taqman fast advanced master mix  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher taqman fast advanced master mix
    Taqman Fast Advanced Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 363 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman fast advanced master mix/product/Thermo Fisher
    Average 99 stars, based on 363 article reviews
    Price from $9.99 to $1999.99
    taqman fast advanced master mix - by Bioz Stars, 2020-02
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Distinct RhoGEFs Activate Apical and Junctional Contractility under Control of G Proteins during Epithelial Morphogenesis
    Article Snippet: .. Real-time PCR was performed on a CFX96 QPCR detection system (Bio-RAD) using TaqMan Fast Advanced Master Mix (Life technologies) with the following TaqMan probes, following classical TaqMan protocol: • CG10188 : Dm01811075_m1 = probe located in E2 (exon 2-3 boundary, 1210 / GenBank NM_001273659 , amplicon = 57bp). .. • RPl32 : House-keeping gene reference: Dm02151827_g1: (exon 2-3 boundary, 377 / GenBank NM_001144655 , amplicon = 72bp) • RPII140: House-keeping gene: Dm02134593_g1 (exon 2-3 boundary, 2347 / GenBank NM_001300394 , amplicon = 78bp) • Act42A: House-keeping gene: Dm02362162_g1 (one exon, 1439 / GenBank NM_078901 , amplicon = 108bp) RT-qPCR conditions were as follows: 50° for 2min; 95° for 10min; 40 cycles [95°C for 15 s and 60°C for 1min].

    Article Title: Source of Dietary Fat in Pig Diet Affects Adipose Expression of Genes Related to Cancer, Cardiovascular, and Neurodegenerative Diseases
    Article Snippet: .. The reaction mix contained 1 µL of cDNA, 5 µL of TaqMan™ Fast Advanced Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 3.23 µL of water, 0.17 µL of 60 × TaqMan assay for OAZ1 (endogenous control) amplification (Assay ID: Ss03397505_u1), and 0.5 µL of 20 × TaqMan gene expression assay for amplification of the target gene (CD200R1 Assay ID: Ss04324657_m1, CD209 Assay ID: Ss03819234_g1, F3 Assay ID: Ss03381417_u1, CYBB Assay ID: Ss03391378_m1, ZNF217 Assay ID: Ss03390845_m1, and PLAU assay ID: Ss03391043_m1). .. The relative quantity (RQ) of each sample was calculated based on the ΔΔCt method using QuantStudioTM 6 and 7 flex real-time PCR software.

    Synthesized:

    Article Title: Transplantation of Neural Progenitors and V2a Interneurons after Spinal Cord Injury
    Article Snippet: .. The complementary DNA (cDNA) was synthesized using a high capacity RNA to cDNA kit (ThermoFisher, #4368814) and combined with TaqMan Gene Expression Assays and TaqMan Fast Advanced Master Mix (Applied Biosystems, #4444963). qRT-PCR was performed using a QuantStudio 3 (Applied Biosystems, CA) thermocycler with the following protocol: 95°C for 20 sec; 40 cycles of 95°C for 1 sec, and 60°C for 20 sec. .. Expression of transcription factor messenger RNA (mRNA) of Evx1, En1, Chx10, Lhx3, and Hb9 was assessed in each NPC sample described above and compared with level of expression in embryonic (E13.5) spinal cord tissue (FSC) and graphically represented as a percent relative to expression in FSC, with FSC levels set as 100%.

    Article Title: Source of Dietary Fat in Pig Diet Affects Adipose Expression of Genes Related to Cancer, Cardiovascular, and Neurodegenerative Diseases
    Article Snippet: The same samples were used for RNA-seq and qPCR analysis. cDNA was synthesized from 500 ng of total RNA with the cDNA Archive Kit (Thermo Fisher Scientific, Waltham, MA). qPCR was performed in triplicates on a QuantStudio 7–Flex Instrument (Thermo Fisher Scientific, Waltham, MA, USA) under the fast thermal profile. .. The reaction mix contained 1 µL of cDNA, 5 µL of TaqMan™ Fast Advanced Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 3.23 µL of water, 0.17 µL of 60 × TaqMan assay for OAZ1 (endogenous control) amplification (Assay ID: Ss03397505_u1), and 0.5 µL of 20 × TaqMan gene expression assay for amplification of the target gene (CD200R1 Assay ID: Ss04324657_m1, CD209 Assay ID: Ss03819234_g1, F3 Assay ID: Ss03381417_u1, CYBB Assay ID: Ss03391378_m1, ZNF217 Assay ID: Ss03390845_m1, and PLAU assay ID: Ss03391043_m1).

    Article Title: Acute Exposure to Low Level Light at Night is Sufficient to Induce Neurological Changes and Depressive-like Behavior
    Article Snippet: RNA quantity and quality was assessed using a spectrophotometer (Nanodrop One, Wilmington, DE) and then cDNA was synthesized using M-MLV reverse transcriptase and diluted 1:10 for subsequent analysis via PCR. .. For qRT-PCR, 4μl (40μg) of diluted cDNA was combined with 16μl of master mix solution containing: Taqman Fast Advanced Master Mix (Life Technologies, Carlsbad, CA), an inventoried probe from Applied Biosystems (Life Technologies, Carlsbad, CA) , a primer-limited probe for the endogenous control GAPDH, and water.

    Quantitative RT-PCR:

    Article Title: TIMP1 mRNA in tumor-educated platelets is diagnostic biomarker for colorectal cancer
    Article Snippet: .. Quantitative real-time reverse transcription polymerase chain reaction qRT-PCR performed with a CFX Connect Real-Time System (Bio-Rad Laboratories, Hercules, CA, USA) using the TaqMan® Reverse Transcription Kit and the TaqMan® Fast Advanced Master Mix (Applied Biosystems, Foster City, CA, USA) according the manufacturer’s instructions. .. Cell culture HT29 and Caco-2 cells were purchased from the Institute of Cell Biology at the Chinese Academy of Sciences (Shanghai, China) and cultured in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin in a humidified atmosphere containing 5% CO2 /95% air at 37° C.

    Article Title: Epithelial HIF-1α/claudin-1 axis regulates barrier dysfunction in eosinophilic esophagitis
    Article Snippet: .. Total RNA was prepared from human mucosal pinch biopsies, whole esophageal mouse tissues, or cultured cells with RNeasy Mini Kits (Qiagen), first-strand cDNA synthesis using the High Capacity cDNA archive kit (Applied Biosystems), and TaqMan Gene Expression Assays TaqMan probes in real-time RT-PCR reactions using TaqMan Fast Advanced Master Mix (Applied Biosystems). .. Thermocycling and analysis were performed with an ABI-7300 System and software, and data calculated as relative quantification were normalized to 18S (2–ΔΔCt ; refs. , ).

    Article Title: Distinct RhoGEFs Activate Apical and Junctional Contractility under Control of G Proteins during Epithelial Morphogenesis
    Article Snippet: Paragraph title: RT-qPCR experiment ... Real-time PCR was performed on a CFX96 QPCR detection system (Bio-RAD) using TaqMan Fast Advanced Master Mix (Life technologies) with the following TaqMan probes, following classical TaqMan protocol: • CG10188 : Dm01811075_m1 = probe located in E2 (exon 2-3 boundary, 1210 / GenBank NM_001273659 , amplicon = 57bp).

    Article Title: The A3 adenosine receptor agonist, namodenoson, ameliorates non-alcoholic steatohepatitis in mice
    Article Snippet: .. RT-qPCR was performed for the quantification gene expression of the encoded α-SMA, compared to β-actin as a housekeeping gene using TaqMan Fast Advanced Master Mix (Applied Biosystems). ..

    Article Title: Annexin A2 Deficiency Exacerbates Neuroinflammation and Long-Term Neurological Deficits after Traumatic Brain Injury in Mice
    Article Snippet: .. The mRNA levels were measured by RT-qPCR using TaqMan® Fast Advanced Master Mix (Applied Biosystems, Foster City, CA, USA) in an ABI 7500 real-time PCR system (Applied Biosystems). .. TaqMan probes were used as follows: Mm00434228_m1 (IL-1β), Mm00443258_m1 (TNFα), Mm00516024_g1 (ICAM1), Mm01320970_m1 (VCAM1), Mm00441278_m1 (E-selectin), Mm01545399_m1 (HPRT).

    Article Title: Transplantation of Neural Progenitors and V2a Interneurons after Spinal Cord Injury
    Article Snippet: .. The complementary DNA (cDNA) was synthesized using a high capacity RNA to cDNA kit (ThermoFisher, #4368814) and combined with TaqMan Gene Expression Assays and TaqMan Fast Advanced Master Mix (Applied Biosystems, #4444963). qRT-PCR was performed using a QuantStudio 3 (Applied Biosystems, CA) thermocycler with the following protocol: 95°C for 20 sec; 40 cycles of 95°C for 1 sec, and 60°C for 20 sec. .. Expression of transcription factor messenger RNA (mRNA) of Evx1, En1, Chx10, Lhx3, and Hb9 was assessed in each NPC sample described above and compared with level of expression in embryonic (E13.5) spinal cord tissue (FSC) and graphically represented as a percent relative to expression in FSC, with FSC levels set as 100%.

    Article Title: Acute Exposure to Low Level Light at Night is Sufficient to Induce Neurological Changes and Depressive-like Behavior
    Article Snippet: .. For qRT-PCR, 4μl (40μg) of diluted cDNA was combined with 16μl of master mix solution containing: Taqman Fast Advanced Master Mix (Life Technologies, Carlsbad, CA), an inventoried probe from Applied Biosystems (Life Technologies, Carlsbad, CA) , a primer-limited probe for the endogenous control GAPDH, and water. .. The 2-step real-time PCR cycling conditions used were 95 °C for 20 s, 40 cycles of 95 °C for 3 s, and then 60 °C for 30 s. Gene expression was quantified using the Pfaffl Method .

    Article Title: RNAi-Mediated β-Catenin Inhibition Promotes T Cell Infiltration and Antitumor Activity in Combination with Immune Checkpoint Blockade
    Article Snippet: .. The cDNA was then diluted 4 times for qRT-PCR using TaqMan Fast Advanced Master Mix (Applied Biosystems) and murine gene-specific primer-probe sets. .. The following primer-probe sets from Life Technologies were used: Ctnnb1 (Mm00483039_m1), mouse Cd8a (Mm01182107_g1), mouse Ccl4 (Mm00443111_m1), mouse Pdcd1 (Mm01285676_m1), mouse Cd274 (Mm00452054_m1), mouse Cd247 (Mm00446171_m1), mouse Ppib (Mm00478295_m1), mouse Cxcl10 (Mm00445235_m1), mouse Cxcl11 (Mm00444662_m1), Cxcl9 (Mm00434946_m1), Stat1 (Mm01257286_m1), Ido1 (Mm00492590_m1), Ifng (Mm01168134_m1), human CTNNB1 (Hs00355045_m1), and human AXIN2 (Hs00610344_m1).

    Article Title: Septin 9 isoforms promote tumorigenesis in mammary epithelial cells by increasing migration and ECM degradation through metalloproteinase secretion at focal adhesions.
    Article Snippet: .. Real-Time qRT-PCR was performed using Applied Biosystems Fast SYBR Green Master Mix and TaqMan Fast Advanced Master Mix with the StepOnePlus Real-Time PCR System (Life Technologies Corp., Carlsbad, CA, USA). .. Correlation analyses were performed by computing the normalized read counts for each analyzed MCF7 line with the levels obtained by TaqMan assay.

    Real-time Polymerase Chain Reaction:

    Article Title: CRISPR-Cas9–mediated therapeutic editing of Rpe65 ameliorates the disease phenotypes in a mouse model of Leber congenital amaurosis
    Article Snippet: .. Real-time PCR was performed with the StepOnePlus Real-Time PCR System (Thermo Fisher) using TaqMan Fast Advanced Master Mix (Thermo Fisher) with Gene Expression Assays (Thermo Fisher) for gene expression analyses. .. Product IDs of the gene expression assays for genes are as follows: for Rpe65 , Mm00504133_m1; for Gapdh , Mm99999915_g1; and for Rn18s , Mm03928990_g1.

    Article Title: Assessment of methods for serum extracellular vesicle small RNA sequencing to support biomarker development
    Article Snippet: .. Quantitative PCR cDNA was generated using 2 µL of purified total RNA (from three healthy donors) with the TaqMan Advanced miRNA cDNA Synthesis kit per the manufacturer’s instructions (Thermo Fisher Scientific). qPCR was then performed (in triplicate) for each sample using 2 µL of diluted cDNA, TaqMan Advanced miRNA Assays (given below), and Applied Biosystems™ TaqMan™ Fast Advanced Master Mix under fast cycling conditions on the ABI 7500 Fast real-time PCR system (Thermo Fisher Scientific). .. Ten miRNAs were selected and quantified for expression with U6 snRNA as the normalizer (Table S2). miRNA abundance was evaluated in four biological replicates for each group with three technical replicates for each primer pair.

    Article Title: Distinct RhoGEFs Activate Apical and Junctional Contractility under Control of G Proteins during Epithelial Morphogenesis
    Article Snippet: .. Real-time PCR was performed on a CFX96 QPCR detection system (Bio-RAD) using TaqMan Fast Advanced Master Mix (Life technologies) with the following TaqMan probes, following classical TaqMan protocol: • CG10188 : Dm01811075_m1 = probe located in E2 (exon 2-3 boundary, 1210 / GenBank NM_001273659 , amplicon = 57bp). .. • RPl32 : House-keeping gene reference: Dm02151827_g1: (exon 2-3 boundary, 377 / GenBank NM_001144655 , amplicon = 72bp) • RPII140: House-keeping gene: Dm02134593_g1 (exon 2-3 boundary, 2347 / GenBank NM_001300394 , amplicon = 78bp) • Act42A: House-keeping gene: Dm02362162_g1 (one exon, 1439 / GenBank NM_078901 , amplicon = 108bp) RT-qPCR conditions were as follows: 50° for 2min; 95° for 10min; 40 cycles [95°C for 15 s and 60°C for 1min].

    Article Title: Annexin A2 Deficiency Exacerbates Neuroinflammation and Long-Term Neurological Deficits after Traumatic Brain Injury in Mice
    Article Snippet: .. The mRNA levels were measured by RT-qPCR using TaqMan® Fast Advanced Master Mix (Applied Biosystems, Foster City, CA, USA) in an ABI 7500 real-time PCR system (Applied Biosystems). .. TaqMan probes were used as follows: Mm00434228_m1 (IL-1β), Mm00443258_m1 (TNFα), Mm00516024_g1 (ICAM1), Mm01320970_m1 (VCAM1), Mm00441278_m1 (E-selectin), Mm01545399_m1 (HPRT).

    Article Title: SOX30, a target gene of miR-653-5p, represses the proliferation and invasion of prostate cancer cells through inhibition of Wnt/β-catenin signaling
    Article Snippet: Paragraph title: Quantitative real-time PCR analysis ... MiR-653-5p expression was determined with TaqMan Fast Advanced Master Mix (Applied Biosystems), using U6 as the internal control.

    Article Title: Transplantation of Neural Progenitors and V2a Interneurons after Spinal Cord Injury
    Article Snippet: Paragraph title: Quantitative real-time polymerase chain reaction (qRT-PCR) ... The complementary DNA (cDNA) was synthesized using a high capacity RNA to cDNA kit (ThermoFisher, #4368814) and combined with TaqMan Gene Expression Assays and TaqMan Fast Advanced Master Mix (Applied Biosystems, #4444963). qRT-PCR was performed using a QuantStudio 3 (Applied Biosystems, CA) thermocycler with the following protocol: 95°C for 20 sec; 40 cycles of 95°C for 1 sec, and 60°C for 20 sec.

    Article Title: Source of Dietary Fat in Pig Diet Affects Adipose Expression of Genes Related to Cancer, Cardiovascular, and Neurodegenerative Diseases
    Article Snippet: Paragraph title: 2.2. RNA Isolation, RNA-Seq, and qPCR Procedures ... The reaction mix contained 1 µL of cDNA, 5 µL of TaqMan™ Fast Advanced Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 3.23 µL of water, 0.17 µL of 60 × TaqMan assay for OAZ1 (endogenous control) amplification (Assay ID: Ss03397505_u1), and 0.5 µL of 20 × TaqMan gene expression assay for amplification of the target gene (CD200R1 Assay ID: Ss04324657_m1, CD209 Assay ID: Ss03819234_g1, F3 Assay ID: Ss03381417_u1, CYBB Assay ID: Ss03391378_m1, ZNF217 Assay ID: Ss03390845_m1, and PLAU assay ID: Ss03391043_m1).

    Article Title: Acute Exposure to Low Level Light at Night is Sufficient to Induce Neurological Changes and Depressive-like Behavior
    Article Snippet: For qRT-PCR, 4μl (40μg) of diluted cDNA was combined with 16μl of master mix solution containing: Taqman Fast Advanced Master Mix (Life Technologies, Carlsbad, CA), an inventoried probe from Applied Biosystems (Life Technologies, Carlsbad, CA) , a primer-limited probe for the endogenous control GAPDH, and water. .. The 2-step real-time PCR cycling conditions used were 95 °C for 20 s, 40 cycles of 95 °C for 3 s, and then 60 °C for 30 s. Gene expression was quantified using the Pfaffl Method .

    Article Title: Septin 9 isoforms promote tumorigenesis in mammary epithelial cells by increasing migration and ECM degradation through metalloproteinase secretion at focal adhesions.
    Article Snippet: .. Real-Time qRT-PCR was performed using Applied Biosystems Fast SYBR Green Master Mix and TaqMan Fast Advanced Master Mix with the StepOnePlus Real-Time PCR System (Life Technologies Corp., Carlsbad, CA, USA). .. Correlation analyses were performed by computing the normalized read counts for each analyzed MCF7 line with the levels obtained by TaqMan assay.

    Expressing:

    Article Title: CRISPR-Cas9–mediated therapeutic editing of Rpe65 ameliorates the disease phenotypes in a mouse model of Leber congenital amaurosis
    Article Snippet: .. Real-time PCR was performed with the StepOnePlus Real-Time PCR System (Thermo Fisher) using TaqMan Fast Advanced Master Mix (Thermo Fisher) with Gene Expression Assays (Thermo Fisher) for gene expression analyses. .. Product IDs of the gene expression assays for genes are as follows: for Rpe65 , Mm00504133_m1; for Gapdh , Mm99999915_g1; and for Rn18s , Mm03928990_g1.

    Article Title: Epithelial HIF-1α/claudin-1 axis regulates barrier dysfunction in eosinophilic esophagitis
    Article Snippet: .. Total RNA was prepared from human mucosal pinch biopsies, whole esophageal mouse tissues, or cultured cells with RNeasy Mini Kits (Qiagen), first-strand cDNA synthesis using the High Capacity cDNA archive kit (Applied Biosystems), and TaqMan Gene Expression Assays TaqMan probes in real-time RT-PCR reactions using TaqMan Fast Advanced Master Mix (Applied Biosystems). .. Thermocycling and analysis were performed with an ABI-7300 System and software, and data calculated as relative quantification were normalized to 18S (2–ΔΔCt ; refs. , ).

    Article Title: Assessment of methods for serum extracellular vesicle small RNA sequencing to support biomarker development
    Article Snippet: Quantitative PCR cDNA was generated using 2 µL of purified total RNA (from three healthy donors) with the TaqMan Advanced miRNA cDNA Synthesis kit per the manufacturer’s instructions (Thermo Fisher Scientific). qPCR was then performed (in triplicate) for each sample using 2 µL of diluted cDNA, TaqMan Advanced miRNA Assays (given below), and Applied Biosystems™ TaqMan™ Fast Advanced Master Mix under fast cycling conditions on the ABI 7500 Fast real-time PCR system (Thermo Fisher Scientific). .. Ten miRNAs were selected and quantified for expression with U6 snRNA as the normalizer (Table S2). miRNA abundance was evaluated in four biological replicates for each group with three technical replicates for each primer pair.

    Article Title: The A3 adenosine receptor agonist, namodenoson, ameliorates non-alcoholic steatohepatitis in mice
    Article Snippet: .. RT-qPCR was performed for the quantification gene expression of the encoded α-SMA, compared to β-actin as a housekeeping gene using TaqMan Fast Advanced Master Mix (Applied Biosystems). ..

    Article Title: Annexin A2 Deficiency Exacerbates Neuroinflammation and Long-Term Neurological Deficits after Traumatic Brain Injury in Mice
    Article Snippet: Since it is known that elevated pro-inflammatory cytokine gene expression occurs from hours to days after TBI [ ], total RNA from mouse cortical brain tissues or micro-vessels were isolated at day 1 after TBI with miRNeasy micro kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s instruction followed by cDNA synthesis with QuantiTect Reverse Transcription Kit (Qiagen). .. The mRNA levels were measured by RT-qPCR using TaqMan® Fast Advanced Master Mix (Applied Biosystems, Foster City, CA, USA) in an ABI 7500 real-time PCR system (Applied Biosystems).

    Article Title: SOX30, a target gene of miR-653-5p, represses the proliferation and invasion of prostate cancer cells through inhibition of Wnt/β-catenin signaling
    Article Snippet: .. MiR-653-5p expression was determined with TaqMan Fast Advanced Master Mix (Applied Biosystems), using U6 as the internal control. .. Target gene expression was determined with the 2−ΔΔCt method.

    Article Title: Transplantation of Neural Progenitors and V2a Interneurons after Spinal Cord Injury
    Article Snippet: .. The complementary DNA (cDNA) was synthesized using a high capacity RNA to cDNA kit (ThermoFisher, #4368814) and combined with TaqMan Gene Expression Assays and TaqMan Fast Advanced Master Mix (Applied Biosystems, #4444963). qRT-PCR was performed using a QuantStudio 3 (Applied Biosystems, CA) thermocycler with the following protocol: 95°C for 20 sec; 40 cycles of 95°C for 1 sec, and 60°C for 20 sec. .. Expression of transcription factor messenger RNA (mRNA) of Evx1, En1, Chx10, Lhx3, and Hb9 was assessed in each NPC sample described above and compared with level of expression in embryonic (E13.5) spinal cord tissue (FSC) and graphically represented as a percent relative to expression in FSC, with FSC levels set as 100%.

    Article Title: Source of Dietary Fat in Pig Diet Affects Adipose Expression of Genes Related to Cancer, Cardiovascular, and Neurodegenerative Diseases
    Article Snippet: .. The reaction mix contained 1 µL of cDNA, 5 µL of TaqMan™ Fast Advanced Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 3.23 µL of water, 0.17 µL of 60 × TaqMan assay for OAZ1 (endogenous control) amplification (Assay ID: Ss03397505_u1), and 0.5 µL of 20 × TaqMan gene expression assay for amplification of the target gene (CD200R1 Assay ID: Ss04324657_m1, CD209 Assay ID: Ss03819234_g1, F3 Assay ID: Ss03381417_u1, CYBB Assay ID: Ss03391378_m1, ZNF217 Assay ID: Ss03390845_m1, and PLAU assay ID: Ss03391043_m1). .. The relative quantity (RQ) of each sample was calculated based on the ΔΔCt method using QuantStudioTM 6 and 7 flex real-time PCR software.

    Article Title: Acute Exposure to Low Level Light at Night is Sufficient to Induce Neurological Changes and Depressive-like Behavior
    Article Snippet: For qRT-PCR, 4μl (40μg) of diluted cDNA was combined with 16μl of master mix solution containing: Taqman Fast Advanced Master Mix (Life Technologies, Carlsbad, CA), an inventoried probe from Applied Biosystems (Life Technologies, Carlsbad, CA) , a primer-limited probe for the endogenous control GAPDH, and water. .. The 2-step real-time PCR cycling conditions used were 95 °C for 20 s, 40 cycles of 95 °C for 3 s, and then 60 °C for 30 s. Gene expression was quantified using the Pfaffl Method .

    Article Title: Septin 9 isoforms promote tumorigenesis in mammary epithelial cells by increasing migration and ECM degradation through metalloproteinase secretion at focal adhesions.
    Article Snippet: Due to the low expression levels of MMP2 and MMP9, a TaqMan assay was also performed for these two genes using MMP2 - Hs00234422_m1, MMP9 - Hs00234579_m1, GAPDH - Hs99999905_m1 (Roche LifeScience) as we previously described . .. Real-Time qRT-PCR was performed using Applied Biosystems Fast SYBR Green Master Mix and TaqMan Fast Advanced Master Mix with the StepOnePlus Real-Time PCR System (Life Technologies Corp., Carlsbad, CA, USA).

    Modification:

    Article Title: Assessment of methods for serum extracellular vesicle small RNA sequencing to support biomarker development
    Article Snippet: Quantitative PCR cDNA was generated using 2 µL of purified total RNA (from three healthy donors) with the TaqMan Advanced miRNA cDNA Synthesis kit per the manufacturer’s instructions (Thermo Fisher Scientific). qPCR was then performed (in triplicate) for each sample using 2 µL of diluted cDNA, TaqMan Advanced miRNA Assays (given below), and Applied Biosystems™ TaqMan™ Fast Advanced Master Mix under fast cycling conditions on the ABI 7500 Fast real-time PCR system (Thermo Fisher Scientific). .. A modified 2−ΔΔCt method [28]was used to calculate miRNA abundance for each gene of interest.

    Cell Culture:

    Article Title: Epithelial HIF-1α/claudin-1 axis regulates barrier dysfunction in eosinophilic esophagitis
    Article Snippet: .. Total RNA was prepared from human mucosal pinch biopsies, whole esophageal mouse tissues, or cultured cells with RNeasy Mini Kits (Qiagen), first-strand cDNA synthesis using the High Capacity cDNA archive kit (Applied Biosystems), and TaqMan Gene Expression Assays TaqMan probes in real-time RT-PCR reactions using TaqMan Fast Advanced Master Mix (Applied Biosystems). .. Thermocycling and analysis were performed with an ABI-7300 System and software, and data calculated as relative quantification were normalized to 18S (2–ΔΔCt ; refs. , ).

    Article Title: Transplantation of Neural Progenitors and V2a Interneurons after Spinal Cord Injury
    Article Snippet: Three different groups of cultured NPCs were analyzed and compared with fetal spinal cord tissue (FSC): NPCs that were thawed and plated onto poly-L-lysine and laminin coated T75 flask for 12 h (equivalent to non-aggregated transplanted NPCs) or 2 days (2DIV, 2D), as well as NPC aggregates (2DIV, 3D culture; equivalent to transplanted NPC aggregates). .. The complementary DNA (cDNA) was synthesized using a high capacity RNA to cDNA kit (ThermoFisher, #4368814) and combined with TaqMan Gene Expression Assays and TaqMan Fast Advanced Master Mix (Applied Biosystems, #4444963). qRT-PCR was performed using a QuantStudio 3 (Applied Biosystems, CA) thermocycler with the following protocol: 95°C for 20 sec; 40 cycles of 95°C for 1 sec, and 60°C for 20 sec.

    Generated:

    Article Title: Assessment of methods for serum extracellular vesicle small RNA sequencing to support biomarker development
    Article Snippet: .. Quantitative PCR cDNA was generated using 2 µL of purified total RNA (from three healthy donors) with the TaqMan Advanced miRNA cDNA Synthesis kit per the manufacturer’s instructions (Thermo Fisher Scientific). qPCR was then performed (in triplicate) for each sample using 2 µL of diluted cDNA, TaqMan Advanced miRNA Assays (given below), and Applied Biosystems™ TaqMan™ Fast Advanced Master Mix under fast cycling conditions on the ABI 7500 Fast real-time PCR system (Thermo Fisher Scientific). .. Ten miRNAs were selected and quantified for expression with U6 snRNA as the normalizer (Table S2). miRNA abundance was evaluated in four biological replicates for each group with three technical replicates for each primer pair.

    Polymerase Chain Reaction:

    Article Title: The A3 adenosine receptor agonist, namodenoson, ameliorates non-alcoholic steatohepatitis in mice
    Article Snippet: Paragraph title: Semi-quantitative PCR ... RT-qPCR was performed for the quantification gene expression of the encoded α-SMA, compared to β-actin as a housekeeping gene using TaqMan Fast Advanced Master Mix (Applied Biosystems).

    Article Title: Acute Exposure to Low Level Light at Night is Sufficient to Induce Neurological Changes and Depressive-like Behavior
    Article Snippet: RNA quantity and quality was assessed using a spectrophotometer (Nanodrop One, Wilmington, DE) and then cDNA was synthesized using M-MLV reverse transcriptase and diluted 1:10 for subsequent analysis via PCR. .. For qRT-PCR, 4μl (40μg) of diluted cDNA was combined with 16μl of master mix solution containing: Taqman Fast Advanced Master Mix (Life Technologies, Carlsbad, CA), an inventoried probe from Applied Biosystems (Life Technologies, Carlsbad, CA) , a primer-limited probe for the endogenous control GAPDH, and water.

    Sequencing:

    Article Title: Source of Dietary Fat in Pig Diet Affects Adipose Expression of Genes Related to Cancer, Cardiovascular, and Neurodegenerative Diseases
    Article Snippet: All samples were run on one flowcell for NGS sequencing. .. The reaction mix contained 1 µL of cDNA, 5 µL of TaqMan™ Fast Advanced Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 3.23 µL of water, 0.17 µL of 60 × TaqMan assay for OAZ1 (endogenous control) amplification (Assay ID: Ss03397505_u1), and 0.5 µL of 20 × TaqMan gene expression assay for amplification of the target gene (CD200R1 Assay ID: Ss04324657_m1, CD209 Assay ID: Ss03819234_g1, F3 Assay ID: Ss03381417_u1, CYBB Assay ID: Ss03391378_m1, ZNF217 Assay ID: Ss03390845_m1, and PLAU assay ID: Ss03391043_m1).

    Software:

    Article Title: Epithelial HIF-1α/claudin-1 axis regulates barrier dysfunction in eosinophilic esophagitis
    Article Snippet: Total RNA was prepared from human mucosal pinch biopsies, whole esophageal mouse tissues, or cultured cells with RNeasy Mini Kits (Qiagen), first-strand cDNA synthesis using the High Capacity cDNA archive kit (Applied Biosystems), and TaqMan Gene Expression Assays TaqMan probes in real-time RT-PCR reactions using TaqMan Fast Advanced Master Mix (Applied Biosystems). .. Thermocycling and analysis were performed with an ABI-7300 System and software, and data calculated as relative quantification were normalized to 18S (2–ΔΔCt ; refs. , ).

    Article Title: Source of Dietary Fat in Pig Diet Affects Adipose Expression of Genes Related to Cancer, Cardiovascular, and Neurodegenerative Diseases
    Article Snippet: The reaction mix contained 1 µL of cDNA, 5 µL of TaqMan™ Fast Advanced Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 3.23 µL of water, 0.17 µL of 60 × TaqMan assay for OAZ1 (endogenous control) amplification (Assay ID: Ss03397505_u1), and 0.5 µL of 20 × TaqMan gene expression assay for amplification of the target gene (CD200R1 Assay ID: Ss04324657_m1, CD209 Assay ID: Ss03819234_g1, F3 Assay ID: Ss03381417_u1, CYBB Assay ID: Ss03391378_m1, ZNF217 Assay ID: Ss03390845_m1, and PLAU assay ID: Ss03391043_m1). .. The relative quantity (RQ) of each sample was calculated based on the ΔΔCt method using QuantStudioTM 6 and 7 flex real-time PCR software.

    Article Title: Septin 9 isoforms promote tumorigenesis in mammary epithelial cells by increasing migration and ECM degradation through metalloproteinase secretion at focal adhesions.
    Article Snippet: Primer3 software was used to design SEPT9 primers (F- 5’- CCCCAGAAGGAATTTGATGA −3’; R- 5’- TGGTACCCCACTTGGTCTTC −3’) along with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) primers (F- 5’-CCACATCGCTCAGACACCAT-3’; R- 5’-CCAGGCGCCCAATACG-3’). .. Real-Time qRT-PCR was performed using Applied Biosystems Fast SYBR Green Master Mix and TaqMan Fast Advanced Master Mix with the StepOnePlus Real-Time PCR System (Life Technologies Corp., Carlsbad, CA, USA).

    RNA Sequencing Assay:

    Article Title: Source of Dietary Fat in Pig Diet Affects Adipose Expression of Genes Related to Cancer, Cardiovascular, and Neurodegenerative Diseases
    Article Snippet: Paragraph title: 2.2. RNA Isolation, RNA-Seq, and qPCR Procedures ... The reaction mix contained 1 µL of cDNA, 5 µL of TaqMan™ Fast Advanced Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 3.23 µL of water, 0.17 µL of 60 × TaqMan assay for OAZ1 (endogenous control) amplification (Assay ID: Ss03397505_u1), and 0.5 µL of 20 × TaqMan gene expression assay for amplification of the target gene (CD200R1 Assay ID: Ss04324657_m1, CD209 Assay ID: Ss03819234_g1, F3 Assay ID: Ss03381417_u1, CYBB Assay ID: Ss03391378_m1, ZNF217 Assay ID: Ss03390845_m1, and PLAU assay ID: Ss03391043_m1).

    Isolation:

    Article Title: CRISPR-Cas9–mediated therapeutic editing of Rpe65 ameliorates the disease phenotypes in a mouse model of Leber congenital amaurosis
    Article Snippet: Real-time qPCR Total RNA was isolated using TRI Reagent (Molecular Research Center) from RPE cells of rd12 mice at 7 months after AAV-mediated delivery of SpCas9 and TS4 sgRNA-Rpe65 -donor. cDNAs were prepared with a High-Capacity RNA-to-cDNA Kit (Thermo Fisher). .. Real-time PCR was performed with the StepOnePlus Real-Time PCR System (Thermo Fisher) using TaqMan Fast Advanced Master Mix (Thermo Fisher) with Gene Expression Assays (Thermo Fisher) for gene expression analyses.

    Article Title: Epithelial HIF-1α/claudin-1 axis regulates barrier dysfunction in eosinophilic esophagitis
    Article Snippet: Paragraph title: RNA isolation and real-time RT-PCR. ... Total RNA was prepared from human mucosal pinch biopsies, whole esophageal mouse tissues, or cultured cells with RNeasy Mini Kits (Qiagen), first-strand cDNA synthesis using the High Capacity cDNA archive kit (Applied Biosystems), and TaqMan Gene Expression Assays TaqMan probes in real-time RT-PCR reactions using TaqMan Fast Advanced Master Mix (Applied Biosystems).

    Article Title: Annexin A2 Deficiency Exacerbates Neuroinflammation and Long-Term Neurological Deficits after Traumatic Brain Injury in Mice
    Article Snippet: Since it is known that elevated pro-inflammatory cytokine gene expression occurs from hours to days after TBI [ ], total RNA from mouse cortical brain tissues or micro-vessels were isolated at day 1 after TBI with miRNeasy micro kit (Qiagen, Germantown, MD, USA) according to the manufacturer’s instruction followed by cDNA synthesis with QuantiTect Reverse Transcription Kit (Qiagen). .. The mRNA levels were measured by RT-qPCR using TaqMan® Fast Advanced Master Mix (Applied Biosystems, Foster City, CA, USA) in an ABI 7500 real-time PCR system (Applied Biosystems).

    Article Title: SOX30, a target gene of miR-653-5p, represses the proliferation and invasion of prostate cancer cells through inhibition of Wnt/β-catenin signaling
    Article Snippet: Small RNA-containing total RNA was extracted and purified with the mirVana miRNA Isolation Kit (Ambion) and converted into cDNA using the Taqman miRNA Reverse Transcription Kit (Applied Biosystems) following the manufacturer’s instructions. .. MiR-653-5p expression was determined with TaqMan Fast Advanced Master Mix (Applied Biosystems), using U6 as the internal control.

    Article Title: Source of Dietary Fat in Pig Diet Affects Adipose Expression of Genes Related to Cancer, Cardiovascular, and Neurodegenerative Diseases
    Article Snippet: Paragraph title: 2.2. RNA Isolation, RNA-Seq, and qPCR Procedures ... The reaction mix contained 1 µL of cDNA, 5 µL of TaqMan™ Fast Advanced Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 3.23 µL of water, 0.17 µL of 60 × TaqMan assay for OAZ1 (endogenous control) amplification (Assay ID: Ss03397505_u1), and 0.5 µL of 20 × TaqMan gene expression assay for amplification of the target gene (CD200R1 Assay ID: Ss04324657_m1, CD209 Assay ID: Ss03819234_g1, F3 Assay ID: Ss03381417_u1, CYBB Assay ID: Ss03391378_m1, ZNF217 Assay ID: Ss03390845_m1, and PLAU assay ID: Ss03391043_m1).

    Article Title: RNAi-Mediated β-Catenin Inhibition Promotes T Cell Infiltration and Antitumor Activity in Combination with Immune Checkpoint Blockade
    Article Snippet: After total RNA isolation, representative RNA samples were subjected to quality control (QC) and determination of the RNA Integrity Number (RIN) score by Agilent 2100 Bioanalyzer. .. The cDNA was then diluted 4 times for qRT-PCR using TaqMan Fast Advanced Master Mix (Applied Biosystems) and murine gene-specific primer-probe sets.

    Size-exclusion Chromatography:

    Article Title: Transplantation of Neural Progenitors and V2a Interneurons after Spinal Cord Injury
    Article Snippet: .. The complementary DNA (cDNA) was synthesized using a high capacity RNA to cDNA kit (ThermoFisher, #4368814) and combined with TaqMan Gene Expression Assays and TaqMan Fast Advanced Master Mix (Applied Biosystems, #4444963). qRT-PCR was performed using a QuantStudio 3 (Applied Biosystems, CA) thermocycler with the following protocol: 95°C for 20 sec; 40 cycles of 95°C for 1 sec, and 60°C for 20 sec. .. Expression of transcription factor messenger RNA (mRNA) of Evx1, En1, Chx10, Lhx3, and Hb9 was assessed in each NPC sample described above and compared with level of expression in embryonic (E13.5) spinal cord tissue (FSC) and graphically represented as a percent relative to expression in FSC, with FSC levels set as 100%.

    Mouse Assay:

    Article Title: CRISPR-Cas9–mediated therapeutic editing of Rpe65 ameliorates the disease phenotypes in a mouse model of Leber congenital amaurosis
    Article Snippet: Real-time qPCR Total RNA was isolated using TRI Reagent (Molecular Research Center) from RPE cells of rd12 mice at 7 months after AAV-mediated delivery of SpCas9 and TS4 sgRNA-Rpe65 -donor. cDNAs were prepared with a High-Capacity RNA-to-cDNA Kit (Thermo Fisher). .. Real-time PCR was performed with the StepOnePlus Real-Time PCR System (Thermo Fisher) using TaqMan Fast Advanced Master Mix (Thermo Fisher) with Gene Expression Assays (Thermo Fisher) for gene expression analyses.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: TIMP1 mRNA in tumor-educated platelets is diagnostic biomarker for colorectal cancer
    Article Snippet: .. Quantitative real-time reverse transcription polymerase chain reaction qRT-PCR performed with a CFX Connect Real-Time System (Bio-Rad Laboratories, Hercules, CA, USA) using the TaqMan® Reverse Transcription Kit and the TaqMan® Fast Advanced Master Mix (Applied Biosystems, Foster City, CA, USA) according the manufacturer’s instructions. .. Cell culture HT29 and Caco-2 cells were purchased from the Institute of Cell Biology at the Chinese Academy of Sciences (Shanghai, China) and cultured in DMEM supplemented with 10% FBS and 1% penicillin/streptomycin in a humidified atmosphere containing 5% CO2 /95% air at 37° C.

    Article Title: Caveolae‐Mediated Activation of Mechanosensitive Chloride Channels in Pulmonary Veins Triggers Atrial Arrhythmogenesis
    Article Snippet: .. Quantitative reverse transcription polymerase chain reaction for ClC‐2 , ClC‐3 , LRRC8A , ANO1 (anoctamin 1), Cav3 , and GAPDH (probes are listed in Table ) were performed using TaqMan Fast Advanced Master Mix (Thermo Fisher Scientific). ..

    Purification:

    Article Title: Assessment of methods for serum extracellular vesicle small RNA sequencing to support biomarker development
    Article Snippet: .. Quantitative PCR cDNA was generated using 2 µL of purified total RNA (from three healthy donors) with the TaqMan Advanced miRNA cDNA Synthesis kit per the manufacturer’s instructions (Thermo Fisher Scientific). qPCR was then performed (in triplicate) for each sample using 2 µL of diluted cDNA, TaqMan Advanced miRNA Assays (given below), and Applied Biosystems™ TaqMan™ Fast Advanced Master Mix under fast cycling conditions on the ABI 7500 Fast real-time PCR system (Thermo Fisher Scientific). .. Ten miRNAs were selected and quantified for expression with U6 snRNA as the normalizer (Table S2). miRNA abundance was evaluated in four biological replicates for each group with three technical replicates for each primer pair.

    Article Title: SOX30, a target gene of miR-653-5p, represses the proliferation and invasion of prostate cancer cells through inhibition of Wnt/β-catenin signaling
    Article Snippet: Small RNA-containing total RNA was extracted and purified with the mirVana miRNA Isolation Kit (Ambion) and converted into cDNA using the Taqman miRNA Reverse Transcription Kit (Applied Biosystems) following the manufacturer’s instructions. .. MiR-653-5p expression was determined with TaqMan Fast Advanced Master Mix (Applied Biosystems), using U6 as the internal control.

    TaqMan Assay:

    Article Title: Source of Dietary Fat in Pig Diet Affects Adipose Expression of Genes Related to Cancer, Cardiovascular, and Neurodegenerative Diseases
    Article Snippet: .. The reaction mix contained 1 µL of cDNA, 5 µL of TaqMan™ Fast Advanced Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 3.23 µL of water, 0.17 µL of 60 × TaqMan assay for OAZ1 (endogenous control) amplification (Assay ID: Ss03397505_u1), and 0.5 µL of 20 × TaqMan gene expression assay for amplification of the target gene (CD200R1 Assay ID: Ss04324657_m1, CD209 Assay ID: Ss03819234_g1, F3 Assay ID: Ss03381417_u1, CYBB Assay ID: Ss03391378_m1, ZNF217 Assay ID: Ss03390845_m1, and PLAU assay ID: Ss03391043_m1). .. The relative quantity (RQ) of each sample was calculated based on the ΔΔCt method using QuantStudioTM 6 and 7 flex real-time PCR software.

    Article Title: Patients with enthesitis related arthritis show similar monocyte function pattern as seen in adult axial spondyloarthropathy
    Article Snippet: .. Each 20 μl reaction mixture comprised of 10 μl TaqMan Fast Advanced Master mix, 1 μl TaqMan assay probe, 7 μl RNase free water and 2 μl cDNA. .. The reaction conditions in the real-time PCR amplification and detection instrument (LightCycler 480 Instrument II, Roche Molecular Systems Inc., CA, USA) were 50 °C for 2 min, 95 °C for 2 min and finally 40 PCR cycles of 95 °C for 3 s and 60 °C for 30 s. GAPDH was used as a housekeeping gene.

    Article Title: Septin 9 isoforms promote tumorigenesis in mammary epithelial cells by increasing migration and ECM degradation through metalloproteinase secretion at focal adhesions.
    Article Snippet: Due to the low expression levels of MMP2 and MMP9, a TaqMan assay was also performed for these two genes using MMP2 - Hs00234422_m1, MMP9 - Hs00234579_m1, GAPDH - Hs99999905_m1 (Roche LifeScience) as we previously described . .. Real-Time qRT-PCR was performed using Applied Biosystems Fast SYBR Green Master Mix and TaqMan Fast Advanced Master Mix with the StepOnePlus Real-Time PCR System (Life Technologies Corp., Carlsbad, CA, USA).

    SYBR Green Assay:

    Article Title: SOX30, a target gene of miR-653-5p, represses the proliferation and invasion of prostate cancer cells through inhibition of Wnt/β-catenin signaling
    Article Snippet: SOX30 transcription levels were determined using PowerUp SYBR Green Master Mix (Applied Biosystems), with glyceraldehyde 3-phosphate dehydrogenase (GAPDH) as the internal control. .. MiR-653-5p expression was determined with TaqMan Fast Advanced Master Mix (Applied Biosystems), using U6 as the internal control.

    Article Title: Septin 9 isoforms promote tumorigenesis in mammary epithelial cells by increasing migration and ECM degradation through metalloproteinase secretion at focal adhesions.
    Article Snippet: .. Real-Time qRT-PCR was performed using Applied Biosystems Fast SYBR Green Master Mix and TaqMan Fast Advanced Master Mix with the StepOnePlus Real-Time PCR System (Life Technologies Corp., Carlsbad, CA, USA). .. Correlation analyses were performed by computing the normalized read counts for each analyzed MCF7 line with the levels obtained by TaqMan assay.

    RNA Extraction:

    Article Title: Distinct RhoGEFs Activate Apical and Junctional Contractility under Control of G Proteins during Epithelial Morphogenesis
    Article Snippet: Total RNA extraction from ∼100 gastrulating embryos from maternal knockdown of CG10188 compared to {mata4-GAL-VP16} embryos was performed using the Direct-zol RNA miniprep kit (Zymo Research, R2050). .. Real-time PCR was performed on a CFX96 QPCR detection system (Bio-RAD) using TaqMan Fast Advanced Master Mix (Life technologies) with the following TaqMan probes, following classical TaqMan protocol: • CG10188 : Dm01811075_m1 = probe located in E2 (exon 2-3 boundary, 1210 / GenBank NM_001273659 , amplicon = 57bp).

    Article Title: Acute Exposure to Low Level Light at Night is Sufficient to Induce Neurological Changes and Depressive-like Behavior
    Article Snippet: Paragraph title: RNA extraction, cDNA, and qRT-PCR. ... For qRT-PCR, 4μl (40μg) of diluted cDNA was combined with 16μl of master mix solution containing: Taqman Fast Advanced Master Mix (Life Technologies, Carlsbad, CA), an inventoried probe from Applied Biosystems (Life Technologies, Carlsbad, CA) , a primer-limited probe for the endogenous control GAPDH, and water.

    shRNA:

    Article Title: Distinct RhoGEFs Activate Apical and Junctional Contractility under Control of G Proteins during Epithelial Morphogenesis
    Article Snippet: RT-qPCR experiment CG10188 shRNA (BL41579) knock-down efficiency was estimated by measuring endogenous mRNA level using RT-qPCR. .. Real-time PCR was performed on a CFX96 QPCR detection system (Bio-RAD) using TaqMan Fast Advanced Master Mix (Life technologies) with the following TaqMan probes, following classical TaqMan protocol: • CG10188 : Dm01811075_m1 = probe located in E2 (exon 2-3 boundary, 1210 / GenBank NM_001273659 , amplicon = 57bp).

    Next-Generation Sequencing:

    Article Title: Source of Dietary Fat in Pig Diet Affects Adipose Expression of Genes Related to Cancer, Cardiovascular, and Neurodegenerative Diseases
    Article Snippet: All samples were run on one flowcell for NGS sequencing. .. The reaction mix contained 1 µL of cDNA, 5 µL of TaqMan™ Fast Advanced Master Mix (Thermo Fisher Scientific, Waltham, MA, USA), 3.23 µL of water, 0.17 µL of 60 × TaqMan assay for OAZ1 (endogenous control) amplification (Assay ID: Ss03397505_u1), and 0.5 µL of 20 × TaqMan gene expression assay for amplification of the target gene (CD200R1 Assay ID: Ss04324657_m1, CD209 Assay ID: Ss03819234_g1, F3 Assay ID: Ss03381417_u1, CYBB Assay ID: Ss03391378_m1, ZNF217 Assay ID: Ss03390845_m1, and PLAU assay ID: Ss03391043_m1).

    Spectrophotometry:

    Article Title: Acute Exposure to Low Level Light at Night is Sufficient to Induce Neurological Changes and Depressive-like Behavior
    Article Snippet: RNA quantity and quality was assessed using a spectrophotometer (Nanodrop One, Wilmington, DE) and then cDNA was synthesized using M-MLV reverse transcriptase and diluted 1:10 for subsequent analysis via PCR. .. For qRT-PCR, 4μl (40μg) of diluted cDNA was combined with 16μl of master mix solution containing: Taqman Fast Advanced Master Mix (Life Technologies, Carlsbad, CA), an inventoried probe from Applied Biosystems (Life Technologies, Carlsbad, CA) , a primer-limited probe for the endogenous control GAPDH, and water.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher taqman fast advanced master mix
    circRNA effects on linear transcripts, miRNAs and tumor growth ( A ) Upon efficient transduction of TUSC3 circ104557 in HCT-116 cells (harboring a methylated CpG island), the TUSC3 linear RNA levels did not change: it was not detected in any of the conditions tested. ( B ) TUSC3 circ104557 transduction in DKO cells (harboring an unmethylated CpG island) did not affect the levels of TUSC3 linear RNA. RNA levels were determined using circular or linear specific qRT-PCR primers. The lentiviral transduction of the empty vector (Mock condition) was used as a control. Experiments were performed in technical triplicates. ( C ) Expression of candidate miRNAs putatively targeted by ATRNL1 circ100686 (miR-378a-3p), SAMD4A circ101356 (miR-660-5p and miR-330-3p) and TUSC3 circ104557 (miR-330-3p) was significantly downregulated in DKO cells, evaluated in three biological replicates by real-time quantitative PCR using <t>TaqMan</t> Advanced MicroRNA Assays. Expression levels were normalized using hsa-miR-345-5p, hsa-miR-191-5p and hsa-miR-423-3p advanced Control miRNA Assays. ( D ) Using the same strategy, expression of miR-330-3p, putatively targeted by TUSC3 circ104557, was also assessed in the gain-of-function cellular model. A significant downregulation of miR-330-3p was detected upon TUSC3 circ104557 transduction in HCT116 cells. ( E ) HCT116-Mock and HCT116-TUSC3 circular cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time (left panel) and tumor weight upon sacrifice (right panel) are shown. Tumor growth was significantly reduced upon TUSC3 circular ectopic expression. ns, nonsignificant; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001, using Student’s t -test. Error bars show means ± s.d.
    Taqman Fast Advanced Master Mix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 363 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taqman fast advanced master mix/product/Thermo Fisher
    Average 90 stars, based on 363 article reviews
    Price from $9.99 to $1999.99
    taqman fast advanced master mix - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    circRNA effects on linear transcripts, miRNAs and tumor growth ( A ) Upon efficient transduction of TUSC3 circ104557 in HCT-116 cells (harboring a methylated CpG island), the TUSC3 linear RNA levels did not change: it was not detected in any of the conditions tested. ( B ) TUSC3 circ104557 transduction in DKO cells (harboring an unmethylated CpG island) did not affect the levels of TUSC3 linear RNA. RNA levels were determined using circular or linear specific qRT-PCR primers. The lentiviral transduction of the empty vector (Mock condition) was used as a control. Experiments were performed in technical triplicates. ( C ) Expression of candidate miRNAs putatively targeted by ATRNL1 circ100686 (miR-378a-3p), SAMD4A circ101356 (miR-660-5p and miR-330-3p) and TUSC3 circ104557 (miR-330-3p) was significantly downregulated in DKO cells, evaluated in three biological replicates by real-time quantitative PCR using TaqMan Advanced MicroRNA Assays. Expression levels were normalized using hsa-miR-345-5p, hsa-miR-191-5p and hsa-miR-423-3p advanced Control miRNA Assays. ( D ) Using the same strategy, expression of miR-330-3p, putatively targeted by TUSC3 circ104557, was also assessed in the gain-of-function cellular model. A significant downregulation of miR-330-3p was detected upon TUSC3 circ104557 transduction in HCT116 cells. ( E ) HCT116-Mock and HCT116-TUSC3 circular cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time (left panel) and tumor weight upon sacrifice (right panel) are shown. Tumor growth was significantly reduced upon TUSC3 circular ectopic expression. ns, nonsignificant; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001, using Student’s t -test. Error bars show means ± s.d.

    Journal: Oncotarget

    Article Title: Circular RNA CpG island hypermethylation-associated silencing in human cancer

    doi: 10.18632/oncotarget.25673

    Figure Lengend Snippet: circRNA effects on linear transcripts, miRNAs and tumor growth ( A ) Upon efficient transduction of TUSC3 circ104557 in HCT-116 cells (harboring a methylated CpG island), the TUSC3 linear RNA levels did not change: it was not detected in any of the conditions tested. ( B ) TUSC3 circ104557 transduction in DKO cells (harboring an unmethylated CpG island) did not affect the levels of TUSC3 linear RNA. RNA levels were determined using circular or linear specific qRT-PCR primers. The lentiviral transduction of the empty vector (Mock condition) was used as a control. Experiments were performed in technical triplicates. ( C ) Expression of candidate miRNAs putatively targeted by ATRNL1 circ100686 (miR-378a-3p), SAMD4A circ101356 (miR-660-5p and miR-330-3p) and TUSC3 circ104557 (miR-330-3p) was significantly downregulated in DKO cells, evaluated in three biological replicates by real-time quantitative PCR using TaqMan Advanced MicroRNA Assays. Expression levels were normalized using hsa-miR-345-5p, hsa-miR-191-5p and hsa-miR-423-3p advanced Control miRNA Assays. ( D ) Using the same strategy, expression of miR-330-3p, putatively targeted by TUSC3 circ104557, was also assessed in the gain-of-function cellular model. A significant downregulation of miR-330-3p was detected upon TUSC3 circ104557 transduction in HCT116 cells. ( E ) HCT116-Mock and HCT116-TUSC3 circular cells were injected in the left or right flank of 10 mice, respectively. Tumor volume measured over time (left panel) and tumor weight upon sacrifice (right panel) are shown. Tumor growth was significantly reduced upon TUSC3 circular ectopic expression. ns, nonsignificant; * p ≤ 0.05; ** p ≤ 0.01; *** p ≤ 0.001, using Student’s t -test. Error bars show means ± s.d.

    Article Snippet: Next, RT-qPCR was performed using TaqMan Fast Advanced Master Mix (ThermoFisher, Cat. No. 4444557) and specific TaqMan assays.

    Techniques: Transduction, Methylation, Quantitative RT-PCR, Plasmid Preparation, Expressing, Real-time Polymerase Chain Reaction, Injection, Mouse Assay

    Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.

    Journal: Cell Host & Microbe

    Article Title: Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling

    doi: 10.1016/j.chom.2018.10.007

    Figure Lengend Snippet: Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.

    Article Snippet: TaqMan qPCR reactions contained 5 μl of eluted DNA, 300 nM forward and reverse primers against GFP, 150 nM probe, 20 μg salmon sperm DNA, and TaqMan Fast Advanced Master Mix (ThermoFisher Scientific).

    Techniques: Expressing, Western Blot, Transduction, Plasmid Preparation, Infection, Real-time Polymerase Chain Reaction, Flow Cytometry, Cytometry, Fluorescence

    N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.

    Journal: Cell Host & Microbe

    Article Title: Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling

    doi: 10.1016/j.chom.2018.10.007

    Figure Lengend Snippet: N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.

    Article Snippet: TaqMan qPCR reactions contained 5 μl of eluted DNA, 300 nM forward and reverse primers against GFP, 150 nM probe, 20 μg salmon sperm DNA, and TaqMan Fast Advanced Master Mix (ThermoFisher Scientific).

    Techniques: Expressing, Infection, Flow Cytometry, Cytometry, Fluorescence, Construct, Real-time Polymerase Chain Reaction, Plasmid Preparation

    Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.

    Journal: Cell Host & Microbe

    Article Title: Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling

    doi: 10.1016/j.chom.2018.10.007

    Figure Lengend Snippet: Ubiquitination Drives TRIM5 Turnover and Virus Destruction (A and B) Left: cycloheximide (CHX) chase experiments of CrFK cells expressing full-length TRIM5 E2 interface mutants (A) or TRIM5 RING dimer mutants (B), bearing C-terminal HA tags (A and B). Immunoblots detecting HA tag or β-actin. Right: densitometry of immunoblots shown. (C and D) CrFK cells (C) or TE671 cells transduced with Cas9 and TRIM5-specific single guide RNA (D) and expressing empty vector or full-length TRIM5 mutants (bearing C-terminal HA tags), infected with N-MLV- or B-MLV-GFP vectors, viral DNA copies quantified by GFP TaqMan qPCR. In (C), vector or WT TRIM5 cells were also treated with 10 μM MG132. Boiled virus served as a control for plasmid contamination. (E) TE671 cells from (D) infected with N-MLV-GFP or B-MLV-GFP vectors, percentage infection quantified by flow cytometry. (F) Representative confocal fluorescence images of CrFK cells expressing full-length TRIM5 mutants (bearing C-terminal HA tags), detecting HA tag, K63-Ub, or DNA. Cells containing K63-Ub-positive CBs were counted and expressed as percentage of total cells counted. All data are representative of at least two replicates. (C–E) Error bars represent SD. In (F), n = number of cells counted in the experiment shown.

    Article Snippet: TaqMan qPCR reactions contained 5 μl of eluted DNA, 300 nM forward and reverse primers against GFP, 150 nM probe, 20 μg salmon sperm DNA, and TaqMan Fast Advanced Master Mix (ThermoFisher Scientific).

    Techniques: Expressing, Western Blot, Transduction, Plasmid Preparation, Infection, Real-time Polymerase Chain Reaction, Flow Cytometry, Cytometry, Fluorescence

    N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.

    Journal: Cell Host & Microbe

    Article Title: Trivalent RING Assembly on Retroviral Capsids Activates TRIM5 Ubiquitination and Innate Immune Signaling

    doi: 10.1016/j.chom.2018.10.007

    Figure Lengend Snippet: N-Terminal Ubiquitination before TRIM5 Assembly Causes Premature Proteasome Recruitment (A and B) CrFK cells expressing WT or Ub(GA)TRIM5 RING mutants (A) or Ub mutants (B), infected with N-MLV- or B-MLV-GFP; percentage infection quantified by flow cytometry. (C) Representative confocal fluorescence images of CrFK cells expressing constructs indicated, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. (D) Number of visible CBs per cell, from (C). (E) CrFK cells from (C) infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry. (F and G) CrFK cells expressing constructs indicated, infected with N-MLV- or B-MLV-GFP, percentage infection quantified by flow cytometry (F) or viral DNA copies quantified by TaqMan GFP qPCR (G). In (G), cells were also treated with DMSO or 10 μM MG132. Boiled virus served as a control for plasmid contamination. (H) Representative confocal fluorescence images of CrFK cells expressing Ub(K63only,GA)TRIM5-HA, treated with DMSO or 10 μM MG132, detecting HA tag or DNA. All data are representative of at least two replicates. Error bars represent SD.

    Article Snippet: TaqMan qPCR reactions contained 5 μl of eluted DNA, 300 nM forward and reverse primers against GFP, 150 nM probe, 20 μg salmon sperm DNA, and TaqMan Fast Advanced Master Mix (ThermoFisher Scientific).

    Techniques: Expressing, Infection, Flow Cytometry, Cytometry, Fluorescence, Construct, Real-time Polymerase Chain Reaction, Plasmid Preparation

    Percentage of detection for each miRNA, employing ( a ) Taqman qPCR or ( b ) Multiplex Circulating miRNA Assay (Abcam).

    Journal: Cancers

    Article Title: Comparative miRNA Analysis of Urine Extracellular Vesicles Isolated through Five Different Methods

    doi: 10.3390/cancers8120112

    Figure Lengend Snippet: Percentage of detection for each miRNA, employing ( a ) Taqman qPCR or ( b ) Multiplex Circulating miRNA Assay (Abcam).

    Article Snippet: The TaqMan reactions were performed using the Taqman Advance miRNA assays (ThermoFisher Scientific) for the following miRNAs (hsa-let-7d-5p, hsa-let-7i-5p, hsa-mir-21-5p, hsa-mir-22-3p, hsa-mir-30c-5p, hsa-mir-92a-3p, hsa-mir-122-5p, hsa-mir-192-5p, hsa-mir-451a), and qPCR was performed in a Via7 using TaqMan® Fast Advanced Master Mix (ThermoFisher Scientific).

    Techniques: Real-time Polymerase Chain Reaction, Multiplex Assay

    Correlation between signal intensity (Log 10 transformed) achieved by multiplex miRNA assay and C t values obtained by Taqman qPCR, using the same RNAs.

    Journal: Cancers

    Article Title: Comparative miRNA Analysis of Urine Extracellular Vesicles Isolated through Five Different Methods

    doi: 10.3390/cancers8120112

    Figure Lengend Snippet: Correlation between signal intensity (Log 10 transformed) achieved by multiplex miRNA assay and C t values obtained by Taqman qPCR, using the same RNAs.

    Article Snippet: The TaqMan reactions were performed using the Taqman Advance miRNA assays (ThermoFisher Scientific) for the following miRNAs (hsa-let-7d-5p, hsa-let-7i-5p, hsa-mir-21-5p, hsa-mir-22-3p, hsa-mir-30c-5p, hsa-mir-92a-3p, hsa-mir-122-5p, hsa-mir-192-5p, hsa-mir-451a), and qPCR was performed in a Via7 using TaqMan® Fast Advanced Master Mix (ThermoFisher Scientific).

    Techniques: Transformation Assay, Multiplex Assay, Real-time Polymerase Chain Reaction