC3 linear RNA. RNA levels were determined using circular or linear specific qRT-PCR primers. The lentiviral transduction of the empty vector (Mock condition) was used as a control. Experiments were performed in technical triplicates. ( C ) Expression of candidate miRNAs putatively targeted by ATRNL1 circ100686 (miR-378a-3p), SAMD4A circ101356 (miR-660-5p and miR-330-3p) and TUSC3 circ104557 (miR-330-3p) was significantly downregulated in DKO cells, evaluated in three biological replicates by real-time quantitative PCR using TaqMan Advanced MicroRNA Assays. Expression levels were normalized using hsa-miR-345-5p, hsa-miR-191-5p and hsa-miR-423-3p advanced Control miRNA Assays. ( D ) Using the same strategy, expression of miR-330-3p, putatively targeted by TUSC3 circ104557, was also assessed in the gain-of-function cellular model. A significant downregulation of miR-330-3p was detected upon TUSC3 circ104557 transduction in HCT116 cells. ( E ) HCT116-Mock and HCT116-TUSC3 circular cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time (left panel) and tumor weight upon sacrifice (right panel) are shown. Tumor growth was significantly reduced upon TUSC3 circular ectopic expression. ns, nonsignificant; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001, using Student’s t -test. Error bars show means ± s.d.

    Techniques Used: Transduction, Methylation, Quantitative RT-PCR, Plasmid Preparation, Expressing, Real-time Polymerase Chain Reaction, Injection, Mouse Assay

    3) Product Images from "Rad51C-ATXN7 fusion gene expression in colorectal tumors"

    Article Title: Rad51C-ATXN7 fusion gene expression in colorectal tumors

    Journal: Molecular Cancer

    doi: 10.1186/s12943-016-0527-1

    Real time PCR analysis of Rad51C-ATXN7 fusion gene Variant 2 expression in LS-174 T and RKO colorectal tumor cells pre and post 5-Azacytidine treatment. The LS-174 T and RKO cells were treated with 5-Azacytidine at dose of 5 μM for 72 h. The total RNA was isolated from pre and post 5-Azacytdine treated LS-174 T and RKO colorectal tumor cells and reverse transcribed to cDNA. The cDNA was then used as template for Rad51C-ATXN7 fusion Variant expression analysis using Taqman real time PCR. The analysis showed 3.51 fold increase in relative expression of RNA for Variant 2 in comparison to untreated control in LS-174 T cells. The RKO cells showed only 1.2 fold mild increase in relative expression of RNA for Variant 2 in comparison to untreated control
    Figure Legend Snippet: Real time PCR analysis of Rad51C-ATXN7 fusion gene Variant 2 expression in LS-174 T and RKO colorectal tumor cells pre and post 5-Azacytidine treatment. The LS-174 T and RKO cells were treated with 5-Azacytidine at dose of 5 μM for 72 h. The total RNA was isolated from pre and post 5-Azacytdine treated LS-174 T and RKO colorectal tumor cells and reverse transcribed to cDNA. The cDNA was then used as template for Rad51C-ATXN7 fusion Variant expression analysis using Taqman real time PCR. The analysis showed 3.51 fold increase in relative expression of RNA for Variant 2 in comparison to untreated control in LS-174 T cells. The RKO cells showed only 1.2 fold mild increase in relative expression of RNA for Variant 2 in comparison to untreated control

    Techniques Used: Real-time Polymerase Chain Reaction, Variant Assay, Expressing, Isolation

    4) Product Images from "Prazosin Can Prevent Glucocorticoid Mediated Capillary Rarefaction"

    Article Title: Prazosin Can Prevent Glucocorticoid Mediated Capillary Rarefaction

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0166899

    Alterations to VEGF-A and TSP-1 with elevated CORT and concomitant prazosin treatment. RNA or protein was isolated from the TA muscle after 1W or 2W of CORT with or without concurrent prazosin treatment. Taqman qPCR was used to assess the mRNA levels of VEGF-A (A,B) and TSP-1 (D,E), while VEGF-A protein was assessed by ELISA (C) and TSP-1 protein by Western blot (F). (A) VEGF-A mRNA was not altered in response to 1W CORT and/or prazosin. (B) VEGF-A mRNA was not affected by 2W CORT ( P = 0.08), while a significant prazosin effect was detected within the 2W CORT-prazosin group (* P
    Figure Legend Snippet: Alterations to VEGF-A and TSP-1 with elevated CORT and concomitant prazosin treatment. RNA or protein was isolated from the TA muscle after 1W or 2W of CORT with or without concurrent prazosin treatment. Taqman qPCR was used to assess the mRNA levels of VEGF-A (A,B) and TSP-1 (D,E), while VEGF-A protein was assessed by ELISA (C) and TSP-1 protein by Western blot (F). (A) VEGF-A mRNA was not altered in response to 1W CORT and/or prazosin. (B) VEGF-A mRNA was not affected by 2W CORT ( P = 0.08), while a significant prazosin effect was detected within the 2W CORT-prazosin group (* P

    Techniques Used: Isolation, Real-time Polymerase Chain Reaction, Enzyme-linked Immunosorbent Assay, Western Blot

    CORT influence on Ang-1 mRNA and Akt phosphorylation. RNA was isolated from the TA muscle after 1W or 2W of CORT treatment with or without concurrent prazosin or from cultured endothelial or C2C12 cell extracts after 48 hours of CORT-treatment. (A,B) Ang-1 mRNA, assessed by Taqman qPCR and represented as 2 -ΔCt relative to the housekeeping gene HPRT1, was significantly reduced with CORT treatment ( # P = 0.02; main effect of 1W CORT; ## P
    Figure Legend Snippet: CORT influence on Ang-1 mRNA and Akt phosphorylation. RNA was isolated from the TA muscle after 1W or 2W of CORT treatment with or without concurrent prazosin or from cultured endothelial or C2C12 cell extracts after 48 hours of CORT-treatment. (A,B) Ang-1 mRNA, assessed by Taqman qPCR and represented as 2 -ΔCt relative to the housekeeping gene HPRT1, was significantly reduced with CORT treatment ( # P = 0.02; main effect of 1W CORT; ## P

    Techniques Used: Isolation, Cell Culture, Real-time Polymerase Chain Reaction

    5) Product Images from "NF90 modulates processing of a subset of human pri-miRNAs"

    Article Title: NF90 modulates processing of a subset of human pri-miRNAs

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkaa386

    NF90 modulates the expression level of a subset of miRNAs in HepG2 cells. ( A ) Extracts of HepG2 cells transfected with non-targeting control siRNAs (Scr, Scr#2) or siRNA targeting NF90 (NF90, NF90#2) as indicated were analyzed by immunoblot using the antibodies indicated. ( B ) Total RNA extracted from cells transfected with siScr or siNF90 were analyzed by small RNA-seq. Results are shown as log 2 fold change versus –log 10 P -value. ( C ) Table summarizing the number of mature miRNAs and pri-miRNAs modulated in HepG2 cell line upon loss of NF90, according to small-RNA seq. ( D ) Total RNA extracted from cells described in (A) were analyzed by Taqman RT-qPCR as indicated. Results were normalized by those obtained for U6 abundance in the same samples. ND indicates ‘not detected’. Data represent mean ± SEM obtained from three independent experiments (*** P
    Figure Legend Snippet: NF90 modulates the expression level of a subset of miRNAs in HepG2 cells. ( A ) Extracts of HepG2 cells transfected with non-targeting control siRNAs (Scr, Scr#2) or siRNA targeting NF90 (NF90, NF90#2) as indicated were analyzed by immunoblot using the antibodies indicated. ( B ) Total RNA extracted from cells transfected with siScr or siNF90 were analyzed by small RNA-seq. Results are shown as log 2 fold change versus –log 10 P -value. ( C ) Table summarizing the number of mature miRNAs and pri-miRNAs modulated in HepG2 cell line upon loss of NF90, according to small-RNA seq. ( D ) Total RNA extracted from cells described in (A) were analyzed by Taqman RT-qPCR as indicated. Results were normalized by those obtained for U6 abundance in the same samples. ND indicates ‘not detected’. Data represent mean ± SEM obtained from three independent experiments (*** P

    Techniques Used: Expressing, Transfection, RNA Sequencing Assay, Quantitative RT-PCR

    6) Product Images from "Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling"

    Article Title: Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling

    Journal: Cell Host & Microbe

    doi: 10.1016/j.chom.2018.10.007

    Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.
    Figure Legend Snippet: Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.

    Techniques Used: Expressing, Western Blot, Transduction, Plasmid Preparation, Infection, Real-time Polymerase Chain Reaction, Flow Cytometry, Cytometry, Fluorescence

    N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.
    Figure Legend Snippet: N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.

    Techniques Used: Expressing, Infection, Flow Cytometry, Cytometry, Fluorescence, Construct, Real-time Polymerase Chain Reaction, Plasmid Preparation

    7) Product Images from "Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling"

    Article Title: Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling

    Journal: Cell Host & Microbe

    doi: 10.1016/j.chom.2018.10.007

    Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.
    Figure Legend Snippet: Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.

    Techniques Used: Expressing, Western Blot, Transduction, Plasmid Preparation, Infection, Real-time Polymerase Chain Reaction, Flow Cytometry, Cytometry, Fluorescence

    N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.
    Figure Legend Snippet: N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.

    Techniques Used: Expressing, Infection, Flow Cytometry, Cytometry, Fluorescence, Construct, Real-time Polymerase Chain Reaction, Plasmid Preparation

    8) Product Images from "Comparative miRNA Analysis of Urine Extracellular Vesicles Isolated through Five Different Methods"

    Article Title: Comparative miRNA Analysis of Urine Extracellular Vesicles Isolated through Five Different Methods

    Journal: Cancers

    doi: 10.3390/cancers8120112

    Percentage of detection for each miRNA, employing ( a ) Taqman qPCR or ( b ) Multiplex Circulating miRNA Assay (Abcam).
    Figure Legend Snippet: Percentage of detection for each miRNA, employing ( a ) Taqman qPCR or ( b ) Multiplex Circulating miRNA Assay (Abcam).

    Techniques Used: Real-time Polymerase Chain Reaction, Multiplex Assay

    Correlation between signal intensity (Log 10 transformed) achieved by multiplex miRNA assay and C t values obtained by Taqman qPCR, using the same RNAs.
    Figure Legend Snippet: Correlation between signal intensity (Log 10 transformed) achieved by multiplex miRNA assay and C t values obtained by Taqman qPCR, using the same RNAs.

    Techniques Used: Transformation Assay, Multiplex Assay, Real-time Polymerase Chain Reaction

    9) Product Images from "Proteasome inhibition and oxidative reactions disrupt cellular homeostasis during heme stress"

    Article Title: Proteasome inhibition and oxidative reactions disrupt cellular homeostasis during heme stress

    Journal: Cell Death and Differentiation

    doi: 10.1038/cdd.2014.154

    Cell culture model of heme toxicity. ( a ) Hmox1 (+/+) and Hmox1 (−/−) cells were incubated with 10 μ M heme for 4 h. The relative Hmox1 mRNA induction in response to heme exposure was quantified by TaqMan RT-PCR. The mRNA levels are indicated as fold expression over control. No transcript was detected in the Hmox1 (−/−) cell line. ( b ) Cell pellets of Hmox1 (+/+) and Hmox1 (−/−) cells after 24 h of heme exposure (10 μ M). Before imaging, cells were washed three times in large volumes of PBS containing EDTA. ( c and d ) Hmox1 (+/+) MEFs (blue) and Hmox1 (−/−) MEFs (red) were treated with the indicated concentrations of heme for 12 h. Intracellular ATP ( c ) and caspase 3/7 activity ( d ) were measured by luminescence assays. Data represent the mean±S.D. of six biologic replicates. ( e ) Hmox1 (+/+) MEFs (blue) and Hmox1 (−/−) MEFs (red) were treated with the indicated concentrations of heme for 14 h. Condensed nuclei were quantified by digital image analysis after Hoechst staining. Data include images (15 per replicate) from three independent biologic replicates. ( f ) Hmox 1 (−/−) MEFs were incubated with or without 20 μ M heme for 12 h and stained with Hoechst (nuclei=yellow) and Alexa 488 phalloidin (actin cytoskeleton=cyan). The heme toxicity, which was characterized by cytoskeleton rarefication and nuclear condensation, was totally prevented by hemopexin (Hpx; 0.5 mg/ml). Images were acquired with a Zeiss Observer Z1 equipped with an ApoTome.2 module and an Axiocam MRm at × 400 original magnification. °indicates outlier values
    Figure Legend Snippet: Cell culture model of heme toxicity. ( a ) Hmox1 (+/+) and Hmox1 (−/−) cells were incubated with 10 μ M heme for 4 h. The relative Hmox1 mRNA induction in response to heme exposure was quantified by TaqMan RT-PCR. The mRNA levels are indicated as fold expression over control. No transcript was detected in the Hmox1 (−/−) cell line. ( b ) Cell pellets of Hmox1 (+/+) and Hmox1 (−/−) cells after 24 h of heme exposure (10 μ M). Before imaging, cells were washed three times in large volumes of PBS containing EDTA. ( c and d ) Hmox1 (+/+) MEFs (blue) and Hmox1 (−/−) MEFs (red) were treated with the indicated concentrations of heme for 12 h. Intracellular ATP ( c ) and caspase 3/7 activity ( d ) were measured by luminescence assays. Data represent the mean±S.D. of six biologic replicates. ( e ) Hmox1 (+/+) MEFs (blue) and Hmox1 (−/−) MEFs (red) were treated with the indicated concentrations of heme for 14 h. Condensed nuclei were quantified by digital image analysis after Hoechst staining. Data include images (15 per replicate) from three independent biologic replicates. ( f ) Hmox 1 (−/−) MEFs were incubated with or without 20 μ M heme for 12 h and stained with Hoechst (nuclei=yellow) and Alexa 488 phalloidin (actin cytoskeleton=cyan). The heme toxicity, which was characterized by cytoskeleton rarefication and nuclear condensation, was totally prevented by hemopexin (Hpx; 0.5 mg/ml). Images were acquired with a Zeiss Observer Z1 equipped with an ApoTome.2 module and an Axiocam MRm at × 400 original magnification. °indicates outlier values

    Techniques Used: Cell Culture, Incubation, Reverse Transcription Polymerase Chain Reaction, Expressing, Imaging, Activity Assay, Staining

    10) Product Images from "NF90 Modulates Processing of a Subset of Human Pri-miRNAs"

    Article Title: NF90 Modulates Processing of a Subset of Human Pri-miRNAs

    Journal: bioRxiv

    doi: 10.1101/2020.01.24.916957

    NF90 Modulates the Expression Level of a subset of miRNAs in HepG2 cells. (A) Extracts of HepG2 cells transfected with non-targeting control siRNAs (Scr, Scr#2) or siRNA targeting NF90 (NF90, NF90#2) as indicated were analyzed by immunoblot using the antibodies indicated. (B) Total RNA extracted from cells transfected with siScr or siNF90 were analyzed by small RNA-seq. Results are shown as log2 fold change versus –log10 p-value. (C) Total RNA extracted from cells described in (A) were analyzed by Taqman RT-qPCR as indicated. Results were normalized by those obtained for U6 abundance in the same samples. ND indicates “not detected”. Data represent mean ± SEM obtained from 3 independent experiments (*** P
    Figure Legend Snippet: NF90 Modulates the Expression Level of a subset of miRNAs in HepG2 cells. (A) Extracts of HepG2 cells transfected with non-targeting control siRNAs (Scr, Scr#2) or siRNA targeting NF90 (NF90, NF90#2) as indicated were analyzed by immunoblot using the antibodies indicated. (B) Total RNA extracted from cells transfected with siScr or siNF90 were analyzed by small RNA-seq. Results are shown as log2 fold change versus –log10 p-value. (C) Total RNA extracted from cells described in (A) were analyzed by Taqman RT-qPCR as indicated. Results were normalized by those obtained for U6 abundance in the same samples. ND indicates “not detected”. Data represent mean ± SEM obtained from 3 independent experiments (*** P

    Techniques Used: Expressing, Transfection, RNA Sequencing Assay, Quantitative RT-PCR

    11) Product Images from "Effects of advanced age upon astrocyte-specific responses to acute traumatic brain injury in mice"

    Article Title: Effects of advanced age upon astrocyte-specific responses to acute traumatic brain injury in mice

    Journal: Journal of Neuroinflammation

    doi: 10.1186/s12974-020-01800-w

    Validation of ACSA-2 astrocyte cell enrichment from brain tissue. a Generalized workflow for ACSA-2 magnetic bead enrichment of astrocytes from the injured brain parenchyma. Digested cell suspensions were labeled with the ACSA-2 magnetic bead before being placed in the magnetic column for removal of non-specific cells, which were collected into a tube as the ACSA-2 neg. fraction. Removal of the column from the magnetic stand allowed the flow-through of the retained ACSA-2 astrocytes to be collected as the ACSA-2 pos. fraction. RNA from both fractions was harvested to examine gene expression endpoints. b Gene expression analyses using putative markers of five neural tissue subsets: astrocyte ( Aldh1l1 ), neuronal ( Dlg4 ), oligodendroglial ( Klk6 ), microglial ( Tmem119 ), and endothelial ( Nostrin) . These data demonstrate a significant induction of putative astrocyte signature (orange bar), with little signature of other cell populations (blue bars). Log 2 fold change is a ratio of ACSA-2 pos to ACSA-2 neg . TLDA, Taqman low density array cards
    Figure Legend Snippet: Validation of ACSA-2 astrocyte cell enrichment from brain tissue. a Generalized workflow for ACSA-2 magnetic bead enrichment of astrocytes from the injured brain parenchyma. Digested cell suspensions were labeled with the ACSA-2 magnetic bead before being placed in the magnetic column for removal of non-specific cells, which were collected into a tube as the ACSA-2 neg. fraction. Removal of the column from the magnetic stand allowed the flow-through of the retained ACSA-2 astrocytes to be collected as the ACSA-2 pos. fraction. RNA from both fractions was harvested to examine gene expression endpoints. b Gene expression analyses using putative markers of five neural tissue subsets: astrocyte ( Aldh1l1 ), neuronal ( Dlg4 ), oligodendroglial ( Klk6 ), microglial ( Tmem119 ), and endothelial ( Nostrin) . These data demonstrate a significant induction of putative astrocyte signature (orange bar), with little signature of other cell populations (blue bars). Log 2 fold change is a ratio of ACSA-2 pos to ACSA-2 neg . TLDA, Taqman low density array cards

    Techniques Used: Labeling, Expressing, TLDA Assay

    12) Product Images from "Multiplex Real-Time Polymerase Chain Reaction for Simultaneous Quantification of Salmonella spp., Escherichia coli, and Staphylococcus aureus in Different Food Matrices: Advantages and Disadvantages"

    Article Title: Multiplex Real-Time Polymerase Chain Reaction for Simultaneous Quantification of Salmonella spp., Escherichia coli, and Staphylococcus aureus in Different Food Matrices: Advantages and Disadvantages

    Journal: BioMed Research International

    doi: 10.1155/2018/6104015

    Amplification curves (left) and standard curves through TaqMan qPCR of serial dilutions of target genes. Copy numbers of each gene: (a) ssf from Salmonella spp. (8.64 × 10 6 to 8.64 × 10 1 ); (b) pho A from Escherichia coli (7.2 × 10 5 to 7.2 × 10 1 ); (c) nuc from Staphylococcus aureus (1.3 × 10 5 to 1.3 × 10 0 ).
    Figure Legend Snippet: Amplification curves (left) and standard curves through TaqMan qPCR of serial dilutions of target genes. Copy numbers of each gene: (a) ssf from Salmonella spp. (8.64 × 10 6 to 8.64 × 10 1 ); (b) pho A from Escherichia coli (7.2 × 10 5 to 7.2 × 10 1 ); (c) nuc from Staphylococcus aureus (1.3 × 10 5 to 1.3 × 10 0 ).

    Techniques Used: Amplification, Real-time Polymerase Chain Reaction

    13) Product Images from "Exposure to galactic cosmic radiation compromises DNA repair and increases the potential for oncogenic chromosomal rearrangement in bronchial epithelial cells"

    Article Title: Exposure to galactic cosmic radiation compromises DNA repair and increases the potential for oncogenic chromosomal rearrangement in bronchial epithelial cells

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-29350-5

    Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for Taqman PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman qPCR assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.
    Figure Legend Snippet: Experimental strategy and example data. ( A ) Schematic depicting sites of Cas9/sgRNA cleavage relative to ALK and EML4 genes. Chevrons depict direction of transcription. Cleavage sites are within introns. Exon (ex) numbers are shown. P1 and P2 are primers for Taqman PCR assays. Taqman hybridization probe is shown with fluorophore (green) and quencher (black) that separate upon hybridization to amplicon. ( B ) Reconstruction experiment showing linearity of Taqman qPCR assay. ( C ) Experimental timeline showing irradiation, recovery, Cas9/sgRNA challenge, and harvesting of DNA for analysis. ( D,E ) Example Taqman PCR data. Independent cultures were irradiated, challenged, and DNA collected for analysis. Amplification curves are shown for single-copy internal standard (RNase P, Panel D) or for EML4-ALK junctions (Panel E). Irradiation was performed at an LET of 108 keV/μm). Parallel cultures not challenged with Cas9/sgRNAs were included in the experiment in Panel E but showed no detectable amplification products after 40 cycles of amplification. Plots depict normalized fluorescence reporter values (ΔRn) as a function of cycle number. Green line denotes software-determined threshold for determination of amplification (C t ) values.

    Techniques Used: Polymerase Chain Reaction, Hybridization, Amplification, Real-time Polymerase Chain Reaction, Irradiation, Fluorescence, Software

    Effect of irradiation on the frequency of Cas9/sgRNA-induced EML4-ALK rearrangement. ( A ) Effect of 108 keV/μm or 200 keV/μm 48 Ti on response to Cas9/sgRNA challenge. Triplicate cultures were irradiated as indicated, challenged by transduction with lentiviral Cas9/sgRNA vectors, and DNA was analysed by Taqman qPCR using RNase P as an internal standard. Significance was evaluated by ANOVA followed by 2-sided Dunnett t-tests *P
    Figure Legend Snippet: Effect of irradiation on the frequency of Cas9/sgRNA-induced EML4-ALK rearrangement. ( A ) Effect of 108 keV/μm or 200 keV/μm 48 Ti on response to Cas9/sgRNA challenge. Triplicate cultures were irradiated as indicated, challenged by transduction with lentiviral Cas9/sgRNA vectors, and DNA was analysed by Taqman qPCR using RNase P as an internal standard. Significance was evaluated by ANOVA followed by 2-sided Dunnett t-tests *P

    Techniques Used: Irradiation, Transduction, Real-time Polymerase Chain Reaction

    14) Product Images from "COLRAcinetobacter baumannii sRNA Signatures: Computational Comparative Identification and Biological Targets"

    Article Title: COLRAcinetobacter baumannii sRNA Signatures: Computational Comparative Identification and Biological Targets

    Journal: Frontiers in Microbiology

    doi: 10.3389/fmicb.2019.03075

    Custom TaqMan probe-based real-time qPCR validation of RNA-seq expression data on colistin resistant (COL R ) characterizing sRNAs.a value of 5-Fold Changes (FC) was indicated for incalculable FC due to the presence of a 0 value in one of the strains. ∗ p -value ≤ 0.01 obtained by a Student’s T -test and † q -value ≤ 0.01 according to the Rockhopper guidelines were considered statistically significant.
    Figure Legend Snippet: Custom TaqMan probe-based real-time qPCR validation of RNA-seq expression data on colistin resistant (COL R ) characterizing sRNAs.a value of 5-Fold Changes (FC) was indicated for incalculable FC due to the presence of a 0 value in one of the strains. ∗ p -value ≤ 0.01 obtained by a Student’s T -test and † q -value ≤ 0.01 according to the Rockhopper guidelines were considered statistically significant.

    Techniques Used: Real-time Polymerase Chain Reaction, RNA Sequencing Assay, Expressing

    15) Product Images from "Overexpression of prostate specific membrane antigen by canine hemangiosarcoma cells provides opportunity for the molecular detection of disease burdens within hemorrhagic body cavity effusions"

    Article Title: Overexpression of prostate specific membrane antigen by canine hemangiosarcoma cells provides opportunity for the molecular detection of disease burdens within hemorrhagic body cavity effusions

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0210297

    Gene transcription of PSMA across cell lines. (A) Validation of canine-specific TaqMan PSMA primer efficiency across 5-log orders of RNA concentration using CPA, a canine prostatic carcinoma cell line. (B) Comparative PSMA gene expression across canine cell lines. Relative PSMA expressions for six cHSA cell lines (red) compared to the non-malignant canine endothelial cell line, CAoEC (green). Positive and negative control cell lines include CPA (blue) and ACE-1 (purple), respectively. Representative data presented from 3 independent biologic replicates with 5 technical replicates for each cell line.
    Figure Legend Snippet: Gene transcription of PSMA across cell lines. (A) Validation of canine-specific TaqMan PSMA primer efficiency across 5-log orders of RNA concentration using CPA, a canine prostatic carcinoma cell line. (B) Comparative PSMA gene expression across canine cell lines. Relative PSMA expressions for six cHSA cell lines (red) compared to the non-malignant canine endothelial cell line, CAoEC (green). Positive and negative control cell lines include CPA (blue) and ACE-1 (purple), respectively. Representative data presented from 3 independent biologic replicates with 5 technical replicates for each cell line.

    Techniques Used: Concentration Assay, Expressing, Negative Control

    16) Product Images from "Dysregulation of human NEFM and NEFH mRNA stability by ALS-linked miRNAs"

    Article Title: Dysregulation of human NEFM and NEFH mRNA stability by ALS-linked miRNAs

    Journal: Molecular Brain

    doi: 10.1186/s13041-018-0386-3

    NEFM and NEFH transcript and protein levels are increased in spinal cord of ALS patients. ( a ) Real-time PCR using TaqMan and ( b ) Western blots were performed using ventral lumbar spinal cord samples of controls and ALS patients. ( c ) Quantification of Western blots in ( b ). Protein levels were normalized to GAPDH. Data was expressed as the mean ± SEM (Student t -test: **** p
    Figure Legend Snippet: NEFM and NEFH transcript and protein levels are increased in spinal cord of ALS patients. ( a ) Real-time PCR using TaqMan and ( b ) Western blots were performed using ventral lumbar spinal cord samples of controls and ALS patients. ( c ) Quantification of Western blots in ( b ). Protein levels were normalized to GAPDH. Data was expressed as the mean ± SEM (Student t -test: **** p

    Techniques Used: Real-time Polymerase Chain Reaction, Western Blot

    17) Product Images from "ASL Metabolically Regulates Tyrosine Hydroxylase in the Nucleus Locus Coeruleus"

    Article Title: ASL Metabolically Regulates Tyrosine Hydroxylase in the Nucleus Locus Coeruleus

    Journal: Cell Reports

    doi: 10.1016/j.celrep.2019.10.043

    ASL Is Highly Expressed in the LC and Regulates TH Levels (A) Left: in situ hybridization with Asl anti-sense mRNA probe showing in purple Asl prominent expression in the LC. Right: scheme of brain stem coronal section is shown. LC region is highlighted in purple (image adapted from The Mouse Brain Atlas). (B) Immunostaining of mouse brainstem for Asl (left, red), TH (center, green), and their merged co-localization (right). (C) Immunostaining of human brainstem for ASL (left, red), TH (center, green), and their merged co-localization (right). (D and E) Quantification of Asl mRNA (D) and TH mRNA (E) isolated by laser microdissection from the LC of Asl f/f ;TH Cre +/− and from Asl f/f control mice as measured by RT-PCR with specific TaqMan probes (n = 100 cells from 7 animals). (F) Immunohistochemistry quantification of TH protein normalized to cells number (n = 4 in each group). (G) Quantification of western blots for TH levels in LC regions taken by punch biopsies (n = 4 in each group). The bottom panels of (F) and (G) show representative images for each detection method, respectively. Data represent mean ± SEM ( ∗ p
    Figure Legend Snippet: ASL Is Highly Expressed in the LC and Regulates TH Levels (A) Left: in situ hybridization with Asl anti-sense mRNA probe showing in purple Asl prominent expression in the LC. Right: scheme of brain stem coronal section is shown. LC region is highlighted in purple (image adapted from The Mouse Brain Atlas). (B) Immunostaining of mouse brainstem for Asl (left, red), TH (center, green), and their merged co-localization (right). (C) Immunostaining of human brainstem for ASL (left, red), TH (center, green), and their merged co-localization (right). (D and E) Quantification of Asl mRNA (D) and TH mRNA (E) isolated by laser microdissection from the LC of Asl f/f ;TH Cre +/− and from Asl f/f control mice as measured by RT-PCR with specific TaqMan probes (n = 100 cells from 7 animals). (F) Immunohistochemistry quantification of TH protein normalized to cells number (n = 4 in each group). (G) Quantification of western blots for TH levels in LC regions taken by punch biopsies (n = 4 in each group). The bottom panels of (F) and (G) show representative images for each detection method, respectively. Data represent mean ± SEM ( ∗ p

    Techniques Used: In Situ Hybridization, Expressing, Immunostaining, Isolation, Laser Capture Microdissection, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Immunohistochemistry, Western Blot

    18) Product Images from "Can baseline serum microRNAs predict response to TNF-alpha inhibitors in rheumatoid arthritis?"

    Article Title: Can baseline serum microRNAs predict response to TNF-alpha inhibitors in rheumatoid arthritis?

    Journal: Arthritis Research & Therapy

    doi: 10.1186/s13075-016-1085-z

    Correlation between OpenArray and single assay results. A technical replication of the four selected miRNAs was performed. Per miRNA, all ADA ( a and b ) or ETN ( c and d ) samples from the discovery cohort were re-analyzed using TaqMan single miRNA assays. The normalized values for the OpenArray (ΔCrt) and single assay (ΔCt) for all 40 samples was plotted and the Spearman correlation (r) was calculated
    Figure Legend Snippet: Correlation between OpenArray and single assay results. A technical replication of the four selected miRNAs was performed. Per miRNA, all ADA ( a and b ) or ETN ( c and d ) samples from the discovery cohort were re-analyzed using TaqMan single miRNA assays. The normalized values for the OpenArray (ΔCrt) and single assay (ΔCt) for all 40 samples was plotted and the Spearman correlation (r) was calculated

    Techniques Used:

    19) Product Images from "Vitamin-D-Binding Protein Contributes to the Maintenance of α Cell Function and Glucagon Secretion"

    Article Title: Vitamin-D-Binding Protein Contributes to the Maintenance of α Cell Function and Glucagon Secretion

    Journal: Cell Reports

    doi: 10.1016/j.celrep.2020.107761

    DBP Alters α Cell and δ Cell Number and Size (A and B) Cell resolution reconstruction of pancreatic sections reveals no differences in α cell and β cell mass in DBP +/+ and DBP −/− mice (A), quantified in bar graph (B) (scale bar represents 530 μm; representative images are shown; inset is a zoom showing maintenance of cellular resolution in a single image; n = 9–12 sections from 3 to 4 animals; unpaired t test). (C–I) Morphological analyses of DBP −/− islets (C) reveal increased α cell number (D) and decreased α cell size (E) (representative images shown in right panel), but normal area occupied (F). By contrast, β cell number is increased (G), although β cell size (H) (representative images shown in right panel) and area (I) are unchanged (scale bar in D represents 85 μm; scale bars in E and H represent 10 μm; n = 24–45 islets from 3 to 4 animals; E and H are zooms of C to better show α cell and β cell size; DAPI is shown in blue; unpaired t test). (J–M) δ cell proportion (J and K; n = 55–79 islets from 4 to 5 animals) and size (L and M; n = 29 to 30 islets from 3 animals) are decreased in DBP −/− islets (scale bar in J represents 85 μm; scale bar in L represents 10 μm; representative images are shown; L is a zoom of J to better show δ cell size; unpaired t test). (N) Expression levels of the α cell differentiation markers Arx , Pax6 , Pou3f4 , and Irx2 are similar in DBP +/− and DBP −/− islets (n = 3–10 animals; Mann-Whitney test). Note that Arx , Pax6 , and Pou3f4 were quantified using SYBR Green chemistry, whereas Irx2 was quantified using Taqman reagents. For the sake of clarity, all genes are presented on the same graph normalized to their respective housekeeping gene. (O–Q) No changes in the proportion of α cells expressing PDX1 (O and P) or MAFA (O and Q) are detected in pancreatic sections from DBP −/− versus DBP +/+ islets (scale bar represents 85 μm; representative images are shown; n = 17–27 islets from 3 animals; unpaired t test). (R) DBP is expressed in a subpopulation of δ cells (arrows show SST + /DBP + cells; n = 3 animals; scale bar represents 85 μm). (S) The δ cell markers Hhex and Ghsr are not significantly different in DBP −/− islets (n = 8–10 animals; one-way ANOVA with Bonferroni’s multiple comparisons test). Bar graphs show scatterplot with mean ± SEM. ∗ p
    Figure Legend Snippet: DBP Alters α Cell and δ Cell Number and Size (A and B) Cell resolution reconstruction of pancreatic sections reveals no differences in α cell and β cell mass in DBP +/+ and DBP −/− mice (A), quantified in bar graph (B) (scale bar represents 530 μm; representative images are shown; inset is a zoom showing maintenance of cellular resolution in a single image; n = 9–12 sections from 3 to 4 animals; unpaired t test). (C–I) Morphological analyses of DBP −/− islets (C) reveal increased α cell number (D) and decreased α cell size (E) (representative images shown in right panel), but normal area occupied (F). By contrast, β cell number is increased (G), although β cell size (H) (representative images shown in right panel) and area (I) are unchanged (scale bar in D represents 85 μm; scale bars in E and H represent 10 μm; n = 24–45 islets from 3 to 4 animals; E and H are zooms of C to better show α cell and β cell size; DAPI is shown in blue; unpaired t test). (J–M) δ cell proportion (J and K; n = 55–79 islets from 4 to 5 animals) and size (L and M; n = 29 to 30 islets from 3 animals) are decreased in DBP −/− islets (scale bar in J represents 85 μm; scale bar in L represents 10 μm; representative images are shown; L is a zoom of J to better show δ cell size; unpaired t test). (N) Expression levels of the α cell differentiation markers Arx , Pax6 , Pou3f4 , and Irx2 are similar in DBP +/− and DBP −/− islets (n = 3–10 animals; Mann-Whitney test). Note that Arx , Pax6 , and Pou3f4 were quantified using SYBR Green chemistry, whereas Irx2 was quantified using Taqman reagents. For the sake of clarity, all genes are presented on the same graph normalized to their respective housekeeping gene. (O–Q) No changes in the proportion of α cells expressing PDX1 (O and P) or MAFA (O and Q) are detected in pancreatic sections from DBP −/− versus DBP +/+ islets (scale bar represents 85 μm; representative images are shown; n = 17–27 islets from 3 animals; unpaired t test). (R) DBP is expressed in a subpopulation of δ cells (arrows show SST + /DBP + cells; n = 3 animals; scale bar represents 85 μm). (S) The δ cell markers Hhex and Ghsr are not significantly different in DBP −/− islets (n = 8–10 animals; one-way ANOVA with Bonferroni’s multiple comparisons test). Bar graphs show scatterplot with mean ± SEM. ∗ p

    Techniques Used: Mouse Assay, Expressing, Cell Differentiation, MANN-WHITNEY, SYBR Green Assay

    20) Product Images from "Stochasticity in the miR-9/Hes1 oscillatory network can account for clonal heterogeneity in the timing of differentiation"

    Article Title: Stochasticity in the miR-9/Hes1 oscillatory network can account for clonal heterogeneity in the timing of differentiation

    Journal: eLife

    doi: 10.7554/eLife.16118

    Method to quantify miR-9 copy number. ( A ) Diagram showing the process of microRNA reverse transcription (Applied Biosystems TaqMan microRNA Reverse Transcription kit (4366596)) and TaqMan qRT-PCR (TaqMan Fast Advanced master mix reagent (Applied Biosystems 4444557)) using ThermoFisher Scientific’s stem loop primer for mouse miR-9-5p (product 4427975, assay ID 001089). ( B ) Graphs showing the efficacy of the stem loop primers to reverse transcribe the synthetic mature miR-9 variants as described on miRBase (accession MI0000157, deep sequencing mmu-miR-9-5p accession MIMAT0000142). Only the two longest forms, miR-9 UAUGA and miR-9 UAUG, are reliably reverse transcribed for amplification. This is highlighted by the high R 2 values and by all points of the curve residing on the trend line. The third graph is representative of the other 3 truncated forms tested (miR-9 UAU, UA and U) DOI: http://dx.doi.org/10.7554/eLife.16118.011
    Figure Legend Snippet: Method to quantify miR-9 copy number. ( A ) Diagram showing the process of microRNA reverse transcription (Applied Biosystems TaqMan microRNA Reverse Transcription kit (4366596)) and TaqMan qRT-PCR (TaqMan Fast Advanced master mix reagent (Applied Biosystems 4444557)) using ThermoFisher Scientific’s stem loop primer for mouse miR-9-5p (product 4427975, assay ID 001089). ( B ) Graphs showing the efficacy of the stem loop primers to reverse transcribe the synthetic mature miR-9 variants as described on miRBase (accession MI0000157, deep sequencing mmu-miR-9-5p accession MIMAT0000142). Only the two longest forms, miR-9 UAUGA and miR-9 UAUG, are reliably reverse transcribed for amplification. This is highlighted by the high R 2 values and by all points of the curve residing on the trend line. The third graph is representative of the other 3 truncated forms tested (miR-9 UAU, UA and U) DOI: http://dx.doi.org/10.7554/eLife.16118.011

    Techniques Used: Quantitative RT-PCR, Sequencing, Amplification

    21) Product Images from "Overexpression of prostate specific membrane antigen by canine hemangiosarcoma cells provides opportunity for the molecular detection of disease burdens within hemorrhagic body cavity effusions"

    Article Title: Overexpression of prostate specific membrane antigen by canine hemangiosarcoma cells provides opportunity for the molecular detection of disease burdens within hemorrhagic body cavity effusions

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0210297

    Gene transcription of PSMA across cell lines. (A) Validation of canine-specific TaqMan PSMA primer efficiency across 5-log orders of RNA concentration using CPA, a canine prostatic carcinoma cell line. (B) Comparative PSMA gene expression across canine cell lines. Relative PSMA expressions for six cHSA cell lines (red) compared to the non-malignant canine endothelial cell line, CAoEC (green). Positive and negative control cell lines include CPA (blue) and ACE-1 (purple), respectively. Representative data presented from 3 independent biologic replicates with 5 technical replicates for each cell line.
    Figure Legend Snippet: Gene transcription of PSMA across cell lines. (A) Validation of canine-specific TaqMan PSMA primer efficiency across 5-log orders of RNA concentration using CPA, a canine prostatic carcinoma cell line. (B) Comparative PSMA gene expression across canine cell lines. Relative PSMA expressions for six cHSA cell lines (red) compared to the non-malignant canine endothelial cell line, CAoEC (green). Positive and negative control cell lines include CPA (blue) and ACE-1 (purple), respectively. Representative data presented from 3 independent biologic replicates with 5 technical replicates for each cell line.

    Techniques Used: Concentration Assay, Expressing, Negative Control

    22) Product Images from "Circular RNA CpG island hypermethylation-associated silencing in human cancer"

    Article Title: Circular RNA CpG island hypermethylation-associated silencing in human cancer

    Journal: Oncotarget

    doi: 10.18632/oncotarget.25673

    circRNA effects on linear transcripts, miRNAs and tumor growth ( A ) Upon efficient transduction of TUSC3 circ104557 in HCT-116 cells (harboring a methylated CpG island), the TUSC3 linear RNA levels did not change: it was not detected in any of the conditions tested. ( B ) TUSC3 circ104557 transduction in DKO cells (harboring an unmethylated CpG island) did not affect the levels of TUSC3 linear RNA. RNA levels were determined using circular or linear specific qRT-PCR primers. The lentiviral transduction of the empty vector (Mock condition) was used as a control. Experiments were performed in technical triplicates. ( C ) Expression of candidate miRNAs putatively targeted by ATRNL1 circ100686 (miR-378a-3p), SAMD4A circ101356 (miR-660-5p and miR-330-3p) and TUSC3 circ104557 (miR-330-3p) was significantly downregulated in DKO cells, evaluated in three biological replicates by real-time quantitative PCR using TaqMan Advanced MicroRNA Assays. Expression levels were normalized using hsa-miR-345-5p, hsa-miR-191-5p and hsa-miR-423-3p advanced Control miRNA Assays. ( D ) Using the same strategy, expression of miR-330-3p, putatively targeted by TUSC3 circ104557, was also assessed in the gain-of-function cellular model. A significant downregulation of miR-330-3p was detected upon TUSC3 circ104557 transduction in HCT116 cells. ( E ) HCT116-Mock and HCT116-TUSC3 circular cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time (left panel) and tumor weight upon sacrifice (right panel) are shown. Tumor growth was significantly reduced upon TUSC3 circular ectopic expression. ns, nonsignificant; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001, using Student’s t -test. Error bars show means ± s.d.
    Figure Legend Snippet: circRNA effects on linear transcripts, miRNAs and tumor growth ( A ) Upon efficient transduction of TUSC3 circ104557 in HCT-116 cells (harboring a methylated CpG island), the TUSC3 linear RNA levels did not change: it was not detected in any of the conditions tested. ( B ) TUSC3 circ104557 transduction in DKO cells (harboring an unmethylated CpG island) did not affect the levels of TUSC3 linear RNA. RNA levels were determined using circular or linear specific qRT-PCR primers. The lentiviral transduction of the empty vector (Mock condition) was used as a control. Experiments were performed in technical triplicates. ( C ) Expression of candidate miRNAs putatively targeted by ATRNL1 circ100686 (miR-378a-3p), SAMD4A circ101356 (miR-660-5p and miR-330-3p) and TUSC3 circ104557 (miR-330-3p) was significantly downregulated in DKO cells, evaluated in three biological replicates by real-time quantitative PCR using TaqMan Advanced MicroRNA Assays. Expression levels were normalized using hsa-miR-345-5p, hsa-miR-191-5p and hsa-miR-423-3p advanced Control miRNA Assays. ( D ) Using the same strategy, expression of miR-330-3p, putatively targeted by TUSC3 circ104557, was also assessed in the gain-of-function cellular model. A significant downregulation of miR-330-3p was detected upon TUSC3 circ104557 transduction in HCT116 cells. ( E ) HCT116-Mock and HCT116-TUSC3 circular cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time (left panel) and tumor weight upon sacrifice (right panel) are shown. Tumor growth was significantly reduced upon TUSC3 circular ectopic expression. ns, nonsignificant; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001, using Student’s t -test. Error bars show means ± s.d.

    Techniques Used: Transduction, Methylation, Quantitative RT-PCR, Plasmid Preparation, Expressing, Real-time Polymerase Chain Reaction, Injection, Mouse Assay

    23) Product Images from "Dysregulation of human NEFM and NEFH mRNA stability by ALS-linked miRNAs"

    Article Title: Dysregulation of human NEFM and NEFH mRNA stability by ALS-linked miRNAs

    Journal: Molecular Brain

    doi: 10.1186/s13041-018-0386-3

    NEFM and NEFH transcript and protein levels are increased in spinal cord of ALS patients. ( a ) Real-time PCR using TaqMan and ( b ) Western blots were performed using ventral lumbar spinal cord samples of controls and ALS patients. ( c ) Quantification of Western blots in ( b ). Protein levels were normalized to GAPDH. Data was expressed as the mean ± SEM (Student t -test: **** p
    Figure Legend Snippet: NEFM and NEFH transcript and protein levels are increased in spinal cord of ALS patients. ( a ) Real-time PCR using TaqMan and ( b ) Western blots were performed using ventral lumbar spinal cord samples of controls and ALS patients. ( c ) Quantification of Western blots in ( b ). Protein levels were normalized to GAPDH. Data was expressed as the mean ± SEM (Student t -test: **** p

    Techniques Used: Real-time Polymerase Chain Reaction, Western Blot

    24) Product Images from "Patient DNA cross-reactivity of the CDC SARS-CoV-2 extraction control leads to an inherent potential for false negative results"

    Article Title: Patient DNA cross-reactivity of the CDC SARS-CoV-2 extraction control leads to an inherent potential for false negative results

    Journal: bioRxiv

    doi: 10.1101/2020.05.13.094839

    Positive signal from a transcript-specific RPP30 probe requires both RNA and reverse transcriptase (RT). The CDC-specified RP control requires neither RNA nor RT when genomic is present. Dilutions of either commercial RNA or DNA were used as input for reactions containing either Viral One-step RT-qPCR mastermix (containing reverse transcriptase) or TaqMan Fast qPCR mastermix (lacking reverse transcriptase) using either the CDC-specified or transcript-specific RPP30 probe. The transcript-specific probe generates signal only in reactions with an RNA input where reverse-transcriptase is present (as a one-step mastermix). Genomic DNA does not generate a signal above baseline even in an extended 50-cycle amplification, nor does RNA generate a signal in a qPCR-only (no reverse transcriptase) reaction for a transcript-specific probe. Signal generated for CDC-RP probe in PCR-only analysis of “RNA” is due to low-concentration genomic DNA present in Quantigene commercial RNA (supplemental discussion), further underscoring the need for transcript-specific primer design.
    Figure Legend Snippet: Positive signal from a transcript-specific RPP30 probe requires both RNA and reverse transcriptase (RT). The CDC-specified RP control requires neither RNA nor RT when genomic is present. Dilutions of either commercial RNA or DNA were used as input for reactions containing either Viral One-step RT-qPCR mastermix (containing reverse transcriptase) or TaqMan Fast qPCR mastermix (lacking reverse transcriptase) using either the CDC-specified or transcript-specific RPP30 probe. The transcript-specific probe generates signal only in reactions with an RNA input where reverse-transcriptase is present (as a one-step mastermix). Genomic DNA does not generate a signal above baseline even in an extended 50-cycle amplification, nor does RNA generate a signal in a qPCR-only (no reverse transcriptase) reaction for a transcript-specific probe. Signal generated for CDC-RP probe in PCR-only analysis of “RNA” is due to low-concentration genomic DNA present in Quantigene commercial RNA (supplemental discussion), further underscoring the need for transcript-specific primer design.

    Techniques Used: Quantitative RT-PCR, Real-time Polymerase Chain Reaction, Amplification, Generated, Polymerase Chain Reaction, Concentration Assay

    25) Product Images from "Comprehensive Exploration of Novel Chimeric Transcripts in Clear Cell Renal Cell Carcinomas Using Whole Transcriptome Analysis"

    Article Title: Comprehensive Exploration of Novel Chimeric Transcripts in Clear Cell Renal Cell Carcinomas Using Whole Transcriptome Analysis

    Journal: Genes, Chromosomes & Cancer

    doi: 10.1002/gcc.22211

    Levels of mRNA expression for the partner genes involved in chimeric transcripts in 26 paired samples of tumorous tissue (T) and non-cancerous renal cortex tissue (N) in the second cohort. mRNA expression was analyzed using custom TaqMan Gene Expression Assays on the 7500 Fast Real-Time PCR System (Life Technologies) employing the relative standard curve method. The probes and PCR primer sets used are summarized in Supporting Information Table S6. Experiments were performed in triplicate for each sample-primer set, and the mean value for the three experiments was used as the CT value. All CT values were normalized to that of GAPDH in the same sample. Levels of mRNA expression for the MMACHC, PTER, EPC2, ATXN7, FHIT, KIFAP3, CPEB1, MINPP1, TEX264, FAM107A , UPF3A, CDC16, MCCC1, CPSF3 , and ASAP2 genes were significantly reduced in T samples (shaded column) relative to N samples (white column). Bar, standard deviation.
    Figure Legend Snippet: Levels of mRNA expression for the partner genes involved in chimeric transcripts in 26 paired samples of tumorous tissue (T) and non-cancerous renal cortex tissue (N) in the second cohort. mRNA expression was analyzed using custom TaqMan Gene Expression Assays on the 7500 Fast Real-Time PCR System (Life Technologies) employing the relative standard curve method. The probes and PCR primer sets used are summarized in Supporting Information Table S6. Experiments were performed in triplicate for each sample-primer set, and the mean value for the three experiments was used as the CT value. All CT values were normalized to that of GAPDH in the same sample. Levels of mRNA expression for the MMACHC, PTER, EPC2, ATXN7, FHIT, KIFAP3, CPEB1, MINPP1, TEX264, FAM107A , UPF3A, CDC16, MCCC1, CPSF3 , and ASAP2 genes were significantly reduced in T samples (shaded column) relative to N samples (white column). Bar, standard deviation.

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Standard Deviation

    26) Product Images from "Early and consistent overexpression of ADRM1 in ovarian high-grade serous carcinoma"

    Article Title: Early and consistent overexpression of ADRM1 in ovarian high-grade serous carcinoma

    Journal: Journal of Ovarian Research

    doi: 10.1186/s13048-017-0347-y

    Amplification of RPN13 does not alter expression of protein. a Amplification of ADRM1 was assayed by Taqman Gene Assay and analyzed by CopyCaller™ Software for 7 ovarian cancer and 1 immortalized fallopian tube epithelial (FT2021) cell lines measured. Similarly, purified mRNA was measured by qRT-PCR and found to have no correlation with amplification status. b As assayed by Western blot, RPN13 protein levels vary little despite ADRM1 gene amplification status. Ratio to loading control, ß-actin, was calculated by comparing pixel density as measured by ImageJ. C) XTT cell viability assay of various HGSC cell lines with known RPN13 CNV. All cell lines were shown to be sensitive to RPN13 inhibition by RA190 regardless of amplification status
    Figure Legend Snippet: Amplification of RPN13 does not alter expression of protein. a Amplification of ADRM1 was assayed by Taqman Gene Assay and analyzed by CopyCaller™ Software for 7 ovarian cancer and 1 immortalized fallopian tube epithelial (FT2021) cell lines measured. Similarly, purified mRNA was measured by qRT-PCR and found to have no correlation with amplification status. b As assayed by Western blot, RPN13 protein levels vary little despite ADRM1 gene amplification status. Ratio to loading control, ß-actin, was calculated by comparing pixel density as measured by ImageJ. C) XTT cell viability assay of various HGSC cell lines with known RPN13 CNV. All cell lines were shown to be sensitive to RPN13 inhibition by RA190 regardless of amplification status

    Techniques Used: Amplification, Expressing, Gene Assay, Software, Purification, Quantitative RT-PCR, Western Blot, Viability Assay, Inhibition

    27) Product Images from "Targeting mir128-3p alleviates myocardial insulin resistance and prevents ischemia-induced heart failure"

    Article Title: Targeting mir128-3p alleviates myocardial insulin resistance and prevents ischemia-induced heart failure

    Journal: eLife

    doi: 10.7554/eLife.54298

    MiRNA analysis in 4w-MI myocardium. ( A ) Mature mir144-3p and mir145-5p in 4w-MI myocardium were measured using TaqMan Advanced miRNA qPCR (N = 6–8 mice). Data were normalized against mature mir191-5p expression. ( B ) In situ hybridization with digoxigenin-labeled mir128-3p probes was quantified using ImageJ software (N = 3–5 mice). Groups were compared using the Mann-Whitney test. ( C ) Pri-mir128-1 and Pri-mir128-2 measurement in 4w-MI myocardium using TaqMan Gene expression (N = 6–8 mice). Data were normalised against 18S expression. Data presented as mean ± SEM. Groups were compared using two-tailed Student’s t-test. MiRNA analysis in 4w-MI myocardium.
    Figure Legend Snippet: MiRNA analysis in 4w-MI myocardium. ( A ) Mature mir144-3p and mir145-5p in 4w-MI myocardium were measured using TaqMan Advanced miRNA qPCR (N = 6–8 mice). Data were normalized against mature mir191-5p expression. ( B ) In situ hybridization with digoxigenin-labeled mir128-3p probes was quantified using ImageJ software (N = 3–5 mice). Groups were compared using the Mann-Whitney test. ( C ) Pri-mir128-1 and Pri-mir128-2 measurement in 4w-MI myocardium using TaqMan Gene expression (N = 6–8 mice). Data were normalised against 18S expression. Data presented as mean ± SEM. Groups were compared using two-tailed Student’s t-test. MiRNA analysis in 4w-MI myocardium.

    Techniques Used: Real-time Polymerase Chain Reaction, Mouse Assay, Expressing, In Situ Hybridization, Labeling, Software, MANN-WHITNEY, Two Tailed Test

    Mir128-3p overexpression and inhibition optimization. Validation of mir128-3p mimic and antagomir. ( A ) mir128-3p mimic and ( B ) antagomir validation was carried out on H9C2 cells at different concentrations. Mature miRNA was measured by TaqMan Advanced miRNA qPCR. Data were normalized against mature mir191-5p expression (N = 3 experiments). Data presented as mean ± SEM. Groups were compared using one-way ANOVA followed by Bonferroni post hoc tests. Mir128-3p overexpression and inhibition optimization.
    Figure Legend Snippet: Mir128-3p overexpression and inhibition optimization. Validation of mir128-3p mimic and antagomir. ( A ) mir128-3p mimic and ( B ) antagomir validation was carried out on H9C2 cells at different concentrations. Mature miRNA was measured by TaqMan Advanced miRNA qPCR. Data were normalized against mature mir191-5p expression (N = 3 experiments). Data presented as mean ± SEM. Groups were compared using one-way ANOVA followed by Bonferroni post hoc tests. Mir128-3p overexpression and inhibition optimization.

    Techniques Used: Over Expression, Inhibition, Real-time Polymerase Chain Reaction, Expressing

    Mir128-3p level in rat cardiomyocytes after hypoxia. Mature mir128-3p was measured using TaqMan Advanced miRNA qPCR (N = 6 experiments). Data were normalized against mature mir191-5p expression. Data presented as mean ± SEM. Groups were compared using one-way ANOVA followed by Bonferroni post hoc tests. Mir128-3p level in rat cardiomyocytes after hypoxia.
    Figure Legend Snippet: Mir128-3p level in rat cardiomyocytes after hypoxia. Mature mir128-3p was measured using TaqMan Advanced miRNA qPCR (N = 6 experiments). Data were normalized against mature mir191-5p expression. Data presented as mean ± SEM. Groups were compared using one-way ANOVA followed by Bonferroni post hoc tests. Mir128-3p level in rat cardiomyocytes after hypoxia.

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Comparative miRNA Analysis of Urine Extracellular Vesicles Isolated through Five Different Methods
    Article Snippet: .. The TaqMan reactions were performed using the Taqman Advance miRNA assays (ThermoFisher Scientific) for the following miRNAs (hsa-let-7d-5p, hsa-let-7i-5p, hsa-mir-21-5p, hsa-mir-22-3p, hsa-mir-30c-5p, hsa-mir-92a-3p, hsa-mir-122-5p, hsa-mir-192-5p, hsa-mir-451a), and qPCR was performed in a Via7 using TaqMan® Fast Advanced Master Mix (ThermoFisher Scientific). ..

    Article Title: Prazosin Can Prevent Glucocorticoid Mediated Capillary Rarefaction
    Article Snippet: .. RNA was reverse transcribed using MMLV reverse transcriptase (New England Biolabs, Whitby ON Canada). cDNA were analyzed by Taqman qPCR using qPCR mastermix (#4444963; Invitrogen Canada) and Taqman probes for rat HPRT1 (Rn01527840_m1), VEGF-A (Rn00582935_m1), TSP-1 (Rn01513693_m1), Ang1 (Rn01504818_m1 or Mm00456503_m1), Ang 2 (Mm00545822_m1), MMP-2 (Mm00439498_m1), TIMP1 (Rn00587558_m1) and TGFβ1 (Rn99999016_m1) using the ABI 7500 Fast PCR system (Invitrogen Canada). .. For each sample, the comparative Ct method (2-ΔCt ) was used to determine relative mRNA expression of target genes relative to the housekeeping gene HPRT1.

    Article Title: Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling
    Article Snippet: .. TaqMan qPCR reactions contained 5 μl of eluted DNA, 300 nM forward and reverse primers against GFP, 150 nM probe, 20 μg salmon sperm DNA, and TaqMan Fast Advanced Master Mix (ThermoFisher Scientific). .. Standard curves generated from GFP cDNA plasmids were created for each assay.

    Article Title: Exposure to galactic cosmic radiation compromises DNA repair and increases the potential for oncogenic chromosomal rearrangement in bronchial epithelial cells
    Article Snippet: .. For Taqman qPCR, reactions (20 μl) contained Taqman Fast Advanced Master Mix (Applied Biosystems), primers P1, d(CAGTTGTGTTGTTCAATTTTTAAGGT) and P2, d(CTGTGTTGCAAGTATAACCCC), and Taqman probe, d(CTTCCCTCCCTCCCTCGTTC). .. A single copy gene RNase P was amplified as an internal standard by the TaqMan Copy Number Reference Assay (Life Technologies).

    Polymerase Chain Reaction:

    Article Title: Prazosin Can Prevent Glucocorticoid Mediated Capillary Rarefaction
    Article Snippet: .. RNA was reverse transcribed using MMLV reverse transcriptase (New England Biolabs, Whitby ON Canada). cDNA were analyzed by Taqman qPCR using qPCR mastermix (#4444963; Invitrogen Canada) and Taqman probes for rat HPRT1 (Rn01527840_m1), VEGF-A (Rn00582935_m1), TSP-1 (Rn01513693_m1), Ang1 (Rn01504818_m1 or Mm00456503_m1), Ang 2 (Mm00545822_m1), MMP-2 (Mm00439498_m1), TIMP1 (Rn00587558_m1) and TGFβ1 (Rn99999016_m1) using the ABI 7500 Fast PCR system (Invitrogen Canada). .. For each sample, the comparative Ct method (2-ΔCt ) was used to determine relative mRNA expression of target genes relative to the housekeeping gene HPRT1.

    Quantitative RT-PCR:

    Article Title: Circular RNA CpG island hypermethylation-associated silencing in human cancer
    Article Snippet: .. Next, RT-qPCR was performed using TaqMan Fast Advanced Master Mix (ThermoFisher, Cat. No. 4444557) and specific TaqMan assays. .. Advanced Control miRNA Assays hsa-miR-345-5p, hsa-miR-191-5p and hsa-miR-423-3p (ThermoFisher, Cat. No. ) were used as endogenous controls.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher taqman fast advanced master mix
    circRNA effects on linear transcripts, miRNAs and tumor growth ( A ) Upon efficient transduction of TUSC3 circ104557 in HCT-116 cells (harboring a methylated CpG island), the TUSC3 linear RNA levels did not change: it was not detected in any of the conditions tested. ( B ) TUSC3 circ104557 transduction in DKO cells (harboring an unmethylated CpG island) did not affect the levels of TUSC3 linear RNA. RNA levels were determined using circular or linear specific qRT-PCR primers. The lentiviral transduction of the empty vector (Mock condition) was used as a control. Experiments were performed in technical triplicates. ( C ) Expression of candidate miRNAs putatively targeted by ATRNL1 circ100686 (miR-378a-3p), SAMD4A circ101356 (miR-660-5p and miR-330-3p) and TUSC3 circ104557 (miR-330-3p) was significantly downregulated in DKO cells, evaluated in three biological replicates by real-time quantitative PCR using <t>TaqMan</t> Advanced MicroRNA Assays. Expression levels were normalized using hsa-miR-345-5p, hsa-miR-191-5p and hsa-miR-423-3p advanced Control miRNA Assays. ( D ) Using the same strategy, expression of miR-330-3p, putatively targeted by TUSC3 circ104557, was also assessed in the gain-of-function cellular model. A significant downregulation of miR-330-3p was detected upon TUSC3 circ104557 transduction in HCT116 cells. ( E ) HCT116-Mock and HCT116-TUSC3 circular cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time (left panel) and tumor weight upon sacrifice (right panel) are shown. Tumor growth was significantly reduced upon TUSC3 circular ectopic expression. ns, nonsignificant; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001, using Student’s t -test. Error bars show means ± s.d.
    Taqman Fast Advanced Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1087 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman fast advanced master mix/product/Thermo Fisher
    Average 99 stars, based on 1087 article reviews
    Price from $9.99 to $1999.99
    taqman fast advanced master mix - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    circRNA effects on linear transcripts, miRNAs and tumor growth ( A ) Upon efficient transduction of TUSC3 circ104557 in HCT-116 cells (harboring a methylated CpG island), the TUSC3 linear RNA levels did not change: it was not detected in any of the conditions tested. ( B ) TUSC3 circ104557 transduction in DKO cells (harboring an unmethylated CpG island) did not affect the levels of TUSC3 linear RNA. RNA levels were determined using circular or linear specific qRT-PCR primers. The lentiviral transduction of the empty vector (Mock condition) was used as a control. Experiments were performed in technical triplicates. ( C ) Expression of candidate miRNAs putatively targeted by ATRNL1 circ100686 (miR-378a-3p), SAMD4A circ101356 (miR-660-5p and miR-330-3p) and TUSC3 circ104557 (miR-330-3p) was significantly downregulated in DKO cells, evaluated in three biological replicates by real-time quantitative PCR using TaqMan Advanced MicroRNA Assays. Expression levels were normalized using hsa-miR-345-5p, hsa-miR-191-5p and hsa-miR-423-3p advanced Control miRNA Assays. ( D ) Using the same strategy, expression of miR-330-3p, putatively targeted by TUSC3 circ104557, was also assessed in the gain-of-function cellular model. A significant downregulation of miR-330-3p was detected upon TUSC3 circ104557 transduction in HCT116 cells. ( E ) HCT116-Mock and HCT116-TUSC3 circular cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time (left panel) and tumor weight upon sacrifice (right panel) are shown. Tumor growth was significantly reduced upon TUSC3 circular ectopic expression. ns, nonsignificant; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001, using Student’s t -test. Error bars show means ± s.d.

    Journal: Oncotarget

    Article Title: Circular RNA CpG island hypermethylation-associated silencing in human cancer

    doi: 10.18632/oncotarget.25673

    Figure Lengend Snippet: circRNA effects on linear transcripts, miRNAs and tumor growth ( A ) Upon efficient transduction of TUSC3 circ104557 in HCT-116 cells (harboring a methylated CpG island), the TUSC3 linear RNA levels did not change: it was not detected in any of the conditions tested. ( B ) TUSC3 circ104557 transduction in DKO cells (harboring an unmethylated CpG island) did not affect the levels of TUSC3 linear RNA. RNA levels were determined using circular or linear specific qRT-PCR primers. The lentiviral transduction of the empty vector (Mock condition) was used as a control. Experiments were performed in technical triplicates. ( C ) Expression of candidate miRNAs putatively targeted by ATRNL1 circ100686 (miR-378a-3p), SAMD4A circ101356 (miR-660-5p and miR-330-3p) and TUSC3 circ104557 (miR-330-3p) was significantly downregulated in DKO cells, evaluated in three biological replicates by real-time quantitative PCR using TaqMan Advanced MicroRNA Assays. Expression levels were normalized using hsa-miR-345-5p, hsa-miR-191-5p and hsa-miR-423-3p advanced Control miRNA Assays. ( D ) Using the same strategy, expression of miR-330-3p, putatively targeted by TUSC3 circ104557, was also assessed in the gain-of-function cellular model. A significant downregulation of miR-330-3p was detected upon TUSC3 circ104557 transduction in HCT116 cells. ( E ) HCT116-Mock and HCT116-TUSC3 circular cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time (left panel) and tumor weight upon sacrifice (right panel) are shown. Tumor growth was significantly reduced upon TUSC3 circular ectopic expression. ns, nonsignificant; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001, using Student’s t -test. Error bars show means ± s.d.

    Article Snippet: Next, RT-qPCR was performed using TaqMan Fast Advanced Master Mix (ThermoFisher, Cat. No. 4444557) and specific TaqMan assays.

    Techniques: Transduction, Methylation, Quantitative RT-PCR, Plasmid Preparation, Expressing, Real-time Polymerase Chain Reaction, Injection, Mouse Assay

    NF90 modulates the expression level of a subset of miRNAs in HepG2 cells. ( A ) Extracts of HepG2 cells transfected with non-targeting control siRNAs (Scr, Scr#2) or siRNA targeting NF90 (NF90, NF90#2) as indicated were analyzed by immunoblot using the antibodies indicated. ( B ) Total RNA extracted from cells transfected with siScr or siNF90 were analyzed by small RNA-seq. Results are shown as log 2 fold change versus –log 10 P -value. ( C ) Table summarizing the number of mature miRNAs and pri-miRNAs modulated in HepG2 cell line upon loss of NF90, according to small-RNA seq. ( D ) Total RNA extracted from cells described in (A) were analyzed by Taqman RT-qPCR as indicated. Results were normalized by those obtained for U6 abundance in the same samples. ND indicates ‘not detected’. Data represent mean ± SEM obtained from three independent experiments (*** P

    Journal: Nucleic Acids Research

    Article Title: NF90 modulates processing of a subset of human pri-miRNAs

    doi: 10.1093/nar/gkaa386

    Figure Lengend Snippet: NF90 modulates the expression level of a subset of miRNAs in HepG2 cells. ( A ) Extracts of HepG2 cells transfected with non-targeting control siRNAs (Scr, Scr#2) or siRNA targeting NF90 (NF90, NF90#2) as indicated were analyzed by immunoblot using the antibodies indicated. ( B ) Total RNA extracted from cells transfected with siScr or siNF90 were analyzed by small RNA-seq. Results are shown as log 2 fold change versus –log 10 P -value. ( C ) Table summarizing the number of mature miRNAs and pri-miRNAs modulated in HepG2 cell line upon loss of NF90, according to small-RNA seq. ( D ) Total RNA extracted from cells described in (A) were analyzed by Taqman RT-qPCR as indicated. Results were normalized by those obtained for U6 abundance in the same samples. ND indicates ‘not detected’. Data represent mean ± SEM obtained from three independent experiments (*** P

    Article Snippet: For RT-qPCR, RT was performed using TaqMan™ Reverse Transcription Reagent or TaqMan™ Advanced miRNA cDNA Synthesis Kit (Thermo Fisher). qPCRs were performed using GoTaq® Probe qPCR Master Mix (Promega) or TaqMan® Fast Advanced Master Mix (Thermo Fisher).

    Techniques: Expressing, Transfection, RNA Sequencing Assay, Quantitative RT-PCR

    Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.

    Journal: Cell Host & Microbe

    Article Title: Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling

    doi: 10.1016/j.chom.2018.10.007

    Figure Lengend Snippet: Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.

    Article Snippet: TaqMan qPCR reactions contained 5 μl of eluted DNA, 300 nM forward and reverse primers against GFP, 150 nM probe, 20 μg salmon sperm DNA, and TaqMan Fast Advanced Master Mix (ThermoFisher Scientific).

    Techniques: Expressing, Western Blot, Transduction, Plasmid Preparation, Infection, Real-time Polymerase Chain Reaction, Flow Cytometry, Cytometry, Fluorescence

    N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.

    Journal: Cell Host & Microbe

    Article Title: Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling

    doi: 10.1016/j.chom.2018.10.007

    Figure Lengend Snippet: N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.

    Article Snippet: TaqMan qPCR reactions contained 5 μl of eluted DNA, 300 nM forward and reverse primers against GFP, 150 nM probe, 20 μg salmon sperm DNA, and TaqMan Fast Advanced Master Mix (ThermoFisher Scientific).

    Techniques: Expressing, Infection, Flow Cytometry, Cytometry, Fluorescence, Construct, Real-time Polymerase Chain Reaction, Plasmid Preparation

    Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.

    Journal: Cell Host & Microbe

    Article Title: Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling

    doi: 10.1016/j.chom.2018.10.007

    Figure Lengend Snippet: Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.

    Article Snippet: TaqMan qPCR reactions contained 5 μl of eluted DNA, 300 nM forward and reverse primers against GFP, 150 nM probe, 20 μg salmon sperm DNA, and TaqMan Fast Advanced Master Mix (ThermoFisher Scientific).

    Techniques: Expressing, Western Blot, Transduction, Plasmid Preparation, Infection, Real-time Polymerase Chain Reaction, Flow Cytometry, Cytometry, Fluorescence

    N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.

    Journal: Cell Host & Microbe

    Article Title: Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling

    doi: 10.1016/j.chom.2018.10.007

    Figure Lengend Snippet: N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.

    Article Snippet: TaqMan qPCR reactions contained 5 μl of eluted DNA, 300 nM forward and reverse primers against GFP, 150 nM probe, 20 μg salmon sperm DNA, and TaqMan Fast Advanced Master Mix (ThermoFisher Scientific).

    Techniques: Expressing, Infection, Flow Cytometry, Cytometry, Fluorescence, Construct, Real-time Polymerase Chain Reaction, Plasmid Preparation