taq polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Taq DNA Polymerase with ThermoPol Buffer
    Description:
    Taq DNA Polymerase with ThermoPol Buffer 20 000 units
    Catalog Number:
    M0267E
    Price:
    1200
    Size:
    20 000 units
    Category:
    Thermostable DNA Polymerases
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs taq polymerase
    Taq DNA Polymerase with ThermoPol Buffer
    Taq DNA Polymerase with ThermoPol Buffer 20 000 units
    https://www.bioz.com/result/taq polymerase/product/New England Biolabs
    Average 99 stars, based on 0 article reviews
    Price from $9.99 to $1999.99
    taq polymerase - by Bioz Stars, 2019-10
    99/100 stars

    Images

    1) Product Images from "Next-generation mapping: a novel approach for detection of pathogenic structural variants with a potential utility in clinical diagnosis"

    Article Title: Next-generation mapping: a novel approach for detection of pathogenic structural variants with a potential utility in clinical diagnosis

    Journal: Genome Medicine

    doi: 10.1186/s13073-017-0479-0

    DNA labeling for NGM. The DNA labeling workflow is divided into four consecutive steps. First, the high molecular weight DNA is nicked with an endonuclease of choice that introduces single strand nicks throughout the genome. Second, Taq polymerase recognizes these sites and replaces several nucleotides with fluorescently tagged nucleotides added to the solution. Third, the two ends of the DNA are ligated together using DNA ligase. Fourth, the DNA backbone is stained with DNA Stain
    Figure Legend Snippet: DNA labeling for NGM. The DNA labeling workflow is divided into four consecutive steps. First, the high molecular weight DNA is nicked with an endonuclease of choice that introduces single strand nicks throughout the genome. Second, Taq polymerase recognizes these sites and replaces several nucleotides with fluorescently tagged nucleotides added to the solution. Third, the two ends of the DNA are ligated together using DNA ligase. Fourth, the DNA backbone is stained with DNA Stain

    Techniques Used: DNA Labeling, Molecular Weight, Staining

    2) Product Images from "Direct Chromatin PCR (DC-PCR): Hypotonic Conditions Allow Differentiation of Chromatin States during Thermal Cycling"

    Article Title: Direct Chromatin PCR (DC-PCR): Hypotonic Conditions Allow Differentiation of Chromatin States during Thermal Cycling

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0044690

    Direct Amplification of open chromatin with phi29 polymerase: Translation of DC-PCR to genome-wide chromatin analysis. CDKN2A PCR on KMS-12-PE supernatant after direct genome-wide phi29 amplification ( A ). Untreated KMS-12-PE cells or cells treated with DAC (1 µM for 3 d) were placed directly in phi29 reaction mix for 4.5 hrs at 30°C. After that, the reaction was centrifuged to pellet cell carcasses. Only the upper 50% of the supernatant was used for subsequent amplification of CDKN2A sites by conventional PCR. Supernatant from DAC treated cells yielded more CDKN2A products than vehicle treated cells. When DAC treated cells were incubated in reaction buffer without Phi29 polymerase no CDKN2A products could be amplified from supernatants by taq polymerase during conventional PCR. FOSB PCR on KMS-12-PE supernatants obtained from untreated cells or cells treated with 10-E-09 (10 µM for 6 h) after direct genome-wide phi29 amplification ( B ). The same procedure as above yielded FOSB PCR products from supernatants of 10-E-09 treated KMS-12-PE cells amplified by phi29 while vehicle treated cells or supernatants from 10-E-09 treated cells incubated in reaction buffer without phi29 yielded no FOSB regulatory region amplicons. Results are representative of three independent experiments.
    Figure Legend Snippet: Direct Amplification of open chromatin with phi29 polymerase: Translation of DC-PCR to genome-wide chromatin analysis. CDKN2A PCR on KMS-12-PE supernatant after direct genome-wide phi29 amplification ( A ). Untreated KMS-12-PE cells or cells treated with DAC (1 µM for 3 d) were placed directly in phi29 reaction mix for 4.5 hrs at 30°C. After that, the reaction was centrifuged to pellet cell carcasses. Only the upper 50% of the supernatant was used for subsequent amplification of CDKN2A sites by conventional PCR. Supernatant from DAC treated cells yielded more CDKN2A products than vehicle treated cells. When DAC treated cells were incubated in reaction buffer without Phi29 polymerase no CDKN2A products could be amplified from supernatants by taq polymerase during conventional PCR. FOSB PCR on KMS-12-PE supernatants obtained from untreated cells or cells treated with 10-E-09 (10 µM for 6 h) after direct genome-wide phi29 amplification ( B ). The same procedure as above yielded FOSB PCR products from supernatants of 10-E-09 treated KMS-12-PE cells amplified by phi29 while vehicle treated cells or supernatants from 10-E-09 treated cells incubated in reaction buffer without phi29 yielded no FOSB regulatory region amplicons. Results are representative of three independent experiments.

    Techniques Used: Amplification, Polymerase Chain Reaction, Genome Wide, Incubation

    3) Product Images from "In situ 10-cell RNA sequencing in tissue and tumor biopsy samples"

    Article Title: In situ 10-cell RNA sequencing in tissue and tumor biopsy samples

    Journal: Scientific Reports

    doi: 10.1038/s41598-019-41235-9

    A blend of Taq–Phusion polymerases improves selective poly(A) amplification of cDNA and reduces AL1 primer requirements. Cells were obtained by LCM from a human breast biopsy and split into 10-cell equivalent amplification replicates. ( A ) Poly(A) PCR was performed with 15 µg of AL1 primer with Taq alone (10 units), Phusion alone (4 units) or Taq/Phusion combination (3.75 units/1.5 units). ( B ) Poly(A) PCR was performed with either 25, 5, 2.5, or 0.5 µg of AL1 primer and the Taq–Phusion blend from (A). Above—Relative abundance for the indicated genes and preamplification conditions was measured by quantitative PCR (qPCR). Data are shown as the median inverse quantification cycle (40–Cq) ± range from n = 3 amplification replicates and were analysed by two-way (A) or one-way (B) ANOVA with replication. Below—Preamplifications were analysed by agarose gel electrophoresis to separate poly(A)-amplified cDNA from nonspecific, low molecular-weight concatemer (n.s.). Qualitatively similar results were obtained separately three times. Lanes were cropped by poly(A) PCR cycles for display but were electrophoresed on the same agarose gel and processed identically. The uncropped image is shown in Supplementary Fig. S13A .
    Figure Legend Snippet: A blend of Taq–Phusion polymerases improves selective poly(A) amplification of cDNA and reduces AL1 primer requirements. Cells were obtained by LCM from a human breast biopsy and split into 10-cell equivalent amplification replicates. ( A ) Poly(A) PCR was performed with 15 µg of AL1 primer with Taq alone (10 units), Phusion alone (4 units) or Taq/Phusion combination (3.75 units/1.5 units). ( B ) Poly(A) PCR was performed with either 25, 5, 2.5, or 0.5 µg of AL1 primer and the Taq–Phusion blend from (A). Above—Relative abundance for the indicated genes and preamplification conditions was measured by quantitative PCR (qPCR). Data are shown as the median inverse quantification cycle (40–Cq) ± range from n = 3 amplification replicates and were analysed by two-way (A) or one-way (B) ANOVA with replication. Below—Preamplifications were analysed by agarose gel electrophoresis to separate poly(A)-amplified cDNA from nonspecific, low molecular-weight concatemer (n.s.). Qualitatively similar results were obtained separately three times. Lanes were cropped by poly(A) PCR cycles for display but were electrophoresed on the same agarose gel and processed identically. The uncropped image is shown in Supplementary Fig. S13A .

    Techniques Used: Amplification, Laser Capture Microdissection, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis, Molecular Weight

    4) Product Images from "Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro"

    Article Title: Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    Journal: Frontiers in Genetics

    doi: 10.3389/fgene.2015.00177

    Guanine-rich templates from TCF3 and PBX1 block DNA synthesis in vitro . (A) Klenow polymerase extension assays using templates from the cytosine-rich strand (C-strand, left) or guanine-rich strand (G-strand, right) for each G4 sequence motif, resolved by denaturing PAGE. Reactions were performed in either KCl (K + ) or LiCl (Li + ). Shown are bands for stalled DNA synthesis (bracket) and full-length extension product (black arrow). G4 sequences begin at the bottom of the brackets. T-3′ differs from the motif listed in Table 1 , it includes 472 bp of surrounding genomic sequence (Supplementary Figure S2 ). (B) Primer extension reactions used Taq polymerase across a temperature range (50–80∘C) in either KCl (K + ) or (NH 4 ) 2 SO 4 (N) salt conditions on guanine-rich templates from TCF3 and PBX1 . Bands corresponding to stalled DNA synthesis (bracket) or full-length extension (black arrow) are shown.
    Figure Legend Snippet: Guanine-rich templates from TCF3 and PBX1 block DNA synthesis in vitro . (A) Klenow polymerase extension assays using templates from the cytosine-rich strand (C-strand, left) or guanine-rich strand (G-strand, right) for each G4 sequence motif, resolved by denaturing PAGE. Reactions were performed in either KCl (K + ) or LiCl (Li + ). Shown are bands for stalled DNA synthesis (bracket) and full-length extension product (black arrow). G4 sequences begin at the bottom of the brackets. T-3′ differs from the motif listed in Table 1 , it includes 472 bp of surrounding genomic sequence (Supplementary Figure S2 ). (B) Primer extension reactions used Taq polymerase across a temperature range (50–80∘C) in either KCl (K + ) or (NH 4 ) 2 SO 4 (N) salt conditions on guanine-rich templates from TCF3 and PBX1 . Bands corresponding to stalled DNA synthesis (bracket) or full-length extension (black arrow) are shown.

    Techniques Used: Blocking Assay, DNA Synthesis, In Vitro, Sequencing, Polyacrylamide Gel Electrophoresis

    5) Product Images from "Antibody-Directed Lentiviral Gene Transduction for Live-Cell Monitoring and Selection of Human iPS and hES Cells"

    Article Title: Antibody-Directed Lentiviral Gene Transduction for Live-Cell Monitoring and Selection of Human iPS and hES Cells

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0034778

    Characterization of endogenous pluripotent makers in selected iPS cell lines. Panel A. Total RNA was isolated using RNeasy Micro Kit from selected iPS cell lines (G1–G3, G5, G6), hES H9 cells (H9), and human primary fibroblasts (F). Total RNA (500 ng) was reverse-transcribed using Superscript III Reverse Transcriptase primed with oligo(dT) 12–18 and used as template in subsequent PCR with Taq DNA Polymerase. PCR analysis examined the expression of endogenous Oct4, Nanog, Sox2, as well as ABCG2, Rex1, DNMT3B and hTERT. GAPDH was used as an internal control. N, no template control (N). PCR products were analyzed on a 10% polyacrylamide TBE Precast Gel. Panel B. TRAP assay for telomerase activity. Selected iPS cells (G1–G3, G6), hES H9 cells (H9), and human primary fibroblasts (F) were analyzed for telomerase activity using the TRAPEZE RT Telomerase Detection Kit as described in M M. PCR products were separated on 10% polyacrylamide TBE Precast Gel. Individual samples are as indicated.
    Figure Legend Snippet: Characterization of endogenous pluripotent makers in selected iPS cell lines. Panel A. Total RNA was isolated using RNeasy Micro Kit from selected iPS cell lines (G1–G3, G5, G6), hES H9 cells (H9), and human primary fibroblasts (F). Total RNA (500 ng) was reverse-transcribed using Superscript III Reverse Transcriptase primed with oligo(dT) 12–18 and used as template in subsequent PCR with Taq DNA Polymerase. PCR analysis examined the expression of endogenous Oct4, Nanog, Sox2, as well as ABCG2, Rex1, DNMT3B and hTERT. GAPDH was used as an internal control. N, no template control (N). PCR products were analyzed on a 10% polyacrylamide TBE Precast Gel. Panel B. TRAP assay for telomerase activity. Selected iPS cells (G1–G3, G6), hES H9 cells (H9), and human primary fibroblasts (F) were analyzed for telomerase activity using the TRAPEZE RT Telomerase Detection Kit as described in M M. PCR products were separated on 10% polyacrylamide TBE Precast Gel. Individual samples are as indicated.

    Techniques Used: Isolation, Polymerase Chain Reaction, Expressing, TRAP Assay, Activity Assay

    Related Articles

    Clone Assay:

    Article Title: Labeling of unique sequences in double-stranded DNA at sites of vicinal nicks generated by nicking endonucleases
    Article Snippet: Assembly PCR was performed by conducting first extension reactions with hybridized, overlapping oligonucleotides in the absence of primers, followed by PCR amplification in the presence of primers. .. Extension reactions were performed in 1 × Pfu reaction buffer (Stratagene) containing 20 nM of oligonucleotides A-D (see Supplementary Table 1 for sequences), 200 μM dNTPs and 0.025 U/μl of cloned Pfu DNA polymerase (Stratagene) at the following conditions: one step at 94°C for 60 s, followed by 10 cycles of denaturation at 94°C for 30 s, annealing at 35°C for 30 s and extension at 72°C for 30 s. The last cycle was followed by an extension step at 72°C for 2 min. PCR amplification reactions were performed in 1× ThermoPol polymerase buffer (NEB) containing 200 μM dNTPs, 0.5 μM each of primers P1 and P2, 5 μl of extension reaction product and 0.02 U/μl of Taq DNA polymerase. .. PCR conditions were: one step at 94°C for 60 s, followed by 28 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 30 s and extension at 72°C for 30 s. The last cycle was followed by an extension step at 72°C for 2 min.

    Article Title: Mitochondrial DNA Sequence and Lack of Response to Anoxia in the Annual Killifish Austrofundulus limnaeus
    Article Snippet: PCR reactions (50 μl total volume) consisted of 50 ng total DNA, 10 pmol of forward and reverse primers (Table , Integrated DNA Technologies, Coralville, IA, USA), 0.25 U Taq polymerase (New England BioLabs, Ipswich, MA, USA #M0267L), in 1X ThermoPol buffer (New England BioLabs # M0267L). .. PCR products were resolved via 1% agarose electrophoresis and product size was estimated by comparison to a DNA ladder (GeneRuler 1 kb Plus, Thermo Scientific #SM0312) using GelAnalyser ( http://www.sequentix.de/ ).

    Article Title: Cellular localization of relaxin‐like gonad‐stimulating peptide expression in Asterias rubens: New insights into neurohormonal control of spawning in starfish
    Article Snippet: A pBluescript SKII (+) vector containing the cloned and sequenced AruRGP precursor cDNA was used to synthesize RNA probes. .. First, a routine PCR was performed using Taq DNA polymerase (Taq DNA Polymerase with Thermopol Buffer, New England Biolabs) and standard M13 primers (Forward: 5′‐GTAAAACGACGGCCAGTG‐3′, Reverse: 5′‐GGAAACAGCTATGACCATG‐3′, custom‐synthesized by Sigma‐Aldrich) to linearize the plasmid and amplify the insert.

    Amplification:

    Article Title: Labeling of unique sequences in double-stranded DNA at sites of vicinal nicks generated by nicking endonucleases
    Article Snippet: Assembly PCR was performed by conducting first extension reactions with hybridized, overlapping oligonucleotides in the absence of primers, followed by PCR amplification in the presence of primers. .. Extension reactions were performed in 1 × Pfu reaction buffer (Stratagene) containing 20 nM of oligonucleotides A-D (see Supplementary Table 1 for sequences), 200 μM dNTPs and 0.025 U/μl of cloned Pfu DNA polymerase (Stratagene) at the following conditions: one step at 94°C for 60 s, followed by 10 cycles of denaturation at 94°C for 30 s, annealing at 35°C for 30 s and extension at 72°C for 30 s. The last cycle was followed by an extension step at 72°C for 2 min. PCR amplification reactions were performed in 1× ThermoPol polymerase buffer (NEB) containing 200 μM dNTPs, 0.5 μM each of primers P1 and P2, 5 μl of extension reaction product and 0.02 U/μl of Taq DNA polymerase. .. PCR conditions were: one step at 94°C for 60 s, followed by 28 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 30 s and extension at 72°C for 30 s. The last cycle was followed by an extension step at 72°C for 2 min.

    Article Title: Investigating the transmissibility of tet(W) in bifidobacteria exposed to acid and bile stress
    Article Snippet: The 25 µl reaction mixture contained 2.5 µl of 10x PCR buffer including 20 mM MgCl2 (B9004S, New England Biolabs, Hertfordshire, UK), 4 µl of 1.25 mM dNTP mix (N0447, New England Biolabs), 0.1 µl of 5U Taq DNA polymerase (M0267X, New England Biolabs), 1 µl each of 10 pmol/µl forward and reverse primer ( ), 15.4 µl of sterile Milli-Q water, and 1 µl of DNA template. .. The 25 µl reaction mixture contained 2.5 µl of 10x PCR buffer including 20 mM MgCl2 (B9004S, New England Biolabs, Hertfordshire, UK), 4 µl of 1.25 mM dNTP mix (N0447, New England Biolabs), 0.1 µl of 5U Taq DNA polymerase (M0267X, New England Biolabs), 1 µl each of 10 pmol/µl forward and reverse primer ( ), 15.4 µl of sterile Milli-Q water, and 1 µl of DNA template.

    Article Title: Extended Synaptotagmin 1 Interacts with Herpes Simplex Virus 1 Glycoprotein M and Negatively Modulates Virus-Induced Membrane Fusion
    Article Snippet: Paragraph title: RNA isolation and RT-PCR amplification. ... The resulting cDNAs were subjected to PCR assay using Taq DNA polymerase and ThermoPol buffer (M0267; New England BioLabs, Ipswich, MA, USA) in a total volume of 50 μl.

    Article Title: Pyrroloquinoline Quinone Biosynthesis Gene pqqC, a Novel Molecular Marker for Studying the Phylogeny and Diversity of Phosphate-Solubilizing Pseudomonads
    Article Snippet: PCR amplifications of pqqC from bacterial DNA lysates were carried out in 20-μl mixtures containing 1× ThermoPol buffer (New England BioLabs, Inc., Beverly, MA), 100 μM (each) deoxynucleoside triphosphate (dNTP), 0.4 μM (each) forward and reverse primer, 0.75 U Taq DNA polymerase (5,000 U/ml; New England BioLabs, Inc.), and 2 μl of genomic DNA. .. The following thermocycling conditions were used: initial denaturation at 96°C for 10 min followed by 30 cycles of 96°C for 30 s, 63°C for 30 s, 72°C for 1 min, and final elongation at 72°C for 10 min. For pqqC amplification from roots, 20 ng total DNA extracts, 5% dimethyl sulfoxide (Sigma-Aldrich, St. Louis, MO), and 5% bovine serum albumin were added to the PCR mix, and thermocycling conditions were slightly modified from those described above, i.e., 35 cycles instead of 30, denaturing and annealing times of 1 min, and an elongation time of 2 min per cycle.

    Article Title: Strong Seasonality and Interannual Recurrence in Marine Myovirus Communities
    Article Snippet: Each PCR mixture (final volume, 50 μl) contained 2 ng DNA, 1× ThermoPol buffer (including 20 mM MgSO4 ; NEB), an additional 1.75 mM MgCl2 (final concentration, 3.75 mM), 0.25 mM each deoxynucleoside triphosphate (dNTP), 400 nM each primer, 10 μg bovine serum albumin (BSA) (Sigma; number 7030), and 5 units Taq DNA polymerase (NEB). .. Each PCR mixture (final volume, 50 μl) contained 2 ng DNA, 1× ThermoPol buffer (including 20 mM MgSO4 ; NEB), an additional 1.75 mM MgCl2 (final concentration, 3.75 mM), 0.25 mM each deoxynucleoside triphosphate (dNTP), 400 nM each primer, 10 μg bovine serum albumin (BSA) (Sigma; number 7030), and 5 units Taq DNA polymerase (NEB).

    Article Title: Genomic characterization of patient-derived xenograft models established from fine needle aspirate biopsies of a primary pancreatic ductal adenocarcinoma and from patient-matched metastatic sites
    Article Snippet: DNA extraction was performed in lysis buffer (0.45% Nonidet P40 [Roche, Nutley, NJ, USA], 1X ThermoPol Taq buffer (New England Biolabs, Ipwich, MA, USA), and 100 μg/mL proteinase K [Roche]) at 55°C. .. The thermocycler protocol was as follows: 1. (94°C, 2 minutes), 2. (94°C, 15 seconds), 3. (58°C (CHEK1 ) or 52°C (KRAS ), 30 seconds), 4. (72°C, 1 minute, 5. (72°C, 10 minutes), with steps 2-4 repeated for 30-40 cycles.

    Article Title: The Skin Microbiome of Cohabiting Couples
    Article Snippet: Two rounds of amplification did not result in a difference in community composition according to a preliminary subset of four samples that were sequenced using both protocols with one round and two rounds of amplification (data not shown). .. The first PCR amplification mix contained 2.5 μl of 10× ThermoPol Taq buffer (New England Biolabs), 1.5 μl of 10 mg ml−1 bovine serum albumin (BSA), 0.05 μl of 100 mM total deoxynucleoside triphosphates (dNTPs) (New England Biolabs), 0.05 μl of each 100 μM forward and reverse primer (Integrated DNA Technologies), 0.125 μl of 5 U μl−1 Taq polymerase (New England Biolabs), 1 to 10 ng of template DNA (3 μl for the majority of samples), and nuclease-free PCR-grade H2 O to a 25-μl total reaction volume. .. The reaction was run on either the T100 thermal cycler (Bio-Rad) or the C1000 thermal cycler (Bio-Rad) at 95°C for 30 s (initial denaturation) and 25 cycles, with 1 cycle consisting of 95°C for 15 s (denaturation), 55°C for 30 s (annealing), 68°C for 60 s (extension), and a final extension of 68°C for 10 min.

    Positive Control:

    Article Title: Emergence of a Competence-Reducing Filamentous Phage from the Genome of Acinetobacter baylyi ADP1
    Article Snippet: PCRs across the junctions of the genomically located prophage were conducted in parallel to serve as a positive control. .. PCRs were conducted with Taq polymerase in ThermoPol buffer (New England BioLabs) under standard conditions with purified genomic DNA as the template.

    Synthesized:

    Article Title: Spliced Leader Trapping Reveals Widespread Alternative Splicing Patterns in the Highly Dynamic Transcriptome of Trypanosoma brucei
    Article Snippet: First strand cDNA was synthesized from poly(A) RNA using random hexamers and Superscript II reverse transcriptase (Invitrogen, USA) in a final volume of 20 µl for 1 hour at 42°C. .. Second strand synthesis was done using 2 µl 10× Thermopol buffer (New England BioLabs), 1 µl dNTPs 10 mM, 1 µl 2nd strand primer 10 µM ([BIOT] 5′- AATGATACGGCGACCACCGAGATCTACAGTTTCTGTACTATATTG -3′ ), 2 units Taq polymerase (New England BioLabs, USA) and 4.5 µl H2 O by incubation for 5 minut es at 50°C and then 5 minutes at 72°C.

    Article Title: Cellular localization of relaxin‐like gonad‐stimulating peptide expression in Asterias rubens: New insights into neurohormonal control of spawning in starfish
    Article Snippet: First, a routine PCR was performed using Taq DNA polymerase (Taq DNA Polymerase with Thermopol Buffer, New England Biolabs) and standard M13 primers (Forward: 5′‐GTAAAACGACGGCCAGTG‐3′, Reverse: 5′‐GGAAACAGCTATGACCATG‐3′, custom‐synthesized by Sigma‐Aldrich) to linearize the plasmid and amplify the insert. .. The PCR product, which included the AruRGP precursor cDNA sequence and T3 and T7 RNA polymerase sites, was purified using a QIAquick gel extraction kit (Qiagen).

    Article Title: Extended Synaptotagmin 1 Interacts with Herpes Simplex Virus 1 Glycoprotein M and Negatively Modulates Virus-Induced Membrane Fusion
    Article Snippet: First, total RNA was extracted from HeLa cells using the SV Total RNA isolation system (Promega Corporation, Madison, WI, USA) according to the manufacturer's instructions. cDNAs were next synthesized using 2 μg of RNA with a high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA) following the manufacture's protocol. .. The resulting cDNAs were subjected to PCR assay using Taq DNA polymerase and ThermoPol buffer (M0267; New England BioLabs, Ipswich, MA, USA) in a total volume of 50 μl.

    Terminal Restriction Fragment Length Polymorphism:

    Article Title: Short-term observations of marine bacterial and viral communities: patterns, connections and resilience
    Article Snippet: Upon thawing, bacterial and viral DNA in the extract was quantified with PicoGreen (Invitrogen, Carlsbad, CA, USA) and diluted to 2 ng μl−1 and 2.5 ng μl−1 , respectively, for analysis by automated ribosomal intergenic spacer analysis (ARISA) and TRFLP. .. Fifty microliter ARISA PCR reactions contained 2 ng of bacterial DNA extract, 1 × Thermopol PCR Buffer (New England Biolabs, NEB, Ipswich, MA, USA), 10 μℳ dNTPs (Promega, Madison, WI, USA), 20 ng μl−1 BSA (Sigma-Aldrich, Catalog Number: A7030, St Louis, MO, USA), 5 U Thermopol Taq polymerase (NEB).

    Article Title: Strong Seasonality and Interannual Recurrence in Marine Myovirus Communities
    Article Snippet: T4-like virus communities were assayed by TRFLP of the major capsid protein gene, as described by Chow and Fuhrman ( ). .. Each PCR mixture (final volume, 50 μl) contained 2 ng DNA, 1× ThermoPol buffer (including 20 mM MgSO4 ; NEB), an additional 1.75 mM MgCl2 (final concentration, 3.75 mM), 0.25 mM each deoxynucleoside triphosphate (dNTP), 400 nM each primer, 10 μg bovine serum albumin (BSA) (Sigma; number 7030), and 5 units Taq DNA polymerase (NEB).

    Electrophoresis:

    Article Title: Mitochondrial DNA Sequence and Lack of Response to Anoxia in the Annual Killifish Austrofundulus limnaeus
    Article Snippet: PCR reactions (50 μl total volume) consisted of 50 ng total DNA, 10 pmol of forward and reverse primers (Table , Integrated DNA Technologies, Coralville, IA, USA), 0.25 U Taq polymerase (New England BioLabs, Ipswich, MA, USA #M0267L), in 1X ThermoPol buffer (New England BioLabs # M0267L). .. PCR reactions (50 μl total volume) consisted of 50 ng total DNA, 10 pmol of forward and reverse primers (Table , Integrated DNA Technologies, Coralville, IA, USA), 0.25 U Taq polymerase (New England BioLabs, Ipswich, MA, USA #M0267L), in 1X ThermoPol buffer (New England BioLabs # M0267L).

    IA:

    Article Title: Mitochondrial DNA Sequence and Lack of Response to Anoxia in the Annual Killifish Austrofundulus limnaeus
    Article Snippet: PCR products were generated using total DNA from adult liver as the DNA template. .. PCR reactions (50 μl total volume) consisted of 50 ng total DNA, 10 pmol of forward and reverse primers (Table , Integrated DNA Technologies, Coralville, IA, USA), 0.25 U Taq polymerase (New England BioLabs, Ipswich, MA, USA #M0267L), in 1X ThermoPol buffer (New England BioLabs # M0267L). .. A single final elongation step of 10 min at 68°C followed the initial 40 cycles.

    Incubation:

    Article Title: Spliced Leader Trapping Reveals Widespread Alternative Splicing Patterns in the Highly Dynamic Transcriptome of Trypanosoma brucei
    Article Snippet: Half of the first strand mix was used for second strand synthesis (10 µl 1st strand mix, 1 µl RNaseH, 15 minutes at 37°C). .. Second strand synthesis was done using 2 µl 10× Thermopol buffer (New England BioLabs), 1 µl dNTPs 10 mM, 1 µl 2nd strand primer 10 µM ([BIOT] 5′- AATGATACGGCGACCACCGAGATCTACAGTTTCTGTACTATATTG -3′ ), 2 units Taq polymerase (New England BioLabs, USA) and 4.5 µl H2 O by incubation for 5 minut es at 50°C and then 5 minutes at 72°C. .. The cDNA was purified on a Qiagen MinElute column (Qiagen, USA) and eluted in 10ul TE buffer.

    Article Title: High-throughput single-molecule telomere characterization
    Article Snippet: The DNA (300 ng) and 5 U of Nt.BspQI (NEB) were added to the mixture and incubated at 37°C for 60 min. .. The nicks were repaired with 20 kU of Taq DNA Ligase (NEB), 1 mM NAD+ (NEB), 100 nM dNTPs , and 1× Thermopol buffer (NEB) at 37°C for 30 min.

    Article Title: Differential effect of CLK SR Kinases on HIV-1 gene expression: potential novel targets for therapy
    Article Snippet: Cells were harvested by incubation in 2 mM EDTA-PBS for 15 minutes at 37°C and pelleted cells used in RNA purification or protein analysis. .. Each reaction was set-up as follows: 0.4 μL of Taq DNA polymerase (5 U/μL, NEB, Cat. #M0267L), 2.5 μL of ThermolPol buffer, 2.5 μL of 10X SYBR Green I (Sigma-Aldrich, Cat. #S9430), 2.5 μL of 2.5 mM dNTPs, 1.0 μL of 5' primer (0.1 ug/uL), and 1.0 μL of 3' primer (0.1 μg/μL), 10.1 μL H2 O, and 5 μL of cDNA.

    Modification:

    Article Title: On the road to diploidization? Homoeolog loss in independently formed populations of the allopolyploid Tragopogon miscellus (Asteraceae)
    Article Snippet: Leaf material was harvested from seedlings and DNA extracted following a modified CTAB protocol [ ]. .. Genomic amplifications were conducted in a 25 μL volume with 50 ng template, 10× Thermopol buffer (New England Biolabs, Ipswich, MA, USA), 0.4 mM dNTPs, 0.2 μM each primer, and 0.5 unit Taq polymerase (New England Biolabs).

    Article Title: The Skin Microbiome of Cohabiting Couples
    Article Snippet: The primers were modified to include adapters for binding the flow cell (Illumina), a 6-base barcode for multiplexing, and complementary forward and reverse regions required for Illumina primers, as described previously ( ). .. The first PCR amplification mix contained 2.5 μl of 10× ThermoPol Taq buffer (New England Biolabs), 1.5 μl of 10 mg ml−1 bovine serum albumin (BSA), 0.05 μl of 100 mM total deoxynucleoside triphosphates (dNTPs) (New England Biolabs), 0.05 μl of each 100 μM forward and reverse primer (Integrated DNA Technologies), 0.125 μl of 5 U μl−1 Taq polymerase (New England Biolabs), 1 to 10 ng of template DNA (3 μl for the majority of samples), and nuclease-free PCR-grade H2 O to a 25-μl total reaction volume.

    Transformation Assay:

    Article Title: Mitochondrial DNA Sequence and Lack of Response to Anoxia in the Annual Killifish Austrofundulus limnaeus
    Article Snippet: PCR reactions (50 μl total volume) consisted of 50 ng total DNA, 10 pmol of forward and reverse primers (Table , Integrated DNA Technologies, Coralville, IA, USA), 0.25 U Taq polymerase (New England BioLabs, Ipswich, MA, USA #M0267L), in 1X ThermoPol buffer (New England BioLabs # M0267L). .. PCR products were then excised and cloned into the pGEM-T vector or sequenced directly (Table ).

    Derivative Assay:

    Article Title: On the road to diploidization? Homoeolog loss in independently formed populations of the allopolyploid Tragopogon miscellus (Asteraceae)
    Article Snippet: The cry1 sequence originated from an EST library of T. dubius (Tdu01-6MS1_D11.e), and the TDF27.10 (TDF stands for transcript-derived fragment) sequence was derived from a previous cDNA-AFLP study [ ]. .. Genomic amplifications were conducted in a 25 μL volume with 50 ng template, 10× Thermopol buffer (New England Biolabs, Ipswich, MA, USA), 0.4 mM dNTPs, 0.2 μM each primer, and 0.5 unit Taq polymerase (New England Biolabs).

    Flow Cytometry:

    Article Title: The Skin Microbiome of Cohabiting Couples
    Article Snippet: The primers were modified to include adapters for binding the flow cell (Illumina), a 6-base barcode for multiplexing, and complementary forward and reverse regions required for Illumina primers, as described previously ( ). .. The first PCR amplification mix contained 2.5 μl of 10× ThermoPol Taq buffer (New England Biolabs), 1.5 μl of 10 mg ml−1 bovine serum albumin (BSA), 0.05 μl of 100 mM total deoxynucleoside triphosphates (dNTPs) (New England Biolabs), 0.05 μl of each 100 μM forward and reverse primer (Integrated DNA Technologies), 0.125 μl of 5 U μl−1 Taq polymerase (New England Biolabs), 1 to 10 ng of template DNA (3 μl for the majority of samples), and nuclease-free PCR-grade H2 O to a 25-μl total reaction volume.

    Ligation:

    Article Title: Spliced Leader Trapping Reveals Widespread Alternative Splicing Patterns in the Highly Dynamic Transcriptome of Trypanosoma brucei
    Article Snippet: Second strand synthesis was done using 2 µl 10× Thermopol buffer (New England BioLabs), 1 µl dNTPs 10 mM, 1 µl 2nd strand primer 10 µM ([BIOT] 5′- AATGATACGGCGACCACCGAGATCTACAGTTTCTGTACTATATTG -3′ ), 2 units Taq polymerase (New England BioLabs, USA) and 4.5 µl H2 O by incubation for 5 minut es at 50°C and then 5 minutes at 72°C. .. Second strand synthesis was done using 2 µl 10× Thermopol buffer (New England BioLabs), 1 µl dNTPs 10 mM, 1 µl 2nd strand primer 10 µM ([BIOT] 5′- AATGATACGGCGACCACCGAGATCTACAGTTTCTGTACTATATTG -3′ ), 2 units Taq polymerase (New England BioLabs, USA) and 4.5 µl H2 O by incubation for 5 minut es at 50°C and then 5 minutes at 72°C.

    Cell Culture:

    Article Title: Genomic characterization of patient-derived xenograft models established from fine needle aspirate biopsies of a primary pancreatic ductal adenocarcinoma and from patient-matched metastatic sites
    Article Snippet: Tumor explants were cultured on poly-D-lysine coated coverslips (Neuvitro Corporation) and allowed to adhere overnight. .. DNA extraction was performed in lysis buffer (0.45% Nonidet P40 [Roche, Nutley, NJ, USA], 1X ThermoPol Taq buffer (New England Biolabs, Ipwich, MA, USA), and 100 μg/mL proteinase K [Roche]) at 55°C.

    Generated:

    Article Title: Mitochondrial DNA Sequence and Lack of Response to Anoxia in the Annual Killifish Austrofundulus limnaeus
    Article Snippet: PCR products were generated using total DNA from adult liver as the DNA template. .. PCR reactions (50 μl total volume) consisted of 50 ng total DNA, 10 pmol of forward and reverse primers (Table , Integrated DNA Technologies, Coralville, IA, USA), 0.25 U Taq polymerase (New England BioLabs, Ipswich, MA, USA #M0267L), in 1X ThermoPol buffer (New England BioLabs # M0267L).

    Polymerase Chain Reaction:

    Article Title: Labeling of unique sequences in double-stranded DNA at sites of vicinal nicks generated by nicking endonucleases
    Article Snippet: Assembly PCR was performed by conducting first extension reactions with hybridized, overlapping oligonucleotides in the absence of primers, followed by PCR amplification in the presence of primers. .. Extension reactions were performed in 1 × Pfu reaction buffer (Stratagene) containing 20 nM of oligonucleotides A-D (see Supplementary Table 1 for sequences), 200 μM dNTPs and 0.025 U/μl of cloned Pfu DNA polymerase (Stratagene) at the following conditions: one step at 94°C for 60 s, followed by 10 cycles of denaturation at 94°C for 30 s, annealing at 35°C for 30 s and extension at 72°C for 30 s. The last cycle was followed by an extension step at 72°C for 2 min. PCR amplification reactions were performed in 1× ThermoPol polymerase buffer (NEB) containing 200 μM dNTPs, 0.5 μM each of primers P1 and P2, 5 μl of extension reaction product and 0.02 U/μl of Taq DNA polymerase. .. PCR conditions were: one step at 94°C for 60 s, followed by 28 cycles of denaturation at 94°C for 30 s, annealing at 53°C for 30 s and extension at 72°C for 30 s. The last cycle was followed by an extension step at 72°C for 2 min.

    Article Title: No association between HPV positive breast cancer and expression of human papilloma viral transcripts
    Article Snippet: Paragraph title: PCR analysis ... For S100A8 and MY09/MY11 primer sets Taq Polymerase with Thermopol Buffer (New England Biolabs) was used.

    Article Title: Mitochondrial DNA Sequence and Lack of Response to Anoxia in the Annual Killifish Austrofundulus limnaeus
    Article Snippet: PCR products were generated using total DNA from adult liver as the DNA template. .. PCR reactions (50 μl total volume) consisted of 50 ng total DNA, 10 pmol of forward and reverse primers (Table , Integrated DNA Technologies, Coralville, IA, USA), 0.25 U Taq polymerase (New England BioLabs, Ipswich, MA, USA #M0267L), in 1X ThermoPol buffer (New England BioLabs # M0267L). .. A single final elongation step of 10 min at 68°C followed the initial 40 cycles.

    Article Title: Cellular localization of relaxin‐like gonad‐stimulating peptide expression in Asterias rubens: New insights into neurohormonal control of spawning in starfish
    Article Snippet: A pBluescript SKII (+) vector containing the cloned and sequenced AruRGP precursor cDNA was used to synthesize RNA probes. .. First, a routine PCR was performed using Taq DNA polymerase (Taq DNA Polymerase with Thermopol Buffer, New England Biolabs) and standard M13 primers (Forward: 5′‐GTAAAACGACGGCCAGTG‐3′, Reverse: 5′‐GGAAACAGCTATGACCATG‐3′, custom‐synthesized by Sigma‐Aldrich) to linearize the plasmid and amplify the insert. .. The PCR product, which included the AruRGP precursor cDNA sequence and T3 and T7 RNA polymerase sites, was purified using a QIAquick gel extraction kit (Qiagen).

    Article Title: Investigating the transmissibility of tet(W) in bifidobacteria exposed to acid and bile stress
    Article Snippet: Extraction of genomic DNA was carried out using InstaGene Matrix (7326030, Bio-Rad, Hertfordshire, UK) according to the manufacturer’s instructions. .. The 25 µl reaction mixture contained 2.5 µl of 10x PCR buffer including 20 mM MgCl2 (B9004S, New England Biolabs, Hertfordshire, UK), 4 µl of 1.25 mM dNTP mix (N0447, New England Biolabs), 0.1 µl of 5U Taq DNA polymerase (M0267X, New England Biolabs), 1 µl each of 10 pmol/µl forward and reverse primer ( ), 15.4 µl of sterile Milli-Q water, and 1 µl of DNA template. .. PCR amplification was carried out in an Eppendorf Master Cycler (22331, Eppendorf, Germany) using the following temperature program: initial denaturation (1 min, 94°C) followed by 35 cycles of denaturation (1 min, 94°C), annealing (1 min, 55°C), and elongation (1 min, 72°C) and then final extension (7 min, 72°C).

    Article Title: Extended Synaptotagmin 1 Interacts with Herpes Simplex Virus 1 Glycoprotein M and Negatively Modulates Virus-Induced Membrane Fusion
    Article Snippet: First, total RNA was extracted from HeLa cells using the SV Total RNA isolation system (Promega Corporation, Madison, WI, USA) according to the manufacturer's instructions. cDNAs were next synthesized using 2 μg of RNA with a high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA) following the manufacture's protocol. .. The resulting cDNAs were subjected to PCR assay using Taq DNA polymerase and ThermoPol buffer (M0267; New England BioLabs, Ipswich, MA, USA) in a total volume of 50 μl. .. The following primers were used: E-Syt1 forward primer, 5′-GGGGCTGTGTCAATGTTCTT-3′; E-Syt1 reverse primer, 5′-TCCTTCACTTGCACATCGAG-3′; E-Syt2 forward primer, 5′-GAACCTGTGTGGGAGGAAAA-3′; E-Syt2 reverse primer, 5′-GCCTTTGGCAAGTTCTTCAG-3′; E-Syt3 forward primer, 5′-AGACCTGTCCCCACAACAAG-3′; and E-Syt3 reverse primer, 5′-TAGGGATCAGCTCCACTGCT-3′.

    Article Title: Pyrroloquinoline Quinone Biosynthesis Gene pqqC, a Novel Molecular Marker for Studying the Phylogeny and Diversity of Phosphate-Solubilizing Pseudomonads
    Article Snippet: For phylogenetic analyses, a subset of 36 Pseudomonas reference strains were used as described below. .. PCR amplifications of pqqC from bacterial DNA lysates were carried out in 20-μl mixtures containing 1× ThermoPol buffer (New England BioLabs, Inc., Beverly, MA), 100 μM (each) deoxynucleoside triphosphate (dNTP), 0.4 μM (each) forward and reverse primer, 0.75 U Taq DNA polymerase (5,000 U/ml; New England BioLabs, Inc.), and 2 μl of genomic DNA. .. The following thermocycling conditions were used: initial denaturation at 96°C for 10 min followed by 30 cycles of 96°C for 30 s, 63°C for 30 s, 72°C for 1 min, and final elongation at 72°C for 10 min. For pqqC amplification from roots, 20 ng total DNA extracts, 5% dimethyl sulfoxide (Sigma-Aldrich, St. Louis, MO), and 5% bovine serum albumin were added to the PCR mix, and thermocycling conditions were slightly modified from those described above, i.e., 35 cycles instead of 30, denaturing and annealing times of 1 min, and an elongation time of 2 min per cycle.

    Article Title: A Quick, No Frills Approach to Mouse Genotyping
    Article Snippet: .. NaOH (NaOH pellets) Taq DNA Polymerase with ThermoPol buffer (New England Biolabs, catalog number: M0267X*, M0267L, or M0267S) * Note: At 4,000 U, ~800 μl of Taq serves several thousand PCR reactions. .. ThermoPol buffer recipe is available at NEB website.

    Article Title: Short-term observations of marine bacterial and viral communities: patterns, connections and resilience
    Article Snippet: Upon thawing, bacterial and viral DNA in the extract was quantified with PicoGreen (Invitrogen, Carlsbad, CA, USA) and diluted to 2 ng μl−1 and 2.5 ng μl−1 , respectively, for analysis by automated ribosomal intergenic spacer analysis (ARISA) and TRFLP. .. Fifty microliter ARISA PCR reactions contained 2 ng of bacterial DNA extract, 1 × Thermopol PCR Buffer (New England Biolabs, NEB, Ipswich, MA, USA), 10 μℳ dNTPs (Promega, Madison, WI, USA), 20 ng μl−1 BSA (Sigma-Aldrich, Catalog Number: A7030, St Louis, MO, USA), 5 U Thermopol Taq polymerase (NEB). .. Primer concentrations, sequences and thermocycling for ARISA proceeded as described elsewhere ( ) except we used a 3-minute initial denaturation and 31 cycles of amplification. g23-TRFLP is described elsewhere ( ); only modifications are mentioned here.

    Article Title: Strong Seasonality and Interannual Recurrence in Marine Myovirus Communities
    Article Snippet: Briefly, the g23 PCR primers used here were T4superF1, 5′-GAY HTI KSI GGI GTI CAR CCI ATG-3′, and T4superR1, 5′-GC IYK IAR RTC YTG IGC IAR YTC-3′. .. Each PCR mixture (final volume, 50 μl) contained 2 ng DNA, 1× ThermoPol buffer (including 20 mM MgSO4 ; NEB), an additional 1.75 mM MgCl2 (final concentration, 3.75 mM), 0.25 mM each deoxynucleoside triphosphate (dNTP), 400 nM each primer, 10 μg bovine serum albumin (BSA) (Sigma; number 7030), and 5 units Taq DNA polymerase (NEB). .. The cycling parameters were 95°C for 5 min and 35 cycles of 95°C for 30 s, 54°C for 30 s, and 72°C for 30 s, with a final extension at 72°C for 9.5 min.

    Article Title: Genome-Scale Analysis of Replication Timing: from Bench to Bioinformatics
    Article Snippet: Anti-Mouse IgG-AlexaFluor488 (Invitrogen/Molecular Probes, Cat#A-11029) Store at 4 °C. .. Taq DNA Polymerase with ThermoPol Buffer (New England BioLabs, M0267) 10 μM dNTPs (Bioline, BIO-39025) 10 mg/ml Ethidium Bromide (Fisher, BP102-5) Agarose (OmniPur, 2125) PCR primers for BrdU-IP quality verification (steps 45–49), see 0.1M HCl/0.5% (vol/vol) Triton X-100(Sigma T9284) in ddH2 O. .. Store at room temperature 0.1M Sodium Tetraborate, (Na2 B4 O7 10H2 O)(Sigma S-9640), pH 8.5 in ddH2 O 0.5% (vol/vol) Tween20 (Sigma P-1379)/1% (wt/vol) BSA(Fisher Scientific BP1600-1) in PBS 0.1% (vol/vol) Triton X-100(Sigma T9284) in PBS 0.5% (vol/vol) Triton X-100(Sigma T9284) in PBS BSA (Fisher Scientific BP1600-1) GenomePlex Complete Whole Genome Amplification Kit (Sigma WGA2) GenomePlex WGA Reamplification Kit (Sigma WGA3) QIAquick PCR Purification Kit (QIAGEN 28106) NimbleGen Dual-Color DNA Labeling Kit (cat. no. 05223547001) NimbleGen Hybridization Kit (cat. no. 05583683001) NimbleGen Wash Buffer Kit (cat. no. 05584507001)

    Article Title: On the road to diploidization? Homoeolog loss in independently formed populations of the allopolyploid Tragopogon miscellus (Asteraceae)
    Article Snippet: Genomic amplifications were conducted in a 25 μL volume with 50 ng template, 10× Thermopol buffer (New England Biolabs, Ipswich, MA, USA), 0.4 mM dNTPs, 0.2 μM each primer, and 0.5 unit Taq polymerase (New England Biolabs). .. Products were separated on a 1.5% agarose gel, stained with ethidium bromide, and visualized by UV on a transilluminator.

    Article Title: Genomic characterization of patient-derived xenograft models established from fine needle aspirate biopsies of a primary pancreatic ductal adenocarcinoma and from patient-matched metastatic sites
    Article Snippet: [ ] PCR was performed using primers directed towards mouse Chek1 , human CHK1 (introns 3 and 6) and human KRAS . .. DNA extraction was performed in lysis buffer (0.45% Nonidet P40 [Roche, Nutley, NJ, USA], 1X ThermoPol Taq buffer (New England Biolabs, Ipwich, MA, USA), and 100 μg/mL proteinase K [Roche]) at 55°C.

    Article Title: The Skin Microbiome of Cohabiting Couples
    Article Snippet: Two rounds of amplification did not result in a difference in community composition according to a preliminary subset of four samples that were sequenced using both protocols with one round and two rounds of amplification (data not shown). .. The first PCR amplification mix contained 2.5 μl of 10× ThermoPol Taq buffer (New England Biolabs), 1.5 μl of 10 mg ml−1 bovine serum albumin (BSA), 0.05 μl of 100 mM total deoxynucleoside triphosphates (dNTPs) (New England Biolabs), 0.05 μl of each 100 μM forward and reverse primer (Integrated DNA Technologies), 0.125 μl of 5 U μl−1 Taq polymerase (New England Biolabs), 1 to 10 ng of template DNA (3 μl for the majority of samples), and nuclease-free PCR-grade H2 O to a 25-μl total reaction volume. .. The reaction was run on either the T100 thermal cycler (Bio-Rad) or the C1000 thermal cycler (Bio-Rad) at 95°C for 30 s (initial denaturation) and 25 cycles, with 1 cycle consisting of 95°C for 15 s (denaturation), 55°C for 30 s (annealing), 68°C for 60 s (extension), and a final extension of 68°C for 10 min.

    cDNA-AFLP Assay:

    Article Title: On the road to diploidization? Homoeolog loss in independently formed populations of the allopolyploid Tragopogon miscellus (Asteraceae)
    Article Snippet: The cry1 sequence originated from an EST library of T. dubius (Tdu01-6MS1_D11.e), and the TDF27.10 (TDF stands for transcript-derived fragment) sequence was derived from a previous cDNA-AFLP study [ ]. .. Genomic amplifications were conducted in a 25 μL volume with 50 ng template, 10× Thermopol buffer (New England Biolabs, Ipswich, MA, USA), 0.4 mM dNTPs, 0.2 μM each primer, and 0.5 unit Taq polymerase (New England Biolabs).

    Sequencing:

    Article Title: Mitochondrial DNA Sequence and Lack of Response to Anoxia in the Annual Killifish Austrofundulus limnaeus
    Article Snippet: Paragraph title: Sanger sequencing ... PCR reactions (50 μl total volume) consisted of 50 ng total DNA, 10 pmol of forward and reverse primers (Table , Integrated DNA Technologies, Coralville, IA, USA), 0.25 U Taq polymerase (New England BioLabs, Ipswich, MA, USA #M0267L), in 1X ThermoPol buffer (New England BioLabs # M0267L).

    Article Title: A New Clade of Insect-Specific Flaviviruses from Australian Anopheles Mosquitoes Displays Species-Specific Host Restriction
    Article Snippet: The gDNA extracts were used in PCRs with the ITS2 primers as quality control and subsequently tested for integrated virus sequence with a range of primers based on KRBV NS4 and NS5 sequences. .. PCRs were performed with Taq DNA polymerase and Thermopol buffer (New England Biolabs) in accordance with the manufacturer’s protocol.

    Article Title: Emergence of a Competence-Reducing Filamentous Phage from the Genome of Acinetobacter baylyi ADP1
    Article Snippet: Primers used for detecting active phage DNA and for sequencing specific CRAϕ regions are provided in Table S1 in the supplemental material. .. PCRs were conducted with Taq polymerase in ThermoPol buffer (New England BioLabs) under standard conditions with purified genomic DNA as the template.

    Article Title: On the road to diploidization? Homoeolog loss in independently formed populations of the allopolyploid Tragopogon miscellus (Asteraceae)
    Article Snippet: These primers were used to amplify genomic DNA from T. dubius and T. pratensis with the aim of identifying sequence polymorphisms that could distinguish the homoeologs in T. miscellus . .. Genomic amplifications were conducted in a 25 μL volume with 50 ng template, 10× Thermopol buffer (New England Biolabs, Ipswich, MA, USA), 0.4 mM dNTPs, 0.2 μM each primer, and 0.5 unit Taq polymerase (New England Biolabs).

    Article Title: Genomic characterization of patient-derived xenograft models established from fine needle aspirate biopsies of a primary pancreatic ductal adenocarcinoma and from patient-matched metastatic sites
    Article Snippet: DNA extraction was performed in lysis buffer (0.45% Nonidet P40 [Roche, Nutley, NJ, USA], 1X ThermoPol Taq buffer (New England Biolabs, Ipwich, MA, USA), and 100 μg/mL proteinase K [Roche]) at 55°C. .. Amplified DNA and a 100 kb ladder was run on a 1.5% TBE-agar gel with ethidium bromide for 40 minutes at 100 V and visualized with UV light.

    Binding Assay:

    Article Title: A New Clade of Insect-Specific Flaviviruses from Australian Anopheles Mosquitoes Displays Species-Specific Host Restriction
    Article Snippet: Six primer sets were used in 12 combinations to prevent false-negative results due to potential introns in the primer binding regions ( ). .. PCRs were performed with Taq DNA polymerase and Thermopol buffer (New England Biolabs) in accordance with the manufacturer’s protocol.

    Article Title: The Skin Microbiome of Cohabiting Couples
    Article Snippet: The primers were modified to include adapters for binding the flow cell (Illumina), a 6-base barcode for multiplexing, and complementary forward and reverse regions required for Illumina primers, as described previously ( ). .. The first PCR amplification mix contained 2.5 μl of 10× ThermoPol Taq buffer (New England Biolabs), 1.5 μl of 10 mg ml−1 bovine serum albumin (BSA), 0.05 μl of 100 mM total deoxynucleoside triphosphates (dNTPs) (New England Biolabs), 0.05 μl of each 100 μM forward and reverse primer (Integrated DNA Technologies), 0.125 μl of 5 U μl−1 Taq polymerase (New England Biolabs), 1 to 10 ng of template DNA (3 μl for the majority of samples), and nuclease-free PCR-grade H2 O to a 25-μl total reaction volume.

    Multiplexing:

    Article Title: The Skin Microbiome of Cohabiting Couples
    Article Snippet: The primers were modified to include adapters for binding the flow cell (Illumina), a 6-base barcode for multiplexing, and complementary forward and reverse regions required for Illumina primers, as described previously ( ). .. The first PCR amplification mix contained 2.5 μl of 10× ThermoPol Taq buffer (New England Biolabs), 1.5 μl of 10 mg ml−1 bovine serum albumin (BSA), 0.05 μl of 100 mM total deoxynucleoside triphosphates (dNTPs) (New England Biolabs), 0.05 μl of each 100 μM forward and reverse primer (Integrated DNA Technologies), 0.125 μl of 5 U μl−1 Taq polymerase (New England Biolabs), 1 to 10 ng of template DNA (3 μl for the majority of samples), and nuclease-free PCR-grade H2 O to a 25-μl total reaction volume.

    Nucleic Acid Electrophoresis:

    Article Title: Pyrroloquinoline Quinone Biosynthesis Gene pqqC, a Novel Molecular Marker for Studying the Phylogeny and Diversity of Phosphate-Solubilizing Pseudomonads
    Article Snippet: PCR amplifications of pqqC from bacterial DNA lysates were carried out in 20-μl mixtures containing 1× ThermoPol buffer (New England BioLabs, Inc., Beverly, MA), 100 μM (each) deoxynucleoside triphosphate (dNTP), 0.4 μM (each) forward and reverse primer, 0.75 U Taq DNA polymerase (5,000 U/ml; New England BioLabs, Inc.), and 2 μl of genomic DNA. .. The following thermocycling conditions were used: initial denaturation at 96°C for 10 min followed by 30 cycles of 96°C for 30 s, 63°C for 30 s, 72°C for 1 min, and final elongation at 72°C for 10 min. For pqqC amplification from roots, 20 ng total DNA extracts, 5% dimethyl sulfoxide (Sigma-Aldrich, St. Louis, MO), and 5% bovine serum albumin were added to the PCR mix, and thermocycling conditions were slightly modified from those described above, i.e., 35 cycles instead of 30, denaturing and annealing times of 1 min, and an elongation time of 2 min per cycle.

    Isolation:

    Article Title: Extended Synaptotagmin 1 Interacts with Herpes Simplex Virus 1 Glycoprotein M and Negatively Modulates Virus-Induced Membrane Fusion
    Article Snippet: Paragraph title: RNA isolation and RT-PCR amplification. ... The resulting cDNAs were subjected to PCR assay using Taq DNA polymerase and ThermoPol buffer (M0267; New England BioLabs, Ipswich, MA, USA) in a total volume of 50 μl.

    Size-exclusion Chromatography:

    Article Title: Investigating the transmissibility of tet(W) in bifidobacteria exposed to acid and bile stress
    Article Snippet: The 25 µl reaction mixture contained 2.5 µl of 10x PCR buffer including 20 mM MgCl2 (B9004S, New England Biolabs, Hertfordshire, UK), 4 µl of 1.25 mM dNTP mix (N0447, New England Biolabs), 0.1 µl of 5U Taq DNA polymerase (M0267X, New England Biolabs), 1 µl each of 10 pmol/µl forward and reverse primer ( ), 15.4 µl of sterile Milli-Q water, and 1 µl of DNA template. .. The 50 µl PCR assay mix contained 32.8 µl of sterile Milli-Q water, 1 µl of 1.25 mM dNTP mix (N0447, New England Biolabs), 5 µL of 10x PCR buffer including 20 mM MgCl2 (B9004S, New England Biolabs), 3 µl each of 10 pmol/µl forward and reverse primer , 0.2 µl of 5U Taq DNA polymerase (M0267X, New England Biolabs), and 5 µl of DNA template.

    Labeling:

    Article Title: High-throughput single-molecule telomere characterization
    Article Snippet: Paragraph title: The two-color labeling scheme ... The nicks were repaired with 20 kU of Taq DNA Ligase (NEB), 1 mM NAD+ (NEB), 100 nM dNTPs , and 1× Thermopol buffer (NEB) at 37°C for 30 min.

    Article Title: Genomic characterization of patient-derived xenograft models established from fine needle aspirate biopsies of a primary pancreatic ductal adenocarcinoma and from patient-matched metastatic sites
    Article Snippet: Cells of human origin were labeled using 1:200 rat anti-human HLA Class I ABC #SM2012P for one hour at RT (Acris Antibodies) and 1:100 goat anti-rat FITC for one hour at RT (Sigma-Aldrich, St. Louis, MO, USA) diluted in IF buffer. .. DNA extraction was performed in lysis buffer (0.45% Nonidet P40 [Roche, Nutley, NJ, USA], 1X ThermoPol Taq buffer (New England Biolabs, Ipwich, MA, USA), and 100 μg/mL proteinase K [Roche]) at 55°C.

    Purification:

    Article Title: Spliced Leader Trapping Reveals Widespread Alternative Splicing Patterns in the Highly Dynamic Transcriptome of Trypanosoma brucei
    Article Snippet: Poly(A) mRNA was purified from 7.5 µg total RNA using Dynabeads oligo-(dT) beads according to the manufacturer (Invitrogen, USA). .. Second strand synthesis was done using 2 µl 10× Thermopol buffer (New England BioLabs), 1 µl dNTPs 10 mM, 1 µl 2nd strand primer 10 µM ([BIOT] 5′- AATGATACGGCGACCACCGAGATCTACAGTTTCTGTACTATATTG -3′ ), 2 units Taq polymerase (New England BioLabs, USA) and 4.5 µl H2 O by incubation for 5 minut es at 50°C and then 5 minutes at 72°C.

    Article Title: Short-term observations of marine bacterial and viral communities: patterns, connections and resilience
    Article Snippet: Fifty microliter ARISA PCR reactions contained 2 ng of bacterial DNA extract, 1 × Thermopol PCR Buffer (New England Biolabs, NEB, Ipswich, MA, USA), 10 μℳ dNTPs (Promega, Madison, WI, USA), 20 ng μl−1 BSA (Sigma-Aldrich, Catalog Number: A7030, St Louis, MO, USA), 5 U Thermopol Taq polymerase (NEB). .. ARISA and digested TRFLP PCR products were cleaned and concentrated using Zymo DNA Clean and Concentrate -5 kit and then diluted to 5 and 7.5 ng μl−1 , respectively.

    Article Title: Emergence of a Competence-Reducing Filamentous Phage from the Genome of Acinetobacter baylyi ADP1
    Article Snippet: PCRs across the junctions of the genomically located prophage were conducted in parallel to serve as a positive control. .. PCRs were conducted with Taq polymerase in ThermoPol buffer (New England BioLabs) under standard conditions with purified genomic DNA as the template. .. Mutations in CRAϕ isolates were detected by Sanger sequencing of PCR products amplified from genomic DNA purified from evolved ADP1 cells.

    Article Title: Differential effect of CLK SR Kinases on HIV-1 gene expression: potential novel targets for therapy
    Article Snippet: Purified RNA was reverse transcribed using M-MLV (Invitrogen, Cat. #28025-013). cDNAs reactions (20 μl) were diluted to 150 μL and used in qRT-PCR analysis of HIV-1 mRNA levels using the standard curve method. .. Each reaction was set-up as follows: 0.4 μL of Taq DNA polymerase (5 U/μL, NEB, Cat. #M0267L), 2.5 μL of ThermolPol buffer, 2.5 μL of 10X SYBR Green I (Sigma-Aldrich, Cat. #S9430), 2.5 μL of 2.5 mM dNTPs, 1.0 μL of 5' primer (0.1 ug/uL), and 1.0 μL of 3' primer (0.1 μg/μL), 10.1 μL H2 O, and 5 μL of cDNA.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Extended Synaptotagmin 1 Interacts with Herpes Simplex Virus 1 Glycoprotein M and Negatively Modulates Virus-Induced Membrane Fusion
    Article Snippet: Paragraph title: RNA isolation and RT-PCR amplification. ... The resulting cDNAs were subjected to PCR assay using Taq DNA polymerase and ThermoPol buffer (M0267; New England BioLabs, Ipswich, MA, USA) in a total volume of 50 μl.

    Quantitative RT-PCR:

    Article Title: Differential effect of CLK SR Kinases on HIV-1 gene expression: potential novel targets for therapy
    Article Snippet: Purified RNA was reverse transcribed using M-MLV (Invitrogen, Cat. #28025-013). cDNAs reactions (20 μl) were diluted to 150 μL and used in qRT-PCR analysis of HIV-1 mRNA levels using the standard curve method. .. Each reaction was set-up as follows: 0.4 μL of Taq DNA polymerase (5 U/μL, NEB, Cat. #M0267L), 2.5 μL of ThermolPol buffer, 2.5 μL of 10X SYBR Green I (Sigma-Aldrich, Cat. #S9430), 2.5 μL of 2.5 mM dNTPs, 1.0 μL of 5' primer (0.1 ug/uL), and 1.0 μL of 3' primer (0.1 μg/μL), 10.1 μL H2 O, and 5 μL of cDNA.

    Staining:

    Article Title: Investigating the transmissibility of tet(W) in bifidobacteria exposed to acid and bile stress
    Article Snippet: Bifidobacterium isolates were phenotypically characterized by Gram staining and catalase reaction. .. The 25 µl reaction mixture contained 2.5 µl of 10x PCR buffer including 20 mM MgCl2 (B9004S, New England Biolabs, Hertfordshire, UK), 4 µl of 1.25 mM dNTP mix (N0447, New England Biolabs), 0.1 µl of 5U Taq DNA polymerase (M0267X, New England Biolabs), 1 µl each of 10 pmol/µl forward and reverse primer ( ), 15.4 µl of sterile Milli-Q water, and 1 µl of DNA template.

    Article Title: Extended Synaptotagmin 1 Interacts with Herpes Simplex Virus 1 Glycoprotein M and Negatively Modulates Virus-Induced Membrane Fusion
    Article Snippet: The resulting cDNAs were subjected to PCR assay using Taq DNA polymerase and ThermoPol buffer (M0267; New England BioLabs, Ipswich, MA, USA) in a total volume of 50 μl. .. The resulting cDNAs were subjected to PCR assay using Taq DNA polymerase and ThermoPol buffer (M0267; New England BioLabs, Ipswich, MA, USA) in a total volume of 50 μl.

    Article Title: Pyrroloquinoline Quinone Biosynthesis Gene pqqC, a Novel Molecular Marker for Studying the Phylogeny and Diversity of Phosphate-Solubilizing Pseudomonads
    Article Snippet: PCR amplifications of pqqC from bacterial DNA lysates were carried out in 20-μl mixtures containing 1× ThermoPol buffer (New England BioLabs, Inc., Beverly, MA), 100 μM (each) deoxynucleoside triphosphate (dNTP), 0.4 μM (each) forward and reverse primer, 0.75 U Taq DNA polymerase (5,000 U/ml; New England BioLabs, Inc.), and 2 μl of genomic DNA. .. The following thermocycling conditions were used: initial denaturation at 96°C for 10 min followed by 30 cycles of 96°C for 30 s, 63°C for 30 s, 72°C for 1 min, and final elongation at 72°C for 10 min. For pqqC amplification from roots, 20 ng total DNA extracts, 5% dimethyl sulfoxide (Sigma-Aldrich, St. Louis, MO), and 5% bovine serum albumin were added to the PCR mix, and thermocycling conditions were slightly modified from those described above, i.e., 35 cycles instead of 30, denaturing and annealing times of 1 min, and an elongation time of 2 min per cycle.

    Article Title: A Quick, No Frills Approach to Mouse Genotyping
    Article Snippet: NaOH (NaOH pellets) Taq DNA Polymerase with ThermoPol buffer (New England Biolabs, catalog number: M0267X*, M0267L, or M0267S) * Note: At 4,000 U, ~800 μl of Taq serves several thousand PCR reactions. .. NaOH (NaOH pellets) Taq DNA Polymerase with ThermoPol buffer (New England Biolabs, catalog number: M0267X*, M0267L, or M0267S) * Note: At 4,000 U, ~800 μl of Taq serves several thousand PCR reactions.

    Nested PCR:

    Article Title: No association between HPV positive breast cancer and expression of human papilloma viral transcripts
    Article Snippet: Ten percent of the MY09/MY11 reaction volume was used as a template for the GP5 + /6 + nested PCR. .. For S100A8 and MY09/MY11 primer sets Taq Polymerase with Thermopol Buffer (New England Biolabs) was used.

    Agarose Gel Electrophoresis:

    Article Title: Extended Synaptotagmin 1 Interacts with Herpes Simplex Virus 1 Glycoprotein M and Negatively Modulates Virus-Induced Membrane Fusion
    Article Snippet: The resulting cDNAs were subjected to PCR assay using Taq DNA polymerase and ThermoPol buffer (M0267; New England BioLabs, Ipswich, MA, USA) in a total volume of 50 μl. .. The resulting cDNAs were subjected to PCR assay using Taq DNA polymerase and ThermoPol buffer (M0267; New England BioLabs, Ipswich, MA, USA) in a total volume of 50 μl.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Genome-Scale Analysis of Replication Timing: from Bench to Bioinformatics
    Article Snippet: Anti-Mouse IgG-AlexaFluor488 (Invitrogen/Molecular Probes, CatA-11029) Store at 4 °C. .. Taq DNA Polymerase with ThermoPol Buffer (New England BioLabs, M0267) 10 μM dNTPs (Bioline, BIO-39025) 10 mg/ml Ethidium Bromide (Fisher, BP102-5) Agarose (OmniPur, 2125) PCR primers for BrdU-IP quality verification (steps 45–49), see 0.1M HCl/0.5% (vol/vol) Triton X-100(Sigma T9284) in ddH2 O.

    Polymerase Cycling Assembly:

    Article Title: Labeling of unique sequences in double-stranded DNA at sites of vicinal nicks generated by nicking endonucleases
    Article Snippet: Paragraph title: Assembly PCR ... Extension reactions were performed in 1 × Pfu reaction buffer (Stratagene) containing 20 nM of oligonucleotides A-D (see Supplementary Table 1 for sequences), 200 μM dNTPs and 0.025 U/μl of cloned Pfu DNA polymerase (Stratagene) at the following conditions: one step at 94°C for 60 s, followed by 10 cycles of denaturation at 94°C for 30 s, annealing at 35°C for 30 s and extension at 72°C for 30 s. The last cycle was followed by an extension step at 72°C for 2 min. PCR amplification reactions were performed in 1× ThermoPol polymerase buffer (NEB) containing 200 μM dNTPs, 0.5 μM each of primers P1 and P2, 5 μl of extension reaction product and 0.02 U/μl of Taq DNA polymerase.

    Plasmid Preparation:

    Article Title: Mitochondrial DNA Sequence and Lack of Response to Anoxia in the Annual Killifish Austrofundulus limnaeus
    Article Snippet: PCR reactions (50 μl total volume) consisted of 50 ng total DNA, 10 pmol of forward and reverse primers (Table , Integrated DNA Technologies, Coralville, IA, USA), 0.25 U Taq polymerase (New England BioLabs, Ipswich, MA, USA #M0267L), in 1X ThermoPol buffer (New England BioLabs # M0267L). .. PCR products were resolved via 1% agarose electrophoresis and product size was estimated by comparison to a DNA ladder (GeneRuler 1 kb Plus, Thermo Scientific #SM0312) using GelAnalyser ( http://www.sequentix.de/ ).

    Article Title: Cellular localization of relaxin‐like gonad‐stimulating peptide expression in Asterias rubens: New insights into neurohormonal control of spawning in starfish
    Article Snippet: A pBluescript SKII (+) vector containing the cloned and sequenced AruRGP precursor cDNA was used to synthesize RNA probes. .. First, a routine PCR was performed using Taq DNA polymerase (Taq DNA Polymerase with Thermopol Buffer, New England Biolabs) and standard M13 primers (Forward: 5′‐GTAAAACGACGGCCAGTG‐3′, Reverse: 5′‐GGAAACAGCTATGACCATG‐3′, custom‐synthesized by Sigma‐Aldrich) to linearize the plasmid and amplify the insert. .. The PCR product, which included the AruRGP precursor cDNA sequence and T3 and T7 RNA polymerase sites, was purified using a QIAquick gel extraction kit (Qiagen).

    Software:

    Article Title: Emergence of a Competence-Reducing Filamentous Phage from the Genome of Acinetobacter baylyi ADP1
    Article Snippet: PCRs were conducted with Taq polymerase in ThermoPol buffer (New England BioLabs) under standard conditions with purified genomic DNA as the template. .. Mutations in CRAϕ isolates were detected by Sanger sequencing of PCR products amplified from genomic DNA purified from evolved ADP1 cells.

    Microscopy:

    Article Title: Genomic characterization of patient-derived xenograft models established from fine needle aspirate biopsies of a primary pancreatic ductal adenocarcinoma and from patient-matched metastatic sites
    Article Snippet: Images were acquired with a Zeiss Imager Z1 wide-field microscope equipped with a 40x 1.3 NA EC Plan-NEOFLUAR objective. .. DNA extraction was performed in lysis buffer (0.45% Nonidet P40 [Roche, Nutley, NJ, USA], 1X ThermoPol Taq buffer (New England Biolabs, Ipwich, MA, USA), and 100 μg/mL proteinase K [Roche]) at 55°C.

    SYBR Green Assay:

    Article Title: Differential effect of CLK SR Kinases on HIV-1 gene expression: potential novel targets for therapy
    Article Snippet: Purified RNA was reverse transcribed using M-MLV (Invitrogen, Cat. #28025-013). cDNAs reactions (20 μl) were diluted to 150 μL and used in qRT-PCR analysis of HIV-1 mRNA levels using the standard curve method. .. Each reaction was set-up as follows: 0.4 μL of Taq DNA polymerase (5 U/μL, NEB, Cat. #M0267L), 2.5 μL of ThermolPol buffer, 2.5 μL of 10X SYBR Green I (Sigma-Aldrich, Cat. #S9430), 2.5 μL of 2.5 mM dNTPs, 1.0 μL of 5' primer (0.1 ug/uL), and 1.0 μL of 3' primer (0.1 μg/μL), 10.1 μL H2 O, and 5 μL of cDNA. .. The forward and reverse primers used in the quantitation of HIV-1 mRNA are shown below: unspliced (US), 5' - GAC GCT CTC GCA CCC ATC TC - 3' and 5' - CTG AAG CGC GCA CGG CAA - 3'; singly spliced (SS), 5' - GGC GGC GAC TGG AAG AAG C - 3' and 5' - CTA TGA TTA CTA TGG ACC ACA C - 3'; and multiply spliced (MS), 5' - GAC TCA TCA AGT TTC TCT ATC AAA - 3' and 5' - AGT CTC TCA AGC GGT GGT - 3'.

    RNA Extraction:

    Article Title: Spliced Leader Trapping Reveals Widespread Alternative Splicing Patterns in the Highly Dynamic Transcriptome of Trypanosoma brucei
    Article Snippet: Paragraph title: RNA extraction and library construction ... Second strand synthesis was done using 2 µl 10× Thermopol buffer (New England BioLabs), 1 µl dNTPs 10 mM, 1 µl 2nd strand primer 10 µM ([BIOT] 5′- AATGATACGGCGACCACCGAGATCTACAGTTTCTGTACTATATTG -3′ ), 2 units Taq polymerase (New England BioLabs, USA) and 4.5 µl H2 O by incubation for 5 minut es at 50°C and then 5 minutes at 72°C.

    Ribosomal Intergenic Spacer Analysis:

    Article Title: Short-term observations of marine bacterial and viral communities: patterns, connections and resilience
    Article Snippet: Upon thawing, bacterial and viral DNA in the extract was quantified with PicoGreen (Invitrogen, Carlsbad, CA, USA) and diluted to 2 ng μl−1 and 2.5 ng μl−1 , respectively, for analysis by automated ribosomal intergenic spacer analysis (ARISA) and TRFLP. .. Fifty microliter ARISA PCR reactions contained 2 ng of bacterial DNA extract, 1 × Thermopol PCR Buffer (New England Biolabs, NEB, Ipswich, MA, USA), 10 μℳ dNTPs (Promega, Madison, WI, USA), 20 ng μl−1 BSA (Sigma-Aldrich, Catalog Number: A7030, St Louis, MO, USA), 5 U Thermopol Taq polymerase (NEB).

    Quantitation Assay:

    Article Title: Differential effect of CLK SR Kinases on HIV-1 gene expression: potential novel targets for therapy
    Article Snippet: Paragraph title: Quantitation of HIV-1 mRNA Levels ... Each reaction was set-up as follows: 0.4 μL of Taq DNA polymerase (5 U/μL, NEB, Cat. #M0267L), 2.5 μL of ThermolPol buffer, 2.5 μL of 10X SYBR Green I (Sigma-Aldrich, Cat. #S9430), 2.5 μL of 2.5 mM dNTPs, 1.0 μL of 5' primer (0.1 ug/uL), and 1.0 μL of 3' primer (0.1 μg/μL), 10.1 μL H2 O, and 5 μL of cDNA.

    Sampling:

    Article Title: Strong Seasonality and Interannual Recurrence in Marine Myovirus Communities
    Article Snippet: Each PCR mixture (final volume, 50 μl) contained 2 ng DNA, 1× ThermoPol buffer (including 20 mM MgSO4 ; NEB), an additional 1.75 mM MgCl2 (final concentration, 3.75 mM), 0.25 mM each deoxynucleoside triphosphate (dNTP), 400 nM each primer, 10 μg bovine serum albumin (BSA) (Sigma; number 7030), and 5 units Taq DNA polymerase (NEB). .. Each PCR mixture (final volume, 50 μl) contained 2 ng DNA, 1× ThermoPol buffer (including 20 mM MgSO4 ; NEB), an additional 1.75 mM MgCl2 (final concentration, 3.75 mM), 0.25 mM each deoxynucleoside triphosphate (dNTP), 400 nM each primer, 10 μg bovine serum albumin (BSA) (Sigma; number 7030), and 5 units Taq DNA polymerase (NEB).

    DNA Extraction:

    Article Title: Genomic characterization of patient-derived xenograft models established from fine needle aspirate biopsies of a primary pancreatic ductal adenocarcinoma and from patient-matched metastatic sites
    Article Snippet: Species specific Chek1/CHK1 primers were used to confirm that the PDX-derived explant cells were of human origin. .. DNA extraction was performed in lysis buffer (0.45% Nonidet P40 [Roche, Nutley, NJ, USA], 1X ThermoPol Taq buffer (New England Biolabs, Ipwich, MA, USA), and 100 μg/mL proteinase K [Roche]) at 55°C. .. Amplification was performed in a 20 μL reaction volume including 1 μL DNA extract, 0.5 μM forward and reverse primer mixture, 200 μM dNTPs, 0.1 unit Taq DNA Polymerase (New England Biolabs), 2 μL 10X Standard Taq Buffer (New England Biolabs), and 15 μL nuclease-free water.

    Article Title: The Skin Microbiome of Cohabiting Couples
    Article Snippet: Paragraph title: DNA extraction and amplification. ... The first PCR amplification mix contained 2.5 μl of 10× ThermoPol Taq buffer (New England Biolabs), 1.5 μl of 10 mg ml−1 bovine serum albumin (BSA), 0.05 μl of 100 mM total deoxynucleoside triphosphates (dNTPs) (New England Biolabs), 0.05 μl of each 100 μM forward and reverse primer (Integrated DNA Technologies), 0.125 μl of 5 U μl−1 Taq polymerase (New England Biolabs), 1 to 10 ng of template DNA (3 μl for the majority of samples), and nuclease-free PCR-grade H2 O to a 25-μl total reaction volume.

    Concentration Assay:

    Article Title: Investigating the transmissibility of tet(W) in bifidobacteria exposed to acid and bile stress
    Article Snippet: The MIC was identified as the lowest antibiotic concentration at which no growth (turbidity) was observed. .. The 25 µl reaction mixture contained 2.5 µl of 10x PCR buffer including 20 mM MgCl2 (B9004S, New England Biolabs, Hertfordshire, UK), 4 µl of 1.25 mM dNTP mix (N0447, New England Biolabs), 0.1 µl of 5U Taq DNA polymerase (M0267X, New England Biolabs), 1 µl each of 10 pmol/µl forward and reverse primer ( ), 15.4 µl of sterile Milli-Q water, and 1 µl of DNA template.

    Article Title: Strong Seasonality and Interannual Recurrence in Marine Myovirus Communities
    Article Snippet: Briefly, the g23 PCR primers used here were T4superF1, 5′-GAY HTI KSI GGI GTI CAR CCI ATG-3′, and T4superR1, 5′-GC IYK IAR RTC YTG IGC IAR YTC-3′. .. Each PCR mixture (final volume, 50 μl) contained 2 ng DNA, 1× ThermoPol buffer (including 20 mM MgSO4 ; NEB), an additional 1.75 mM MgCl2 (final concentration, 3.75 mM), 0.25 mM each deoxynucleoside triphosphate (dNTP), 400 nM each primer, 10 μg bovine serum albumin (BSA) (Sigma; number 7030), and 5 units Taq DNA polymerase (NEB). .. The cycling parameters were 95°C for 5 min and 35 cycles of 95°C for 30 s, 54°C for 30 s, and 72°C for 30 s, with a final extension at 72°C for 9.5 min.

    Lysis:

    Article Title: Genomic characterization of patient-derived xenograft models established from fine needle aspirate biopsies of a primary pancreatic ductal adenocarcinoma and from patient-matched metastatic sites
    Article Snippet: Species specific Chek1/CHK1 primers were used to confirm that the PDX-derived explant cells were of human origin. .. DNA extraction was performed in lysis buffer (0.45% Nonidet P40 [Roche, Nutley, NJ, USA], 1X ThermoPol Taq buffer (New England Biolabs, Ipwich, MA, USA), and 100 μg/mL proteinase K [Roche]) at 55°C. .. Amplification was performed in a 20 μL reaction volume including 1 μL DNA extract, 0.5 μM forward and reverse primer mixture, 200 μM dNTPs, 0.1 unit Taq DNA Polymerase (New England Biolabs), 2 μL 10X Standard Taq Buffer (New England Biolabs), and 15 μL nuclease-free water.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs taq dna polymerase supertaq
    <t>DNA</t> modification and bypass during bisulfite treatment. ( A ) Scheme of the chemical reaction of cytidine: Treatment with bisulfite generates the non-aromatic, non-planar 5,6-dihydrouridine-6-sulfonate (dhU6S), which decomposes to uracil upon treatment with base (and heat). ( B ) Primer extension activity of different polymerases <t>(Taq,</t> 5D4, 3A10, E10, TgoT) on template T1 either unmodified (C), bisulfite-treated and desulfonated (Reagent 1, 80°C, 20 min) (converting dC to dU) (D) or bisulfite-treated (Reagent 1) but not desulphonated (converting dC to dhU6S) (S). Polymerases 5D4 and 3A10 are able to generate full-length (+20) products even from the non-desulphonated template (S). ( C ) Time-course comparison of primer extension activity of Taq and 5D4 on T1 either unmodified (C) or bisulfite-treated with (D) or without desulphonation (S). (P: primer).
    Taq Dna Polymerase Supertaq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase supertaq/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase supertaq - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    97
    New England Biolabs taq dna polymerase
    CE analysis of processing synthetic <t>DNA</t> by soluble enzyme mix PKT and immobilized enzymes. 5′ FAM-labeled blunt-end substrates, 51-AT possessing multiple 3′ terminal A-T base pairs, and 51-GC possessing multiple 3′ terminal G-C base pairs, were incubated with PKT for end repair at 20 °C for 30 min followed by 65 °C for 30 min (PKT mix). The substrates were also treated with immobilized T4 DNA pol and PNK at 20 °C for 30 min, followed by separation of the enzymes on beads and the reaction medium (supernatant). The reaction medium was subsequently treated with immobilized <t>Taq</t> DNA pol for 3′ A-tailing at 37 °C for 30 min (IM PKT mix). The CE data show that incubation with PKT resulted in extensive degradation of 51-AT and little degradation of 51-GC. Treatment of 51-AT or 51-GC with the immobilized enzymes resulted in mostly 3′ A-tailing product, without detectable degradation of the 5′ FAM-labeled oligos. NC, negative control reaction performed in the absence of enzyme.
    Taq Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 927 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/New England Biolabs
    Average 97 stars, based on 927 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2019-10
    97/100 stars
      Buy from Supplier

    99
    New England Biolabs taq dna ligase
    PCR and Gibson assembly using cellular reagents. (a) Schematic depicting cellular PCR followed by cellular Gibson assembly for constructing new plasmids. Bacteria harboring target plasmids are mixed with polymerase-expressing cellular reagents and PCR is initiated by adding appropriate primers, buffer, and dNTP. The resulting PCR products are incubated with cellular reagents expressing Gibson assembly <t>enzymes–Taq</t> <t>DNA</t> polymerase, Taq DNA ligase, and T5 exonuclease–to assemble the new construct. (b) Cellular PCR amplification of vector and insert fragments directly from E . coli bacteria bearing target DNA plasmids using 2 x 10 7 cells of Phusion cellular reagents. Assembly parts include: (i) “pATetO 6XHis full length” vector for two part assembly with Kan r cassette bearing appropriate overlapping ends, and (ii) “pUC19 Fragments 1 and 2” for three part assembly with Kan r cassette whose ends overlap with pUC19 vector fragments. (c) Gibson assembly of agarose gel purified and unpurified cellular PCR products using pure or cellular Gibson assembly reagents. In “negative control” samples the PCR products were incubated in Gibson reaction buffer without pure or cellular Gibson enzymes. “pATetO 6XHis + Kan r ”represents a two part Gibson assembly while “Puc19 Fragment 1 + pUC19 Fragment 2 + Kan r ” represents a three-part Gibson assembly. Representative number of clones recovered in each case in the presence of both ampicillin and kanamycin are reported.
    Taq Dna Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 108 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna ligase/product/New England Biolabs
    Average 99 stars, based on 108 article reviews
    Price from $9.99 to $1999.99
    taq dna ligase - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    DNA modification and bypass during bisulfite treatment. ( A ) Scheme of the chemical reaction of cytidine: Treatment with bisulfite generates the non-aromatic, non-planar 5,6-dihydrouridine-6-sulfonate (dhU6S), which decomposes to uracil upon treatment with base (and heat). ( B ) Primer extension activity of different polymerases (Taq, 5D4, 3A10, E10, TgoT) on template T1 either unmodified (C), bisulfite-treated and desulfonated (Reagent 1, 80°C, 20 min) (converting dC to dU) (D) or bisulfite-treated (Reagent 1) but not desulphonated (converting dC to dhU6S) (S). Polymerases 5D4 and 3A10 are able to generate full-length (+20) products even from the non-desulphonated template (S). ( C ) Time-course comparison of primer extension activity of Taq and 5D4 on T1 either unmodified (C) or bisulfite-treated with (D) or without desulphonation (S). (P: primer).

    Journal: Nucleic Acids Research

    Article Title: A polymerase engineered for bisulfite sequencing

    doi: 10.1093/nar/gkv798

    Figure Lengend Snippet: DNA modification and bypass during bisulfite treatment. ( A ) Scheme of the chemical reaction of cytidine: Treatment with bisulfite generates the non-aromatic, non-planar 5,6-dihydrouridine-6-sulfonate (dhU6S), which decomposes to uracil upon treatment with base (and heat). ( B ) Primer extension activity of different polymerases (Taq, 5D4, 3A10, E10, TgoT) on template T1 either unmodified (C), bisulfite-treated and desulfonated (Reagent 1, 80°C, 20 min) (converting dC to dU) (D) or bisulfite-treated (Reagent 1) but not desulphonated (converting dC to dhU6S) (S). Polymerases 5D4 and 3A10 are able to generate full-length (+20) products even from the non-desulphonated template (S). ( C ) Time-course comparison of primer extension activity of Taq and 5D4 on T1 either unmodified (C) or bisulfite-treated with (D) or without desulphonation (S). (P: primer).

    Article Snippet: Taq DNA polymerase (SuperTaq) was obtained from HT Biotechnology (Cambridge) and Q5 polymerase from New England Biolabs.

    Techniques: Modification, Activity Assay

    Amplification of 24 individual human genomic loci. Comparison of PCR performance of Taq (top) panel, with two different Taq/5D4 blends (5/1 (middle panel); 10/1 (bottom panel)) on the amplification of 24 different promotor regions in bisulfite-treated and fully desulphonated human genomic DNA. Both blends are able to amplify a significantly larger number of loci than Taq alone and together enable amplification of 18 out of 24 loci (75%).

    Journal: Nucleic Acids Research

    Article Title: A polymerase engineered for bisulfite sequencing

    doi: 10.1093/nar/gkv798

    Figure Lengend Snippet: Amplification of 24 individual human genomic loci. Comparison of PCR performance of Taq (top) panel, with two different Taq/5D4 blends (5/1 (middle panel); 10/1 (bottom panel)) on the amplification of 24 different promotor regions in bisulfite-treated and fully desulphonated human genomic DNA. Both blends are able to amplify a significantly larger number of loci than Taq alone and together enable amplification of 18 out of 24 loci (75%).

    Article Snippet: Taq DNA polymerase (SuperTaq) was obtained from HT Biotechnology (Cambridge) and Q5 polymerase from New England Biolabs.

    Techniques: Amplification, Polymerase Chain Reaction

    PCR amplification of bisulfite-treated plasmid templates. PCR amplification of bisulfite-treated high GC and low GC content templates ranging from 200–600 bp in size using fully desulphonated templates and three different 5D4/Taq blends (1/10, 1/5, 1/1) with progressively lower Taq content and Taq alone on low dC content plasmid regions (top panel) and high dC content plasmid regions (bottom panel). On templates with low dC content (and hence lower levels of dU and residual dhU6S adducts post bisulfite treatment and desulphonation) either Taq or Taq/5D4 polymerase blends with a high amount of Taq perform best. In contrast on the higher dC content templates only blends containing 5D4 yield amplicons with Taq/5D4 blends (10/1; 5/1) superior to 5D4/Taq 1/1 blend, while Taq alone does not yield any amplification products. Thus only 5D4/Taq blends are able to copy the high GC content templates indicating that the blended enzymes are more efficient at copying templates containing sporadic dUs (and dhU6S adducts) and dU homopolymer stretches. Low molecular weight bands result from primer-dimer formation. (M: E-Gel ® Low Range Quantitative DNA Ladder).

    Journal: Nucleic Acids Research

    Article Title: A polymerase engineered for bisulfite sequencing

    doi: 10.1093/nar/gkv798

    Figure Lengend Snippet: PCR amplification of bisulfite-treated plasmid templates. PCR amplification of bisulfite-treated high GC and low GC content templates ranging from 200–600 bp in size using fully desulphonated templates and three different 5D4/Taq blends (1/10, 1/5, 1/1) with progressively lower Taq content and Taq alone on low dC content plasmid regions (top panel) and high dC content plasmid regions (bottom panel). On templates with low dC content (and hence lower levels of dU and residual dhU6S adducts post bisulfite treatment and desulphonation) either Taq or Taq/5D4 polymerase blends with a high amount of Taq perform best. In contrast on the higher dC content templates only blends containing 5D4 yield amplicons with Taq/5D4 blends (10/1; 5/1) superior to 5D4/Taq 1/1 blend, while Taq alone does not yield any amplification products. Thus only 5D4/Taq blends are able to copy the high GC content templates indicating that the blended enzymes are more efficient at copying templates containing sporadic dUs (and dhU6S adducts) and dU homopolymer stretches. Low molecular weight bands result from primer-dimer formation. (M: E-Gel ® Low Range Quantitative DNA Ladder).

    Article Snippet: Taq DNA polymerase (SuperTaq) was obtained from HT Biotechnology (Cambridge) and Q5 polymerase from New England Biolabs.

    Techniques: Polymerase Chain Reaction, Amplification, Plasmid Preparation, Gas Chromatography, Molecular Weight

    Degree of methylation of individual CpG sites. Promoter regions of four genes ( A — prkcdbp , B — dab2ip , C — ptgs2 , D — ezh2) were amplified with either Taq ot 5D4/Taq blends, using bisulfide-treated genomic DNA from normal cells or LNCapP cells as a template and subjected to deep sequencing. Cyan—methylated CpGs, orange—unmethylated CpGs. Individual CpGs are numbered starting from the 5′ end of the amplicon.

    Journal: Nucleic Acids Research

    Article Title: A polymerase engineered for bisulfite sequencing

    doi: 10.1093/nar/gkv798

    Figure Lengend Snippet: Degree of methylation of individual CpG sites. Promoter regions of four genes ( A — prkcdbp , B — dab2ip , C — ptgs2 , D — ezh2) were amplified with either Taq ot 5D4/Taq blends, using bisulfide-treated genomic DNA from normal cells or LNCapP cells as a template and subjected to deep sequencing. Cyan—methylated CpGs, orange—unmethylated CpGs. Individual CpGs are numbered starting from the 5′ end of the amplicon.

    Article Snippet: Taq DNA polymerase (SuperTaq) was obtained from HT Biotechnology (Cambridge) and Q5 polymerase from New England Biolabs.

    Techniques: Methylation, Amplification, Sequencing

    CE analysis of processing synthetic DNA by soluble enzyme mix PKT and immobilized enzymes. 5′ FAM-labeled blunt-end substrates, 51-AT possessing multiple 3′ terminal A-T base pairs, and 51-GC possessing multiple 3′ terminal G-C base pairs, were incubated with PKT for end repair at 20 °C for 30 min followed by 65 °C for 30 min (PKT mix). The substrates were also treated with immobilized T4 DNA pol and PNK at 20 °C for 30 min, followed by separation of the enzymes on beads and the reaction medium (supernatant). The reaction medium was subsequently treated with immobilized Taq DNA pol for 3′ A-tailing at 37 °C for 30 min (IM PKT mix). The CE data show that incubation with PKT resulted in extensive degradation of 51-AT and little degradation of 51-GC. Treatment of 51-AT or 51-GC with the immobilized enzymes resulted in mostly 3′ A-tailing product, without detectable degradation of the 5′ FAM-labeled oligos. NC, negative control reaction performed in the absence of enzyme.

    Journal: Scientific Reports

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA

    doi: 10.1038/s41598-018-34079-2

    Figure Lengend Snippet: CE analysis of processing synthetic DNA by soluble enzyme mix PKT and immobilized enzymes. 5′ FAM-labeled blunt-end substrates, 51-AT possessing multiple 3′ terminal A-T base pairs, and 51-GC possessing multiple 3′ terminal G-C base pairs, were incubated with PKT for end repair at 20 °C for 30 min followed by 65 °C for 30 min (PKT mix). The substrates were also treated with immobilized T4 DNA pol and PNK at 20 °C for 30 min, followed by separation of the enzymes on beads and the reaction medium (supernatant). The reaction medium was subsequently treated with immobilized Taq DNA pol for 3′ A-tailing at 37 °C for 30 min (IM PKT mix). The CE data show that incubation with PKT resulted in extensive degradation of 51-AT and little degradation of 51-GC. Treatment of 51-AT or 51-GC with the immobilized enzymes resulted in mostly 3′ A-tailing product, without detectable degradation of the 5′ FAM-labeled oligos. NC, negative control reaction performed in the absence of enzyme.

    Article Snippet: Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only.

    Techniques: Labeling, Gas Chromatography, Incubation, Negative Control

    Effect of end repair and 3′ A-tailing at high temperature on GC-bias in Illumina reads from PCR-free human DNA libraries. ( a ) Comparison of GC-bias curves in duplicate libraries prepared by immobilized enzymes with 3′ A-tailing performed at 37 °C (IM 37 °C -1 and IM 37 °C -2, in blue) or 65 °C (IM 65 °C -1 and IM 65 °C -2, in green) revealed a dramatic effect of 3′ A-tailing at high temperature on sequence coverage of the AT-rich regions from human DNA libraries. ( b ) GC-bias curves were generated from two sets of duplicate libraries produced using the soluble enzyme mixture PKT with (PKT purify-1 and PKT purify-2) or without (PKT-1 and PKT-2) a purification step between end repair and high temperature incubation (with Taq DNA pol added to the samples following purification). Although some bias against AT-rich regions can be attributed to the end repair step, the elevated temperature contributes to the majority of the dropouts in the AT-rich regions. ( c ) Shown are the GC-bias curves from 4 sets of duplicate libraries produced by the method of soluble enzymes. Two sets of the duplicate libraries were purified after end repair with PK mixture and then treated at 37 °C with Klenow Fragment (3′-5′ exo − ) (red, Klenow 37 °C-1 and Klenow 37 °C-2) or Taq DNA pol (blue, Taq 37 °C-1 and Taq 37 °C-2). The other two duplicate sets were prepared using the high temperature treatment protocol either with (green, Taq 65 °C-1 and Taq 65 °C-2) or without (orange, PKT-1 and PKT-2) a purification step between end repair with PKT and treatment with Taq DNA pol at 65 °C for 30 min. ( d ) Comparison of library yield of the three sets described above with or without (PKT on the left) a purification step between end repair and 3′ A-tailing indicates that purification caused substantial loss of library DNA.

    Journal: Scientific Reports

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA

    doi: 10.1038/s41598-018-34079-2

    Figure Lengend Snippet: Effect of end repair and 3′ A-tailing at high temperature on GC-bias in Illumina reads from PCR-free human DNA libraries. ( a ) Comparison of GC-bias curves in duplicate libraries prepared by immobilized enzymes with 3′ A-tailing performed at 37 °C (IM 37 °C -1 and IM 37 °C -2, in blue) or 65 °C (IM 65 °C -1 and IM 65 °C -2, in green) revealed a dramatic effect of 3′ A-tailing at high temperature on sequence coverage of the AT-rich regions from human DNA libraries. ( b ) GC-bias curves were generated from two sets of duplicate libraries produced using the soluble enzyme mixture PKT with (PKT purify-1 and PKT purify-2) or without (PKT-1 and PKT-2) a purification step between end repair and high temperature incubation (with Taq DNA pol added to the samples following purification). Although some bias against AT-rich regions can be attributed to the end repair step, the elevated temperature contributes to the majority of the dropouts in the AT-rich regions. ( c ) Shown are the GC-bias curves from 4 sets of duplicate libraries produced by the method of soluble enzymes. Two sets of the duplicate libraries were purified after end repair with PK mixture and then treated at 37 °C with Klenow Fragment (3′-5′ exo − ) (red, Klenow 37 °C-1 and Klenow 37 °C-2) or Taq DNA pol (blue, Taq 37 °C-1 and Taq 37 °C-2). The other two duplicate sets were prepared using the high temperature treatment protocol either with (green, Taq 65 °C-1 and Taq 65 °C-2) or without (orange, PKT-1 and PKT-2) a purification step between end repair with PKT and treatment with Taq DNA pol at 65 °C for 30 min. ( d ) Comparison of library yield of the three sets described above with or without (PKT on the left) a purification step between end repair and 3′ A-tailing indicates that purification caused substantial loss of library DNA.

    Article Snippet: Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only.

    Techniques: Gas Chromatography, Polymerase Chain Reaction, Sequencing, Generated, Produced, Purification, Incubation

    Enzyme immobilization and comparison of Illumina library preparation protocols. ( a ) A schematic of covalent conjugation of SNAP-tagged enzyme fusion proteins to magnetic beads functionalized with O 6 -benzylguanine (BG) moieties that specifically react with active site cysteine residues of SNAP-tag proteins, forming a stable covalent thioether bond 15 , 16 . ( b ) Workflow for library construction using immobilized enzymes for Illumina sequencing. A typical streamlined protocol for Illumina library construction is modified by employing immobilized enzymes to catalyze end repair and 3′ A-tailing. This method utilizes SNAP-tagged T4 DNA pol and PNK covalently conjugated to BG-functionalized magnetic beads to carry out end repair of fragmented DNA at 20°C (or 37 °C) for 30 min. The enzymes are removed by magnetic separation from the DNA pool, which is subjected to 3′ A-tailing at 37 °C for 30 min using immobilized Taq DNA pol. ( c ) Streamlined protocol for Illumina amplification-free library preparation using soluble enzymes. Typically, end repair and 3′ A-tailing of fragmented DNA are catalyzed by an enzyme mixture at 20 °C for 30 min, followed by heat treatment at 65 °C for 30 min. ( d ) The workflow of Illumina TruSeq DNA PCR-free LT Library Prep Kit with a purification step. End repair is performed for 30 min at 30 °C, followed by a bead-based step for clean up and size selection. 3′ A-tailing is carried out for 30 min at 37 °C with a subsequent treatment for 5 min at 70 °C. Each library was ligated to preannealed full-length paired-end Illumina adaptors, size-selected and analyzed, and sequenced on an Illumina sequencing platform.

    Journal: Scientific Reports

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA

    doi: 10.1038/s41598-018-34079-2

    Figure Lengend Snippet: Enzyme immobilization and comparison of Illumina library preparation protocols. ( a ) A schematic of covalent conjugation of SNAP-tagged enzyme fusion proteins to magnetic beads functionalized with O 6 -benzylguanine (BG) moieties that specifically react with active site cysteine residues of SNAP-tag proteins, forming a stable covalent thioether bond 15 , 16 . ( b ) Workflow for library construction using immobilized enzymes for Illumina sequencing. A typical streamlined protocol for Illumina library construction is modified by employing immobilized enzymes to catalyze end repair and 3′ A-tailing. This method utilizes SNAP-tagged T4 DNA pol and PNK covalently conjugated to BG-functionalized magnetic beads to carry out end repair of fragmented DNA at 20°C (or 37 °C) for 30 min. The enzymes are removed by magnetic separation from the DNA pool, which is subjected to 3′ A-tailing at 37 °C for 30 min using immobilized Taq DNA pol. ( c ) Streamlined protocol for Illumina amplification-free library preparation using soluble enzymes. Typically, end repair and 3′ A-tailing of fragmented DNA are catalyzed by an enzyme mixture at 20 °C for 30 min, followed by heat treatment at 65 °C for 30 min. ( d ) The workflow of Illumina TruSeq DNA PCR-free LT Library Prep Kit with a purification step. End repair is performed for 30 min at 30 °C, followed by a bead-based step for clean up and size selection. 3′ A-tailing is carried out for 30 min at 37 °C with a subsequent treatment for 5 min at 70 °C. Each library was ligated to preannealed full-length paired-end Illumina adaptors, size-selected and analyzed, and sequenced on an Illumina sequencing platform.

    Article Snippet: Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only.

    Techniques: Conjugation Assay, Magnetic Beads, Sequencing, Modification, Amplification, Polymerase Chain Reaction, Purification, Selection

    A model for GC-related sequence coverage bias in amplification-free NGS data. ( a ) A schematic of DNA end “breathing” (or “fraying”) present in the AT-rich fraction of a DNA library. DNA thermal breathing refers to spontaneous local conformational fluctuations, leading to unpaired bases at the ends of DNA duplex. The extent of breathing is highly dependent upon temperature and DNA sequence so that AT-rich segments (AT) melt before GC-rich segments (GC). The difference of the end breathing profile relevant to GC-content leads to less efficient end-polishing of AT-rich fragments during library construction using DNA modifying enzymes, resulting in the under-representation of the AT-rich regions. ( b ) Degradation of AT-rich DNA by 3′-5′ exonuclease activity of T4 DNA pol (blue). Preferential degradation of AT-rich DNA fragments that undergo terminal base pair breathing may occur at the end repair step or during high temperature incubation. ( c ) Processing AT-rich DNA by Taq DNA pol at elevated temperatures. During high temperature incubation, for example, at 65 °C or 70 °C, the ends of AT-rich DNA fragments melt into transient or predominant single-stranded structures. Taq DNA pol (red) can act on these DNA substrates by its polymerization and 5′ nuclease activities as previously described 34 , yielding unintended cleavage and primer extension products. Arrow (red) indicates the position of cleavage whereas arrow in black indicates the orientation of primer extension due to intermolecular annealing of two single-stranded 3′ terminal sequences. Primer extension may also occur from intramolecular annealing of a single-stranded 3′ terminal sequence.

    Journal: Scientific Reports

    Article Title: Solid-phase enzyme catalysis of DNA end repair and 3′ A-tailing reduces GC-bias in next-generation sequencing of human genomic DNA

    doi: 10.1038/s41598-018-34079-2

    Figure Lengend Snippet: A model for GC-related sequence coverage bias in amplification-free NGS data. ( a ) A schematic of DNA end “breathing” (or “fraying”) present in the AT-rich fraction of a DNA library. DNA thermal breathing refers to spontaneous local conformational fluctuations, leading to unpaired bases at the ends of DNA duplex. The extent of breathing is highly dependent upon temperature and DNA sequence so that AT-rich segments (AT) melt before GC-rich segments (GC). The difference of the end breathing profile relevant to GC-content leads to less efficient end-polishing of AT-rich fragments during library construction using DNA modifying enzymes, resulting in the under-representation of the AT-rich regions. ( b ) Degradation of AT-rich DNA by 3′-5′ exonuclease activity of T4 DNA pol (blue). Preferential degradation of AT-rich DNA fragments that undergo terminal base pair breathing may occur at the end repair step or during high temperature incubation. ( c ) Processing AT-rich DNA by Taq DNA pol at elevated temperatures. During high temperature incubation, for example, at 65 °C or 70 °C, the ends of AT-rich DNA fragments melt into transient or predominant single-stranded structures. Taq DNA pol (red) can act on these DNA substrates by its polymerization and 5′ nuclease activities as previously described 34 , yielding unintended cleavage and primer extension products. Arrow (red) indicates the position of cleavage whereas arrow in black indicates the orientation of primer extension due to intermolecular annealing of two single-stranded 3′ terminal sequences. Primer extension may also occur from intramolecular annealing of a single-stranded 3′ terminal sequence.

    Article Snippet: Enzyme mix PKT was comprised of approximately 1,200 units/ml T4 DNA polymerase, 2,000 units/ml T4 PNK and 2,000 units/ml Taq DNA polymerase (NEB) while PK contained T4 DNA polymerase and T4 PNK only.

    Techniques: Gas Chromatography, Sequencing, Amplification, Next-Generation Sequencing, Activity Assay, Incubation, Activated Clotting Time Assay

    PCR and Gibson assembly using cellular reagents. (a) Schematic depicting cellular PCR followed by cellular Gibson assembly for constructing new plasmids. Bacteria harboring target plasmids are mixed with polymerase-expressing cellular reagents and PCR is initiated by adding appropriate primers, buffer, and dNTP. The resulting PCR products are incubated with cellular reagents expressing Gibson assembly enzymes–Taq DNA polymerase, Taq DNA ligase, and T5 exonuclease–to assemble the new construct. (b) Cellular PCR amplification of vector and insert fragments directly from E . coli bacteria bearing target DNA plasmids using 2 x 10 7 cells of Phusion cellular reagents. Assembly parts include: (i) “pATetO 6XHis full length” vector for two part assembly with Kan r cassette bearing appropriate overlapping ends, and (ii) “pUC19 Fragments 1 and 2” for three part assembly with Kan r cassette whose ends overlap with pUC19 vector fragments. (c) Gibson assembly of agarose gel purified and unpurified cellular PCR products using pure or cellular Gibson assembly reagents. In “negative control” samples the PCR products were incubated in Gibson reaction buffer without pure or cellular Gibson enzymes. “pATetO 6XHis + Kan r ”represents a two part Gibson assembly while “Puc19 Fragment 1 + pUC19 Fragment 2 + Kan r ” represents a three-part Gibson assembly. Representative number of clones recovered in each case in the presence of both ampicillin and kanamycin are reported.

    Journal: PLoS ONE

    Article Title: Cellular reagents for diagnostics and synthetic biology

    doi: 10.1371/journal.pone.0201681

    Figure Lengend Snippet: PCR and Gibson assembly using cellular reagents. (a) Schematic depicting cellular PCR followed by cellular Gibson assembly for constructing new plasmids. Bacteria harboring target plasmids are mixed with polymerase-expressing cellular reagents and PCR is initiated by adding appropriate primers, buffer, and dNTP. The resulting PCR products are incubated with cellular reagents expressing Gibson assembly enzymes–Taq DNA polymerase, Taq DNA ligase, and T5 exonuclease–to assemble the new construct. (b) Cellular PCR amplification of vector and insert fragments directly from E . coli bacteria bearing target DNA plasmids using 2 x 10 7 cells of Phusion cellular reagents. Assembly parts include: (i) “pATetO 6XHis full length” vector for two part assembly with Kan r cassette bearing appropriate overlapping ends, and (ii) “pUC19 Fragments 1 and 2” for three part assembly with Kan r cassette whose ends overlap with pUC19 vector fragments. (c) Gibson assembly of agarose gel purified and unpurified cellular PCR products using pure or cellular Gibson assembly reagents. In “negative control” samples the PCR products were incubated in Gibson reaction buffer without pure or cellular Gibson enzymes. “pATetO 6XHis + Kan r ”represents a two part Gibson assembly while “Puc19 Fragment 1 + pUC19 Fragment 2 + Kan r ” represents a three-part Gibson assembly. Representative number of clones recovered in each case in the presence of both ampicillin and kanamycin are reported.

    Article Snippet: Assemblies using pure enzymes contained 0.08 units of T5 exonuclease (NEB), 0.5 units of Phusion DNA polymerase (NEB) and 80 units of Taq DNA ligase (NEB).

    Techniques: Polymerase Chain Reaction, Expressing, Incubation, Construct, Amplification, Plasmid Preparation, Agarose Gel Electrophoresis, Purification, Clone Assay

    RNA detection by two-step reverse transcription TaqMan qPCR using cellular reagents for MMLV RT and Taq DNA polymerase. Indicated copies of synthetic RNA template derived from Zika virus genomic sequence were tested using 2 x 10 7 cells each of MMLV RT and Taq DNA polymerase lyophilized cellular reagents. Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are presented. Color of the traces indicate presence (black traces) or absence (red traces) of MMLV RT cellular reagents, or the absence of templates (blue traces). The corresponding derivation of template copies from Cq analyses are tabulated. Cq values were converted to template copies using standard curve analyses of the same RNA samples with commercial qRT-PCR master mix ( S8 Fig ).

    Journal: PLoS ONE

    Article Title: Cellular reagents for diagnostics and synthetic biology

    doi: 10.1371/journal.pone.0201681

    Figure Lengend Snippet: RNA detection by two-step reverse transcription TaqMan qPCR using cellular reagents for MMLV RT and Taq DNA polymerase. Indicated copies of synthetic RNA template derived from Zika virus genomic sequence were tested using 2 x 10 7 cells each of MMLV RT and Taq DNA polymerase lyophilized cellular reagents. Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are presented. Color of the traces indicate presence (black traces) or absence (red traces) of MMLV RT cellular reagents, or the absence of templates (blue traces). The corresponding derivation of template copies from Cq analyses are tabulated. Cq values were converted to template copies using standard curve analyses of the same RNA samples with commercial qRT-PCR master mix ( S8 Fig ).

    Article Snippet: Assemblies using pure enzymes contained 0.08 units of T5 exonuclease (NEB), 0.5 units of Phusion DNA polymerase (NEB) and 80 units of Taq DNA ligase (NEB).

    Techniques: RNA Detection, Real-time Polymerase Chain Reaction, Derivative Assay, Sequencing, Amplification, Fluorescence, Generated, Software, Quantitative RT-PCR

    TaqMan qPCR analysis using lyophilized Taq DNA polymerase cellular reagents. Indicated copies of synthetic DNA templates derived from Zika virus genomic sequence were amplified using 2.5 units of pure commercial Taq DNA polymerase (panels a and b) or 2 x 10 7 cells of rehydrated cellular reagents expressing Taq DNA polymerase (panels c and d). Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are depicted in panels a and c. Amplification curve colors distinguish starting template copies–yellow: 60,000 template copies; green: 6000 template copies; blue: 600 template copies; red: 60 template copies; and gray: no template control. These curves depict the real-time kinetics of PCR amplification mediated by pure versus cellular reagents. The corresponding standard curve analyses performed using the “Abs quant” protocol in the LightCycler 96 software are depicted in panels b and d, respectively. Standard curve analyses data for comparing amplification efficiency, linearity, and error are tabulated as insets.

    Journal: PLoS ONE

    Article Title: Cellular reagents for diagnostics and synthetic biology

    doi: 10.1371/journal.pone.0201681

    Figure Lengend Snippet: TaqMan qPCR analysis using lyophilized Taq DNA polymerase cellular reagents. Indicated copies of synthetic DNA templates derived from Zika virus genomic sequence were amplified using 2.5 units of pure commercial Taq DNA polymerase (panels a and b) or 2 x 10 7 cells of rehydrated cellular reagents expressing Taq DNA polymerase (panels c and d). Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are depicted in panels a and c. Amplification curve colors distinguish starting template copies–yellow: 60,000 template copies; green: 6000 template copies; blue: 600 template copies; red: 60 template copies; and gray: no template control. These curves depict the real-time kinetics of PCR amplification mediated by pure versus cellular reagents. The corresponding standard curve analyses performed using the “Abs quant” protocol in the LightCycler 96 software are depicted in panels b and d, respectively. Standard curve analyses data for comparing amplification efficiency, linearity, and error are tabulated as insets.

    Article Snippet: Assemblies using pure enzymes contained 0.08 units of T5 exonuclease (NEB), 0.5 units of Phusion DNA polymerase (NEB) and 80 units of Taq DNA ligase (NEB).

    Techniques: Real-time Polymerase Chain Reaction, Derivative Assay, Sequencing, Amplification, Expressing, Fluorescence, Generated, Software, Polymerase Chain Reaction

    Single strand binding protein, ET SSB, only has a minor effect on the reduction of artifacts. Taq (NE Biolabs) and AccuPrime Pfx (Life Technologies) DNA polymerases were used in amplification of TALE DNA repeats. The arrows indicate the expected size of the amplification products. PCR conditions are given in the supplementary material .

    Journal: Scientific Reports

    Article Title: PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications

    doi: 10.1038/srep05052

    Figure Lengend Snippet: Single strand binding protein, ET SSB, only has a minor effect on the reduction of artifacts. Taq (NE Biolabs) and AccuPrime Pfx (Life Technologies) DNA polymerases were used in amplification of TALE DNA repeats. The arrows indicate the expected size of the amplification products. PCR conditions are given in the supplementary material .

    Article Snippet: Even the use of a non-proofreading but robust DNA polymerase, Taq (NE Biolabs) failed to amplify only the desired fragment ( ).

    Techniques: Binding Assay, Amplification, Polymerase Chain Reaction

    Primers that anneal far away from the repetitive DNA perform much better in amplifying the desired product. Taq DNA polymerase (NE Biolabs) was used in the PCR amplification of the indicated region of the pdTALE12 plasmid. PCR conditions are given in the supplementary material .

    Journal: Scientific Reports

    Article Title: PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications

    doi: 10.1038/srep05052

    Figure Lengend Snippet: Primers that anneal far away from the repetitive DNA perform much better in amplifying the desired product. Taq DNA polymerase (NE Biolabs) was used in the PCR amplification of the indicated region of the pdTALE12 plasmid. PCR conditions are given in the supplementary material .

    Article Snippet: Even the use of a non-proofreading but robust DNA polymerase, Taq (NE Biolabs) failed to amplify only the desired fragment ( ).

    Techniques: Polymerase Chain Reaction, Amplification, Plasmid Preparation

    PCR fragments generated upon a typical PCR amplification from the pTAL2 vector with 12.5 TALE DNA-binding repeats. Plasmid map is shown in Supplementary Fig. 3 . Proofreading Pfu polymerase (Bioline) and normal Taq polymerase (NE Biolabs) were used in PCR amplification. PCR conditions are described in the supplementary material .

    Journal: Scientific Reports

    Article Title: PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications

    doi: 10.1038/srep05052

    Figure Lengend Snippet: PCR fragments generated upon a typical PCR amplification from the pTAL2 vector with 12.5 TALE DNA-binding repeats. Plasmid map is shown in Supplementary Fig. 3 . Proofreading Pfu polymerase (Bioline) and normal Taq polymerase (NE Biolabs) were used in PCR amplification. PCR conditions are described in the supplementary material .

    Article Snippet: Even the use of a non-proofreading but robust DNA polymerase, Taq (NE Biolabs) failed to amplify only the desired fragment ( ).

    Techniques: Polymerase Chain Reaction, Generated, Amplification, Plasmid Preparation, Binding Assay

    Testing the generality of the model to other template DNAs with repetitive sequences. (A). GFP-coding sequences were cloned into the pBasicS1 vector and their integrity were checked by sequencing and restriction enzyme digestions. (B). PCR results obtained with primers 390 and 570. Taq DNA polymerase (NE Biolabs) was used in PCR amplification. The arrow indicates the sequenced artifact product which contained only one copy of the GFP lacking the filler sequence. See the supplementary material for PCR conditions.

    Journal: Scientific Reports

    Article Title: PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications

    doi: 10.1038/srep05052

    Figure Lengend Snippet: Testing the generality of the model to other template DNAs with repetitive sequences. (A). GFP-coding sequences were cloned into the pBasicS1 vector and their integrity were checked by sequencing and restriction enzyme digestions. (B). PCR results obtained with primers 390 and 570. Taq DNA polymerase (NE Biolabs) was used in PCR amplification. The arrow indicates the sequenced artifact product which contained only one copy of the GFP lacking the filler sequence. See the supplementary material for PCR conditions.

    Article Snippet: Even the use of a non-proofreading but robust DNA polymerase, Taq (NE Biolabs) failed to amplify only the desired fragment ( ).

    Techniques: Clone Assay, Plasmid Preparation, Sequencing, Polymerase Chain Reaction, Amplification