taq polymerase  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    Name:
    GoTaq(R) DNA Polymerase, 500u
    Description:

    Catalog Number:
    M3175
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Promega taq polymerase
    (A) 7-Deaza-2`-deoxyguanosine (deaza-dGTP) allows PCR of the human <t>p16INK4A</t> promoter because the specific 140 bp product (black arrow, 140) is clearly visible whether standard <t>Taq</t> polymerase (no hot start) or AmpliTaq Gold (hot start) is used. (B) dGTP gives rise to unspecific byproducts (black arrow, by), which are reduced if hot start PCR is performed. The 600 bp band of the 100 bp ladder standard is indicated (white arrow, 600).

    https://www.bioz.com/result/taq polymerase/product/Promega
    Average 88 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    taq polymerase - by Bioz Stars, 2019-10
    88/100 stars

    Images

    1) Product Images from "7-Deaza-2`-deoxyguanosine allows PCR and sequencing reactions from CpG islands"

    Article Title: 7-Deaza-2`-deoxyguanosine allows PCR and sequencing reactions from CpG islands

    Journal:

    doi:

    (A) 7-Deaza-2`-deoxyguanosine (deaza-dGTP) allows PCR of the human p16INK4A promoter because the specific 140 bp product (black arrow, 140) is clearly visible whether standard Taq polymerase (no hot start) or AmpliTaq Gold (hot start) is used. (B) dGTP gives rise to unspecific byproducts (black arrow, by), which are reduced if hot start PCR is performed. The 600 bp band of the 100 bp ladder standard is indicated (white arrow, 600).
    Figure Legend Snippet: (A) 7-Deaza-2`-deoxyguanosine (deaza-dGTP) allows PCR of the human p16INK4A promoter because the specific 140 bp product (black arrow, 140) is clearly visible whether standard Taq polymerase (no hot start) or AmpliTaq Gold (hot start) is used. (B) dGTP gives rise to unspecific byproducts (black arrow, by), which are reduced if hot start PCR is performed. The 600 bp band of the 100 bp ladder standard is indicated (white arrow, 600).

    Techniques Used: Polymerase Chain Reaction, Hot Start PCR

    2) Product Images from "7-Deaza-2`-deoxyguanosine allows PCR and sequencing reactions from CpG islands"

    Article Title: 7-Deaza-2`-deoxyguanosine allows PCR and sequencing reactions from CpG islands

    Journal:

    doi:

    (A) 7-Deaza-2`-deoxyguanosine (deaza-dGTP) allows PCR of the human p16INK4A promoter because the specific 140 bp product (black arrow, 140) is clearly visible whether standard Taq polymerase (no hot start) or AmpliTaq Gold (hot start) is used. (B) dGTP gives rise to unspecific byproducts (black arrow, by), which are reduced if hot start PCR is performed. The 600 bp band of the 100 bp ladder standard is indicated (white arrow, 600).
    Figure Legend Snippet: (A) 7-Deaza-2`-deoxyguanosine (deaza-dGTP) allows PCR of the human p16INK4A promoter because the specific 140 bp product (black arrow, 140) is clearly visible whether standard Taq polymerase (no hot start) or AmpliTaq Gold (hot start) is used. (B) dGTP gives rise to unspecific byproducts (black arrow, by), which are reduced if hot start PCR is performed. The 600 bp band of the 100 bp ladder standard is indicated (white arrow, 600).

    Techniques Used: Polymerase Chain Reaction, Hot Start PCR

    3) Product Images from "Intrastrain and interstrain genetic variation within a paralogous gene family in Chlamydia pneumoniae"

    Article Title: Intrastrain and interstrain genetic variation within a paralogous gene family in Chlamydia pneumoniae

    Journal: BMC Microbiology

    doi: 10.1186/1471-2180-2-38

    Variation of the homopolymeric cytosine (polyC) tract in the Cpn 1054 gene family in C. pneumoniae . In each panel the vertical axis indicates the number of individual clones with a specific length of polyC. The horizontal axis indicates the number of cytosines within an individual polyC tract. (A) Intrastrain variation of the length of the polyC tracts of Cpn 043, 1054,1055 within strain AR39. (B) Variation of the length of the polyC tract in Cpn 1055 within AR39, AR 458 and PS32. (C) The variation of the length of the poly C tract within Cpn 1055 of AR39 identified in recombinant clones using Taq and Pwo DNA polymerases.
    Figure Legend Snippet: Variation of the homopolymeric cytosine (polyC) tract in the Cpn 1054 gene family in C. pneumoniae . In each panel the vertical axis indicates the number of individual clones with a specific length of polyC. The horizontal axis indicates the number of cytosines within an individual polyC tract. (A) Intrastrain variation of the length of the polyC tracts of Cpn 043, 1054,1055 within strain AR39. (B) Variation of the length of the polyC tract in Cpn 1055 within AR39, AR 458 and PS32. (C) The variation of the length of the poly C tract within Cpn 1055 of AR39 identified in recombinant clones using Taq and Pwo DNA polymerases.

    Techniques Used: Clone Assay, Recombinant

    4) Product Images from "Field-deployable, quantitative, rapid identification of active Ebola virus infection in unprocessed blood †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc03281a"

    Article Title: Field-deployable, quantitative, rapid identification of active Ebola virus infection in unprocessed blood †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc03281a

    Journal: Chemical Science

    doi: 10.1039/c7sc03281a

    Overcoming the dose-dependent inhibitory effect of blood on qRT-PCR. Increasing amounts of fresh, unprocessed human blood introduced into qRT-PCR reactions (0.0–5.0% v/v final blood concentration) result in comparable dose-dependent inhibition of FAM-labelled Taqman® probe-based RT-PCR fluorogenicity (amplification plateau) whether the Promega hot-start wild type Taq polymerase (a) or the blood-optimised OmniTaq 2 polymerase (b) is used in conjunction with an MMuLV reverse transcriptase to detect 4 × 10 8 copies of MS2 coliphage RNA. Reaction progression is reported for each of two technical replicates in relative fluorescence units (RFU) normalised to no template control (–ve c) against PCR cycle value. Far red/infrared fluorescent dyes (c) and dye–quencher combinations (d) were screened by spectrophotometry under 620 nm laser diode simulation for utility in blood-containing reactions. The impact of blood on dye fluorogenicity is expressed as the change (Δ F N ) in background-subtracted fluorescence emission (RFU) in the presence and absence of human blood (mean of two technical replicates). DDB: deep dark blue; VRH: Viridian Red High; VRL: Viridian Red Low; IWB: Iowa Black; BHQ: Black Hole Quencher.
    Figure Legend Snippet: Overcoming the dose-dependent inhibitory effect of blood on qRT-PCR. Increasing amounts of fresh, unprocessed human blood introduced into qRT-PCR reactions (0.0–5.0% v/v final blood concentration) result in comparable dose-dependent inhibition of FAM-labelled Taqman® probe-based RT-PCR fluorogenicity (amplification plateau) whether the Promega hot-start wild type Taq polymerase (a) or the blood-optimised OmniTaq 2 polymerase (b) is used in conjunction with an MMuLV reverse transcriptase to detect 4 × 10 8 copies of MS2 coliphage RNA. Reaction progression is reported for each of two technical replicates in relative fluorescence units (RFU) normalised to no template control (–ve c) against PCR cycle value. Far red/infrared fluorescent dyes (c) and dye–quencher combinations (d) were screened by spectrophotometry under 620 nm laser diode simulation for utility in blood-containing reactions. The impact of blood on dye fluorogenicity is expressed as the change (Δ F N ) in background-subtracted fluorescence emission (RFU) in the presence and absence of human blood (mean of two technical replicates). DDB: deep dark blue; VRH: Viridian Red High; VRL: Viridian Red Low; IWB: Iowa Black; BHQ: Black Hole Quencher.

    Techniques Used: Quantitative RT-PCR, Concentration Assay, Inhibition, Reverse Transcription Polymerase Chain Reaction, Amplification, Fluorescence, Polymerase Chain Reaction, Spectrophotometry

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Control of lysosomal biogenesis and Notch-dependent tissue patterning by components of the TFEB-V-ATPase axis in Drosophila melanogaster
    Article Snippet: A polypeptide that lacks the basic helix-loop-helix leucine zipper domains was selected as immunogen to prevent cross-reactions with other bHLH-Zip proteins. .. A fragment of the whole Mitf cDNA was amplified by PCR using the Taq Polymerase (Promega, M3175), using a template genomic DNA of flies carrying the construct UAS Mitf and the following primers: BamHI-1st exon Mitf : 5′ GATCGGATCCATGACGGAATCTGGAATCG 3′; SalI-4th exon Mitf : 5′ GATCGTCGACTTACGAATGATGGTAGCTCAGAGAC 3′. .. The PCR product was inserted into the prokaryotic expression vector pGEX, containing the GST sequence (pGEX-GST), using BamHI and SALI sites.

    Amplification:

    Article Title: Control of lysosomal biogenesis and Notch-dependent tissue patterning by components of the TFEB-V-ATPase axis in Drosophila melanogaster
    Article Snippet: A polypeptide that lacks the basic helix-loop-helix leucine zipper domains was selected as immunogen to prevent cross-reactions with other bHLH-Zip proteins. .. A fragment of the whole Mitf cDNA was amplified by PCR using the Taq Polymerase (Promega, M3175), using a template genomic DNA of flies carrying the construct UAS Mitf and the following primers: BamHI-1st exon Mitf : 5′ GATCGGATCCATGACGGAATCTGGAATCG 3′; SalI-4th exon Mitf : 5′ GATCGTCGACTTACGAATGATGGTAGCTCAGAGAC 3′. .. The PCR product was inserted into the prokaryotic expression vector pGEX, containing the GST sequence (pGEX-GST), using BamHI and SALI sites.

    Construct:

    Article Title: Control of lysosomal biogenesis and Notch-dependent tissue patterning by components of the TFEB-V-ATPase axis in Drosophila melanogaster
    Article Snippet: A polypeptide that lacks the basic helix-loop-helix leucine zipper domains was selected as immunogen to prevent cross-reactions with other bHLH-Zip proteins. .. A fragment of the whole Mitf cDNA was amplified by PCR using the Taq Polymerase (Promega, M3175), using a template genomic DNA of flies carrying the construct UAS Mitf and the following primers: BamHI-1st exon Mitf : 5′ GATCGGATCCATGACGGAATCTGGAATCG 3′; SalI-4th exon Mitf : 5′ GATCGTCGACTTACGAATGATGGTAGCTCAGAGAC 3′. .. The PCR product was inserted into the prokaryotic expression vector pGEX, containing the GST sequence (pGEX-GST), using BamHI and SALI sites.

    Expressing:

    Article Title: Control of lysosomal biogenesis and Notch-dependent tissue patterning by components of the TFEB-V-ATPase axis in Drosophila melanogaster
    Article Snippet: A fragment of the whole Mitf cDNA was amplified by PCR using the Taq Polymerase (Promega, M3175), using a template genomic DNA of flies carrying the construct UAS Mitf and the following primers: BamHI-1st exon Mitf : 5′ GATCGGATCCATGACGGAATCTGGAATCG 3′; SalI-4th exon Mitf : 5′ GATCGTCGACTTACGAATGATGGTAGCTCAGAGAC 3′. .. The PCR product was inserted into the prokaryotic expression vector pGEX, containing the GST sequence (pGEX-GST), using BamHI and SALI sites.

    Purification:

    Article Title: Control of lysosomal biogenesis and Notch-dependent tissue patterning by components of the TFEB-V-ATPase axis in Drosophila melanogaster
    Article Snippet: A fragment of the whole Mitf cDNA was amplified by PCR using the Taq Polymerase (Promega, M3175), using a template genomic DNA of flies carrying the construct UAS Mitf and the following primers: BamHI-1st exon Mitf : 5′ GATCGGATCCATGACGGAATCTGGAATCG 3′; SalI-4th exon Mitf : 5′ GATCGTCGACTTACGAATGATGGTAGCTCAGAGAC 3′. .. A fragment of the whole Mitf cDNA was amplified by PCR using the Taq Polymerase (Promega, M3175), using a template genomic DNA of flies carrying the construct UAS Mitf and the following primers: BamHI-1st exon Mitf : 5′ GATCGGATCCATGACGGAATCTGGAATCG 3′; SalI-4th exon Mitf : 5′ GATCGTCGACTTACGAATGATGGTAGCTCAGAGAC 3′.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78
    Promega taq polymerase
    Overcoming the dose-dependent inhibitory effect of blood on qRT-PCR. Increasing amounts of fresh, unprocessed human blood introduced into qRT-PCR reactions (0.0–5.0% v/v final blood concentration) result in comparable dose-dependent inhibition of FAM-labelled Taqman® probe-based RT-PCR fluorogenicity (amplification plateau) whether the <t>Promega</t> hot-start wild type <t>Taq</t> polymerase (a) or the blood-optimised OmniTaq 2 polymerase (b) is used in conjunction with an MMuLV reverse transcriptase to detect 4 × 10 8 copies of MS2 coliphage RNA. Reaction progression is reported for each of two technical replicates in relative fluorescence units (RFU) normalised to no template control (–ve c) against PCR cycle value. Far red/infrared fluorescent dyes (c) and dye–quencher combinations (d) were screened by spectrophotometry under 620 nm laser diode simulation for utility in blood-containing reactions. The impact of blood on dye fluorogenicity is expressed as the change (Δ F N ) in background-subtracted fluorescence emission (RFU) in the presence and absence of human blood (mean of two technical replicates). DDB: deep dark blue; VRH: Viridian Red High; VRL: Viridian Red Low; IWB: Iowa Black; BHQ: Black Hole Quencher.
    Taq Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerase/product/Promega
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    taq polymerase - by Bioz Stars, 2019-10
    78/100 stars
      Buy from Supplier

    99
    Promega pcr master mix
    Validation of multiplex <t>PCR</t> using individual and combined oligonucleotide primer sets and <t>DNA</t> extracts from mixed bacterial culture. Multiplex PCR was performed on DNA extracts from mixed bacterial cultures. DNA template was extracted using the modified DNAzol ® . (1) Non-pathogenic E. coli strain K-12 18s primers were used (171 bp); (2) MAP UCF4 IS900 AV1/AV2 primers were used (298 bp); (3) K. pneumoniae 23s primers were used (493 bp); (4) Mycobacterium avium complex (MAC) IS1311 primers were used (534 bp); (5) a cocktail of the 4 primer sets mentioned above were used. M: DNA molecular weight marker
    Pcr Master Mix, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 320 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr master mix/product/Promega
    Average 99 stars, based on 320 article reviews
    Price from $9.99 to $1999.99
    pcr master mix - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    Promega pcr mix
    Amplification of bovine leukemia virus (BLV) genome regions in human breast tissue specimens. Nested liquid-phase <t>PCR,</t> using primers from 5 BLV genome regions, was used to amplify products from <t>DNA</t> extracted from breast tissues of 6 human donors. PCR products for each tissue were loaded into 1 well and separated by agarose gel (3.5%) electrophoresis on the basis of size differences: long terminal repeat, 290 bp; group-specific antigen, 272 bp; envelope, 230 bp; trans-activating gene of the X region, 206 bp; polymerase, 157 bp. The section below the white line shows the glyceraldehyde 3-phosphate dehydrogenase amplification of each sample as an indicator of DNA quality. Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA); lane 2, fetal lamb kidney cell line, positive control; lane 3, no-template-DNA negative control (water substituted for DNA template); lane 4, human sample 143; lane 5, human sample 236; lane 6, human sample 010; lane 7, human sample 20874; lane 8, human sample 23803; lane 9, human sample 0253.
    Pcr Mix, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mix/product/Promega
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    pcr mix - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Overcoming the dose-dependent inhibitory effect of blood on qRT-PCR. Increasing amounts of fresh, unprocessed human blood introduced into qRT-PCR reactions (0.0–5.0% v/v final blood concentration) result in comparable dose-dependent inhibition of FAM-labelled Taqman® probe-based RT-PCR fluorogenicity (amplification plateau) whether the Promega hot-start wild type Taq polymerase (a) or the blood-optimised OmniTaq 2 polymerase (b) is used in conjunction with an MMuLV reverse transcriptase to detect 4 × 10 8 copies of MS2 coliphage RNA. Reaction progression is reported for each of two technical replicates in relative fluorescence units (RFU) normalised to no template control (–ve c) against PCR cycle value. Far red/infrared fluorescent dyes (c) and dye–quencher combinations (d) were screened by spectrophotometry under 620 nm laser diode simulation for utility in blood-containing reactions. The impact of blood on dye fluorogenicity is expressed as the change (Δ F N ) in background-subtracted fluorescence emission (RFU) in the presence and absence of human blood (mean of two technical replicates). DDB: deep dark blue; VRH: Viridian Red High; VRL: Viridian Red Low; IWB: Iowa Black; BHQ: Black Hole Quencher.

    Journal: Chemical Science

    Article Title: Field-deployable, quantitative, rapid identification of active Ebola virus infection in unprocessed blood †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc03281a

    doi: 10.1039/c7sc03281a

    Figure Lengend Snippet: Overcoming the dose-dependent inhibitory effect of blood on qRT-PCR. Increasing amounts of fresh, unprocessed human blood introduced into qRT-PCR reactions (0.0–5.0% v/v final blood concentration) result in comparable dose-dependent inhibition of FAM-labelled Taqman® probe-based RT-PCR fluorogenicity (amplification plateau) whether the Promega hot-start wild type Taq polymerase (a) or the blood-optimised OmniTaq 2 polymerase (b) is used in conjunction with an MMuLV reverse transcriptase to detect 4 × 10 8 copies of MS2 coliphage RNA. Reaction progression is reported for each of two technical replicates in relative fluorescence units (RFU) normalised to no template control (–ve c) against PCR cycle value. Far red/infrared fluorescent dyes (c) and dye–quencher combinations (d) were screened by spectrophotometry under 620 nm laser diode simulation for utility in blood-containing reactions. The impact of blood on dye fluorogenicity is expressed as the change (Δ F N ) in background-subtracted fluorescence emission (RFU) in the presence and absence of human blood (mean of two technical replicates). DDB: deep dark blue; VRH: Viridian Red High; VRL: Viridian Red Low; IWB: Iowa Black; BHQ: Black Hole Quencher.

    Article Snippet: We thus assembled one-step RT-qPCR reactions with a commercially available Taq polymerase (GoTaq® G2 Flex; Promega, Inc) or the blood-tolerant OmniTaq 2 (DNA Polymerase Technology, Inc.), using the manufacturer's mastermix, respectively, and 5 U per reaction of GoScript® Moloney Murine Leukemia virus reverse transcriptase (Promega).

    Techniques: Quantitative RT-PCR, Concentration Assay, Inhibition, Reverse Transcription Polymerase Chain Reaction, Amplification, Fluorescence, Polymerase Chain Reaction, Spectrophotometry

    Validation of multiplex PCR using individual and combined oligonucleotide primer sets and DNA extracts from mixed bacterial culture. Multiplex PCR was performed on DNA extracts from mixed bacterial cultures. DNA template was extracted using the modified DNAzol ® . (1) Non-pathogenic E. coli strain K-12 18s primers were used (171 bp); (2) MAP UCF4 IS900 AV1/AV2 primers were used (298 bp); (3) K. pneumoniae 23s primers were used (493 bp); (4) Mycobacterium avium complex (MAC) IS1311 primers were used (534 bp); (5) a cocktail of the 4 primer sets mentioned above were used. M: DNA molecular weight marker

    Journal: Gut Pathogens

    Article Title: Development of multiplex PCR and multi-color fluorescent in situ hybridization (m-FISH) coupled protocol for detection and imaging of multi-pathogens involved in inflammatory bowel disease

    doi: 10.1186/s13099-018-0278-1

    Figure Lengend Snippet: Validation of multiplex PCR using individual and combined oligonucleotide primer sets and DNA extracts from mixed bacterial culture. Multiplex PCR was performed on DNA extracts from mixed bacterial cultures. DNA template was extracted using the modified DNAzol ® . (1) Non-pathogenic E. coli strain K-12 18s primers were used (171 bp); (2) MAP UCF4 IS900 AV1/AV2 primers were used (298 bp); (3) K. pneumoniae 23s primers were used (493 bp); (4) Mycobacterium avium complex (MAC) IS1311 primers were used (534 bp); (5) a cocktail of the 4 primer sets mentioned above were used. M: DNA molecular weight marker

    Article Snippet: Briefly, 10 μL of DNA containing 17 ng/μL of bacterial DNA or 50 ng/μL tissue DNA were added into a 200 μL-microcentrifuge tube containing 25 μL of PCR Master Mix (2× solution containing Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers, Promega©), 5 μL of betaine (Sigma-Aldrich©), and 1 μL of each oligonucleotide primer (10 μM forward and 10 μM reverse primer for each bacterial species (MAP, MAC, non-pathogenic E. coli strain K-12, AIEC strain LF82, and K. pneumoniae ).

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Modification, Molecular Weight, Marker

    Validation of multiplex PCR using individual and combined oligonucleotide primer sets and DNA extracts from IBD tissue. Multiplex PCR was performed on DNA extracts from intestinal tissue samples. DNA template was extracted using the modified DNAzol ® . RS1: ulcerative colitis (UC) patient; RS2: Crohn’s disease (CD) patient; (1) Non-pathogenic E. coli strain K-12 18s primers were used (171 bp); (2) MAP UCF4 IS900 AV1/AV2 primers were used (298 bp); (3) AIEC strain LF82 g ipA primers were used (357 bp); (4) K. pneumoniae 23s primers were used (493 bp); (5) Mycobacterium avium complex (MAC) IS1311 primers were used (534 bp); (6) a cocktail of the 5 primer sets mentioned above were used. M: DNA molecular weight marker

    Journal: Gut Pathogens

    Article Title: Development of multiplex PCR and multi-color fluorescent in situ hybridization (m-FISH) coupled protocol for detection and imaging of multi-pathogens involved in inflammatory bowel disease

    doi: 10.1186/s13099-018-0278-1

    Figure Lengend Snippet: Validation of multiplex PCR using individual and combined oligonucleotide primer sets and DNA extracts from IBD tissue. Multiplex PCR was performed on DNA extracts from intestinal tissue samples. DNA template was extracted using the modified DNAzol ® . RS1: ulcerative colitis (UC) patient; RS2: Crohn’s disease (CD) patient; (1) Non-pathogenic E. coli strain K-12 18s primers were used (171 bp); (2) MAP UCF4 IS900 AV1/AV2 primers were used (298 bp); (3) AIEC strain LF82 g ipA primers were used (357 bp); (4) K. pneumoniae 23s primers were used (493 bp); (5) Mycobacterium avium complex (MAC) IS1311 primers were used (534 bp); (6) a cocktail of the 5 primer sets mentioned above were used. M: DNA molecular weight marker

    Article Snippet: Briefly, 10 μL of DNA containing 17 ng/μL of bacterial DNA or 50 ng/μL tissue DNA were added into a 200 μL-microcentrifuge tube containing 25 μL of PCR Master Mix (2× solution containing Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers, Promega©), 5 μL of betaine (Sigma-Aldrich©), and 1 μL of each oligonucleotide primer (10 μM forward and 10 μM reverse primer for each bacterial species (MAP, MAC, non-pathogenic E. coli strain K-12, AIEC strain LF82, and K. pneumoniae ).

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Modification, Indirect Immunoperoxidase Assay, Molecular Weight, Marker

    PCR-DGGE profiles representing the succession in the bacterial community structure, as well as the monitoring during the time course experiment of M. xanthus on decayed calcarenite. DNA was directly extracted from non-treated ( D ) and treated ( TD ) stone slabs, as well as from aliquots taken from the culture medium of treated samples during the time course experiment, and subsequently amplified with the 16S rRNA primers pair 341f/907r. The description for lane numbers and for b are as indicated for Fig. 1

    Journal: Microbial Ecology

    Article Title: Bacterial Community Dynamics During the Application of a Myxococcus xanthus-Inoculated Culture Medium Used for Consolidation of Ornamental Limestone

    doi: 10.1007/s00248-010-9661-2

    Figure Lengend Snippet: PCR-DGGE profiles representing the succession in the bacterial community structure, as well as the monitoring during the time course experiment of M. xanthus on decayed calcarenite. DNA was directly extracted from non-treated ( D ) and treated ( TD ) stone slabs, as well as from aliquots taken from the culture medium of treated samples during the time course experiment, and subsequently amplified with the 16S rRNA primers pair 341f/907r. The description for lane numbers and for b are as indicated for Fig. 1

    Article Snippet: For PCR analysis, 2× PCR Master Mix (Promega; 50 U ml−1 of Taq DNA polymerase supplied in a proprietary reaction buffer (pH 8.5), 400 µM dATP, 400 µM dGTP, 400 µM dCTP, 400 µM dTTP, 3 mM MgCl2) was diluted as recommended by the manufacturers, and 12.5 pmol of each primer was added.

    Techniques: Polymerase Chain Reaction, Denaturing Gradient Gel Electrophoresis, Amplification

    PCR-DGGE profiles representing the succession in the bacterial community structure, as well as the monitoring during the time course experiment of M. xanthus on quarry calcarenite. DNA was directly extracted from non-treated ( Q ) and treated ( TQ ) stone slabs, as well as from aliquots taken from the culture medium of treated samples during the time course experiment, and subsequently amplified with the 16S rRNA primers pair 341f/907r. Numbers of lanes indicate sampling days. Lane M , marker of M. xanthus . DGGE-bands identified from the 16S rDNA clone libraries are numbered and are indicated by arrowheads . These bands are described in the b . Closest relative, as determined by comparative sequence analysis, level of identity with this relative, clone designation, and accession number for each band are summarized in b

    Journal: Microbial Ecology

    Article Title: Bacterial Community Dynamics During the Application of a Myxococcus xanthus-Inoculated Culture Medium Used for Consolidation of Ornamental Limestone

    doi: 10.1007/s00248-010-9661-2

    Figure Lengend Snippet: PCR-DGGE profiles representing the succession in the bacterial community structure, as well as the monitoring during the time course experiment of M. xanthus on quarry calcarenite. DNA was directly extracted from non-treated ( Q ) and treated ( TQ ) stone slabs, as well as from aliquots taken from the culture medium of treated samples during the time course experiment, and subsequently amplified with the 16S rRNA primers pair 341f/907r. Numbers of lanes indicate sampling days. Lane M , marker of M. xanthus . DGGE-bands identified from the 16S rDNA clone libraries are numbered and are indicated by arrowheads . These bands are described in the b . Closest relative, as determined by comparative sequence analysis, level of identity with this relative, clone designation, and accession number for each band are summarized in b

    Article Snippet: For PCR analysis, 2× PCR Master Mix (Promega; 50 U ml−1 of Taq DNA polymerase supplied in a proprietary reaction buffer (pH 8.5), 400 µM dATP, 400 µM dGTP, 400 µM dCTP, 400 µM dTTP, 3 mM MgCl2) was diluted as recommended by the manufacturers, and 12.5 pmol of each primer was added.

    Techniques: Polymerase Chain Reaction, Denaturing Gradient Gel Electrophoresis, Amplification, Sampling, Marker, Sequencing

    Amplification of bovine leukemia virus (BLV) genome regions in human breast tissue specimens. Nested liquid-phase PCR, using primers from 5 BLV genome regions, was used to amplify products from DNA extracted from breast tissues of 6 human donors. PCR products for each tissue were loaded into 1 well and separated by agarose gel (3.5%) electrophoresis on the basis of size differences: long terminal repeat, 290 bp; group-specific antigen, 272 bp; envelope, 230 bp; trans-activating gene of the X region, 206 bp; polymerase, 157 bp. The section below the white line shows the glyceraldehyde 3-phosphate dehydrogenase amplification of each sample as an indicator of DNA quality. Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA); lane 2, fetal lamb kidney cell line, positive control; lane 3, no-template-DNA negative control (water substituted for DNA template); lane 4, human sample 143; lane 5, human sample 236; lane 6, human sample 010; lane 7, human sample 20874; lane 8, human sample 23803; lane 9, human sample 0253.

    Journal: Emerging Infectious Diseases

    Article Title: Bovine Leukemia Virus DNA in Human Breast Tissue

    doi: 10.3201/eid2005.131298

    Figure Lengend Snippet: Amplification of bovine leukemia virus (BLV) genome regions in human breast tissue specimens. Nested liquid-phase PCR, using primers from 5 BLV genome regions, was used to amplify products from DNA extracted from breast tissues of 6 human donors. PCR products for each tissue were loaded into 1 well and separated by agarose gel (3.5%) electrophoresis on the basis of size differences: long terminal repeat, 290 bp; group-specific antigen, 272 bp; envelope, 230 bp; trans-activating gene of the X region, 206 bp; polymerase, 157 bp. The section below the white line shows the glyceraldehyde 3-phosphate dehydrogenase amplification of each sample as an indicator of DNA quality. Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA); lane 2, fetal lamb kidney cell line, positive control; lane 3, no-template-DNA negative control (water substituted for DNA template); lane 4, human sample 143; lane 5, human sample 236; lane 6, human sample 010; lane 7, human sample 20874; lane 8, human sample 23803; lane 9, human sample 0253.

    Article Snippet: For nested L-PCR, extracted DNA (0.85 µg) was added to 50 μL of PCR mix (2.0 mmol/L MgCl2 , 0.2 mmol/L dNTPs, 0.025 U/µL Taq polymerase [all from Promega, Madison, WI, USA], and 0.2 μmol/L outer primers for each BLV gene [ ]) in Hot Start Micro 50 tubes (MolecularBio Products, San Diego, CA, USA).

    Techniques: Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Electrophoresis, Molecular Weight, Marker, Positive Control, Negative Control

    Test results showing lack of cross - reactivity of bovine leukemia virus (BLV)–specific primers with representatives of all mammalian and avian retrovirus subfamilies and human exogenous and endogenous viruses previously identified in human breast tissue. Nested liquid-phase PCR used primers from 5 BLV genome regions with template DNA from the viruses in lanes 4–10 and 12–21. PCR products for each virus, loaded into 1 well, were separated by agarose gel (1.5%) electrophoresis on the basis of size differences. Amplicons were generated only for known BLV-positive cell lines (FLK and Bat 2 Cl 6 ). Samples in lanes 13–21 were run simultaneously in the same gel in wells below samples in lanes 4–12. The section below the white line shows glyceraldehyde 3-phosphate dehydrogenase (GAPDH) amplification of each sample to indicate DNA quality. Human GAPDH primers were used for human, rhesus monkey, baboon, and bat cell lines (amplicon = 237 bp); murine GAPDH for mouse and rat cell lines (796 bp); and bovine GAPDH for bovine, ovine, and feline cell lines (857 bp). Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA), lane 2, fetal lamb kidney cell line, positive control; lane 3, water substituted for DNA template, negative control; lane 4, Rous sarcoma virus; lane 5, murine sarcoma virus; lane 6, mouse mammary tumor virus; lane 7, Mason-Pfizer monkey virus; lane 8, murine leukemia virus; lane 9, feline leukemia virus; lane 10, BLV Bat 2 Cl 6 ; lane 11, Tb 1 Lu (known BLV-negative cell line), negative control; lane 12, simian T-cell leukemia virus; lane 13, human T-cell leukemia virus 1; lane 14, human T-cell leukemia virus 2; lane 15, HIV-1; lane 16, HIV-2; lane 17, human papillomavirus 16; lane 18, human papillomavirus 18; lane 19, Epstein-Barr virus; lane 20, human endogenous retrovirus K; lane 21, env of human endogenous retrovirus K.

    Journal: Emerging Infectious Diseases

    Article Title: Bovine Leukemia Virus DNA in Human Breast Tissue

    doi: 10.3201/eid2005.131298

    Figure Lengend Snippet: Test results showing lack of cross - reactivity of bovine leukemia virus (BLV)–specific primers with representatives of all mammalian and avian retrovirus subfamilies and human exogenous and endogenous viruses previously identified in human breast tissue. Nested liquid-phase PCR used primers from 5 BLV genome regions with template DNA from the viruses in lanes 4–10 and 12–21. PCR products for each virus, loaded into 1 well, were separated by agarose gel (1.5%) electrophoresis on the basis of size differences. Amplicons were generated only for known BLV-positive cell lines (FLK and Bat 2 Cl 6 ). Samples in lanes 13–21 were run simultaneously in the same gel in wells below samples in lanes 4–12. The section below the white line shows glyceraldehyde 3-phosphate dehydrogenase (GAPDH) amplification of each sample to indicate DNA quality. Human GAPDH primers were used for human, rhesus monkey, baboon, and bat cell lines (amplicon = 237 bp); murine GAPDH for mouse and rat cell lines (796 bp); and bovine GAPDH for bovine, ovine, and feline cell lines (857 bp). Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA), lane 2, fetal lamb kidney cell line, positive control; lane 3, water substituted for DNA template, negative control; lane 4, Rous sarcoma virus; lane 5, murine sarcoma virus; lane 6, mouse mammary tumor virus; lane 7, Mason-Pfizer monkey virus; lane 8, murine leukemia virus; lane 9, feline leukemia virus; lane 10, BLV Bat 2 Cl 6 ; lane 11, Tb 1 Lu (known BLV-negative cell line), negative control; lane 12, simian T-cell leukemia virus; lane 13, human T-cell leukemia virus 1; lane 14, human T-cell leukemia virus 2; lane 15, HIV-1; lane 16, HIV-2; lane 17, human papillomavirus 16; lane 18, human papillomavirus 18; lane 19, Epstein-Barr virus; lane 20, human endogenous retrovirus K; lane 21, env of human endogenous retrovirus K.

    Article Snippet: For nested L-PCR, extracted DNA (0.85 µg) was added to 50 μL of PCR mix (2.0 mmol/L MgCl2 , 0.2 mmol/L dNTPs, 0.025 U/µL Taq polymerase [all from Promega, Madison, WI, USA], and 0.2 μmol/L outer primers for each BLV gene [ ]) in Hot Start Micro 50 tubes (MolecularBio Products, San Diego, CA, USA).

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Electrophoresis, Generated, Amplification, Molecular Weight, Marker, Positive Control, Negative Control