Structured Review

Protech Technology Enterprise taq polymerase
Taq Polymerase, supplied by Protech Technology Enterprise, used in various techniques. Bioz Stars score: 93/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taq polymerase/product/Protech Technology Enterprise
Average 93 stars, based on 6 article reviews
Price from $9.99 to $1999.99
taq polymerase - by Bioz Stars, 2020-04
93/100 stars

Images

Related Articles

Amplification:

Article Title: Association between Interleukin-10 Gene Promoter Haplotype and Schizophrenia in a Han-Chinese Study
Article Snippet: Thereafter, the amplified fragment was subjected for cycle sequencing reaction, which performed by using BigDye terminator cycle sequencing kit version 3.1 according the manufacturer’s instructions. .. In a few words, PCR was conducted in a 20 ul total volume with 50 mM KCl, 10 mM HCl, 0.5 mM MgCl2 , 200 uM of dATP, dCTP, dTTP; 150 uM dGTP and 0.5U Taq polymerase (Protech, Taipei, Taiwan).

Article Title: High‐level expression of ARID1A predicts a favourable outcome in triple‐negative breast cancer patients receiving paclitaxel‐based chemotherapy. High‐level expression of ARID1A predicts a favourable outcome in triple‐negative breast cancer patients receiving paclitaxel‐based chemotherapy
Article Snippet: .. Aliquots (5 μg) of total RNA were treated with M‐MLV reverse transcriptase (Invitrogen) and then amplified with Taq‐polymerase (Protech) using paired primers (for ARID1A , forward‐GCCAGACTCCATATTACAACCAGC and reverse‐GGAATAGGCAGTTTGCTGGGACTG; for glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH), forward‐AGGTCGGAGTCAACGGATTTG and reverse‐GTGATGGCATGGACTGTGGTC). .. The protein concentrations of total cell lysates, nuclear and cytoplasmic extracts were determined by the Bradford assay (Bio‐Rad, Hercules, CA, USA) using bovine serum albumin as a standard.

Article Title: Symbiodinium spp. associated with scleractinian corals from Dongsha Atoll (Pratas), Taiwan, in the South China Sea
Article Snippet: The 5′ end of nuclear large subunit ribosomal DNA (nlsrDNA) was amplified using a Symbiodinium -specific primer set, 28Szoox-D1/D2F (5′-CCT CAG TAA TGG CGA ATG AAC A-3′) and 28Szoox-D1/D2R (5′-CCT TGG TCC GTG TTT CAA GA-3′) ( ). .. A 25 µl PCR reaction consisting of 3 µl DNA (10 ng µl−1 ), 2 µl dNTPs (0.8 mM), 2 µl forward primer (0.16 µM), 2 µl reverse primer (0.16 µM), 3 µl PCR Buffer (1.2X), 0.5 unit Taq polymerase (Protech, Taipei, Taiwan), and 12.5 µl distilled water was run on a Px2 thermal cycler (Thermo Scientific, Waltham, MA, USA).

Article Title: Genetic polymorphisms in glutathione S-transferase (GST) superfamily and risk of arsenic-induced urothelial carcinoma in residents of southwestern Taiwan
Article Snippet: PCR was performed in a total volume of 100 μL, containing 10 μL of genomic DNA (50-100 ng), 400 ng of each of the above primers, and 5 units of Taq polymerase (SuperTag, Protech, Taiwan). .. The internal standard fragment of α-globulin was 268-bp in length, whereas the amplified gene products of GSTM1 and GSTT1 were 215 bp and 480 bp, respectively.

Article Title: High‐level expression of ARID1A predicts a favourable outcome in triple‐negative breast cancer patients receiving paclitaxel‐based chemotherapy. High‐level expression of ARID1A predicts a favourable outcome in triple‐negative breast cancer patients receiving paclitaxel‐based chemotherapy
Article Snippet: .. Aliquots (5 μg) of total RNA were treated with M‐MLV reverse transcriptase (Invitrogen) and then amplified with Taq‐polymerase (Protech) using paired primers (for ARID1A , forward‐GCCAGACTCCATATTACAACCAGC and reverse‐GGAATAGGCAGTTTGCTGGGACTG; for glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH), forward‐AGGTCGGAGTCAACGGATTTG and reverse‐GTGATGGCATGGACTGTGGTC). .. 2.3 Western blot analysis The protein concentrations of total cell lysates, nuclear and cytoplasmic extracts were determined by the Bradford assay (Bio‐Rad, Hercules, CA, USA) using bovine serum albumin as a standard.

Article Title: Hexavalent chromium induces expression of mesenchymal and stem cell markers in renal epithelial cells
Article Snippet: The reaction mixture contained 50 mM Tris (pH 7.2), 1.5 mM MgCl2 , 2 μM dNTP, 0.25 μM of 5′ and 3′ primers, respectively, 0.5 U of Taq DNA polymerase (Protech Technology, Taipei, Taiwan), and 2 μL of cDNA (1 μg). .. The amplified PCR products were analyzed in 1% agarose gel and visualized by ethidium bromide staining.

Article Title: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus
Article Snippet: Paragraph title: Amplification assay for degenerate primers ... The reaction mixture of 25 μl is comprised of 100 ng of plasmid DNA, 2.5 μl of 10× Taq buffer (50 mM Tris–HCl, pH 8.0, 1 mM EDTA, 1 mM DTT and 50% glycerol) (Protech, Taipei, Taiwan), 1 μl of 10 mM dNTPs (Protech), 1 μl of 100 μM forward primer, 1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech).

Article Title: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus
Article Snippet: .. For virus detection, the mixture of 25 μl consisting of 200 ng of plant total RNA, 0.2 μl of M-MuLV reverse transcriptase (5 U/μl) (Protech), 2.5 μl of 10× Taq buffer (Protech), 1 μl of 10 mM dNTPs (Protech), 0.1 μl of 100 μM forward primer, 0.1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech) was used in RT-PCR amplification. .. Complementary DNA was synthesized at 45 °C for 30 min then termination at 95 °C for 5 min.

Article Title: OTUD7B upregulation predicts a poor response to paclitaxel in patients with triple-negative breast cancer
Article Snippet: .. Aliquots (5 μg) of total RNA were treated with M-MLV reverse transcriptase (Invitrogen) and then amplified with Taq-polymerase (Protech) using paired primers (for primary mR-1180, forward-CTGGTGCCCACCTCAGAGACGG and reverse-CACAGCCACCAGGCTGAGCATG; for OTUD7B , forward-GAAGGAGAAGTCAAAGCGAGATCG and reverse-GCATCACCTCCTGGCTATACTTGC; for CASP3 , forward-CATGGAAGCGAATCAATGGACT and reverse-CTGTACCAGACCGAGATGTCA; for GAPDH , forward-AGGTCGGAGTCAACGGATTTG and reverse-GTGATGGCATGGACTGTGGTC). .. In vitro invasion assay For invasion assay, Boyden chambers (Neuro Probe, Inc., USA) were used according to the manufacturer’s protocol.

Synthesized:

Article Title: Hexavalent chromium induces expression of mesenchymal and stem cell markers in renal epithelial cells
Article Snippet: After measuring RNA yield, cDNA was synthesized by AMV reverse transcriptase using oligo random primers. .. The reaction mixture contained 50 mM Tris (pH 7.2), 1.5 mM MgCl2 , 2 μM dNTP, 0.25 μM of 5′ and 3′ primers, respectively, 0.5 U of Taq DNA polymerase (Protech Technology, Taipei, Taiwan), and 2 μL of cDNA (1 μg).

Article Title: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus
Article Snippet: For virus detection, the mixture of 25 μl consisting of 200 ng of plant total RNA, 0.2 μl of M-MuLV reverse transcriptase (5 U/μl) (Protech), 2.5 μl of 10× Taq buffer (Protech), 1 μl of 10 mM dNTPs (Protech), 0.1 μl of 100 μM forward primer, 0.1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech) was used in RT-PCR amplification. .. Complementary DNA was synthesized at 45 °C for 30 min then termination at 95 °C for 5 min.

Construct:

Article Title: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus
Article Snippet: Amplification assay for degenerate primers PCR was conducted to evaluate the degenerate primers using the constructed plasmids. .. The reaction mixture of 25 μl is comprised of 100 ng of plasmid DNA, 2.5 μl of 10× Taq buffer (50 mM Tris–HCl, pH 8.0, 1 mM EDTA, 1 mM DTT and 50% glycerol) (Protech, Taipei, Taiwan), 1 μl of 10 mM dNTPs (Protech), 1 μl of 100 μM forward primer, 1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech).

Real-time Polymerase Chain Reaction:

Article Title: Association between Interleukin-10 Gene Promoter Haplotype and Schizophrenia in a Han-Chinese Study
Article Snippet: Genotyping of IL-10 -1082G/A, -819T/C and -592C/A promoter polymorphisms TaqMan® SNP Assay was used for allelic discrimination of -1082G/A polymorphism, which performed on a BIO-RAD IQ™5 multicolor real-time PCR detection system. .. PCR was firstly carried out in 25 ul volume reaction containing 50 mM KCl, 10 mM HCl, 0.5 mM MgCl2 , 200 uM of dATP, dCTP, dTTP, 150 uM dGTP and 0.5 U Taq polymerase (Protech, Taipei, Taiwan).

Incubation:

Article Title: Genetic polymorphisms in glutathione S-transferase (GST) superfamily and risk of arsenic-induced urothelial carcinoma in residents of southwestern Taiwan
Article Snippet: PCR was performed in a total volume of 100 μL, containing 10 μL of genomic DNA (50-100 ng), 400 ng of each of the above primers, and 5 units of Taq polymerase (SuperTag, Protech, Taiwan). .. The reaction was incubated at 94°C for 4 min and subjected to 35 cycles of 94°C for 60 s, 55°C for 60 s and 72°C for 60 s, then a final 72°C-extension for 10 min. Next, 10-μL PCR aliquots were electrophoresed on 2% agarose gels and were stained with ethidium bromide.

Modification:

Article Title: Symbiodinium spp. associated with scleractinian corals from Dongsha Atoll (Pratas), Taiwan, in the South China Sea
Article Snippet: Molecular identification of Symbiodinium clades (28S RFLP) and types (ITS2 DGGE) A total of 928 samples (20 genera in 2009 and 12 genera in 2010) were used to analyze Symbiodinium clade composition using RFLP method modified from and . .. A 25 µl PCR reaction consisting of 3 µl DNA (10 ng µl−1 ), 2 µl dNTPs (0.8 mM), 2 µl forward primer (0.16 µM), 2 µl reverse primer (0.16 µM), 3 µl PCR Buffer (1.2X), 0.5 unit Taq polymerase (Protech, Taipei, Taiwan), and 12.5 µl distilled water was run on a Px2 thermal cycler (Thermo Scientific, Waltham, MA, USA).

Countercurrent Chromatography:

Article Title: Association between Interleukin-10 Gene Promoter Haplotype and Schizophrenia in a Han-Chinese Study
Article Snippet: The sequencing primer was 5'-TTC AAC TTC TTC CAC CCC ATC-3' (forward primer) and 5'-GGC TCC TTT ACC CCG ATT TC-3' (reverse primer). .. In a few words, PCR was conducted in a 20 ul total volume with 50 mM KCl, 10 mM HCl, 0.5 mM MgCl2 , 200 uM of dATP, dCTP, dTTP; 150 uM dGTP and 0.5U Taq polymerase (Protech, Taipei, Taiwan).

Article Title: Association between Interleukin-10 Gene Promoter Haplotype and Schizophrenia in a Han-Chinese Study
Article Snippet: The probe sequence is 5'-TCC TCT TAC CTA TCC CTA CTT CCC C[T/C]T CCC AAA GAA GCC TTA GTA GTG TTG-3'. .. PCR was firstly carried out in 25 ul volume reaction containing 50 mM KCl, 10 mM HCl, 0.5 mM MgCl2 , 200 uM of dATP, dCTP, dTTP, 150 uM dGTP and 0.5 U Taq polymerase (Protech, Taipei, Taiwan).

Cell Culture:

Article Title: Hexavalent chromium induces expression of mesenchymal and stem cell markers in renal epithelial cells
Article Snippet: RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT‐PCR) Total RNA was extracted from the cultured cells by using an SNAP RNA column (Invitrogen, San Diego, CA). .. The reaction mixture contained 50 mM Tris (pH 7.2), 1.5 mM MgCl2 , 2 μM dNTP, 0.25 μM of 5′ and 3′ primers, respectively, 0.5 U of Taq DNA polymerase (Protech Technology, Taipei, Taiwan), and 2 μL of cDNA (1 μg).

Polymerase Chain Reaction:

Article Title: Association between Interleukin-10 Gene Promoter Haplotype and Schizophrenia in a Han-Chinese Study
Article Snippet: .. In a few words, PCR was conducted in a 20 ul total volume with 50 mM KCl, 10 mM HCl, 0.5 mM MgCl2 , 200 uM of dATP, dCTP, dTTP; 150 uM dGTP and 0.5U Taq polymerase (Protech, Taipei, Taiwan). .. The thermal cycling condition is denaturation at 95°C for 5 min, followed elongation by 38 cycles at 94°C for 30 sec; 56°C for 30 sec; 72°C for 1 minute, and 10 minutes at 72°C for final extension.

Article Title: Symbiodinium spp. associated with scleractinian corals from Dongsha Atoll (Pratas), Taiwan, in the South China Sea
Article Snippet: .. A 25 µl PCR reaction consisting of 3 µl DNA (10 ng µl−1 ), 2 µl dNTPs (0.8 mM), 2 µl forward primer (0.16 µM), 2 µl reverse primer (0.16 µM), 3 µl PCR Buffer (1.2X), 0.5 unit Taq polymerase (Protech, Taipei, Taiwan), and 12.5 µl distilled water was run on a Px2 thermal cycler (Thermo Scientific, Waltham, MA, USA). .. The PCR cycling profile consisted of initial denaturation at 95 °C for 1 min followed by 5 cycles of 94 °C for 30 s, 30 cycles of annealing at 55 °C for 1 min and decreasing 1 °C to a final annealing temperatures of 50 °C and 2 min at 72 °C.

Article Title: Genetic polymorphisms in glutathione S-transferase (GST) superfamily and risk of arsenic-induced urothelial carcinoma in residents of southwestern Taiwan
Article Snippet: .. PCR was performed in a total volume of 100 μL, containing 10 μL of genomic DNA (50-100 ng), 400 ng of each of the above primers, and 5 units of Taq polymerase (SuperTag, Protech, Taiwan). .. The reaction was incubated at 94°C for 4 min and subjected to 35 cycles of 94°C for 60 s, 55°C for 60 s and 72°C for 60 s, then a final 72°C-extension for 10 min. Next, 10-μL PCR aliquots were electrophoresed on 2% agarose gels and were stained with ethidium bromide.

Article Title: Multiple Analytical Approaches Demonstrate a Complex Relationship of Genetic and Nongenetic Factors with Cisplatin- and Carboplatin-Induced Nephrotoxicity in Lung Cancer Patients
Article Snippet: .. The PCR was performed in a total volume of 25 μ L, containing 0.2 mM dNTPs (Protech, Taiwan), 1 mM MgCl2 (Protech), 1x Taq buffer (Mg+ -free) (Protech), 0.04 U Taq polymerase (Protech), 2 μ L primers (Protech), and 1 μ L DNA. ..

Article Title: Hexavalent chromium induces expression of mesenchymal and stem cell markers in renal epithelial cells
Article Snippet: An aliquot of cDNA was then subjected to 35 cycles of PCR. .. The reaction mixture contained 50 mM Tris (pH 7.2), 1.5 mM MgCl2 , 2 μM dNTP, 0.25 μM of 5′ and 3′ primers, respectively, 0.5 U of Taq DNA polymerase (Protech Technology, Taipei, Taiwan), and 2 μL of cDNA (1 μg).

Article Title: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus
Article Snippet: Amplification assay for degenerate primers PCR was conducted to evaluate the degenerate primers using the constructed plasmids. .. The reaction mixture of 25 μl is comprised of 100 ng of plasmid DNA, 2.5 μl of 10× Taq buffer (50 mM Tris–HCl, pH 8.0, 1 mM EDTA, 1 mM DTT and 50% glycerol) (Protech, Taipei, Taiwan), 1 μl of 10 mM dNTPs (Protech), 1 μl of 100 μM forward primer, 1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech).

Article Title: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus
Article Snippet: The amplification was carried out by Applied Biosystems GeneAMP PCR System 9700 (Thermo Fisher Scientific Inc., MA, USA) under the setting of a hot start at 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 50 °C for 40 s and 72 °C for 30 s; and a final reaction at 72 °C for 6 min. .. For virus detection, the mixture of 25 μl consisting of 200 ng of plant total RNA, 0.2 μl of M-MuLV reverse transcriptase (5 U/μl) (Protech), 2.5 μl of 10× Taq buffer (Protech), 1 μl of 10 mM dNTPs (Protech), 0.1 μl of 100 μM forward primer, 0.1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech) was used in RT-PCR amplification.

Article Title: Association between Interleukin-10 Gene Promoter Haplotype and Schizophrenia in a Han-Chinese Study
Article Snippet: .. PCR was firstly carried out in 25 ul volume reaction containing 50 mM KCl, 10 mM HCl, 0.5 mM MgCl2 , 200 uM of dATP, dCTP, dTTP, 150 uM dGTP and 0.5 U Taq polymerase (Protech, Taipei, Taiwan). .. The thermal cycling condition is denaturation at 95°C for 5 min; follow 38 cycles of 94°C for 30 sec, 54°C for 45 sec, 72°C for 1 min, and 7 min for final extension at 72°C.

Article Title: OTUD7B upregulation predicts a poor response to paclitaxel in patients with triple-negative breast cancer
Article Snippet: Paragraph title: Reverse transcription PCR (RT-PCR) ... Aliquots (5 μg) of total RNA were treated with M-MLV reverse transcriptase (Invitrogen) and then amplified with Taq-polymerase (Protech) using paired primers (for primary mR-1180, forward-CTGGTGCCCACCTCAGAGACGG and reverse-CACAGCCACCAGGCTGAGCATG; for OTUD7B , forward-GAAGGAGAAGTCAAAGCGAGATCG and reverse-GCATCACCTCCTGGCTATACTTGC; for CASP3 , forward-CATGGAAGCGAATCAATGGACT and reverse-CTGTACCAGACCGAGATGTCA; for GAPDH , forward-AGGTCGGAGTCAACGGATTTG and reverse-GTGATGGCATGGACTGTGGTC).

Sequencing:

Article Title: Association between Interleukin-10 Gene Promoter Haplotype and Schizophrenia in a Han-Chinese Study
Article Snippet: The sequencing primer was 5'-TTC AAC TTC TTC CAC CCC ATC-3' (forward primer) and 5'-GGC TCC TTT ACC CCG ATT TC-3' (reverse primer). .. In a few words, PCR was conducted in a 20 ul total volume with 50 mM KCl, 10 mM HCl, 0.5 mM MgCl2 , 200 uM of dATP, dCTP, dTTP; 150 uM dGTP and 0.5U Taq polymerase (Protech, Taipei, Taiwan).

Article Title: Association between Interleukin-10 Gene Promoter Haplotype and Schizophrenia in a Han-Chinese Study
Article Snippet: The -819T/C genotyping was done by using Polymerase Chain Reaction (PCR) and direct sequencing. .. PCR was firstly carried out in 25 ul volume reaction containing 50 mM KCl, 10 mM HCl, 0.5 mM MgCl2 , 200 uM of dATP, dCTP, dTTP, 150 uM dGTP and 0.5 U Taq polymerase (Protech, Taipei, Taiwan).

Denaturing Gradient Gel Electrophoresis:

Article Title: Symbiodinium spp. associated with scleractinian corals from Dongsha Atoll (Pratas), Taiwan, in the South China Sea
Article Snippet: Paragraph title: Molecular identification of Symbiodinium clades (28S RFLP) and types (ITS2 DGGE) ... A 25 µl PCR reaction consisting of 3 µl DNA (10 ng µl−1 ), 2 µl dNTPs (0.8 mM), 2 µl forward primer (0.16 µM), 2 µl reverse primer (0.16 µM), 3 µl PCR Buffer (1.2X), 0.5 unit Taq polymerase (Protech, Taipei, Taiwan), and 12.5 µl distilled water was run on a Px2 thermal cycler (Thermo Scientific, Waltham, MA, USA).

Cellular Antioxidant Activity Assay:

Article Title: Symbiodinium spp. associated with scleractinian corals from Dongsha Atoll (Pratas), Taiwan, in the South China Sea
Article Snippet: The 5′ end of nuclear large subunit ribosomal DNA (nlsrDNA) was amplified using a Symbiodinium -specific primer set, 28Szoox-D1/D2F (5′-CCT CAG TAA TGG CGA ATG AAC A-3′) and 28Szoox-D1/D2R (5′-CCT TGG TCC GTG TTT CAA GA-3′) ( ). .. A 25 µl PCR reaction consisting of 3 µl DNA (10 ng µl−1 ), 2 µl dNTPs (0.8 mM), 2 µl forward primer (0.16 µM), 2 µl reverse primer (0.16 µM), 3 µl PCR Buffer (1.2X), 0.5 unit Taq polymerase (Protech, Taipei, Taiwan), and 12.5 µl distilled water was run on a Px2 thermal cycler (Thermo Scientific, Waltham, MA, USA).

Multiplex Assay:

Article Title: Genetic polymorphisms in glutathione S-transferase (GST) superfamily and risk of arsenic-induced urothelial carcinoma in residents of southwestern Taiwan
Article Snippet: SNP Genotyping The GSTM1 and GSTT1 primer pairs (table ) were mixed with β-globulin primer (5'-CAA CTT CAT CCA CGT TCA CC-3' and 5'-GAA GAG CCA AGG ACA GGT AC-3') in a multiplex polymerase chain reaction (PCR). .. PCR was performed in a total volume of 100 μL, containing 10 μL of genomic DNA (50-100 ng), 400 ng of each of the above primers, and 5 units of Taq polymerase (SuperTag, Protech, Taiwan).

Labeling:

Article Title: Association between Interleukin-10 Gene Promoter Haplotype and Schizophrenia in a Han-Chinese Study
Article Snippet: Briefly, the PCR reaction were handled with a total of 25 ul volume containing 12.5 ul of 2X TaqMan Universal PCR Master Mix, 1.25 ul of each 20 uM primer and TaqMan probe, which labeled with FAM or VIC fluorescent dye and 9.25 ul of DNase-free water. .. PCR was firstly carried out in 25 ul volume reaction containing 50 mM KCl, 10 mM HCl, 0.5 mM MgCl2 , 200 uM of dATP, dCTP, dTTP, 150 uM dGTP and 0.5 U Taq polymerase (Protech, Taipei, Taiwan).

Size-exclusion Chromatography:

Article Title: Association between Interleukin-10 Gene Promoter Haplotype and Schizophrenia in a Han-Chinese Study
Article Snippet: The thermal cycling condition is denaturation at 95°C for 5 min; follow 38 cycles of 94°C for 30 sec, 54°C for 45 sec, 72°C for 1 min, and 7 min for final extension at 72°C. .. In a few words, PCR was conducted in a 20 ul total volume with 50 mM KCl, 10 mM HCl, 0.5 mM MgCl2 , 200 uM of dATP, dCTP, dTTP; 150 uM dGTP and 0.5U Taq polymerase (Protech, Taipei, Taiwan).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Hexavalent chromium induces expression of mesenchymal and stem cell markers in renal epithelial cells
Article Snippet: Paragraph title: RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT‐PCR) ... The reaction mixture contained 50 mM Tris (pH 7.2), 1.5 mM MgCl2 , 2 μM dNTP, 0.25 μM of 5′ and 3′ primers, respectively, 0.5 U of Taq DNA polymerase (Protech Technology, Taipei, Taiwan), and 2 μL of cDNA (1 μg).

Article Title: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus
Article Snippet: The reaction mixture of 25 μl is comprised of 100 ng of plasmid DNA, 2.5 μl of 10× Taq buffer (50 mM Tris–HCl, pH 8.0, 1 mM EDTA, 1 mM DTT and 50% glycerol) (Protech, Taipei, Taiwan), 1 μl of 10 mM dNTPs (Protech), 1 μl of 100 μM forward primer, 1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech). .. For virus detection, the mixture of 25 μl consisting of 200 ng of plant total RNA, 0.2 μl of M-MuLV reverse transcriptase (5 U/μl) (Protech), 2.5 μl of 10× Taq buffer (Protech), 1 μl of 10 mM dNTPs (Protech), 0.1 μl of 100 μM forward primer, 0.1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech) was used in RT-PCR amplification.

Article Title: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus
Article Snippet: .. For virus detection, the mixture of 25 μl consisting of 200 ng of plant total RNA, 0.2 μl of M-MuLV reverse transcriptase (5 U/μl) (Protech), 2.5 μl of 10× Taq buffer (Protech), 1 μl of 10 mM dNTPs (Protech), 0.1 μl of 100 μM forward primer, 0.1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech) was used in RT-PCR amplification. .. Complementary DNA was synthesized at 45 °C for 30 min then termination at 95 °C for 5 min.

Article Title: FBXL7 Upregulation Predicts a Poor Prognosis and Associates with a Possible Mechanism for Paclitaxel Resistance in Ovarian Cancer
Article Snippet: Paragraph title: 2.2. Reverse Transcriptase-Polymerase Chain Reaction (RT-PCR) ... Aliquots (5 μg) of total RNA were treated with M-MLV reverse transcriptase (Invitrogen) and then amplified with Taq-polymerase (Protech, Hong Kong, China) using paired primers (for FBXL7, forward-CACGCAGCTCACCCACCTCTA and reverse-GGTGCAGTTCTTGGCGAGGT; for glyceraldehyde-3-phosphate dehydrogenase (GA PDH), forward-AGGTCGGAGTCAACGGATTTG and reverse-GTGATGGCATGGACTGTGGTC).

Article Title: OTUD7B upregulation predicts a poor response to paclitaxel in patients with triple-negative breast cancer
Article Snippet: Paragraph title: Reverse transcription PCR (RT-PCR) ... Aliquots (5 μg) of total RNA were treated with M-MLV reverse transcriptase (Invitrogen) and then amplified with Taq-polymerase (Protech) using paired primers (for primary mR-1180, forward-CTGGTGCCCACCTCAGAGACGG and reverse-CACAGCCACCAGGCTGAGCATG; for OTUD7B , forward-GAAGGAGAAGTCAAAGCGAGATCG and reverse-GCATCACCTCCTGGCTATACTTGC; for CASP3 , forward-CATGGAAGCGAATCAATGGACT and reverse-CTGTACCAGACCGAGATGTCA; for GAPDH , forward-AGGTCGGAGTCAACGGATTTG and reverse-GTGATGGCATGGACTGTGGTC).

Nuclease Assay:

Article Title: Multiple Analytical Approaches Demonstrate a Complex Relationship of Genetic and Nongenetic Factors with Cisplatin- and Carboplatin-Induced Nephrotoxicity in Lung Cancer Patients
Article Snippet: The PCR was performed in a total volume of 25 μ L, containing 0.2 mM dNTPs (Protech, Taiwan), 1 mM MgCl2 (Protech), 1x Taq buffer (Mg+ -free) (Protech), 0.04 U Taq polymerase (Protech), 2 μ L primers (Protech), and 1 μ L DNA. .. Genotypes of ERCC1 codon 118 (rs11615) were determined by a 5′ nuclease assay (TaqMan).

Chloramphenicol Acetyltransferase Assay:

Article Title: Association between Interleukin-10 Gene Promoter Haplotype and Schizophrenia in a Han-Chinese Study
Article Snippet: In a few words, PCR was conducted in a 20 ul total volume with 50 mM KCl, 10 mM HCl, 0.5 mM MgCl2 , 200 uM of dATP, dCTP, dTTP; 150 uM dGTP and 0.5U Taq polymerase (Protech, Taipei, Taiwan). .. The primers are 5'-GGT CAT GGT GAG CAC TAC CT-3' (forward primer) and 5'-AAA AAG TTG ATT TCC TGG GG-3' (reverse primer).

Article Title: Genetic polymorphisms in glutathione S-transferase (GST) superfamily and risk of arsenic-induced urothelial carcinoma in residents of southwestern Taiwan
Article Snippet: SNP Genotyping The GSTM1 and GSTT1 primer pairs (table ) were mixed with β-globulin primer (5'-CAA CTT CAT CCA CGT TCA CC-3' and 5'-GAA GAG CCA AGG ACA GGT AC-3') in a multiplex polymerase chain reaction (PCR). .. PCR was performed in a total volume of 100 μL, containing 10 μL of genomic DNA (50-100 ng), 400 ng of each of the above primers, and 5 units of Taq polymerase (SuperTag, Protech, Taiwan).

Plasmid Preparation:

Article Title: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus
Article Snippet: .. The reaction mixture of 25 μl is comprised of 100 ng of plasmid DNA, 2.5 μl of 10× Taq buffer (50 mM Tris–HCl, pH 8.0, 1 mM EDTA, 1 mM DTT and 50% glycerol) (Protech, Taipei, Taiwan), 1 μl of 10 mM dNTPs (Protech), 1 μl of 100 μM forward primer, 1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech). .. The amplification was carried out by Applied Biosystems GeneAMP PCR System 9700 (Thermo Fisher Scientific Inc., MA, USA) under the setting of a hot start at 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 50 °C for 40 s and 72 °C for 30 s; and a final reaction at 72 °C for 6 min.

Article Title: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus
Article Snippet: The reaction mixture of 25 μl is comprised of 100 ng of plasmid DNA, 2.5 μl of 10× Taq buffer (50 mM Tris–HCl, pH 8.0, 1 mM EDTA, 1 mM DTT and 50% glycerol) (Protech, Taipei, Taiwan), 1 μl of 10 mM dNTPs (Protech), 1 μl of 100 μM forward primer, 1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech). .. For virus detection, the mixture of 25 μl consisting of 200 ng of plant total RNA, 0.2 μl of M-MuLV reverse transcriptase (5 U/μl) (Protech), 2.5 μl of 10× Taq buffer (Protech), 1 μl of 10 mM dNTPs (Protech), 0.1 μl of 100 μM forward primer, 0.1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech) was used in RT-PCR amplification.

RNA Extraction:

Article Title: Hexavalent chromium induces expression of mesenchymal and stem cell markers in renal epithelial cells
Article Snippet: Paragraph title: RNA Extraction and Reverse Transcription Polymerase Chain Reaction (RT‐PCR) ... The reaction mixture contained 50 mM Tris (pH 7.2), 1.5 mM MgCl2 , 2 μM dNTP, 0.25 μM of 5′ and 3′ primers, respectively, 0.5 U of Taq DNA polymerase (Protech Technology, Taipei, Taiwan), and 2 μL of cDNA (1 μg).

Agarose Gel Electrophoresis:

Article Title: Association between Interleukin-10 Gene Promoter Haplotype and Schizophrenia in a Han-Chinese Study
Article Snippet: In a few words, PCR was conducted in a 20 ul total volume with 50 mM KCl, 10 mM HCl, 0.5 mM MgCl2 , 200 uM of dATP, dCTP, dTTP; 150 uM dGTP and 0.5U Taq polymerase (Protech, Taipei, Taiwan). .. The PCR products were subjected to restriction enzyme digestion with RsaI at 37°C for 4 hrs, and then separated on 3% agarose gel containing 0.5ug/ml ethidium bromide, finally visualized under a UV transilluminator.

Article Title: Symbiodinium spp. associated with scleractinian corals from Dongsha Atoll (Pratas), Taiwan, in the South China Sea
Article Snippet: A 25 µl PCR reaction consisting of 3 µl DNA (10 ng µl−1 ), 2 µl dNTPs (0.8 mM), 2 µl forward primer (0.16 µM), 2 µl reverse primer (0.16 µM), 3 µl PCR Buffer (1.2X), 0.5 unit Taq polymerase (Protech, Taipei, Taiwan), and 12.5 µl distilled water was run on a Px2 thermal cycler (Thermo Scientific, Waltham, MA, USA). .. The PCR product was digested with Rsa I (BioLabs, San Diego, CA, USA) solution at 37 °C overnight and then run on 3% agarose gel (2% low melting agarose with 1% agarose) at 50 V for 3 h. Bands were stained using ethidium bromide (EtBr) and visualized under ultraviolet radiation.

Article Title: Multiple Analytical Approaches Demonstrate a Complex Relationship of Genetic and Nongenetic Factors with Cisplatin- and Carboplatin-Induced Nephrotoxicity in Lung Cancer Patients
Article Snippet: The PCR was performed in a total volume of 25 μ L, containing 0.2 mM dNTPs (Protech, Taiwan), 1 mM MgCl2 (Protech), 1x Taq buffer (Mg+ -free) (Protech), 0.04 U Taq polymerase (Protech), 2 μ L primers (Protech), and 1 μ L DNA. .. The PCR product of TP53 codon 72 was digested with BstUI (New England Biolabs), separated on a 2% agarose gel, and visualized by ethidium bromide staining.

Article Title: Hexavalent chromium induces expression of mesenchymal and stem cell markers in renal epithelial cells
Article Snippet: The reaction mixture contained 50 mM Tris (pH 7.2), 1.5 mM MgCl2 , 2 μM dNTP, 0.25 μM of 5′ and 3′ primers, respectively, 0.5 U of Taq DNA polymerase (Protech Technology, Taipei, Taiwan), and 2 μL of cDNA (1 μg). .. The amplified PCR products were analyzed in 1% agarose gel and visualized by ethidium bromide staining.

Article Title: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus
Article Snippet: The reaction mixture of 25 μl is comprised of 100 ng of plasmid DNA, 2.5 μl of 10× Taq buffer (50 mM Tris–HCl, pH 8.0, 1 mM EDTA, 1 mM DTT and 50% glycerol) (Protech, Taipei, Taiwan), 1 μl of 10 mM dNTPs (Protech), 1 μl of 100 μM forward primer, 1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech). .. The amplicons were visualized by 2% agarose gel electrophoresis and ethidium bromide (EtBr) staining.

Staining:

Article Title: Symbiodinium spp. associated with scleractinian corals from Dongsha Atoll (Pratas), Taiwan, in the South China Sea
Article Snippet: A 25 µl PCR reaction consisting of 3 µl DNA (10 ng µl−1 ), 2 µl dNTPs (0.8 mM), 2 µl forward primer (0.16 µM), 2 µl reverse primer (0.16 µM), 3 µl PCR Buffer (1.2X), 0.5 unit Taq polymerase (Protech, Taipei, Taiwan), and 12.5 µl distilled water was run on a Px2 thermal cycler (Thermo Scientific, Waltham, MA, USA). .. The PCR product was digested with Rsa I (BioLabs, San Diego, CA, USA) solution at 37 °C overnight and then run on 3% agarose gel (2% low melting agarose with 1% agarose) at 50 V for 3 h. Bands were stained using ethidium bromide (EtBr) and visualized under ultraviolet radiation.

Article Title: Genetic polymorphisms in glutathione S-transferase (GST) superfamily and risk of arsenic-induced urothelial carcinoma in residents of southwestern Taiwan
Article Snippet: PCR was performed in a total volume of 100 μL, containing 10 μL of genomic DNA (50-100 ng), 400 ng of each of the above primers, and 5 units of Taq polymerase (SuperTag, Protech, Taiwan). .. The reaction was incubated at 94°C for 4 min and subjected to 35 cycles of 94°C for 60 s, 55°C for 60 s and 72°C for 60 s, then a final 72°C-extension for 10 min. Next, 10-μL PCR aliquots were electrophoresed on 2% agarose gels and were stained with ethidium bromide.

Article Title: Multiple Analytical Approaches Demonstrate a Complex Relationship of Genetic and Nongenetic Factors with Cisplatin- and Carboplatin-Induced Nephrotoxicity in Lung Cancer Patients
Article Snippet: The PCR was performed in a total volume of 25 μ L, containing 0.2 mM dNTPs (Protech, Taiwan), 1 mM MgCl2 (Protech), 1x Taq buffer (Mg+ -free) (Protech), 0.04 U Taq polymerase (Protech), 2 μ L primers (Protech), and 1 μ L DNA. .. The PCR product of TP53 codon 72 was digested with BstUI (New England Biolabs), separated on a 2% agarose gel, and visualized by ethidium bromide staining.

Article Title: Hexavalent chromium induces expression of mesenchymal and stem cell markers in renal epithelial cells
Article Snippet: The reaction mixture contained 50 mM Tris (pH 7.2), 1.5 mM MgCl2 , 2 μM dNTP, 0.25 μM of 5′ and 3′ primers, respectively, 0.5 U of Taq DNA polymerase (Protech Technology, Taipei, Taiwan), and 2 μL of cDNA (1 μg). .. The amplified PCR products were analyzed in 1% agarose gel and visualized by ethidium bromide staining.

Article Title: Development of a microarray for simultaneous detection and differentiation of different tospoviruses that are serologically related to Tomato spotted wilt virus
Article Snippet: The reaction mixture of 25 μl is comprised of 100 ng of plasmid DNA, 2.5 μl of 10× Taq buffer (50 mM Tris–HCl, pH 8.0, 1 mM EDTA, 1 mM DTT and 50% glycerol) (Protech, Taipei, Taiwan), 1 μl of 10 mM dNTPs (Protech), 1 μl of 100 μM forward primer, 1 μl of 100 μM reverse primer and 0.1 μl of Pro Plus Taq DNA polymerase (5 U/μl) (Protech). .. The amplicons were visualized by 2% agarose gel electrophoresis and ethidium bromide (EtBr) staining.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87
    Protech Technology Enterprise hotstart taq dna polymerase
    <t>HotStart</t> and <t>low-DNA</t> <t>Taq</t> DNA polymerases are not sufficiently pure for sensitive and specific broad-range amplification of bacterial DNA. The genomic DNA (100 fg) of S. aureus was amplified by HotStart or low-DNA Taq DNA polymerases (Taq #1: Hot Start Taq DNA polymerase, Protech Inc.; Taq #2: Fast Hot Start Taq DNA polymerase, KAPA Biosystems; Taq #3: Taq DNA polymerase, TakaRa Inc.; Taq #4: ULTRATOOLS Taq DNA polymerase, Biotools Inc.) using the primer set p201 and p1370 (lanes 1, 3, 5, and 7). Significant amount of PCR product was present in the no template control reactions (lanes 2, 4, 6, and 8).
    Hotstart Taq Dna Polymerase, supplied by Protech Technology Enterprise, used in various techniques. Bioz Stars score: 87/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstart taq dna polymerase/product/Protech Technology Enterprise
    Average 87 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    hotstart taq dna polymerase - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    Image Search Results


    HotStart and low-DNA Taq DNA polymerases are not sufficiently pure for sensitive and specific broad-range amplification of bacterial DNA. The genomic DNA (100 fg) of S. aureus was amplified by HotStart or low-DNA Taq DNA polymerases (Taq #1: Hot Start Taq DNA polymerase, Protech Inc.; Taq #2: Fast Hot Start Taq DNA polymerase, KAPA Biosystems; Taq #3: Taq DNA polymerase, TakaRa Inc.; Taq #4: ULTRATOOLS Taq DNA polymerase, Biotools Inc.) using the primer set p201 and p1370 (lanes 1, 3, 5, and 7). Significant amount of PCR product was present in the no template control reactions (lanes 2, 4, 6, and 8).

    Journal: PLoS ONE

    Article Title: An Efficient Strategy for Broad-Range Detection of Low Abundance Bacteria without DNA Decontamination of PCR Reagents

    doi: 10.1371/journal.pone.0020303

    Figure Lengend Snippet: HotStart and low-DNA Taq DNA polymerases are not sufficiently pure for sensitive and specific broad-range amplification of bacterial DNA. The genomic DNA (100 fg) of S. aureus was amplified by HotStart or low-DNA Taq DNA polymerases (Taq #1: Hot Start Taq DNA polymerase, Protech Inc.; Taq #2: Fast Hot Start Taq DNA polymerase, KAPA Biosystems; Taq #3: Taq DNA polymerase, TakaRa Inc.; Taq #4: ULTRATOOLS Taq DNA polymerase, Biotools Inc.) using the primer set p201 and p1370 (lanes 1, 3, 5, and 7). Significant amount of PCR product was present in the no template control reactions (lanes 2, 4, 6, and 8).

    Article Snippet: Pretreatment of DNase I for decontamination and broad-range PCR amplification The PCR reagents containing 2 µl of 10× BSA, 2 µl of dNTP (2 mM), 2 µl of 10× LCGreen I plus, 1 µl of 10× PCR buffer, 0.5 µl of HotStart Taq DNA polymerase (5 U/µl), were incubated with DNase I (1 U or 2.5 U) at 37°C for 30 min. After heat inactivation of DNase I at 85°C for 15 min, the reaction mixture was brought up to 20 µl by adding 1 µl of 10× PCR buffer, 2 µl of forward primer p201 (5 µM), 2 µl of reverse primer p1370 (5 µM), and 5 µl of template DNA.

    Techniques: Amplification, Polymerase Chain Reaction