Structured Review

PerkinElmer taq polymerase
Identification of MalE-GadX binding sites in gadA and gadBC promoters. (A) Gel retardation assays of in vitro binding of the purified MalE-GadX protein to the promoter regions of gadA (P gadA , left) and gadBC (P gadB , right) genes. The <t>DNA</t> fragments were labeled with [α- 32 P]dATP by fill-in of 5′ protruding ends. In each binding reaction, 10 fmol of the DNA probe was incubated in a 10-μl volume with increasing amounts (0.5 to 10 pmol) of the MalE-GadX protein, under the conditions described in Materials and Methods. MalE-GadX-bound DNA fragments (forms I, II, and III) were separated from the unbound probe on a 5% polyacrylamide gel run in 0.5× TAE buffer. (B) DNase I footprinting assays. The 265-bp DNA fragments carrying the promoter regions of gadA (left) and gadBC (right) were incubated with the indicated amounts (picomoles) of MalE-GadX. Samples were processed as described in Materials and Methods using gadAfrw (left panel) and gadABrev (right panel) as the primers. Lanes G and A represent <t>Taq</t> I polymerase sequencing reactions using the same primers. The MalE-GadX-protected sites are indicated with vertical lines and labeled with roman numbers from I to IV. Arrows indicate DNase I-hypersensitive sites. (C) Sequence alignment of gadA and gadBC promoter regions showing the DNase I-protected sites on the coding (full line) and noncoding (dotted line) DNA strands. Sites are indicated above the corresponding sequence. The −35 and −10 hexamers for both gadA and gadBC are shown in bold type.
Taq Polymerase, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 93/100, based on 516 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taq polymerase/product/PerkinElmer
Average 93 stars, based on 516 article reviews
Price from $9.99 to $1999.99
taq polymerase - by Bioz Stars, 2020-04
93/100 stars

Images

1) Product Images from "Functional Characterization and Regulation of gadX, a Gene Encoding an AraC/XylS-Like Transcriptional Activator of the Escherichia coli Glutamic Acid Decarboxylase System †"

Article Title: Functional Characterization and Regulation of gadX, a Gene Encoding an AraC/XylS-Like Transcriptional Activator of the Escherichia coli Glutamic Acid Decarboxylase System †

Journal: Journal of Bacteriology

doi: 10.1128/JB.184.10.2603-2613.2002

Identification of MalE-GadX binding sites in gadA and gadBC promoters. (A) Gel retardation assays of in vitro binding of the purified MalE-GadX protein to the promoter regions of gadA (P gadA , left) and gadBC (P gadB , right) genes. The DNA fragments were labeled with [α- 32 P]dATP by fill-in of 5′ protruding ends. In each binding reaction, 10 fmol of the DNA probe was incubated in a 10-μl volume with increasing amounts (0.5 to 10 pmol) of the MalE-GadX protein, under the conditions described in Materials and Methods. MalE-GadX-bound DNA fragments (forms I, II, and III) were separated from the unbound probe on a 5% polyacrylamide gel run in 0.5× TAE buffer. (B) DNase I footprinting assays. The 265-bp DNA fragments carrying the promoter regions of gadA (left) and gadBC (right) were incubated with the indicated amounts (picomoles) of MalE-GadX. Samples were processed as described in Materials and Methods using gadAfrw (left panel) and gadABrev (right panel) as the primers. Lanes G and A represent Taq I polymerase sequencing reactions using the same primers. The MalE-GadX-protected sites are indicated with vertical lines and labeled with roman numbers from I to IV. Arrows indicate DNase I-hypersensitive sites. (C) Sequence alignment of gadA and gadBC promoter regions showing the DNase I-protected sites on the coding (full line) and noncoding (dotted line) DNA strands. Sites are indicated above the corresponding sequence. The −35 and −10 hexamers for both gadA and gadBC are shown in bold type.
Figure Legend Snippet: Identification of MalE-GadX binding sites in gadA and gadBC promoters. (A) Gel retardation assays of in vitro binding of the purified MalE-GadX protein to the promoter regions of gadA (P gadA , left) and gadBC (P gadB , right) genes. The DNA fragments were labeled with [α- 32 P]dATP by fill-in of 5′ protruding ends. In each binding reaction, 10 fmol of the DNA probe was incubated in a 10-μl volume with increasing amounts (0.5 to 10 pmol) of the MalE-GadX protein, under the conditions described in Materials and Methods. MalE-GadX-bound DNA fragments (forms I, II, and III) were separated from the unbound probe on a 5% polyacrylamide gel run in 0.5× TAE buffer. (B) DNase I footprinting assays. The 265-bp DNA fragments carrying the promoter regions of gadA (left) and gadBC (right) were incubated with the indicated amounts (picomoles) of MalE-GadX. Samples were processed as described in Materials and Methods using gadAfrw (left panel) and gadABrev (right panel) as the primers. Lanes G and A represent Taq I polymerase sequencing reactions using the same primers. The MalE-GadX-protected sites are indicated with vertical lines and labeled with roman numbers from I to IV. Arrows indicate DNase I-hypersensitive sites. (C) Sequence alignment of gadA and gadBC promoter regions showing the DNase I-protected sites on the coding (full line) and noncoding (dotted line) DNA strands. Sites are indicated above the corresponding sequence. The −35 and −10 hexamers for both gadA and gadBC are shown in bold type.

Techniques Used: Binding Assay, Electrophoretic Mobility Shift Assay, In Vitro, Purification, Labeling, Incubation, Footprinting, Sequencing

2) Product Images from "Drosophila P-element transposase is a novel site-specific endonuclease"

Article Title: Drosophila P-element transposase is a novel site-specific endonuclease

Journal: Genes & Development

doi:

Transposase makes 17-bp staggered cleavages at the P-element termini. Large-scale cleavage reactions were performed with partially purified transposase and plasmid substrates containing either the 628-bp or 303-bp P elements. Reaction products corresponding to both the cleaved plasmid vector and the excised element were isolated from agarose gel slices. A PCR-based primer extension analysis was performed on each product in order to determine the transposase cleavage sites. Shown are autoradiographs of sequencing gels that display primer extension products from reactions in which nontemplated addition of a single nucleotide by Taq polymerase occurs (as indicated by +1 in each panel). The authentic cleavage sites are indicated by C. Sequencing reactions (ACGT) are shown as markers. The relevant sequence is indicated, with P-element-derived sequences boxed and numbered from the terminal P-element nucleotide, and the cleavage sites indicated by arrows. Schematic diagrams of the direction for primer extension and the cleavage positions for each strand are indicated below each panel. ( A,B ) Extension products to determine the 3′ cleavage site at the left (5′) P-element end ( A ) or the 3′ cleavage site at the right (3′) P-element end ( B ). Products were analyzed for the 303-bp P-element-derived cleavage product only. (Odd-numbered lanes) + transposase; (even-numbered lanes) − transposase. Extension yields a product that terminates exactly at the 3′ end of the P-element inverted repeat. ( C,D ) Extension products to determine the 5′ cleavage sites at the left (5′) P-element end ( C ) or right (3′) P-element end ( D ). (Lanes 1,2,5,6 ) Products derived from the 303-bp P element. (Lanes 3,4,7,8 ) Products derived from the 628-bp P element. (Odd-numbered lanes) + transposase, (even-numbered lanes) − transposase. Extension yields a product that terminates at nucleotide 18 of the P-element inverted repeat.
Figure Legend Snippet: Transposase makes 17-bp staggered cleavages at the P-element termini. Large-scale cleavage reactions were performed with partially purified transposase and plasmid substrates containing either the 628-bp or 303-bp P elements. Reaction products corresponding to both the cleaved plasmid vector and the excised element were isolated from agarose gel slices. A PCR-based primer extension analysis was performed on each product in order to determine the transposase cleavage sites. Shown are autoradiographs of sequencing gels that display primer extension products from reactions in which nontemplated addition of a single nucleotide by Taq polymerase occurs (as indicated by +1 in each panel). The authentic cleavage sites are indicated by C. Sequencing reactions (ACGT) are shown as markers. The relevant sequence is indicated, with P-element-derived sequences boxed and numbered from the terminal P-element nucleotide, and the cleavage sites indicated by arrows. Schematic diagrams of the direction for primer extension and the cleavage positions for each strand are indicated below each panel. ( A,B ) Extension products to determine the 3′ cleavage site at the left (5′) P-element end ( A ) or the 3′ cleavage site at the right (3′) P-element end ( B ). Products were analyzed for the 303-bp P-element-derived cleavage product only. (Odd-numbered lanes) + transposase; (even-numbered lanes) − transposase. Extension yields a product that terminates exactly at the 3′ end of the P-element inverted repeat. ( C,D ) Extension products to determine the 5′ cleavage sites at the left (5′) P-element end ( C ) or right (3′) P-element end ( D ). (Lanes 1,2,5,6 ) Products derived from the 303-bp P element. (Lanes 3,4,7,8 ) Products derived from the 628-bp P element. (Odd-numbered lanes) + transposase, (even-numbered lanes) − transposase. Extension yields a product that terminates at nucleotide 18 of the P-element inverted repeat.

Techniques Used: Purification, Plasmid Preparation, Isolation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Sequencing, Derivative Assay

3) Product Images from "Association between bone mineral density and lifestyle factors or vitamin D receptor gene polymorphism in adult male workers: a cross-sectional study"

Article Title: Association between bone mineral density and lifestyle factors or vitamin D receptor gene polymorphism in adult male workers: a cross-sectional study

Journal: Environmental Health and Preventive Medicine

doi: 10.1007/s12199-009-0104-y

Restriction fragment length polymorphism (RFLP) analysis of the product of a polymerase chain reaction (PCR) targeting VDR . Pattern of fragments for the three possible genotypes after Taq I digestion of the PCR product, a 740-bp amplified region
Figure Legend Snippet: Restriction fragment length polymorphism (RFLP) analysis of the product of a polymerase chain reaction (PCR) targeting VDR . Pattern of fragments for the three possible genotypes after Taq I digestion of the PCR product, a 740-bp amplified region

Techniques Used: Polymerase Chain Reaction, Amplification

4) Product Images from "Intracisternal A-Particle Element Transposition into the Murine ?-Glucuronidase Gene Correlates with Loss of Enzyme Activity: a New Model for ?-Glucuronidase Deficiency in the C3H Mouse †"

Article Title: Intracisternal A-Particle Element Transposition into the Murine ?-Glucuronidase Gene Correlates with Loss of Enzyme Activity: a New Model for ?-Glucuronidase Deficiency in the C3H Mouse †

Journal: Molecular and Cellular Biology

doi:

Schematic showing the insertion site of the IAP in intron 8 of the β-glucuronidase gene and the general method of inverse PCR cloning. The top line represents a fragment of intron 8, with the locations and orientations of the oligonucleotides indicated below; pertinent restriction enzyme sites are indicated above the line (R, Rsa I; S, Ssp I; T, Taq I). Below, partial sequence of the intron shows the IAP integration site. Nucleotides in bold are part of the B2 repeat element. The remaining nucleotides represent nonrepetitive intron 8 sequence. The integrated IAP is represented at the bottom, flanked by its LTR sequences (black boxes). The direction of IAP transcription is indicated by the arrow. Restriction sites used in cloning are shown below the sequence. The six bases flanking the IAP represent the genomic sequence duplicated when the IAP integrated. An example of the mechanism by which insert sequence was obtained by inverse PCR is represented below the IAP. The circularization of the Taq I fragment at the 5′ end of the IAP element is shown. Intron 8-derived sequences are represented by the thin line, while those derived from the IAP LTR are indicated by the heavy line. Digestion of genomic DNA with Taq I cuts at the site adjacent to the oligonucleotide 5′ REVERSE (see cartoon above) and again at the site indicated in the 5′ LTR of the IAP. Subsequent circularization of that fragment via ligation produces the molecule shown, which includes sequences complementary to both 5′ REVERSE and 5′ FORWARD. Note that circularization places these oligonucleotides closer together and in an orientation suitable for PCR.
Figure Legend Snippet: Schematic showing the insertion site of the IAP in intron 8 of the β-glucuronidase gene and the general method of inverse PCR cloning. The top line represents a fragment of intron 8, with the locations and orientations of the oligonucleotides indicated below; pertinent restriction enzyme sites are indicated above the line (R, Rsa I; S, Ssp I; T, Taq I). Below, partial sequence of the intron shows the IAP integration site. Nucleotides in bold are part of the B2 repeat element. The remaining nucleotides represent nonrepetitive intron 8 sequence. The integrated IAP is represented at the bottom, flanked by its LTR sequences (black boxes). The direction of IAP transcription is indicated by the arrow. Restriction sites used in cloning are shown below the sequence. The six bases flanking the IAP represent the genomic sequence duplicated when the IAP integrated. An example of the mechanism by which insert sequence was obtained by inverse PCR is represented below the IAP. The circularization of the Taq I fragment at the 5′ end of the IAP element is shown. Intron 8-derived sequences are represented by the thin line, while those derived from the IAP LTR are indicated by the heavy line. Digestion of genomic DNA with Taq I cuts at the site adjacent to the oligonucleotide 5′ REVERSE (see cartoon above) and again at the site indicated in the 5′ LTR of the IAP. Subsequent circularization of that fragment via ligation produces the molecule shown, which includes sequences complementary to both 5′ REVERSE and 5′ FORWARD. Note that circularization places these oligonucleotides closer together and in an orientation suitable for PCR.

Techniques Used: Inverse PCR, Clone Assay, Sequencing, Derivative Assay, Ligation, Polymerase Chain Reaction

Related Articles

Clone Assay:

Article Title: Functional Characterization and Regulation of gadX, a Gene Encoding an AraC/XylS-Like Transcriptional Activator of the Escherichia coli Glutamic Acid Decarboxylase System †
Article Snippet: To generate the isopropyl-β- d -thiogalactopyranoside (IPTG)-inducible p malE :: gadX construct, the 838-bp DNA fragment encompassing the entire gadX gene was amplified by PCR using Taq polymerase (Perkin Elmer) from pBsAX with the primers 5′-GGCAT ATG CAATCACTACATGGGA-3′ and 5′-CCGGATCC CTA TAATCTTATTCCTTCCG-3′ (the gadX start and stop codons are underlined). .. As a consequence of the cloning strategy, the p malE :: gadX fusion construct contained 18 additional nucleotides in the malE - gadX linker region, coding for an extra amino acid sequence (SEFDWH).

Amplification:

Article Title: Architecture of the Replication Fork Stalled at the 3? End of Yeast Ribosomal Genes
Article Snippet: .. Primer end labeling and the primer extension reaction using Taq DNA polymerase (Perkin-Elmer Cetus) or Vent (exo−) DNA polymerase (New England Biolabs) were carried out as described previously , using 30 amplification cycles consisting of three steps: 94°C for 45 s, 55°C for 4 min, 72°C for 3 min. ..

Article Title: Functional Characterization and Regulation of gadX, a Gene Encoding an AraC/XylS-Like Transcriptional Activator of the Escherichia coli Glutamic Acid Decarboxylase System †
Article Snippet: .. To generate the isopropyl-β- d -thiogalactopyranoside (IPTG)-inducible p malE :: gadX construct, the 838-bp DNA fragment encompassing the entire gadX gene was amplified by PCR using Taq polymerase (Perkin Elmer) from pBsAX with the primers 5′-GGCAT ATG CAATCACTACATGGGA-3′ and 5′-CCGGATCC CTA TAATCTTATTCCTTCCG-3′ (the gadX start and stop codons are underlined). .. The amplicon was initially T/A ligated to the pBs-derived T-vector , yielding pT gadX , and sequenced on both strands to ensure that mispriming did not occur during amplification.

Article Title: MethyLight: a high-throughput assay to measure DNA methylation
Article Snippet: In brief, bisulfite-converted genomic DNA is amplified using locus-specific PCR primers flanking an oligonucleotide probe with a 5′ fluorescent reporter dye (6FAM) and a 3′ quencher dye (TAMRA) ( ). .. The 5′ to 3′ nuclease activity of Taq DNA polymerase cleaves the probe and releases the reporter, whose fluorescence can be detected by the laser detector of the ABI Prism 7700 Sequence Detection System (Perkin-Elmer, Foster City, CA).

Article Title: Drosophila P-element transposase is a novel site-specific endonuclease
Article Snippet: .. Under these conditions, we found that Taq polymerase adds one nontemplated additional nucleotide to the 3′ ends of the amplified products, as previously observed ( ; ). .. Linear PCR amplification was performed in a total volume of 20 μl for 20 cycles: 30 sec at 95°C, 30 sec at 50°C, 1 min at 72°C followed by a final extension of 5 min at 72°C.

Article Title: TT viral infection through blood transfusion: retrospective investigation on patients in a prospective study of post-transfusion hepatitis
Article Snippet: For the first round of PCR, 25 μL of reaction mixture containing 2 μL of the cDNA sample, 1 × PCR buffer (10 mM tris-HCl pH 9.0, 50 mM KCl, 1.5 mM MgCl2 0.01% gelatin, and 0.1% Triton X-100), 10 mM of each dNT P, 100ng of each outer primer T-1 (sense: ACAGACAGAGGAGAAGGCAACATG-3’) and T-2 (anti-sense : 5’-CTACCTCCTGGCATTTTACC-3’), and 1 unit of Taq DNA polymerase was am plified in a thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 30 cycles. .. The amplified products were separated by 3% agarose gel electrophoresis and stained with ethidium bromide.

Positive Control:

Article Title: Intracisternal A-Particle Element Transposition into the Murine ?-Glucuronidase Gene Correlates with Loss of Enzyme Activity: a New Model for ?-Glucuronidase Deficiency in the C3H Mouse †
Article Snippet: Ten-microgram samples of genomic DNA from B6 +/+, C3H +/+, and gusmps2J /gusmps2J animals were digested individually with Taq I. DNA from λ phage containing the full-length normal B6 allele ( ) was digested in parallel as a positive control. .. Samples were transferred to clean tubes, and 20 μl of each (approximately 1.25 μg of DNA) was used in PCR under the following conditions: 1 μM each appropriate forward and reverse oligonucleotide (for sequences, see below; The Great American Gene Company, Ramona, Calif.), 0.25 mM deoxynucleoside triphosphates, 2.5 U of Taq polymerase (Perkin-Elmer Cetus), and 1× PCR buffer with 1.5 mM MgCl2 (Perkin-Elmer Cetus) in a total volume of 50 μl.

Construct:

Article Title: Functional Characterization and Regulation of gadX, a Gene Encoding an AraC/XylS-Like Transcriptional Activator of the Escherichia coli Glutamic Acid Decarboxylase System †
Article Snippet: .. To generate the isopropyl-β- d -thiogalactopyranoside (IPTG)-inducible p malE :: gadX construct, the 838-bp DNA fragment encompassing the entire gadX gene was amplified by PCR using Taq polymerase (Perkin Elmer) from pBsAX with the primers 5′-GGCAT ATG CAATCACTACATGGGA-3′ and 5′-CCGGATCC CTA TAATCTTATTCCTTCCG-3′ (the gadX start and stop codons are underlined). .. The amplicon was initially T/A ligated to the pBs-derived T-vector , yielding pT gadX , and sequenced on both strands to ensure that mispriming did not occur during amplification.

Real-time Polymerase Chain Reaction:

Article Title: MethyLight: a high-throughput assay to measure DNA methylation
Article Snippet: After sodium bisulfite conversion, genomic DNA is amplified by fluorescence-based, real-time quantitative PCR ( , ). .. The 5′ to 3′ nuclease activity of Taq DNA polymerase cleaves the probe and releases the reporter, whose fluorescence can be detected by the laser detector of the ABI Prism 7700 Sequence Detection System (Perkin-Elmer, Foster City, CA).

Incubation:

Article Title: Nucleotide excision repair and photolyase preferentially repair the nontranscribed strand of RNA polymerase III-transcribed genes in Saccharomyces cerevisiae
Article Snippet: The mixture was incubated for 30 min at 37°C, the primer was then separated from the nonincorporated ATP with a G50 Sephadex column (Boehringer) and dissolved in an appropriate volume of TE (pH 8). .. Approximately 1–5 μg of Eco RI-digested genomic DNA was mixed with (1–5 ng) of radiolabeled primer and was subjected to 30 cycles of repeated denaturation (94°C for 45 sec), annealing (60°C for 4 min, 30 sec) and extension (72°C for 2 min) reactions, with 0.2 unit of Taq DNA polymerase (Perkin Elmer) for each reaction.

Activity Assay:

Article Title: MethyLight: a high-throughput assay to measure DNA methylation
Article Snippet: .. The 5′ to 3′ nuclease activity of Taq DNA polymerase cleaves the probe and releases the reporter, whose fluorescence can be detected by the laser detector of the ABI Prism 7700 Sequence Detection System (Perkin-Elmer, Foster City, CA). .. After crossing a fluorescence detection threshold, the PCR amplification results in a fluorescent signal proportional to the amount of PCR product generated.

Expressing:

Article Title: Functional Characterization and Regulation of gadX, a Gene Encoding an AraC/XylS-Like Transcriptional Activator of the Escherichia coli Glutamic Acid Decarboxylase System †
Article Snippet: Paragraph title: Construction of GadX expression systems. ... To generate the isopropyl-β- d -thiogalactopyranoside (IPTG)-inducible p malE :: gadX construct, the 838-bp DNA fragment encompassing the entire gadX gene was amplified by PCR using Taq polymerase (Perkin Elmer) from pBsAX with the primers 5′-GGCAT ATG CAATCACTACATGGGA-3′ and 5′-CCGGATCC CTA TAATCTTATTCCTTCCG-3′ (the gadX start and stop codons are underlined).

Western Blot:

Article Title: Association between bone mineral density and lifestyle factors or vitamin D receptor gene polymorphism in adult male workers: a cross-sectional study
Article Snippet: Genomic DNA was extracted from peripheral blood leukocytes by using a DNA Extractor WB Kit (Wako Pure Chemical Industries, Osaka, Japan). .. PCR was performed for 35 cycles using Taq polymerase (Perkin Elmer Co., Ltd., NJ, USA) under the following conditions: denaturation at 94°C for 1 min, annealing at 57°C for 1 min, and extension at 72°C for 1 min. Then 10 μl of the PCR products were subjected to digestion with Taq I (Takara Shuzo Co., Ltd., Kyoto, Japan) at 65°C for 3 h and were separated on 3% Nusieve agarose gel (FMC Bioproducts, Rockland, ME, USA) [ ].

Derivative Assay:

Article Title: MethyLight: a high-throughput assay to measure DNA methylation
Article Snippet: The 5′ to 3′ nuclease activity of Taq DNA polymerase cleaves the probe and releases the reporter, whose fluorescence can be detected by the laser detector of the ABI Prism 7700 Sequence Detection System (Perkin-Elmer, Foster City, CA). .. Initial template quantity can be derived from the cycle number at which the fluorescent signal crosses a threshold in the exponential phase of the PCR reaction ( ).

Article Title: Intracisternal A-Particle Element Transposition into the Murine ?-Glucuronidase Gene Correlates with Loss of Enzyme Activity: a New Model for ?-Glucuronidase Deficiency in the C3H Mouse †
Article Snippet: Samples were transferred to clean tubes, and 20 μl of each (approximately 1.25 μg of DNA) was used in PCR under the following conditions: 1 μM each appropriate forward and reverse oligonucleotide (for sequences, see below; The Great American Gene Company, Ramona, Calif.), 0.25 mM deoxynucleoside triphosphates, 2.5 U of Taq polymerase (Perkin-Elmer Cetus), and 1× PCR buffer with 1.5 mM MgCl2 (Perkin-Elmer Cetus) in a total volume of 50 μl. .. Oligonucleotides designated “5′” are complementary to intronic sequences 5′ to the insertion site and were used to amplify sequences derived from Taq I-digested DNA; those designated “3′” are complementary to sequences 3′ to the insertion site and were used to amplify sequences derived from Rsa I- or Ssp I-digested DNA.

Sequencing:

Article Title: Architecture of the Replication Fork Stalled at the 3? End of Yeast Ribosomal Genes
Article Snippet: The sequence for primer 256, annealing to the bottom strand (parental lagging strand of RIs), is 5′-GATGGGTTGAAAGAGAAGG-3′ (nt 256 to 274). .. Primer end labeling and the primer extension reaction using Taq DNA polymerase (Perkin-Elmer Cetus) or Vent (exo−) DNA polymerase (New England Biolabs) were carried out as described previously , using 30 amplification cycles consisting of three steps: 94°C for 45 s, 55°C for 4 min, 72°C for 3 min.

Article Title: Functional Characterization and Regulation of gadX, a Gene Encoding an AraC/XylS-Like Transcriptional Activator of the Escherichia coli Glutamic Acid Decarboxylase System †
Article Snippet: To generate the isopropyl-β- d -thiogalactopyranoside (IPTG)-inducible p malE :: gadX construct, the 838-bp DNA fragment encompassing the entire gadX gene was amplified by PCR using Taq polymerase (Perkin Elmer) from pBsAX with the primers 5′-GGCAT ATG CAATCACTACATGGGA-3′ and 5′-CCGGATCC CTA TAATCTTATTCCTTCCG-3′ (the gadX start and stop codons are underlined). .. As a consequence of the cloning strategy, the p malE :: gadX fusion construct contained 18 additional nucleotides in the malE - gadX linker region, coding for an extra amino acid sequence (SEFDWH).

Article Title: MethyLight: a high-throughput assay to measure DNA methylation
Article Snippet: .. The 5′ to 3′ nuclease activity of Taq DNA polymerase cleaves the probe and releases the reporter, whose fluorescence can be detected by the laser detector of the ABI Prism 7700 Sequence Detection System (Perkin-Elmer, Foster City, CA). .. After crossing a fluorescence detection threshold, the PCR amplification results in a fluorescent signal proportional to the amount of PCR product generated.

Article Title: Genotype distribution of cervical human papillomavirus DNA in women with cervical lesions in Bioko, Equatorial Guinea
Article Snippet: 125 ngm of nucleic acid was used for each 50 μl PCR reaction with Taq DNA Polymerase (Perkin-Elmer Hispania). .. The primers had the following sequence: E6 HPV-16 H1+5'ATTAGTGAGTATAGACATTA3'; H2 -5'GGCTTTTGACAGTTAATACA3' and B-GLOBIN +5'GGTTGGCCAATCTACTCCCAGG3'; -5'GCTCACTCAGTGTGGCAAAG3'.

Inverse PCR:

Article Title: Intracisternal A-Particle Element Transposition into the Murine ?-Glucuronidase Gene Correlates with Loss of Enzyme Activity: a New Model for ?-Glucuronidase Deficiency in the C3H Mouse †
Article Snippet: Paragraph title: Inverse PCR. ... Samples were transferred to clean tubes, and 20 μl of each (approximately 1.25 μg of DNA) was used in PCR under the following conditions: 1 μM each appropriate forward and reverse oligonucleotide (for sequences, see below; The Great American Gene Company, Ramona, Calif.), 0.25 mM deoxynucleoside triphosphates, 2.5 U of Taq polymerase (Perkin-Elmer Cetus), and 1× PCR buffer with 1.5 mM MgCl2 (Perkin-Elmer Cetus) in a total volume of 50 μl.

Ligation:

Article Title: Intracisternal A-Particle Element Transposition into the Murine ?-Glucuronidase Gene Correlates with Loss of Enzyme Activity: a New Model for ?-Glucuronidase Deficiency in the C3H Mouse †
Article Snippet: Four micrograms of each DNA at a concentration of 6 to 7 ng per μl to favor intramolecular ligation was used in the following ligation mixture: 50 mM Tris (pH 7.5), 10 mM MgCl2 , 1 mM ATP, 10 mM dithiothreitol, and 1,600 U of T4 DNA ligase (New England Biolabs) in a total volume of 600 μl. .. Samples were transferred to clean tubes, and 20 μl of each (approximately 1.25 μg of DNA) was used in PCR under the following conditions: 1 μM each appropriate forward and reverse oligonucleotide (for sequences, see below; The Great American Gene Company, Ramona, Calif.), 0.25 mM deoxynucleoside triphosphates, 2.5 U of Taq polymerase (Perkin-Elmer Cetus), and 1× PCR buffer with 1.5 mM MgCl2 (Perkin-Elmer Cetus) in a total volume of 50 μl.

Infection:

Article Title: TT viral infection through blood transfusion: retrospective investigation on patients in a prospective study of post-transfusion hepatitis
Article Snippet: The diagnosis of acute TTV infection was based on the occurrence of sero-conversion of TTV DNA determined using PCR method with semi-nested primers as previously described[ , ]. .. For the first round of PCR, 25 μL of reaction mixture containing 2 μL of the cDNA sample, 1 × PCR buffer (10 mM tris-HCl pH 9.0, 50 mM KCl, 1.5 mM MgCl2 0.01% gelatin, and 0.1% Triton X-100), 10 mM of each dNT P, 100ng of each outer primer T-1 (sense: ACAGACAGAGGAGAAGGCAACATG-3’) and T-2 (anti-sense : 5’-CTACCTCCTGGCATTTTACC-3’), and 1 unit of Taq DNA polymerase was am plified in a thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 30 cycles.

Generated:

Article Title: Functional Characterization and Regulation of gadX, a Gene Encoding an AraC/XylS-Like Transcriptional Activator of the Escherichia coli Glutamic Acid Decarboxylase System †
Article Snippet: The 838-bp DNA fragment encompassing the entire gadX gene was generated by PCR using Vent polymerase (New England Biolabs) from pBsAX with primers 5′-GG GGATCC ATG CAATCACTACACGGGAATT-3′ and 5′-GG AAGCTT CTA TAATCTTATTCCTTCCGCAGA-3′ (restriction sites are italicized; the gadX start and stop codons are underlined). .. To generate the isopropyl-β- d -thiogalactopyranoside (IPTG)-inducible p malE :: gadX construct, the 838-bp DNA fragment encompassing the entire gadX gene was amplified by PCR using Taq polymerase (Perkin Elmer) from pBsAX with the primers 5′-GGCAT ATG CAATCACTACATGGGA-3′ and 5′-CCGGATCC CTA TAATCTTATTCCTTCCG-3′ (the gadX start and stop codons are underlined).

Article Title: MethyLight: a high-throughput assay to measure DNA methylation
Article Snippet: The 5′ to 3′ nuclease activity of Taq DNA polymerase cleaves the probe and releases the reporter, whose fluorescence can be detected by the laser detector of the ABI Prism 7700 Sequence Detection System (Perkin-Elmer, Foster City, CA). .. After crossing a fluorescence detection threshold, the PCR amplification results in a fluorescent signal proportional to the amount of PCR product generated.

Article Title: Association between bone mineral density and lifestyle factors or vitamin D receptor gene polymorphism in adult male workers: a cross-sectional study
Article Snippet: A 740-base-pair (bp) fragment was generated by PCR with primers located on intron 8 and exon 9. .. PCR was performed for 35 cycles using Taq polymerase (Perkin Elmer Co., Ltd., NJ, USA) under the following conditions: denaturation at 94°C for 1 min, annealing at 57°C for 1 min, and extension at 72°C for 1 min. Then 10 μl of the PCR products were subjected to digestion with Taq I (Takara Shuzo Co., Ltd., Kyoto, Japan) at 65°C for 3 h and were separated on 3% Nusieve agarose gel (FMC Bioproducts, Rockland, ME, USA) [ ].

other:

Article Title: Is the Perceived Association between Chlamydia pneumoniae and Vascular Diseases Biased by Methodology?
Article Snippet: Assay B2 was the same as assay B1 but using AmpliTaq Gold DNA polymerase instead of Taq DNA polymerase.

DNA Sequencing:

Article Title: Nucleotide excision repair and photolyase preferentially repair the nontranscribed strand of RNA polymerase III-transcribed genes in Saccharomyces cerevisiae
Article Snippet: Approximately 1–5 μg of Eco RI-digested genomic DNA was mixed with (1–5 ng) of radiolabeled primer and was subjected to 30 cycles of repeated denaturation (94°C for 45 sec), annealing (60°C for 4 min, 30 sec) and extension (72°C for 2 min) reactions, with 0.2 unit of Taq DNA polymerase (Perkin Elmer) for each reaction. .. DNA sequencing was done in parallel by use of Sanger chain termination method utilizing the same primers.

Polymerase Chain Reaction:

Article Title: Functional Characterization and Regulation of gadX, a Gene Encoding an AraC/XylS-Like Transcriptional Activator of the Escherichia coli Glutamic Acid Decarboxylase System †
Article Snippet: .. To generate the isopropyl-β- d -thiogalactopyranoside (IPTG)-inducible p malE :: gadX construct, the 838-bp DNA fragment encompassing the entire gadX gene was amplified by PCR using Taq polymerase (Perkin Elmer) from pBsAX with the primers 5′-GGCAT ATG CAATCACTACATGGGA-3′ and 5′-CCGGATCC CTA TAATCTTATTCCTTCCG-3′ (the gadX start and stop codons are underlined). .. The amplicon was initially T/A ligated to the pBs-derived T-vector , yielding pT gadX , and sequenced on both strands to ensure that mispriming did not occur during amplification.

Article Title: Analytical Sensitivity, Reproducibility of Results, and Clinical Performance of Five PCR Assays for Detecting Chlamydia pneumoniae DNA in Peripheral Blood Mononuclear Cells
Article Snippet: .. The HL1-HR1 PCR employed 2.5 mM MgCl2 , a 0.5 μM concentration of each primer, and 0.75 U of Taq polymerase and involved 40 cycles of 30 s at 94°C, 30 s at 57°C, and 1 min at 72°C. .. For the PCR using CP1-CP2 with nested primer pair CPC-CPD, the conditions were as follows: the first round of amplification employed 1.5 mM MgCl2 , 0.4 μM primers, and 0.625 U of Taq polymerase and involved 20 cycles of 1 min at 94°C, 1 min at 65°C minus 0.5°C per cycle, and 1 min at 72°C plus an additional 20 cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C.

Article Title: MethyLight: a high-throughput assay to measure DNA methylation
Article Snippet: In brief, bisulfite-converted genomic DNA is amplified using locus-specific PCR primers flanking an oligonucleotide probe with a 5′ fluorescent reporter dye (6FAM) and a 3′ quencher dye (TAMRA) ( ). .. The 5′ to 3′ nuclease activity of Taq DNA polymerase cleaves the probe and releases the reporter, whose fluorescence can be detected by the laser detector of the ABI Prism 7700 Sequence Detection System (Perkin-Elmer, Foster City, CA).

Article Title: Intracisternal A-Particle Element Transposition into the Murine ?-Glucuronidase Gene Correlates with Loss of Enzyme Activity: a New Model for ?-Glucuronidase Deficiency in the C3H Mouse †
Article Snippet: .. Samples were transferred to clean tubes, and 20 μl of each (approximately 1.25 μg of DNA) was used in PCR under the following conditions: 1 μM each appropriate forward and reverse oligonucleotide (for sequences, see below; The Great American Gene Company, Ramona, Calif.), 0.25 mM deoxynucleoside triphosphates, 2.5 U of Taq polymerase (Perkin-Elmer Cetus), and 1× PCR buffer with 1.5 mM MgCl2 (Perkin-Elmer Cetus) in a total volume of 50 μl. .. Four 30-bp oligomers complementary to nonrepetitive intron 8 sequences of the B6 normal allele were designed for use in PCR.

Article Title: Analytical Sensitivity, Reproducibility of Results, and Clinical Performance of Five PCR Assays for Detecting Chlamydia pneumoniae DNA in Peripheral Blood Mononuclear Cells
Article Snippet: .. For the TETR PCR, the CPN90-CPN91 primer pair was used with 2.5 mM MgCl2 , 0.25 μM primers, and 0.5 U of Taq polymerase. ..

Article Title: Genotype distribution of cervical human papillomavirus DNA in women with cervical lesions in Bioko, Equatorial Guinea
Article Snippet: .. 125 ngm of nucleic acid was used for each 50 μl PCR reaction with Taq DNA Polymerase (Perkin-Elmer Hispania). .. Each PCR reaction contained primers for the intron E6 of the HPV-16 or Beta-globin, following the the protocol described by Shibata et al. (1988) [ ].

Article Title: Association between bone mineral density and lifestyle factors or vitamin D receptor gene polymorphism in adult male workers: a cross-sectional study
Article Snippet: .. PCR was performed for 35 cycles using Taq polymerase (Perkin Elmer Co., Ltd., NJ, USA) under the following conditions: denaturation at 94°C for 1 min, annealing at 57°C for 1 min, and extension at 72°C for 1 min. Then 10 μl of the PCR products were subjected to digestion with Taq I (Takara Shuzo Co., Ltd., Kyoto, Japan) at 65°C for 3 h and were separated on 3% Nusieve agarose gel (FMC Bioproducts, Rockland, ME, USA) [ ]. ..

Article Title: TT viral infection through blood transfusion: retrospective investigation on patients in a prospective study of post-transfusion hepatitis
Article Snippet: .. For the first round of PCR, 25 μL of reaction mixture containing 2 μL of the cDNA sample, 1 × PCR buffer (10 mM tris-HCl pH 9.0, 50 mM KCl, 1.5 mM MgCl2 0.01% gelatin, and 0.1% Triton X-100), 10 mM of each dNT P, 100ng of each outer primer T-1 (sense: ACAGACAGAGGAGAAGGCAACATG-3’) and T-2 (anti-sense : 5’-CTACCTCCTGGCATTTTACC-3’), and 1 unit of Taq DNA polymerase was am plified in a thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 30 cycles. .. On e microliter of the PCR products was re-amplified for another 30 cycles with 100 ng of inner primers, T-3 (sense: 5’-GGCAACATGTTATGGATAGACTGG-3’) and T-4 (anti-sense: CTGGCATTTTACCATTTCCAAAGTT-3’).

Cellular Antioxidant Activity Assay:

Article Title: Association between bone mineral density and lifestyle factors or vitamin D receptor gene polymorphism in adult male workers: a cross-sectional study
Article Snippet: The primer sequences were 5′ cag agc atg gac agg gag caa 3′ (forward) and 5′ gca act cct cat ggc tga ggt ctc 3′ (reverse). .. PCR was performed for 35 cycles using Taq polymerase (Perkin Elmer Co., Ltd., NJ, USA) under the following conditions: denaturation at 94°C for 1 min, annealing at 57°C for 1 min, and extension at 72°C for 1 min. Then 10 μl of the PCR products were subjected to digestion with Taq I (Takara Shuzo Co., Ltd., Kyoto, Japan) at 65°C for 3 h and were separated on 3% Nusieve agarose gel (FMC Bioproducts, Rockland, ME, USA) [ ].

DNA Extraction:

Article Title: Genotype distribution of cervical human papillomavirus DNA in women with cervical lesions in Bioko, Equatorial Guinea
Article Snippet: Paragraph title: Second round of DNA extraction and PCR ... 125 ngm of nucleic acid was used for each 50 μl PCR reaction with Taq DNA Polymerase (Perkin-Elmer Hispania).

Fluorescence:

Article Title: MethyLight: a high-throughput assay to measure DNA methylation
Article Snippet: .. The 5′ to 3′ nuclease activity of Taq DNA polymerase cleaves the probe and releases the reporter, whose fluorescence can be detected by the laser detector of the ABI Prism 7700 Sequence Detection System (Perkin-Elmer, Foster City, CA). .. After crossing a fluorescence detection threshold, the PCR amplification results in a fluorescent signal proportional to the amount of PCR product generated.

Size-exclusion Chromatography:

Article Title: Nucleotide excision repair and photolyase preferentially repair the nontranscribed strand of RNA polymerase III-transcribed genes in Saccharomyces cerevisiae
Article Snippet: .. Approximately 1–5 μg of Eco RI-digested genomic DNA was mixed with (1–5 ng) of radiolabeled primer and was subjected to 30 cycles of repeated denaturation (94°C for 45 sec), annealing (60°C for 4 min, 30 sec) and extension (72°C for 2 min) reactions, with 0.2 unit of Taq DNA polymerase (Perkin Elmer) for each reaction. ..

Labeling:

Article Title: Nucleotide excision repair and photolyase preferentially repair the nontranscribed strand of RNA polymerase III-transcribed genes in Saccharomyces cerevisiae
Article Snippet: Primer labeling and primer extension were done as described in with some modifications. .. Approximately 1–5 μg of Eco RI-digested genomic DNA was mixed with (1–5 ng) of radiolabeled primer and was subjected to 30 cycles of repeated denaturation (94°C for 45 sec), annealing (60°C for 4 min, 30 sec) and extension (72°C for 2 min) reactions, with 0.2 unit of Taq DNA polymerase (Perkin Elmer) for each reaction.

Reverse Transcription Polymerase Chain Reaction:

Article Title: TT viral infection through blood transfusion: retrospective investigation on patients in a prospective study of post-transfusion hepatitis
Article Snippet: The GBV-C/HGV RNA was identified with RT-PCR using nested primers from the 5’-untranslated region of the viral genome as previously described[ ]. .. For the first round of PCR, 25 μL of reaction mixture containing 2 μL of the cDNA sample, 1 × PCR buffer (10 mM tris-HCl pH 9.0, 50 mM KCl, 1.5 mM MgCl2 0.01% gelatin, and 0.1% Triton X-100), 10 mM of each dNT P, 100ng of each outer primer T-1 (sense: ACAGACAGAGGAGAAGGCAACATG-3’) and T-2 (anti-sense : 5’-CTACCTCCTGGCATTTTACC-3’), and 1 unit of Taq DNA polymerase was am plified in a thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 30 cycles.

Activated Clotting Time Assay:

Article Title: Association between bone mineral density and lifestyle factors or vitamin D receptor gene polymorphism in adult male workers: a cross-sectional study
Article Snippet: The primer sequences were 5′ cag agc atg gac agg gag caa 3′ (forward) and 5′ gca act cct cat ggc tga ggt ctc 3′ (reverse). .. PCR was performed for 35 cycles using Taq polymerase (Perkin Elmer Co., Ltd., NJ, USA) under the following conditions: denaturation at 94°C for 1 min, annealing at 57°C for 1 min, and extension at 72°C for 1 min. Then 10 μl of the PCR products were subjected to digestion with Taq I (Takara Shuzo Co., Ltd., Kyoto, Japan) at 65°C for 3 h and were separated on 3% Nusieve agarose gel (FMC Bioproducts, Rockland, ME, USA) [ ].

One-tailed Test:

Article Title: TT viral infection through blood transfusion: retrospective investigation on patients in a prospective study of post-transfusion hepatitis
Article Snippet: For the first round of PCR, 25 μL of reaction mixture containing 2 μL of the cDNA sample, 1 × PCR buffer (10 mM tris-HCl pH 9.0, 50 mM KCl, 1.5 mM MgCl2 0.01% gelatin, and 0.1% Triton X-100), 10 mM of each dNT P, 100ng of each outer primer T-1 (sense: ACAGACAGAGGAGAAGGCAACATG-3’) and T-2 (anti-sense : 5’-CTACCTCCTGGCATTTTACC-3’), and 1 unit of Taq DNA polymerase was am plified in a thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 30 cycles. .. Statistical analysis was performed using Student’s t test, Yates’ corrected Chi-square, and one-tailed Fisher’s exact test where appropriate.

Plasmid Preparation:

Article Title: Functional Characterization and Regulation of gadX, a Gene Encoding an AraC/XylS-Like Transcriptional Activator of the Escherichia coli Glutamic Acid Decarboxylase System †
Article Snippet: The 832-bp Bam HI- Hin dIII fragment from pBs gadX was then ligated to the corresponding sites of the expression vector pQE60, yielding pQE gadX . .. To generate the isopropyl-β- d -thiogalactopyranoside (IPTG)-inducible p malE :: gadX construct, the 838-bp DNA fragment encompassing the entire gadX gene was amplified by PCR using Taq polymerase (Perkin Elmer) from pBsAX with the primers 5′-GGCAT ATG CAATCACTACATGGGA-3′ and 5′-CCGGATCC CTA TAATCTTATTCCTTCCG-3′ (the gadX start and stop codons are underlined).

Enzyme-linked Immunosorbent Assay:

Article Title: TT viral infection through blood transfusion: retrospective investigation on patients in a prospective study of post-transfusion hepatitis
Article Snippet: Patients with positive HBsAg ( Auszyme, Abbott Lab.) were also tested for hepatitis Be antigen [HBeAg; HBe (rDNA) EIA, Abbott Lab.] and antibody to hepatitis delta virus (anti-HDV; Wellcozyme, Wellcome Diagnostics, England ) using the EIA method. .. For the first round of PCR, 25 μL of reaction mixture containing 2 μL of the cDNA sample, 1 × PCR buffer (10 mM tris-HCl pH 9.0, 50 mM KCl, 1.5 mM MgCl2 0.01% gelatin, and 0.1% Triton X-100), 10 mM of each dNT P, 100ng of each outer primer T-1 (sense: ACAGACAGAGGAGAAGGCAACATG-3’) and T-2 (anti-sense : 5’-CTACCTCCTGGCATTTTACC-3’), and 1 unit of Taq DNA polymerase was am plified in a thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 30 cycles.

Agarose Gel Electrophoresis:

Article Title: Association between bone mineral density and lifestyle factors or vitamin D receptor gene polymorphism in adult male workers: a cross-sectional study
Article Snippet: .. PCR was performed for 35 cycles using Taq polymerase (Perkin Elmer Co., Ltd., NJ, USA) under the following conditions: denaturation at 94°C for 1 min, annealing at 57°C for 1 min, and extension at 72°C for 1 min. Then 10 μl of the PCR products were subjected to digestion with Taq I (Takara Shuzo Co., Ltd., Kyoto, Japan) at 65°C for 3 h and were separated on 3% Nusieve agarose gel (FMC Bioproducts, Rockland, ME, USA) [ ]. ..

Article Title: TT viral infection through blood transfusion: retrospective investigation on patients in a prospective study of post-transfusion hepatitis
Article Snippet: For the first round of PCR, 25 μL of reaction mixture containing 2 μL of the cDNA sample, 1 × PCR buffer (10 mM tris-HCl pH 9.0, 50 mM KCl, 1.5 mM MgCl2 0.01% gelatin, and 0.1% Triton X-100), 10 mM of each dNT P, 100ng of each outer primer T-1 (sense: ACAGACAGAGGAGAAGGCAACATG-3’) and T-2 (anti-sense : 5’-CTACCTCCTGGCATTTTACC-3’), and 1 unit of Taq DNA polymerase was am plified in a thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 30 cycles. .. The amplified products were separated by 3% agarose gel electrophoresis and stained with ethidium bromide.

Concentration Assay:

Article Title: Analytical Sensitivity, Reproducibility of Results, and Clinical Performance of Five PCR Assays for Detecting Chlamydia pneumoniae DNA in Peripheral Blood Mononuclear Cells
Article Snippet: .. The HL1-HR1 PCR employed 2.5 mM MgCl2 , a 0.5 μM concentration of each primer, and 0.75 U of Taq polymerase and involved 40 cycles of 30 s at 94°C, 30 s at 57°C, and 1 min at 72°C. .. For the PCR using CP1-CP2 with nested primer pair CPC-CPD, the conditions were as follows: the first round of amplification employed 1.5 mM MgCl2 , 0.4 μM primers, and 0.625 U of Taq polymerase and involved 20 cycles of 1 min at 94°C, 1 min at 65°C minus 0.5°C per cycle, and 1 min at 72°C plus an additional 20 cycles of 1 min at 94°C, 1 min at 55°C, and 1 min at 72°C.

Article Title: Intracisternal A-Particle Element Transposition into the Murine ?-Glucuronidase Gene Correlates with Loss of Enzyme Activity: a New Model for ?-Glucuronidase Deficiency in the C3H Mouse †
Article Snippet: Four micrograms of each DNA at a concentration of 6 to 7 ng per μl to favor intramolecular ligation was used in the following ligation mixture: 50 mM Tris (pH 7.5), 10 mM MgCl2 , 1 mM ATP, 10 mM dithiothreitol, and 1,600 U of T4 DNA ligase (New England Biolabs) in a total volume of 600 μl. .. Samples were transferred to clean tubes, and 20 μl of each (approximately 1.25 μg of DNA) was used in PCR under the following conditions: 1 μM each appropriate forward and reverse oligonucleotide (for sequences, see below; The Great American Gene Company, Ramona, Calif.), 0.25 mM deoxynucleoside triphosphates, 2.5 U of Taq polymerase (Perkin-Elmer Cetus), and 1× PCR buffer with 1.5 mM MgCl2 (Perkin-Elmer Cetus) in a total volume of 50 μl.

End Labeling:

Article Title: Architecture of the Replication Fork Stalled at the 3? End of Yeast Ribosomal Genes
Article Snippet: .. Primer end labeling and the primer extension reaction using Taq DNA polymerase (Perkin-Elmer Cetus) or Vent (exo−) DNA polymerase (New England Biolabs) were carried out as described previously , using 30 amplification cycles consisting of three steps: 94°C for 45 s, 55°C for 4 min, 72°C for 3 min. ..

Staining:

Article Title: TT viral infection through blood transfusion: retrospective investigation on patients in a prospective study of post-transfusion hepatitis
Article Snippet: For the first round of PCR, 25 μL of reaction mixture containing 2 μL of the cDNA sample, 1 × PCR buffer (10 mM tris-HCl pH 9.0, 50 mM KCl, 1.5 mM MgCl2 0.01% gelatin, and 0.1% Triton X-100), 10 mM of each dNT P, 100ng of each outer primer T-1 (sense: ACAGACAGAGGAGAAGGCAACATG-3’) and T-2 (anti-sense : 5’-CTACCTCCTGGCATTTTACC-3’), and 1 unit of Taq DNA polymerase was am plified in a thermal cycler (Perkin-Elmer Cetus, Norwalk, CT) for 30 cycles. .. The amplified products were separated by 3% agarose gel electrophoresis and stained with ethidium bromide.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    PerkinElmer taq dna polymerase
    High-resolution analysis of nucleotide excision repair in the SUP4 gene. Yeast cells were UV-irradiated with 200 J/m 2 and reincubated under yellow light for the indicated repair times. PD repair was analyzed by primer extension. ( A ) Primer extension products in the TSs and NTSs. UV-irradiated <t>DNA</t> (lanes 1–5 ), nonirradiated DNA (lane 6 ), DNA sequencing (lanes T,C,A,G ). The letters on the left and the right sides represent pyrimidine clusters; the numbers refer to the 5′ nucleotide of the pyrimidine cluster in the SUP4 ). Asterisks indicate nonspecific <t>Taq</t> polymerase arrests; (arrows) transcribed part; (boxes) the intragenic promoter elements box A and B. The top strand is NTS; the bottom strand is TS. ( B ) Quantitative analysis of PD removal from SUP4 TSs and NTSs. The fraction of PDs (%) removed after 4 hr from the TS (open bars) and NTS (solid bars). The numbers on the x ). The arrow indicates the direction of transcription. The data are averages of two experiments.
    Taq Dna Polymerase, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 93/100, based on 988 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/PerkinElmer
    Average 93 stars, based on 988 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    Image Search Results


    High-resolution analysis of nucleotide excision repair in the SUP4 gene. Yeast cells were UV-irradiated with 200 J/m 2 and reincubated under yellow light for the indicated repair times. PD repair was analyzed by primer extension. ( A ) Primer extension products in the TSs and NTSs. UV-irradiated DNA (lanes 1–5 ), nonirradiated DNA (lane 6 ), DNA sequencing (lanes T,C,A,G ). The letters on the left and the right sides represent pyrimidine clusters; the numbers refer to the 5′ nucleotide of the pyrimidine cluster in the SUP4 ). Asterisks indicate nonspecific Taq polymerase arrests; (arrows) transcribed part; (boxes) the intragenic promoter elements box A and B. The top strand is NTS; the bottom strand is TS. ( B ) Quantitative analysis of PD removal from SUP4 TSs and NTSs. The fraction of PDs (%) removed after 4 hr from the TS (open bars) and NTS (solid bars). The numbers on the x ). The arrow indicates the direction of transcription. The data are averages of two experiments.

    Journal: Genes & Development

    Article Title: Nucleotide excision repair and photolyase preferentially repair the nontranscribed strand of RNA polymerase III-transcribed genes in Saccharomyces cerevisiae

    doi:

    Figure Lengend Snippet: High-resolution analysis of nucleotide excision repair in the SUP4 gene. Yeast cells were UV-irradiated with 200 J/m 2 and reincubated under yellow light for the indicated repair times. PD repair was analyzed by primer extension. ( A ) Primer extension products in the TSs and NTSs. UV-irradiated DNA (lanes 1–5 ), nonirradiated DNA (lane 6 ), DNA sequencing (lanes T,C,A,G ). The letters on the left and the right sides represent pyrimidine clusters; the numbers refer to the 5′ nucleotide of the pyrimidine cluster in the SUP4 ). Asterisks indicate nonspecific Taq polymerase arrests; (arrows) transcribed part; (boxes) the intragenic promoter elements box A and B. The top strand is NTS; the bottom strand is TS. ( B ) Quantitative analysis of PD removal from SUP4 TSs and NTSs. The fraction of PDs (%) removed after 4 hr from the TS (open bars) and NTS (solid bars). The numbers on the x ). The arrow indicates the direction of transcription. The data are averages of two experiments.

    Article Snippet: Approximately 1–5 μg of Eco RI-digested genomic DNA was mixed with (1–5 ng) of radiolabeled primer and was subjected to 30 cycles of repeated denaturation (94°C for 45 sec), annealing (60°C for 4 min, 30 sec) and extension (72°C for 2 min) reactions, with 0.2 unit of Taq DNA polymerase (Perkin Elmer) for each reaction.

    Techniques: Irradiation, DNA Sequencing

    Identification of MalE-GadX binding sites in gadA and gadBC promoters. (A) Gel retardation assays of in vitro binding of the purified MalE-GadX protein to the promoter regions of gadA (P gadA , left) and gadBC (P gadB , right) genes. The DNA fragments were labeled with [α- 32 P]dATP by fill-in of 5′ protruding ends. In each binding reaction, 10 fmol of the DNA probe was incubated in a 10-μl volume with increasing amounts (0.5 to 10 pmol) of the MalE-GadX protein, under the conditions described in Materials and Methods. MalE-GadX-bound DNA fragments (forms I, II, and III) were separated from the unbound probe on a 5% polyacrylamide gel run in 0.5× TAE buffer. (B) DNase I footprinting assays. The 265-bp DNA fragments carrying the promoter regions of gadA (left) and gadBC (right) were incubated with the indicated amounts (picomoles) of MalE-GadX. Samples were processed as described in Materials and Methods using gadAfrw (left panel) and gadABrev (right panel) as the primers. Lanes G and A represent Taq I polymerase sequencing reactions using the same primers. The MalE-GadX-protected sites are indicated with vertical lines and labeled with roman numbers from I to IV. Arrows indicate DNase I-hypersensitive sites. (C) Sequence alignment of gadA and gadBC promoter regions showing the DNase I-protected sites on the coding (full line) and noncoding (dotted line) DNA strands. Sites are indicated above the corresponding sequence. The −35 and −10 hexamers for both gadA and gadBC are shown in bold type.

    Journal: Journal of Bacteriology

    Article Title: Functional Characterization and Regulation of gadX, a Gene Encoding an AraC/XylS-Like Transcriptional Activator of the Escherichia coli Glutamic Acid Decarboxylase System †

    doi: 10.1128/JB.184.10.2603-2613.2002

    Figure Lengend Snippet: Identification of MalE-GadX binding sites in gadA and gadBC promoters. (A) Gel retardation assays of in vitro binding of the purified MalE-GadX protein to the promoter regions of gadA (P gadA , left) and gadBC (P gadB , right) genes. The DNA fragments were labeled with [α- 32 P]dATP by fill-in of 5′ protruding ends. In each binding reaction, 10 fmol of the DNA probe was incubated in a 10-μl volume with increasing amounts (0.5 to 10 pmol) of the MalE-GadX protein, under the conditions described in Materials and Methods. MalE-GadX-bound DNA fragments (forms I, II, and III) were separated from the unbound probe on a 5% polyacrylamide gel run in 0.5× TAE buffer. (B) DNase I footprinting assays. The 265-bp DNA fragments carrying the promoter regions of gadA (left) and gadBC (right) were incubated with the indicated amounts (picomoles) of MalE-GadX. Samples were processed as described in Materials and Methods using gadAfrw (left panel) and gadABrev (right panel) as the primers. Lanes G and A represent Taq I polymerase sequencing reactions using the same primers. The MalE-GadX-protected sites are indicated with vertical lines and labeled with roman numbers from I to IV. Arrows indicate DNase I-hypersensitive sites. (C) Sequence alignment of gadA and gadBC promoter regions showing the DNase I-protected sites on the coding (full line) and noncoding (dotted line) DNA strands. Sites are indicated above the corresponding sequence. The −35 and −10 hexamers for both gadA and gadBC are shown in bold type.

    Article Snippet: To generate the isopropyl-β- d -thiogalactopyranoside (IPTG)-inducible p malE :: gadX construct, the 838-bp DNA fragment encompassing the entire gadX gene was amplified by PCR using Taq polymerase (Perkin Elmer) from pBsAX with the primers 5′-GGCAT ATG CAATCACTACATGGGA-3′ and 5′-CCGGATCC CTA TAATCTTATTCCTTCCG-3′ (the gadX start and stop codons are underlined).

    Techniques: Binding Assay, Electrophoretic Mobility Shift Assay, In Vitro, Purification, Labeling, Incubation, Footprinting, Sequencing

    Transposase makes 17-bp staggered cleavages at the P-element termini. Large-scale cleavage reactions were performed with partially purified transposase and plasmid substrates containing either the 628-bp or 303-bp P elements. Reaction products corresponding to both the cleaved plasmid vector and the excised element were isolated from agarose gel slices. A PCR-based primer extension analysis was performed on each product in order to determine the transposase cleavage sites. Shown are autoradiographs of sequencing gels that display primer extension products from reactions in which nontemplated addition of a single nucleotide by Taq polymerase occurs (as indicated by +1 in each panel). The authentic cleavage sites are indicated by C. Sequencing reactions (ACGT) are shown as markers. The relevant sequence is indicated, with P-element-derived sequences boxed and numbered from the terminal P-element nucleotide, and the cleavage sites indicated by arrows. Schematic diagrams of the direction for primer extension and the cleavage positions for each strand are indicated below each panel. ( A,B ) Extension products to determine the 3′ cleavage site at the left (5′) P-element end ( A ) or the 3′ cleavage site at the right (3′) P-element end ( B ). Products were analyzed for the 303-bp P-element-derived cleavage product only. (Odd-numbered lanes) + transposase; (even-numbered lanes) − transposase. Extension yields a product that terminates exactly at the 3′ end of the P-element inverted repeat. ( C,D ) Extension products to determine the 5′ cleavage sites at the left (5′) P-element end ( C ) or right (3′) P-element end ( D ). (Lanes 1,2,5,6 ) Products derived from the 303-bp P element. (Lanes 3,4,7,8 ) Products derived from the 628-bp P element. (Odd-numbered lanes) + transposase, (even-numbered lanes) − transposase. Extension yields a product that terminates at nucleotide 18 of the P-element inverted repeat.

    Journal: Genes & Development

    Article Title: Drosophila P-element transposase is a novel site-specific endonuclease

    doi:

    Figure Lengend Snippet: Transposase makes 17-bp staggered cleavages at the P-element termini. Large-scale cleavage reactions were performed with partially purified transposase and plasmid substrates containing either the 628-bp or 303-bp P elements. Reaction products corresponding to both the cleaved plasmid vector and the excised element were isolated from agarose gel slices. A PCR-based primer extension analysis was performed on each product in order to determine the transposase cleavage sites. Shown are autoradiographs of sequencing gels that display primer extension products from reactions in which nontemplated addition of a single nucleotide by Taq polymerase occurs (as indicated by +1 in each panel). The authentic cleavage sites are indicated by C. Sequencing reactions (ACGT) are shown as markers. The relevant sequence is indicated, with P-element-derived sequences boxed and numbered from the terminal P-element nucleotide, and the cleavage sites indicated by arrows. Schematic diagrams of the direction for primer extension and the cleavage positions for each strand are indicated below each panel. ( A,B ) Extension products to determine the 3′ cleavage site at the left (5′) P-element end ( A ) or the 3′ cleavage site at the right (3′) P-element end ( B ). Products were analyzed for the 303-bp P-element-derived cleavage product only. (Odd-numbered lanes) + transposase; (even-numbered lanes) − transposase. Extension yields a product that terminates exactly at the 3′ end of the P-element inverted repeat. ( C,D ) Extension products to determine the 5′ cleavage sites at the left (5′) P-element end ( C ) or right (3′) P-element end ( D ). (Lanes 1,2,5,6 ) Products derived from the 303-bp P element. (Lanes 3,4,7,8 ) Products derived from the 628-bp P element. (Odd-numbered lanes) + transposase, (even-numbered lanes) − transposase. Extension yields a product that terminates at nucleotide 18 of the P-element inverted repeat.

    Article Snippet: Under these conditions, we found that Taq polymerase adds one nontemplated additional nucleotide to the 3′ ends of the amplified products, as previously observed ( ; ).

    Techniques: Purification, Plasmid Preparation, Isolation, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Sequencing, Derivative Assay

    Restriction fragment length polymorphism (RFLP) analysis of the product of a polymerase chain reaction (PCR) targeting VDR . Pattern of fragments for the three possible genotypes after Taq I digestion of the PCR product, a 740-bp amplified region

    Journal: Environmental Health and Preventive Medicine

    Article Title: Association between bone mineral density and lifestyle factors or vitamin D receptor gene polymorphism in adult male workers: a cross-sectional study

    doi: 10.1007/s12199-009-0104-y

    Figure Lengend Snippet: Restriction fragment length polymorphism (RFLP) analysis of the product of a polymerase chain reaction (PCR) targeting VDR . Pattern of fragments for the three possible genotypes after Taq I digestion of the PCR product, a 740-bp amplified region

    Article Snippet: PCR was performed for 35 cycles using Taq polymerase (Perkin Elmer Co., Ltd., NJ, USA) under the following conditions: denaturation at 94°C for 1 min, annealing at 57°C for 1 min, and extension at 72°C for 1 min. Then 10 μl of the PCR products were subjected to digestion with Taq I (Takara Shuzo Co., Ltd., Kyoto, Japan) at 65°C for 3 h and were separated on 3% Nusieve agarose gel (FMC Bioproducts, Rockland, ME, USA) [ ].

    Techniques: Polymerase Chain Reaction, Amplification