taq polymerase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Taq polymerase
    Description:

    Catalog Number:
    TP1360476
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher taq polymerase
    Electrophoresis of Hind III-digested PCR products of the multiplex reaction (A) and <t>Taq</t> I digestion patterns (B) of Lactobacillus isolates SACB 7 01, SACB 7 01a, SACB 7 05, SACB 7 08, SACB03a. Lactobacillus sakei CRL978 and Lactobacillus curvatus CRL1000 were used as type strains; 100-bp <t>DNA</t> ladder was used as molecular weight marker.

    https://www.bioz.com/result/taq polymerase/product/Thermo Fisher
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    taq polymerase - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "Identification, technological and safety characterization of Lactobacillus sakei and Lactobacillus curvatus isolated from Argentinean anchovies (Engraulis anchoita)"

    Article Title: Identification, technological and safety characterization of Lactobacillus sakei and Lactobacillus curvatus isolated from Argentinean anchovies (Engraulis anchoita)

    Journal: SpringerPlus

    doi: 10.1186/2193-1801-2-257

    Electrophoresis of Hind III-digested PCR products of the multiplex reaction (A) and Taq I digestion patterns (B) of Lactobacillus isolates SACB 7 01, SACB 7 01a, SACB 7 05, SACB 7 08, SACB03a. Lactobacillus sakei CRL978 and Lactobacillus curvatus CRL1000 were used as type strains; 100-bp DNA ladder was used as molecular weight marker.
    Figure Legend Snippet: Electrophoresis of Hind III-digested PCR products of the multiplex reaction (A) and Taq I digestion patterns (B) of Lactobacillus isolates SACB 7 01, SACB 7 01a, SACB 7 05, SACB 7 08, SACB03a. Lactobacillus sakei CRL978 and Lactobacillus curvatus CRL1000 were used as type strains; 100-bp DNA ladder was used as molecular weight marker.

    Techniques Used: Electrophoresis, Polymerase Chain Reaction, Multiplex Assay, Molecular Weight, Marker

    2) Product Images from "A Simple Strain Typing Assay for Trypanosoma cruzi: Discrimination of Major Evolutionary Lineages from a Single Amplification Product"

    Article Title: A Simple Strain Typing Assay for Trypanosoma cruzi: Discrimination of Major Evolutionary Lineages from a Single Amplification Product

    Journal: PLoS Neglected Tropical Diseases

    doi: 10.1371/journal.pntd.0001777

    Proposed typing strategy based on the TcSC5D locus. A : the highly streamlined TcSC5D-PCR-RFLP assay can discriminate all non-hybrid lineages. If discrimination of DTUs TcV from TcVI is necessary, sequencing of the TcSC5D amplification locus is required. B : alternatively, if the method of choice is the PCR-RFLP, then a second locus can be assayed to resolve these DTUs. This additional locus can be the TcMK gene as shown in the figure (this work, see main text), or the gp72 gene (polymorphic Taq I site [41] ).
    Figure Legend Snippet: Proposed typing strategy based on the TcSC5D locus. A : the highly streamlined TcSC5D-PCR-RFLP assay can discriminate all non-hybrid lineages. If discrimination of DTUs TcV from TcVI is necessary, sequencing of the TcSC5D amplification locus is required. B : alternatively, if the method of choice is the PCR-RFLP, then a second locus can be assayed to resolve these DTUs. This additional locus can be the TcMK gene as shown in the figure (this work, see main text), or the gp72 gene (polymorphic Taq I site [41] ).

    Techniques Used: Polymerase Chain Reaction, RFLP Assay, Sequencing, Amplification

    Related Articles

    Amplification:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: For all molecular markers, the amplification reactions were performed in a total volume of 21 µL. .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL. .. Amplification cycles were applied in an automatic thermocycler (BIORAD iCycler) as previously reported , , .

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: The 16S rRNA gene was amplified and sequenced for those strains isolated from the lake Aran-Bidgol and from the salterns in Namibia and Spain, using previously described universal primers (Arahal et al., ; López-García et al., ) (Table ). .. PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl. .. All reactions were performed in an Eppendorf Mastercycler Ep gradient thermocycler (Eppendorf).

    Article Title: Activation of the TGFβ pathway impairs endothelial to haematopoietic transition
    Article Snippet: The cells were snap-frozen immediately on dry ice after sort and stored at −80 °C. .. RT/Specific Target amplification (STA) was performed with a mix composed of 2.8 μl of resuspension buffer (Invitrogen cat. #11753), 0.2 μl of SuperScriptIII & Platinum Taq polymerase (Invitrogen cat. #11753) and 1 μl of 500 nM outer primer mix (forward and reverse primers). .. Four μl of the RT-STA mix were added to the frozen cells and the RT-STA proceeded according to the following steps.

    Article Title: Diagnosis of Upper and Lower Respiratory Tract Bacterial Infections with the Use of Multiplex PCR Assays
    Article Snippet: Briefly, the two multiplex PCR assays were designed as follows: .. The amplification reactions contained: 0.8 mM dNTPs, 1× DyNAzyme II buffer and 1.5 U Taq polymerase (DyNAzyme II Hot start, Finnzymes, Finland), 3 mM MgCl (ABgene, Surrey, UK), and primers for serotypes 4, 18C, 6, 23F and 19F in concentrations of 0.6 μΜ, 1.2 μΜ, 0.2 μΜ, 0.4 μΜ and 0.8 μΜ, respectively [ ] and 6 μL DNA template in a total volume of 25 μL. .. PCR conditions were: 95 °C for 10 min; 5 cycles of 95 °C for 50 s, 63 °C for 35 s, 68 °C for 1.15 min; 5 cycles of 95 °C for 50 s, 61 °C for 35 s, 68 °C for 1.15 min; 23 cycles of 95 °C for 50 s, 59 °C for 35 s, 68 °C for 1.30 min (RoboCycler, Stratagene).

    Article Title: Evaluation of Adult Chronic Chagas' Heart Disease Diagnosis by Molecular and Serological Methods
    Article Snippet: For amplification of the T. cruzi nuclear repetitive region, the amplification reactions were performed in a total volume of 21 μl. .. This reaction mixture consisted of 1× Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM deoxynucleoside triphosphate solution, 25 mM MgCl2 solution, 5 U/μl of Taq polymerase platinum (Invitrogen), 50 pM of T. cruzi nuclear repetitive region-specific primers cruzi1 (5′ASTCGGCTGATCGTTTTCGA3′) and cruzi2 (5′AATTCCTCCAAGCAGCGGATA 3′) , 3 μl of template DNA, and a quantity of water sufficient to give a final volume of 21 μl. .. The reaction mixtures were subjected to 40 cycles of amplification in an automatic thermocycler (Bio-Rad iCycler) as reported previously ( ).

    Article Title: Diagnosis of Upper and Lower Respiratory Tract Bacterial Infections with the Use of Multiplex PCR Assays
    Article Snippet: PCR conditions were: 95 °C for 10 min; 5 cycles of 95 °C for 50 s, 63 °C for 35 s, 68 °C for 1.15 min; 5 cycles of 95 °C for 50 s, 61 °C for 35 s, 68 °C for 1.15 min; 23 cycles of 95 °C for 50 s, 59 °C for 35 s, 68 °C for 1.30 min (RoboCycler, Stratagene). .. The amplification reactions contained: 0.8 mM dNTPs, 1.2× DyNAzyme II buffer and 1.5 U Taq polymerase (DyNAzyme II Hot start, Finnzymes, Finland), 3.5 mM MgCl (ABgene, Surrey, UK), and primers for serotypes 19A, 3 and 1 in concentrations of 0.8 μΜ, 0.4 μΜ, and 0.4 μΜ, respectively [ ] and 6 μL DNA template in a total volume of 25 μL. .. For serotype 14, a new primer pair was designed (sp-T14F 7749: 5'-AGAAGTTTGTTAGACTGGGACGGA-3' and sp-T14R 7749: 5'-CGTGTCGCATTGCTACCCGATCTA-3') in wzy gene with FastPCR software [ ].

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: The 16S rRNA gene was amplified and sequenced for those strains isolated from the lake Aran-Bidgol and from the salterns in Namibia and Spain, using previously described universal primers (Arahal et al., ; López-García et al., ) (Table ). .. PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl. .. All reactions were performed in an Eppendorf Mastercycler Ep gradient thermocycler (Eppendorf).

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The amplification reactions were performed in a total volume of 20 µL. .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 25 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 10 µM of each primer, 3 µL of DNA template and water to give a final total volume of 20 µL. .. Each reaction was carried out in duplicate, and twenty microliters of PCR product for each reaction were analysed by electrophoresis on a 2% agarose gel and visualised by staining with ethidium bromide.

    Quantitative RT-PCR:

    Article Title: Activation of the TGFβ pathway impairs endothelial to haematopoietic transition
    Article Snippet: Paragraph title: Quantitative RT-PCR ... RT/Specific Target amplification (STA) was performed with a mix composed of 2.8 μl of resuspension buffer (Invitrogen cat. #11753), 0.2 μl of SuperScriptIII & Platinum Taq polymerase (Invitrogen cat. #11753) and 1 μl of 500 nM outer primer mix (forward and reverse primers).

    Article Title: Insulin-like growth factor 1 receptor regulates hypothermia during calorie restriction
    Article Snippet: Serum levels of IGF1 were determined using the Quantikine ELISA (R & D Systems). .. Levels of IGF1 transcript were determined by real time RT-PCR, using Taq polymerase enzyme (PowerUP Sybr Master Mix, # ; Life Technologies), along with the following primers from Qiagen: RT2 qPCR Primer Assay, Beta Actin (PPM02945B-200), IGF1 (PPM03387F-200). .. Body composition during CR was measured during the first hours of the light period, using the Echo3-in-1 NMR analyzer (Echo Medical).

    Article Title: Genome-Wide Characterization of Light-Regulated Genes in Neurospora crassa
    Article Snippet: Paragraph title: Quantitative RT-PCR ... For qPCR template, 8 ng of cDNA (0.125 ng for quantification of 25S cDNA) was used as in a reaction containing: 1× Platinum Taq PCR Buffer (200 mM Tris-HCl, pH 8.4, 500 mM KCl) (Life Technologies), 2.5 mM MgCl2 , 0.2 mM dNTPs, 1× ROX Reference Dye (Life Technologies), 1× SYBR Green I (Life Technologies), 500 nM each primer and 5 U/µl Platinum Taq DNA Polymerase (Life Technologies), or 5 U/µl TaKaRaTaq DNA Polymerase (Clontech, Mountain View, CA) in a 20-μl reaction with filtered sterile DEPC-treated water.

    Article Title: Activation of Kaposi's Sarcoma-Associated Herpesvirus (KSHV) by Inhibitors of Class III Histone Deacetylases: Identification of Sirtuin 1 as a Regulator of the KSHV Life Cycle
    Article Snippet: Paragraph title: RNA isolation and RT-qPCR. ... Reverse transcription (RT)-quantitative real-time PCR (qPCR) was performed with an ABI Prism 7900 system and SYBR green Taq polymerase mix (Applied Biosystems).

    Real-time Polymerase Chain Reaction:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The variable domain D7 of the rDNA 24Sα subunit using primers D71 ( 5′AAG GTG CGT CGA CAG TGT GG 3′ ) and D72 ( 5′ TTT TCA GAA TGG CCG AAC AGT 3′ ), the primers V1 ( 5′CAA GCG GCT GGG TGG TTA TTC CA 3′ ) and V2 ( 5′TTG AGG GAA GGC ATG ACA CAT GT 3′ ) amplifying the 18S rRNA ribosomal sequence of T. cruzi and the repetitive region of satellite DNA using primers Diaz8 ( 5′ TGT TCA CAC ACT GGA CAC CAA 3′ ) and TcSat4 ( 5′GCA GCC GCT CGA AAA CTA TCC 3′ ) by conventional PCR and qPCR using primers TcZ1 ( 5-′CGAGCTCTTGCCCACACGGGTGCT3) ′ and SatRv ( 5′TTCAGRGTTGTTTGGTGTCCAGTG3′ ) from T. cruzi ( ). .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL.

    Article Title: Insulin-like growth factor 1 receptor regulates hypothermia during calorie restriction
    Article Snippet: Serum levels of IGF1 were determined using the Quantikine ELISA (R & D Systems). .. Levels of IGF1 transcript were determined by real time RT-PCR, using Taq polymerase enzyme (PowerUP Sybr Master Mix, # ; Life Technologies), along with the following primers from Qiagen: RT2 qPCR Primer Assay, Beta Actin (PPM02945B-200), IGF1 (PPM03387F-200). .. Body composition during CR was measured during the first hours of the light period, using the Echo3-in-1 NMR analyzer (Echo Medical).

    Article Title: Genome-Wide Characterization of Light-Regulated Genes in Neurospora crassa
    Article Snippet: Gene identifiers in the Gene Ontology were mapped using the GO Term Finder tool ( http://go.princeton.edu/cgi-bin/GOTermFinder ) with a Neurospora GO gene association file (go_for_nc12.tsv downloaded from http://www.broadinstitute.org/annotation/genome/neurospora/Downloads.html ). .. For qPCR template, 8 ng of cDNA (0.125 ng for quantification of 25S cDNA) was used as in a reaction containing: 1× Platinum Taq PCR Buffer (200 mM Tris-HCl, pH 8.4, 500 mM KCl) (Life Technologies), 2.5 mM MgCl2 , 0.2 mM dNTPs, 1× ROX Reference Dye (Life Technologies), 1× SYBR Green I (Life Technologies), 500 nM each primer and 5 U/µl Platinum Taq DNA Polymerase (Life Technologies), or 5 U/µl TaKaRaTaq DNA Polymerase (Clontech, Mountain View, CA) in a 20-μl reaction with filtered sterile DEPC-treated water. .. Amplification was as follows: 50° for 2 min, 95° for 10 min followed by 40 cycles at 95° for 15 sec, and 60° for 1 min; 25S rRNA was used as an internal control for normalization.

    Article Title: Activation of Kaposi's Sarcoma-Associated Herpesvirus (KSHV) by Inhibitors of Class III Histone Deacetylases: Identification of Sirtuin 1 as a Regulator of the KSHV Life Cycle
    Article Snippet: Total RNA extraction and cDNA synthesis were carried out as previously described ( ). .. Reverse transcription (RT)-quantitative real-time PCR (qPCR) was performed with an ABI Prism 7900 system and SYBR green Taq polymerase mix (Applied Biosystems). .. Primers for RT-qPCR and the method for quantification of gene expression were previously described ( ).

    Article Title: Activation of PI3K signaling prevents aminoglycoside-induced hair cell death in the murine cochlea
    Article Snippet: 1 µg RNA was used to make cDNA using the qScript cDNA synthesis kit (Quanta Biosciences) according to manufacturer instructions. .. Relative levels of cDNA was measured by quantitative real time PCR using SYBR green Taq polymerase (Life Technologies) for 40 cycles of 95°C for 15 s, 60°C for 1 min using the StepOnePlus real-time PCR machine. .. Cells were lysed in lysis buffer [(50 mM Tris/HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, and 10% glycerol containing phosphatase inhibitor (Thermo Scientific) and a mixture of protease inhibitors (Roche)].

    Article Title: NEUROG1 Regulates CDK2 to Promote Proliferation in Otic Progenitors
    Article Snippet: RNA (1 μg) was used to make cDNA using the qScript cDNA synthesis kit (Quanta Biosciences) according to the manufacturer’s instructions. .. Relative levels of cDNA were measured by real-time qPCR using SYBR green Taq polymerase (Life Technologies) for 40 cycles of 95°C for 15 s, and 60°C for 1 min using the StepOnePlus real-time PCR machine. .. Three biological replicates, each with technical triplicates were used for each qPCR sample.

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The real-time PCR assay was performed using 2X Supermix SYBR green iQ (100 mM KCl, 40 mM Tris-HCI, pH 8.4, 0.4 mM dNTP, 50 U/mL of iTaq polymerase, 6 mM MgCl2, SYBR Green I, 20 nM fluorescein); 50 pM of TcZ1 and SatRv primers and 3 µL of DNA, the thermal profile and acquisicion of fluorescence was used as previously reported . .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 25 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 10 µM of each primer, 3 µL of DNA template and water to give a final total volume of 20 µL.

    Nested PCR:

    Article Title: Activation of the TGFβ pathway impairs endothelial to haematopoietic transition
    Article Snippet: Nested PCR was done for each gene with 2 outer primers and 2 inner primers (see for primer sequences) according to the Fluidigm Advanced Development Protocol, section 41. .. RT/Specific Target amplification (STA) was performed with a mix composed of 2.8 μl of resuspension buffer (Invitrogen cat. #11753), 0.2 μl of SuperScriptIII & Platinum Taq polymerase (Invitrogen cat. #11753) and 1 μl of 500 nM outer primer mix (forward and reverse primers).

    Expressing:

    Article Title: Activation of PI3K signaling prevents aminoglycoside-induced hair cell death in the murine cochlea
    Article Snippet: Paragraph title: mRNA expression analysis ... Relative levels of cDNA was measured by quantitative real time PCR using SYBR green Taq polymerase (Life Technologies) for 40 cycles of 95°C for 15 s, 60°C for 1 min using the StepOnePlus real-time PCR machine.

    Article Title: NEUROG1 Regulates CDK2 to Promote Proliferation in Otic Progenitors
    Article Snippet: Paragraph title: mRNA Expression Analysis ... Relative levels of cDNA were measured by real-time qPCR using SYBR green Taq polymerase (Life Technologies) for 40 cycles of 95°C for 15 s, and 60°C for 1 min using the StepOnePlus real-time PCR machine.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The variable domain D7 of the rDNA 24Sα subunit using primers D71 ( 5′AAG GTG CGT CGA CAG TGT GG 3′ ) and D72 ( 5′ TTT TCA GAA TGG CCG AAC AGT 3′ ), the primers V1 ( 5′CAA GCG GCT GGG TGG TTA TTC CA 3′ ) and V2 ( 5′TTG AGG GAA GGC ATG ACA CAT GT 3′ ) amplifying the 18S rRNA ribosomal sequence of T. cruzi and the repetitive region of satellite DNA using primers Diaz8 ( 5′ TGT TCA CAC ACT GGA CAC CAA 3′ ) and TcSat4 ( 5′GCA GCC GCT CGA AAA CTA TCC 3′ ) by conventional PCR and qPCR using primers TcZ1 ( 5-′CGAGCTCTTGCCCACACGGGTGCT3) ′ and SatRv ( 5′TTCAGRGTTGTTTGGTGTCCAGTG3′ ) from T. cruzi ( ). .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL.

    Countercurrent Chromatography:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The intergenic region of the non-transcribed mini-exon gene using primers TCC ( 5′CCC CCC TCC CAG GCC ACA CTG 3′ ), TC1 ( 5′GTG TCC GCC ACC TCC TTCGGG CC 3′ ) and TC2 ( 5′CCT GCA GGC ACA CGT GTG TGT G 3′ ); all mini-exon gene PCR assays were performed using two primers instead of a multiplex PCR assay to determine the presence of mixed infections. .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL.

    SYBR Green Assay:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL. .. Amplification cycles were applied in an automatic thermocycler (BIORAD iCycler) as previously reported , , .

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: The 16S rRNA gene was amplified and sequenced for those strains isolated from the lake Aran-Bidgol and from the salterns in Namibia and Spain, using previously described universal primers (Arahal et al., ; López-García et al., ) (Table ). .. PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl. .. All reactions were performed in an Eppendorf Mastercycler Ep gradient thermocycler (Eppendorf).

    Article Title: Genome-Wide Characterization of Light-Regulated Genes in Neurospora crassa
    Article Snippet: Gene identifiers in the Gene Ontology were mapped using the GO Term Finder tool ( http://go.princeton.edu/cgi-bin/GOTermFinder ) with a Neurospora GO gene association file (go_for_nc12.tsv downloaded from http://www.broadinstitute.org/annotation/genome/neurospora/Downloads.html ). .. For qPCR template, 8 ng of cDNA (0.125 ng for quantification of 25S cDNA) was used as in a reaction containing: 1× Platinum Taq PCR Buffer (200 mM Tris-HCl, pH 8.4, 500 mM KCl) (Life Technologies), 2.5 mM MgCl2 , 0.2 mM dNTPs, 1× ROX Reference Dye (Life Technologies), 1× SYBR Green I (Life Technologies), 500 nM each primer and 5 U/µl Platinum Taq DNA Polymerase (Life Technologies), or 5 U/µl TaKaRaTaq DNA Polymerase (Clontech, Mountain View, CA) in a 20-μl reaction with filtered sterile DEPC-treated water. .. Amplification was as follows: 50° for 2 min, 95° for 10 min followed by 40 cycles at 95° for 15 sec, and 60° for 1 min; 25S rRNA was used as an internal control for normalization.

    Article Title: Activation of Kaposi's Sarcoma-Associated Herpesvirus (KSHV) by Inhibitors of Class III Histone Deacetylases: Identification of Sirtuin 1 as a Regulator of the KSHV Life Cycle
    Article Snippet: Total RNA extraction and cDNA synthesis were carried out as previously described ( ). .. Reverse transcription (RT)-quantitative real-time PCR (qPCR) was performed with an ABI Prism 7900 system and SYBR green Taq polymerase mix (Applied Biosystems). .. Primers for RT-qPCR and the method for quantification of gene expression were previously described ( ).

    Article Title: Activation of PI3K signaling prevents aminoglycoside-induced hair cell death in the murine cochlea
    Article Snippet: 1 µg RNA was used to make cDNA using the qScript cDNA synthesis kit (Quanta Biosciences) according to manufacturer instructions. .. Relative levels of cDNA was measured by quantitative real time PCR using SYBR green Taq polymerase (Life Technologies) for 40 cycles of 95°C for 15 s, 60°C for 1 min using the StepOnePlus real-time PCR machine. .. Cells were lysed in lysis buffer [(50 mM Tris/HCl pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1% Triton X-100, and 10% glycerol containing phosphatase inhibitor (Thermo Scientific) and a mixture of protease inhibitors (Roche)].

    Article Title: Evaluation of Adult Chronic Chagas' Heart Disease Diagnosis by Molecular and Serological Methods
    Article Snippet: This reaction mixture consisted of 1× Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM deoxynucleoside triphosphate solution, 25 mM MgCl2 solution, 5 U/μl of Taq polymerase platinum (Invitrogen), 50 pM of T. cruzi nuclear repetitive region-specific primers cruzi1 (5′ASTCGGCTGATCGTTTTCGA3′) and cruzi2 (5′AATTCCTCCAAGCAGCGGATA 3′) , 3 μl of template DNA, and a quantity of water sufficient to give a final volume of 21 μl. .. The possibility of contamination of the PCR reagents and of the solutions used to prepare DNA was carefully examined through the use of appropriate controls (DNA from strain VS [ T. cruzi IIb] and DNA from strain Dm11 [ T. cruzi I] as positive controls and DNA from strain 444 [ T. rangeli ] and DNA from blood serologically negative as negative controls), and each sample was tested in duplicate.

    Article Title: NEUROG1 Regulates CDK2 to Promote Proliferation in Otic Progenitors
    Article Snippet: RNA (1 μg) was used to make cDNA using the qScript cDNA synthesis kit (Quanta Biosciences) according to the manufacturer’s instructions. .. Relative levels of cDNA were measured by real-time qPCR using SYBR green Taq polymerase (Life Technologies) for 40 cycles of 95°C for 15 s, and 60°C for 1 min using the StepOnePlus real-time PCR machine. .. Three biological replicates, each with technical triplicates were used for each qPCR sample.

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: The 16S rRNA gene was amplified and sequenced for those strains isolated from the lake Aran-Bidgol and from the salterns in Namibia and Spain, using previously described universal primers (Arahal et al., ; López-García et al., ) (Table ). .. PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl. .. All reactions were performed in an Eppendorf Mastercycler Ep gradient thermocycler (Eppendorf).

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The real-time PCR assay was performed using 2X Supermix SYBR green iQ (100 mM KCl, 40 mM Tris-HCI, pH 8.4, 0.4 mM dNTP, 50 U/mL of iTaq polymerase, 6 mM MgCl2, SYBR Green I, 20 nM fluorescein); 50 pM of TcZ1 and SatRv primers and 3 µL of DNA, the thermal profile and acquisicion of fluorescence was used as previously reported . .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 25 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 10 µM of each primer, 3 µL of DNA template and water to give a final total volume of 20 µL.

    Cell Culture:

    Article Title: Characterization of hepatic progenitors from human fetal liver during second trimester
    Article Snippet: Total RNA from cultured EpCAM +ve cells was isolated using RNAeasy Mini Kit (Qiagen). .. PCR reaction was performed using cDNA amount representing 100 ng of total RNA and 1 unit of Taq polymerase (Invitrogen, reaction mixture containing 10 mmol/L Tris-Hcl, 200 mmol/L dNTP and 20 pmol of gene specific primer).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Characterization of hepatic progenitors from human fetal liver during second trimester
    Article Snippet: RT PCR analysis of cultured EpCAM +ve cells was done for 3 samples ( n = 3). .. PCR reaction was performed using cDNA amount representing 100 ng of total RNA and 1 unit of Taq polymerase (Invitrogen, reaction mixture containing 10 mmol/L Tris-Hcl, 200 mmol/L dNTP and 20 pmol of gene specific primer).

    Polymerase Chain Reaction:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The variable domain D7 of the rDNA 24Sα subunit using primers D71 ( 5′AAG GTG CGT CGA CAG TGT GG 3′ ) and D72 ( 5′ TTT TCA GAA TGG CCG AAC AGT 3′ ), the primers V1 ( 5′CAA GCG GCT GGG TGG TTA TTC CA 3′ ) and V2 ( 5′TTG AGG GAA GGC ATG ACA CAT GT 3′ ) amplifying the 18S rRNA ribosomal sequence of T. cruzi and the repetitive region of satellite DNA using primers Diaz8 ( 5′ TGT TCA CAC ACT GGA CAC CAA 3′ ) and TcSat4 ( 5′GCA GCC GCT CGA AAA CTA TCC 3′ ) by conventional PCR and qPCR using primers TcZ1 ( 5-′CGAGCTCTTGCCCACACGGGTGCT3) ′ and SatRv ( 5′TTCAGRGTTGTTTGGTGTCCAGTG3′ ) from T. cruzi ( ). .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL.

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: The 16S rRNA gene was amplified and sequenced for those strains isolated from the lake Aran-Bidgol and from the salterns in Namibia and Spain, using previously described universal primers (Arahal et al., ; López-García et al., ) (Table ). .. PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl. .. All reactions were performed in an Eppendorf Mastercycler Ep gradient thermocycler (Eppendorf).

    Article Title: Activation of the TGFβ pathway impairs endothelial to haematopoietic transition
    Article Snippet: Twenty-five cells of EC, Pre-HPC and HPC populations from in vitro differentiated ESC or cells isolated from E11 AGM region were FACS-sorted in one well of 96-well plate (Bio-Rad Hard-Shell PCR plates cat. #HSP9611) filled with 5 μl of 2x reaction mix (Invitrogen cat. #11753). .. RT/Specific Target amplification (STA) was performed with a mix composed of 2.8 μl of resuspension buffer (Invitrogen cat. #11753), 0.2 μl of SuperScriptIII & Platinum Taq polymerase (Invitrogen cat. #11753) and 1 μl of 500 nM outer primer mix (forward and reverse primers).

    Article Title: Genome-Wide Characterization of Light-Regulated Genes in Neurospora crassa
    Article Snippet: Gene identifiers in the Gene Ontology were mapped using the GO Term Finder tool ( http://go.princeton.edu/cgi-bin/GOTermFinder ) with a Neurospora GO gene association file (go_for_nc12.tsv downloaded from http://www.broadinstitute.org/annotation/genome/neurospora/Downloads.html ). .. For qPCR template, 8 ng of cDNA (0.125 ng for quantification of 25S cDNA) was used as in a reaction containing: 1× Platinum Taq PCR Buffer (200 mM Tris-HCl, pH 8.4, 500 mM KCl) (Life Technologies), 2.5 mM MgCl2 , 0.2 mM dNTPs, 1× ROX Reference Dye (Life Technologies), 1× SYBR Green I (Life Technologies), 500 nM each primer and 5 U/µl Platinum Taq DNA Polymerase (Life Technologies), or 5 U/µl TaKaRaTaq DNA Polymerase (Clontech, Mountain View, CA) in a 20-μl reaction with filtered sterile DEPC-treated water. .. Amplification was as follows: 50° for 2 min, 95° for 10 min followed by 40 cycles at 95° for 15 sec, and 60° for 1 min; 25S rRNA was used as an internal control for normalization.

    Article Title: Diagnosis of Upper and Lower Respiratory Tract Bacterial Infections with the Use of Multiplex PCR Assays
    Article Snippet: Paragraph title: Multiplex PCR Assay for the Identification of Serotypes 4, 18C, 6, 23F and 19F ... The amplification reactions contained: 0.8 mM dNTPs, 1× DyNAzyme II buffer and 1.5 U Taq polymerase (DyNAzyme II Hot start, Finnzymes, Finland), 3 mM MgCl (ABgene, Surrey, UK), and primers for serotypes 4, 18C, 6, 23F and 19F in concentrations of 0.6 μΜ, 1.2 μΜ, 0.2 μΜ, 0.4 μΜ and 0.8 μΜ, respectively [ ] and 6 μL DNA template in a total volume of 25 μL.

    Article Title: Evaluation of Adult Chronic Chagas' Heart Disease Diagnosis by Molecular and Serological Methods
    Article Snippet: Paragraph title: PCR. ... This reaction mixture consisted of 1× Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM deoxynucleoside triphosphate solution, 25 mM MgCl2 solution, 5 U/μl of Taq polymerase platinum (Invitrogen), 50 pM of T. cruzi nuclear repetitive region-specific primers cruzi1 (5′ASTCGGCTGATCGTTTTCGA3′) and cruzi2 (5′AATTCCTCCAAGCAGCGGATA 3′) , 3 μl of template DNA, and a quantity of water sufficient to give a final volume of 21 μl.

    Article Title: Characterization of hepatic progenitors from human fetal liver during second trimester
    Article Snippet: One µg of RNA was reversed transcribed using Moloney murine leukemia virus Reverse transcriptase and Oligo dT (Promega). .. PCR reaction was performed using cDNA amount representing 100 ng of total RNA and 1 unit of Taq polymerase (Invitrogen, reaction mixture containing 10 mmol/L Tris-Hcl, 200 mmol/L dNTP and 20 pmol of gene specific primer). .. PCR was performed in a thermal cycler (Programmable Thermal Controller) following an initial denaturation step of 5 min at 95°C.

    Article Title: Diagnosis of Upper and Lower Respiratory Tract Bacterial Infections with the Use of Multiplex PCR Assays
    Article Snippet: The amplification reactions contained: 0.8 mM dNTPs, 1.2× DyNAzyme II buffer and 1.5 U Taq polymerase (DyNAzyme II Hot start, Finnzymes, Finland), 3.5 mM MgCl (ABgene, Surrey, UK), and primers for serotypes 19A, 3 and 1 in concentrations of 0.8 μΜ, 0.4 μΜ, and 0.4 μΜ, respectively [ ] and 6 μL DNA template in a total volume of 25 μL. .. A concentration of 1 μΜ was used in the mPCR reaction.

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: The 16S rRNA gene was amplified and sequenced for those strains isolated from the lake Aran-Bidgol and from the salterns in Namibia and Spain, using previously described universal primers (Arahal et al., ; López-García et al., ) (Table ). .. PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl. .. All reactions were performed in an Eppendorf Mastercycler Ep gradient thermocycler (Eppendorf).

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 25 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 10 µM of each primer, 3 µL of DNA template and water to give a final total volume of 20 µL. .. Each reaction was carried out in duplicate, and twenty microliters of PCR product for each reaction were analysed by electrophoresis on a 2% agarose gel and visualised by staining with ethidium bromide.

    Cellular Antioxidant Activity Assay:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The variable domain D7 of the rDNA 24Sα subunit using primers D71 ( 5′AAG GTG CGT CGA CAG TGT GG 3′ ) and D72 ( 5′ TTT TCA GAA TGG CCG AAC AGT 3′ ), the primers V1 ( 5′CAA GCG GCT GGG TGG TTA TTC CA 3′ ) and V2 ( 5′TTG AGG GAA GGC ATG ACA CAT GT 3′ ) amplifying the 18S rRNA ribosomal sequence of T. cruzi and the repetitive region of satellite DNA using primers Diaz8 ( 5′ TGT TCA CAC ACT GGA CAC CAA 3′ ) and TcSat4 ( 5′GCA GCC GCT CGA AAA CTA TCC 3′ ) by conventional PCR and qPCR using primers TcZ1 ( 5-′CGAGCTCTTGCCCACACGGGTGCT3) ′ and SatRv ( 5′TTCAGRGTTGTTTGGTGTCCAGTG3′ ) from T. cruzi ( ). .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL.

    Fluorescence:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL. .. Amplification cycles were applied in an automatic thermocycler (BIORAD iCycler) as previously reported , , .

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The real-time PCR assay was performed using 2X Supermix SYBR green iQ (100 mM KCl, 40 mM Tris-HCI, pH 8.4, 0.4 mM dNTP, 50 U/mL of iTaq polymerase, 6 mM MgCl2, SYBR Green I, 20 nM fluorescein); 50 pM of TcZ1 and SatRv primers and 3 µL of DNA, the thermal profile and acquisicion of fluorescence was used as previously reported . .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 25 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 10 µM of each primer, 3 µL of DNA template and water to give a final total volume of 20 µL.

    Isolation:

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: The 16S rRNA gene was amplified and sequenced for those strains isolated from the lake Aran-Bidgol and from the salterns in Namibia and Spain, using previously described universal primers (Arahal et al., ; López-García et al., ) (Table ). .. PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl.

    Article Title: Activation of the TGFβ pathway impairs endothelial to haematopoietic transition
    Article Snippet: Twenty-five cells of EC, Pre-HPC and HPC populations from in vitro differentiated ESC or cells isolated from E11 AGM region were FACS-sorted in one well of 96-well plate (Bio-Rad Hard-Shell PCR plates cat. #HSP9611) filled with 5 μl of 2x reaction mix (Invitrogen cat. #11753). .. RT/Specific Target amplification (STA) was performed with a mix composed of 2.8 μl of resuspension buffer (Invitrogen cat. #11753), 0.2 μl of SuperScriptIII & Platinum Taq polymerase (Invitrogen cat. #11753) and 1 μl of 500 nM outer primer mix (forward and reverse primers).

    Article Title: Activation of Kaposi's Sarcoma-Associated Herpesvirus (KSHV) by Inhibitors of Class III Histone Deacetylases: Identification of Sirtuin 1 as a Regulator of the KSHV Life Cycle
    Article Snippet: Paragraph title: RNA isolation and RT-qPCR. ... Reverse transcription (RT)-quantitative real-time PCR (qPCR) was performed with an ABI Prism 7900 system and SYBR green Taq polymerase mix (Applied Biosystems).

    Article Title: Characterization of hepatic progenitors from human fetal liver during second trimester
    Article Snippet: Total RNA from cultured EpCAM +ve cells was isolated using RNAeasy Mini Kit (Qiagen). .. PCR reaction was performed using cDNA amount representing 100 ng of total RNA and 1 unit of Taq polymerase (Invitrogen, reaction mixture containing 10 mmol/L Tris-Hcl, 200 mmol/L dNTP and 20 pmol of gene specific primer).

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: The 16S rRNA gene was amplified and sequenced for those strains isolated from the lake Aran-Bidgol and from the salterns in Namibia and Spain, using previously described universal primers (Arahal et al., ; López-García et al., ) (Table ). .. PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl.

    Multiplex PCR:

    Article Title: Diagnosis of Upper and Lower Respiratory Tract Bacterial Infections with the Use of Multiplex PCR Assays
    Article Snippet: Paragraph title: mPCR Assay for the Identification of Serotypes 19A, 14, 3 and 1 ... The amplification reactions contained: 0.8 mM dNTPs, 1.2× DyNAzyme II buffer and 1.5 U Taq polymerase (DyNAzyme II Hot start, Finnzymes, Finland), 3.5 mM MgCl (ABgene, Surrey, UK), and primers for serotypes 19A, 3 and 1 in concentrations of 0.8 μΜ, 0.4 μΜ, and 0.4 μΜ, respectively [ ] and 6 μL DNA template in a total volume of 25 μL.

    Multiplex Assay:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The intergenic region of the non-transcribed mini-exon gene using primers TCC ( 5′CCC CCC TCC CAG GCC ACA CTG 3′ ), TC1 ( 5′GTG TCC GCC ACC TCC TTCGGG CC 3′ ) and TC2 ( 5′CCT GCA GGC ACA CGT GTG TGT G 3′ ); all mini-exon gene PCR assays were performed using two primers instead of a multiplex PCR assay to determine the presence of mixed infections. .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL.

    Article Title: Diagnosis of Upper and Lower Respiratory Tract Bacterial Infections with the Use of Multiplex PCR Assays
    Article Snippet: Paragraph title: Multiplex PCR Assay for the Identification of Serotypes 4, 18C, 6, 23F and 19F ... The amplification reactions contained: 0.8 mM dNTPs, 1× DyNAzyme II buffer and 1.5 U Taq polymerase (DyNAzyme II Hot start, Finnzymes, Finland), 3 mM MgCl (ABgene, Surrey, UK), and primers for serotypes 4, 18C, 6, 23F and 19F in concentrations of 0.6 μΜ, 1.2 μΜ, 0.2 μΜ, 0.4 μΜ and 0.8 μΜ, respectively [ ] and 6 μL DNA template in a total volume of 25 μL.

    Sequencing:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The variable domain D7 of the rDNA 24Sα subunit using primers D71 ( 5′AAG GTG CGT CGA CAG TGT GG 3′ ) and D72 ( 5′ TTT TCA GAA TGG CCG AAC AGT 3′ ), the primers V1 ( 5′CAA GCG GCT GGG TGG TTA TTC CA 3′ ) and V2 ( 5′TTG AGG GAA GGC ATG ACA CAT GT 3′ ) amplifying the 18S rRNA ribosomal sequence of T. cruzi and the repetitive region of satellite DNA using primers Diaz8 ( 5′ TGT TCA CAC ACT GGA CAC CAA 3′ ) and TcSat4 ( 5′GCA GCC GCT CGA AAA CTA TCC 3′ ) by conventional PCR and qPCR using primers TcZ1 ( 5-′CGAGCTCTTGCCCACACGGGTGCT3) ′ and SatRv ( 5′TTCAGRGTTGTTTGGTGTCCAGTG3′ ) from T. cruzi ( ). .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL.

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: Paragraph title: Amplification and sequencing ... PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl.

    FACS:

    Article Title: Activation of the TGFβ pathway impairs endothelial to haematopoietic transition
    Article Snippet: Twenty-five cells of EC, Pre-HPC and HPC populations from in vitro differentiated ESC or cells isolated from E11 AGM region were FACS-sorted in one well of 96-well plate (Bio-Rad Hard-Shell PCR plates cat. #HSP9611) filled with 5 μl of 2x reaction mix (Invitrogen cat. #11753). .. RT/Specific Target amplification (STA) was performed with a mix composed of 2.8 μl of resuspension buffer (Invitrogen cat. #11753), 0.2 μl of SuperScriptIII & Platinum Taq polymerase (Invitrogen cat. #11753) and 1 μl of 500 nM outer primer mix (forward and reverse primers).

    IA:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL. .. The real-time PCR assay was performed using 2X Supermix SYBR green iQ (100 mM KCl, 40 mM Tris-HCI, pH 8.4, 0.4 mM dNTP, 50 U/mL of iTaq polymerase, 6 mM MgCl2, SYBR Green I, 20 nM fluorescein); 50 pM of TcZ1 and SatRv primers and 3 µL of DNA, the thermal profile and acquisicion of fluorescence was used as previously reported .

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: Molecular identification of genotypes in TcI was accomplished using primers 1-A ( 5′TGT GTG TGT ATG TAT GTG TGT GTG 3′ ), 1-B ( 5′ CGG AGC GGT GTG TGC AG 3′ ) for the identification of genotype Ia with an amplification product of 288 bp; 2-A ( 5′TGT GTG TGT GTA TGT ATG TAT GCT 3′ ), 2-B ( 5′GGA ACA CAC GCG ACT AAT-3′ ) for the identification of genotype Ib with an amplification product of 250 bp; 4-A ( 5′CTG CAG GCA CAC GTG TGT 3′ ), 4-B ( 5′AAA AGA CGG GAA AAA AGC AA 3′ ) for the identification of genotype Id with an amplification product of 200 bp ( ). .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 25 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 10 µM of each primer, 3 µL of DNA template and water to give a final total volume of 20 µL.

    Activated Clotting Time Assay:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The variable domain D7 of the rDNA 24Sα subunit using primers D71 ( 5′AAG GTG CGT CGA CAG TGT GG 3′ ) and D72 ( 5′ TTT TCA GAA TGG CCG AAC AGT 3′ ), the primers V1 ( 5′CAA GCG GCT GGG TGG TTA TTC CA 3′ ) and V2 ( 5′TTG AGG GAA GGC ATG ACA CAT GT 3′ ) amplifying the 18S rRNA ribosomal sequence of T. cruzi and the repetitive region of satellite DNA using primers Diaz8 ( 5′ TGT TCA CAC ACT GGA CAC CAA 3′ ) and TcSat4 ( 5′GCA GCC GCT CGA AAA CTA TCC 3′ ) by conventional PCR and qPCR using primers TcZ1 ( 5-′CGAGCTCTTGCCCACACGGGTGCT3) ′ and SatRv ( 5′TTCAGRGTTGTTTGGTGTCCAGTG3′ ) from T. cruzi ( ). .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL.

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: Molecular identification of genotypes in TcI was accomplished using primers 1-A ( 5′TGT GTG TGT ATG TAT GTG TGT GTG 3′ ), 1-B ( 5′ CGG AGC GGT GTG TGC AG 3′ ) for the identification of genotype Ia with an amplification product of 288 bp; 2-A ( 5′TGT GTG TGT GTA TGT ATG TAT GCT 3′ ), 2-B ( 5′GGA ACA CAC GCG ACT AAT-3′ ) for the identification of genotype Ib with an amplification product of 250 bp; 4-A ( 5′CTG CAG GCA CAC GTG TGT 3′ ), 4-B ( 5′AAA AGA CGG GAA AAA AGC AA 3′ ) for the identification of genotype Id with an amplification product of 200 bp ( ). .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 25 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 10 µM of each primer, 3 µL of DNA template and water to give a final total volume of 20 µL.

    Chromatin Immunoprecipitation:

    Article Title: Activation of the TGFβ pathway impairs endothelial to haematopoietic transition
    Article Snippet: RT/Specific Target amplification (STA) was performed with a mix composed of 2.8 μl of resuspension buffer (Invitrogen cat. #11753), 0.2 μl of SuperScriptIII & Platinum Taq polymerase (Invitrogen cat. #11753) and 1 μl of 500 nM outer primer mix (forward and reverse primers). .. RT/Specific Target amplification (STA) was performed with a mix composed of 2.8 μl of resuspension buffer (Invitrogen cat. #11753), 0.2 μl of SuperScriptIII & Platinum Taq polymerase (Invitrogen cat. #11753) and 1 μl of 500 nM outer primer mix (forward and reverse primers).

    Enzyme-linked Immunosorbent Assay:

    Article Title: Insulin-like growth factor 1 receptor regulates hypothermia during calorie restriction
    Article Snippet: Serum levels of IGF1 were determined using the Quantikine ELISA (R & D Systems). .. Levels of IGF1 transcript were determined by real time RT-PCR, using Taq polymerase enzyme (PowerUP Sybr Master Mix, # ; Life Technologies), along with the following primers from Qiagen: RT2 qPCR Primer Assay, Beta Actin (PPM02945B-200), IGF1 (PPM03387F-200).

    RNA Extraction:

    Article Title: Activation of Kaposi's Sarcoma-Associated Herpesvirus (KSHV) by Inhibitors of Class III Histone Deacetylases: Identification of Sirtuin 1 as a Regulator of the KSHV Life Cycle
    Article Snippet: Total RNA extraction and cDNA synthesis were carried out as previously described ( ). .. Reverse transcription (RT)-quantitative real-time PCR (qPCR) was performed with an ABI Prism 7900 system and SYBR green Taq polymerase mix (Applied Biosystems).

    Agarose Gel Electrophoresis:

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl. .. PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl.

    Article Title: Evaluation of Adult Chronic Chagas' Heart Disease Diagnosis by Molecular and Serological Methods
    Article Snippet: This reaction mixture consisted of 1× Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM deoxynucleoside triphosphate solution, 25 mM MgCl2 solution, 5 U/μl of Taq polymerase platinum (Invitrogen), 50 pM of T. cruzi nuclear repetitive region-specific primers cruzi1 (5′ASTCGGCTGATCGTTTTCGA3′) and cruzi2 (5′AATTCCTCCAAGCAGCGGATA 3′) , 3 μl of template DNA, and a quantity of water sufficient to give a final volume of 21 μl. .. The possibility of contamination of the PCR reagents and of the solutions used to prepare DNA was carefully examined through the use of appropriate controls (DNA from strain VS [ T. cruzi IIb] and DNA from strain Dm11 [ T. cruzi I] as positive controls and DNA from strain 444 [ T. rangeli ] and DNA from blood serologically negative as negative controls), and each sample was tested in duplicate.

    Article Title: Characterization of hepatic progenitors from human fetal liver during second trimester
    Article Snippet: PCR reaction was performed using cDNA amount representing 100 ng of total RNA and 1 unit of Taq polymerase (Invitrogen, reaction mixture containing 10 mmol/L Tris-Hcl, 200 mmol/L dNTP and 20 pmol of gene specific primer). .. PCR reaction was performed using cDNA amount representing 100 ng of total RNA and 1 unit of Taq polymerase (Invitrogen, reaction mixture containing 10 mmol/L Tris-Hcl, 200 mmol/L dNTP and 20 pmol of gene specific primer).

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl. .. PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl.

    In Vitro:

    Article Title: Activation of the TGFβ pathway impairs endothelial to haematopoietic transition
    Article Snippet: Twenty-five cells of EC, Pre-HPC and HPC populations from in vitro differentiated ESC or cells isolated from E11 AGM region were FACS-sorted in one well of 96-well plate (Bio-Rad Hard-Shell PCR plates cat. #HSP9611) filled with 5 μl of 2x reaction mix (Invitrogen cat. #11753). .. RT/Specific Target amplification (STA) was performed with a mix composed of 2.8 μl of resuspension buffer (Invitrogen cat. #11753), 0.2 μl of SuperScriptIII & Platinum Taq polymerase (Invitrogen cat. #11753) and 1 μl of 500 nM outer primer mix (forward and reverse primers).

    Electrophoresis:

    Article Title: Evaluation of Adult Chronic Chagas' Heart Disease Diagnosis by Molecular and Serological Methods
    Article Snippet: This reaction mixture consisted of 1× Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM deoxynucleoside triphosphate solution, 25 mM MgCl2 solution, 5 U/μl of Taq polymerase platinum (Invitrogen), 50 pM of T. cruzi nuclear repetitive region-specific primers cruzi1 (5′ASTCGGCTGATCGTTTTCGA3′) and cruzi2 (5′AATTCCTCCAAGCAGCGGATA 3′) , 3 μl of template DNA, and a quantity of water sufficient to give a final volume of 21 μl. .. The possibility of contamination of the PCR reagents and of the solutions used to prepare DNA was carefully examined through the use of appropriate controls (DNA from strain VS [ T. cruzi IIb] and DNA from strain Dm11 [ T. cruzi I] as positive controls and DNA from strain 444 [ T. rangeli ] and DNA from blood serologically negative as negative controls), and each sample was tested in duplicate.

    Article Title: Characterization of hepatic progenitors from human fetal liver during second trimester
    Article Snippet: PCR reaction was performed using cDNA amount representing 100 ng of total RNA and 1 unit of Taq polymerase (Invitrogen, reaction mixture containing 10 mmol/L Tris-Hcl, 200 mmol/L dNTP and 20 pmol of gene specific primer). .. PCR reaction was performed using cDNA amount representing 100 ng of total RNA and 1 unit of Taq polymerase (Invitrogen, reaction mixture containing 10 mmol/L Tris-Hcl, 200 mmol/L dNTP and 20 pmol of gene specific primer).

    Concentration Assay:

    Article Title: Diagnosis of Upper and Lower Respiratory Tract Bacterial Infections with the Use of Multiplex PCR Assays
    Article Snippet: The amplification reactions contained: 0.8 mM dNTPs, 1.2× DyNAzyme II buffer and 1.5 U Taq polymerase (DyNAzyme II Hot start, Finnzymes, Finland), 3.5 mM MgCl (ABgene, Surrey, UK), and primers for serotypes 19A, 3 and 1 in concentrations of 0.8 μΜ, 0.4 μΜ, and 0.4 μΜ, respectively [ ] and 6 μL DNA template in a total volume of 25 μL. .. For serotype 14, a new primer pair was designed (sp-T14F 7749: 5'-AGAAGTTTGTTAGACTGGGACGGA-3' and sp-T14R 7749: 5'-CGTGTCGCATTGCTACCCGATCTA-3') in wzy gene with FastPCR software [ ].

    CTG Assay:

    Article Title: Chagas Cardiomyopathy Manifestations and Trypanosoma cruzi Genotypes Circulating in Chronic Chagasic Patients
    Article Snippet: The intergenic region of the non-transcribed mini-exon gene using primers TCC ( 5′CCC CCC TCC CAG GCC ACA CTG 3′ ), TC1 ( 5′GTG TCC GCC ACC TCC TTCGGG CC 3′ ) and TC2 ( 5′CCT GCA GGC ACA CGT GTG TGT G 3′ ); all mini-exon gene PCR assays were performed using two primers instead of a multiplex PCR assay to determine the presence of mixed infections. .. This reaction consisted of 1X of Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM dNTPs solution, 50 mM MgCl2 solution, 5 Units/µL of Taq polymerase platinum (Invitrogen), 50 pM of each primer, 3 µL of DNA template and water to give a final total volume of 21 µL.

    Staining:

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl. .. PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl.

    Article Title: Evaluation of Adult Chronic Chagas' Heart Disease Diagnosis by Molecular and Serological Methods
    Article Snippet: This reaction mixture consisted of 1× Taq polymerase amplification buffer (100 mM Tris-HCl, pH 8.3; Invitrogen), 100 mM deoxynucleoside triphosphate solution, 25 mM MgCl2 solution, 5 U/μl of Taq polymerase platinum (Invitrogen), 50 pM of T. cruzi nuclear repetitive region-specific primers cruzi1 (5′ASTCGGCTGATCGTTTTCGA3′) and cruzi2 (5′AATTCCTCCAAGCAGCGGATA 3′) , 3 μl of template DNA, and a quantity of water sufficient to give a final volume of 21 μl. .. The possibility of contamination of the PCR reagents and of the solutions used to prepare DNA was carefully examined through the use of appropriate controls (DNA from strain VS [ T. cruzi IIb] and DNA from strain Dm11 [ T. cruzi I] as positive controls and DNA from strain 444 [ T. rangeli ] and DNA from blood serologically negative as negative controls), and each sample was tested in duplicate.

    Article Title: Genotypic and Lipid Analyses of Strains From the Archaeal Genus Halorubrum Reveal Insights Into Their Taxonomy, Divergence, and Population Structure
    Article Snippet: PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl. .. PCR amplification was performed in a 50 μl reaction mixture composed of 5.0 μl 10 × PCR buffer, 1.5 μl MgCl2 (50 mM stock), 1.0 μl dNTPs (10 mM each), 2.0 μl each forward and reverse primers (10 μM), 1.0 μl Taq polymerase (5 U μl−1 ; Invitrogen Taq DNA Polymerase Native or Roche Fast Start Universal SYBR Green Master [Rox]), 1.0 μl template DNA (20 ng μl−1 ), and ddH2 O to a final volume of 50 μl.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher maxma hot start taq dna polymerase
    Maxma Hot Start Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maxma hot start taq dna polymerase/product/Thermo Fisher
    Average 97 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    maxma hot start taq dna polymerase - by Bioz Stars, 2019-10
    97/100 stars
      Buy from Supplier

    83
    Thermo Fisher arabidopsis leaves
    Disease phenotype of Col-0 and cwin1-1 plants in response to B. cinerea infection. (A) Lesion diameters measured 3 days after B. cinerea infection. Source leaves were drop-inoculated with a PDB solution containing 5 × 10 4 conidia ml −1 . Data represent mean (±SE) of at least 3 independent experiments. (B) Quantification of in planta growth of B. cinerea . Foliar disks were cut around the infection point, and relative genomic DNA level was quantified by qPCR using B. cinerea CUTINASE and <t>Arabidopsis</t> iASK primers. Data represent mean (±SE) of 3 independent experiments. Asterisks represent significant differences compared to Col-0 plants (Student's t -test, ** P
    Arabidopsis Leaves, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 83/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/arabidopsis leaves/product/Thermo Fisher
    Average 83 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    arabidopsis leaves - by Bioz Stars, 2019-10
    83/100 stars
      Buy from Supplier

    99
    Thermo Fisher gene exp gadd45a hs00169255 m1
    Reduction of <t>GADD45A</t> expression by GADD45A -siRNAs in decitabine-treated U2OS and MG63 cells. (A) Effects of GADD45A-siRNA on mRNA levels in U2OS and MG63. Total RNA was extracted on day 3 after the decitabine treatment was initiated. Preparation of cDNA
    Gene Exp Gadd45a Hs00169255 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gadd45a hs00169255 m1/product/Thermo Fisher
    Average 99 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    gene exp gadd45a hs00169255 m1 - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Disease phenotype of Col-0 and cwin1-1 plants in response to B. cinerea infection. (A) Lesion diameters measured 3 days after B. cinerea infection. Source leaves were drop-inoculated with a PDB solution containing 5 × 10 4 conidia ml −1 . Data represent mean (±SE) of at least 3 independent experiments. (B) Quantification of in planta growth of B. cinerea . Foliar disks were cut around the infection point, and relative genomic DNA level was quantified by qPCR using B. cinerea CUTINASE and Arabidopsis iASK primers. Data represent mean (±SE) of 3 independent experiments. Asterisks represent significant differences compared to Col-0 plants (Student's t -test, ** P

    Journal: Frontiers in Plant Science

    Article Title: Targeting the AtCWIN1 Gene to Explore the Role of Invertases in Sucrose Transport in Roots and during Botrytis cinerea Infection

    doi: 10.3389/fpls.2016.01899

    Figure Lengend Snippet: Disease phenotype of Col-0 and cwin1-1 plants in response to B. cinerea infection. (A) Lesion diameters measured 3 days after B. cinerea infection. Source leaves were drop-inoculated with a PDB solution containing 5 × 10 4 conidia ml −1 . Data represent mean (±SE) of at least 3 independent experiments. (B) Quantification of in planta growth of B. cinerea . Foliar disks were cut around the infection point, and relative genomic DNA level was quantified by qPCR using B. cinerea CUTINASE and Arabidopsis iASK primers. Data represent mean (±SE) of 3 independent experiments. Asterisks represent significant differences compared to Col-0 plants (Student's t -test, ** P

    Article Snippet: Complete coding sequence of AtSTP1 was obtained after a PCR-amplification of cDNA made from Arabidopsis leaves (Phusion Taq Polymerase, Thermo Scientific).

    Techniques: Infection, Real-time Polymerase Chain Reaction

    B. cinerea invertase activity, sugar transport and gene expression (A) Cell wall and intracellular (acidic and neutral) invertase activities in B. cinerea mycelium grown in vitro (mean +/− SE of 3 independent experiments). (B) [ 14 C]-sucrose uptake activity in B. cinerea mycelium grown in vitro (mean +/− SE of 3 independent experiments). Active sucrose uptake results from the difference between total and CCCP-insensitive uptakes. (C) Inhibition of [ 14 C]-sucrose uptake activity by sucrose, glucose:fructose (1:1 mixture) and mannitol supplied in 20-fold excess in B. cinerea mycelium grown in vitro (mean +/− SE of at least 2 independent experiments). (D) Relative expression of B. cinerea putative invertase ( Bc1g10247 and Bc1g16010 ), fructose (BcFRT1) and hexoses transporter ( Hxt1-17 ) genes in infected Arabidopsis leaves (5 × 10 4 conidia ml −1 ). Gene expression analysis was performed by RT-qPCR and results were normalized to the B. cinerea TUBA gene. Data represent mean (±SE) of 3 independent experiments.

    Journal: Frontiers in Plant Science

    Article Title: Targeting the AtCWIN1 Gene to Explore the Role of Invertases in Sucrose Transport in Roots and during Botrytis cinerea Infection

    doi: 10.3389/fpls.2016.01899

    Figure Lengend Snippet: B. cinerea invertase activity, sugar transport and gene expression (A) Cell wall and intracellular (acidic and neutral) invertase activities in B. cinerea mycelium grown in vitro (mean +/− SE of 3 independent experiments). (B) [ 14 C]-sucrose uptake activity in B. cinerea mycelium grown in vitro (mean +/− SE of 3 independent experiments). Active sucrose uptake results from the difference between total and CCCP-insensitive uptakes. (C) Inhibition of [ 14 C]-sucrose uptake activity by sucrose, glucose:fructose (1:1 mixture) and mannitol supplied in 20-fold excess in B. cinerea mycelium grown in vitro (mean +/− SE of at least 2 independent experiments). (D) Relative expression of B. cinerea putative invertase ( Bc1g10247 and Bc1g16010 ), fructose (BcFRT1) and hexoses transporter ( Hxt1-17 ) genes in infected Arabidopsis leaves (5 × 10 4 conidia ml −1 ). Gene expression analysis was performed by RT-qPCR and results were normalized to the B. cinerea TUBA gene. Data represent mean (±SE) of 3 independent experiments.

    Article Snippet: Complete coding sequence of AtSTP1 was obtained after a PCR-amplification of cDNA made from Arabidopsis leaves (Phusion Taq Polymerase, Thermo Scientific).

    Techniques: Activity Assay, Expressing, In Vitro, Inhibition, Infection, Quantitative RT-PCR

    Sucrose uptake activity and gene expression in seedling roots. (A) [ 14 C]-sucrose uptake activity in 9-day-old Col-0 and cwin1-1 seedling roots grown with 2% sucrose (mean +/− SE of 2 independent experiments). Active sucrose uptake results from the difference between total and CCCP-insensitive uptakes (B) Relative [ 14 C]-sucrose uptake rate in 9-day-old seedling roots of cwin1-1, CR-stp1, stp13-2 , OESTP1, and OESTP13 lines grown with 2% sucrose. Results are relative to the Col-0 uptake rate and represent mean (±SE) of at least 3 independent experiments. (C) Relative [ 14 C]-glucose uptake activity in 9-day-old seedling roots of Col-0 and cwin1-1 lines. Results are relative to the Col-0 uptake rate and represent mean (±SE) of 3 independent experiments. (D,E) Expression of the 14 AtSTP (D) and 9 AtSUC (E) genes in 9-day-old Arabidopsis seedling roots. Genes that were expressed below the detection level are not presented. Gene expression analysis was performed by RT-qPCR and results were normalized to the plant reference genes At4g26410 and AtACTIN2 ( At3g18780 ). Data represent mean (±SE) of 3 independent experiments. For (B) and (C) , asterisks represent significant differences compared to Col-0 plants (Student's t -test, * P

    Journal: Frontiers in Plant Science

    Article Title: Targeting the AtCWIN1 Gene to Explore the Role of Invertases in Sucrose Transport in Roots and during Botrytis cinerea Infection

    doi: 10.3389/fpls.2016.01899

    Figure Lengend Snippet: Sucrose uptake activity and gene expression in seedling roots. (A) [ 14 C]-sucrose uptake activity in 9-day-old Col-0 and cwin1-1 seedling roots grown with 2% sucrose (mean +/− SE of 2 independent experiments). Active sucrose uptake results from the difference between total and CCCP-insensitive uptakes (B) Relative [ 14 C]-sucrose uptake rate in 9-day-old seedling roots of cwin1-1, CR-stp1, stp13-2 , OESTP1, and OESTP13 lines grown with 2% sucrose. Results are relative to the Col-0 uptake rate and represent mean (±SE) of at least 3 independent experiments. (C) Relative [ 14 C]-glucose uptake activity in 9-day-old seedling roots of Col-0 and cwin1-1 lines. Results are relative to the Col-0 uptake rate and represent mean (±SE) of 3 independent experiments. (D,E) Expression of the 14 AtSTP (D) and 9 AtSUC (E) genes in 9-day-old Arabidopsis seedling roots. Genes that were expressed below the detection level are not presented. Gene expression analysis was performed by RT-qPCR and results were normalized to the plant reference genes At4g26410 and AtACTIN2 ( At3g18780 ). Data represent mean (±SE) of 3 independent experiments. For (B) and (C) , asterisks represent significant differences compared to Col-0 plants (Student's t -test, * P

    Article Snippet: Complete coding sequence of AtSTP1 was obtained after a PCR-amplification of cDNA made from Arabidopsis leaves (Phusion Taq Polymerase, Thermo Scientific).

    Techniques: Activity Assay, Expressing, Quantitative RT-PCR

    Vacuolar invertase gene expression and activity in different Arabidopsis organs. (A) Relative gene expression of AtVIN genes was performed by RT-qPCR and results were normalized to the plant reference genes At4g26410 and AtACTIN2 ( At3g18780 ). Data represent mean (±SE) of 3 independent experiments. (B) VIN activity was assayed from frozen ground tissues of 5–6 week-old soil grown plants (leaves and roots) or 9-day-old seedling roots. Data represent mean (±SE) of 2 (seedling roots) or 3 (leaves and roots) independent experiments. No significant difference was determined between Col-0 and cwin1-1 by a Student's t -test ( P

    Journal: Frontiers in Plant Science

    Article Title: Targeting the AtCWIN1 Gene to Explore the Role of Invertases in Sucrose Transport in Roots and during Botrytis cinerea Infection

    doi: 10.3389/fpls.2016.01899

    Figure Lengend Snippet: Vacuolar invertase gene expression and activity in different Arabidopsis organs. (A) Relative gene expression of AtVIN genes was performed by RT-qPCR and results were normalized to the plant reference genes At4g26410 and AtACTIN2 ( At3g18780 ). Data represent mean (±SE) of 3 independent experiments. (B) VIN activity was assayed from frozen ground tissues of 5–6 week-old soil grown plants (leaves and roots) or 9-day-old seedling roots. Data represent mean (±SE) of 2 (seedling roots) or 3 (leaves and roots) independent experiments. No significant difference was determined between Col-0 and cwin1-1 by a Student's t -test ( P

    Article Snippet: Complete coding sequence of AtSTP1 was obtained after a PCR-amplification of cDNA made from Arabidopsis leaves (Phusion Taq Polymerase, Thermo Scientific).

    Techniques: Expressing, Activity Assay, Quantitative RT-PCR

    Cell wall invertase activity and gene expression in different Arabidopsis organs. (A) CWIN activity in Col-0 and cwin1-1 was assayed from frozen ground tissues of 5–6 week-old soil-grown plants (leaves and roots) or 9-day-old seedling roots. Data represent mean (±SE) of 2 (seedling roots) or 3 (leaves and roots) independent experiments. (B,C) Relative gene expression of AtCWIN1, AtCWIN5 (B) , AtCIF1 and AtC/VIF2 (C) genes was performed by RT-qPCR and results were normalized to the plant reference genes At4g26410 and AtACTIN2 ( At3g18780 ). Data represent mean (±SE) of 3 independent experiments. AtCWIN2 and -4 are not presented because transcript levels were below the detection threshold. For (A) , asterisks represent significant differences between organs of Col-0 plants (Student's t -test, * P

    Journal: Frontiers in Plant Science

    Article Title: Targeting the AtCWIN1 Gene to Explore the Role of Invertases in Sucrose Transport in Roots and during Botrytis cinerea Infection

    doi: 10.3389/fpls.2016.01899

    Figure Lengend Snippet: Cell wall invertase activity and gene expression in different Arabidopsis organs. (A) CWIN activity in Col-0 and cwin1-1 was assayed from frozen ground tissues of 5–6 week-old soil-grown plants (leaves and roots) or 9-day-old seedling roots. Data represent mean (±SE) of 2 (seedling roots) or 3 (leaves and roots) independent experiments. (B,C) Relative gene expression of AtCWIN1, AtCWIN5 (B) , AtCIF1 and AtC/VIF2 (C) genes was performed by RT-qPCR and results were normalized to the plant reference genes At4g26410 and AtACTIN2 ( At3g18780 ). Data represent mean (±SE) of 3 independent experiments. AtCWIN2 and -4 are not presented because transcript levels were below the detection threshold. For (A) , asterisks represent significant differences between organs of Col-0 plants (Student's t -test, * P

    Article Snippet: Complete coding sequence of AtSTP1 was obtained after a PCR-amplification of cDNA made from Arabidopsis leaves (Phusion Taq Polymerase, Thermo Scientific).

    Techniques: Activity Assay, Expressing, Quantitative RT-PCR

    Simplified model representing key molecular actors involved in the competition for sugars at the  A. thaliana / B. cinerea  interface . Upon infection by  B. cinerea , unloaded sucrose is mainly cleaved into glucose and fructose. Cell wall invertases from host ( AtCWIN1 ) contribute to the accumulation of hexoses in the apoplast through transcriptional and posttranslational regulations. Host cells can assimilate free hexoses  via  the induced activity of hexose-specific transporters belonging to the Sugar Transporter Protein (STPs) family.  B. cinerea  possesses its own functional sucrolytic machinery (Bc1g10247 ?) and also a multigenic hexose uptake system (BcHXTs and BcFRT1). A secondary pathway for apoplastic sucrose retrieval involving sucrose transporter has been evidenced. Intracellular sucrolytic machinery, involving VINs and to lesser extent CINs, is efficient to provide intracellular hexoses to maintain sugar homeostasis in host cells and to fuel plant defenses. The precise regulatory role of tonoplastic, plasma membrane sucrose transporters and sugar facilitators (SWEETs) needs to be elucidated.

    Journal: Frontiers in Plant Science

    Article Title: Targeting the AtCWIN1 Gene to Explore the Role of Invertases in Sucrose Transport in Roots and during Botrytis cinerea Infection

    doi: 10.3389/fpls.2016.01899

    Figure Lengend Snippet: Simplified model representing key molecular actors involved in the competition for sugars at the A. thaliana / B. cinerea interface . Upon infection by B. cinerea , unloaded sucrose is mainly cleaved into glucose and fructose. Cell wall invertases from host ( AtCWIN1 ) contribute to the accumulation of hexoses in the apoplast through transcriptional and posttranslational regulations. Host cells can assimilate free hexoses via the induced activity of hexose-specific transporters belonging to the Sugar Transporter Protein (STPs) family. B. cinerea possesses its own functional sucrolytic machinery (Bc1g10247 ?) and also a multigenic hexose uptake system (BcHXTs and BcFRT1). A secondary pathway for apoplastic sucrose retrieval involving sucrose transporter has been evidenced. Intracellular sucrolytic machinery, involving VINs and to lesser extent CINs, is efficient to provide intracellular hexoses to maintain sugar homeostasis in host cells and to fuel plant defenses. The precise regulatory role of tonoplastic, plasma membrane sucrose transporters and sugar facilitators (SWEETs) needs to be elucidated.

    Article Snippet: Complete coding sequence of AtSTP1 was obtained after a PCR-amplification of cDNA made from Arabidopsis leaves (Phusion Taq Polymerase, Thermo Scientific).

    Techniques: Infection, Activity Assay, Functional Assay

    Reduction of GADD45A expression by GADD45A -siRNAs in decitabine-treated U2OS and MG63 cells. (A) Effects of GADD45A-siRNA on mRNA levels in U2OS and MG63. Total RNA was extracted on day 3 after the decitabine treatment was initiated. Preparation of cDNA

    Journal:

    Article Title: Decitabine-Induced Demethylation of 5? CpG Island in GADD45A Leads to Apoptosis in Osteosarcoma Cells

    doi:

    Figure Lengend Snippet: Reduction of GADD45A expression by GADD45A -siRNAs in decitabine-treated U2OS and MG63 cells. (A) Effects of GADD45A-siRNA on mRNA levels in U2OS and MG63. Total RNA was extracted on day 3 after the decitabine treatment was initiated. Preparation of cDNA

    Article Snippet: About 20 ng of the resulting cDNA was used for Taq Man real-time PCR GADD45A expression assay (Hs00169255_m1; ABI).

    Techniques: Expressing

    Repression of GADD45A expression. (A) Induction of GADD45A mRNA expression in U2OS and MG63 after decitabine treatment. Total RNA was extracted on day 3 after decitabine treatment was initiated. cDNA was then made as detailed in the Materials and Methods

    Journal:

    Article Title: Decitabine-Induced Demethylation of 5? CpG Island in GADD45A Leads to Apoptosis in Osteosarcoma Cells

    doi:

    Figure Lengend Snippet: Repression of GADD45A expression. (A) Induction of GADD45A mRNA expression in U2OS and MG63 after decitabine treatment. Total RNA was extracted on day 3 after decitabine treatment was initiated. cDNA was then made as detailed in the Materials and Methods

    Article Snippet: About 20 ng of the resulting cDNA was used for Taq Man real-time PCR GADD45A expression assay (Hs00169255_m1; ABI).

    Techniques: Expressing

    Induction of Gadd45a protein in OS xenografts by decitabine treatment. (A) Induction of Gadd45a protein levels in U2OS xenografts. Analysis of the relative levels of nuclear Gadd45a protein within xenografts derived from representative control untreated

    Journal:

    Article Title: Decitabine-Induced Demethylation of 5? CpG Island in GADD45A Leads to Apoptosis in Osteosarcoma Cells

    doi:

    Figure Lengend Snippet: Induction of Gadd45a protein in OS xenografts by decitabine treatment. (A) Induction of Gadd45a protein levels in U2OS xenografts. Analysis of the relative levels of nuclear Gadd45a protein within xenografts derived from representative control untreated

    Article Snippet: About 20 ng of the resulting cDNA was used for Taq Man real-time PCR GADD45A expression assay (Hs00169255_m1; ABI).

    Techniques: Derivative Assay

    Apoptosis induction by pCMV-GADD45A in U2OS and MG63. (A) Percentage of apoptotic nuclei as detected by Hoechst stain in U2OS and MG63. Columns are mean of three replicas, and error bars are standard deviation from the mean. (B) Induction of Gadd45a protein

    Journal:

    Article Title: Decitabine-Induced Demethylation of 5? CpG Island in GADD45A Leads to Apoptosis in Osteosarcoma Cells

    doi:

    Figure Lengend Snippet: Apoptosis induction by pCMV-GADD45A in U2OS and MG63. (A) Percentage of apoptotic nuclei as detected by Hoechst stain in U2OS and MG63. Columns are mean of three replicas, and error bars are standard deviation from the mean. (B) Induction of Gadd45a protein

    Article Snippet: About 20 ng of the resulting cDNA was used for Taq Man real-time PCR GADD45A expression assay (Hs00169255_m1; ABI).

    Techniques: Staining, Standard Deviation

    Gadd45a-siRNA treatment abolishes decitabine-induced apoptosis. (A) A representative image of apoptotic nuclei (arrows) from decitabine-treated MG63 stained with Hoechst 33342 dye. (B) One hundred nuclei were counted per slide, and three slides were prepared

    Journal:

    Article Title: Decitabine-Induced Demethylation of 5? CpG Island in GADD45A Leads to Apoptosis in Osteosarcoma Cells

    doi:

    Figure Lengend Snippet: Gadd45a-siRNA treatment abolishes decitabine-induced apoptosis. (A) A representative image of apoptotic nuclei (arrows) from decitabine-treated MG63 stained with Hoechst 33342 dye. (B) One hundred nuclei were counted per slide, and three slides were prepared

    Article Snippet: About 20 ng of the resulting cDNA was used for Taq Man real-time PCR GADD45A expression assay (Hs00169255_m1; ABI).

    Techniques: Staining

    GADD45A CpG methylation in osteosarcoma cells. (A) Schematic of GADD45A genomic locus. 5′ CpG island spanning the first three exonic regions of GADD45A is shown. An amplicon of ∼250 bp was amplified, and a cluster of eight CG dinucleotides

    Journal:

    Article Title: Decitabine-Induced Demethylation of 5? CpG Island in GADD45A Leads to Apoptosis in Osteosarcoma Cells

    doi:

    Figure Lengend Snippet: GADD45A CpG methylation in osteosarcoma cells. (A) Schematic of GADD45A genomic locus. 5′ CpG island spanning the first three exonic regions of GADD45A is shown. An amplicon of ∼250 bp was amplified, and a cluster of eight CG dinucleotides

    Article Snippet: About 20 ng of the resulting cDNA was used for Taq Man real-time PCR GADD45A expression assay (Hs00169255_m1; ABI).

    Techniques: CpG Methylation Assay, Amplification