taq ligase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    New England Biolabs taq ligase
    Taq Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 97/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq ligase/product/New England Biolabs
    Average 97 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    taq ligase - by Bioz Stars, 2020-04
    97/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance
    Article Snippet: Paragraph title: Cloning and expression of CwpV ‐related constructions ... Equimolar ratios of 5′ and 3′ cwpV fragments and linearized pRPF144E were pooled in a total volume of 5 μl and mixed with 15 μl of Gibson enzyme–reagent master mix containing 5% PEG‐8000, 100 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 10 mM DTT, 200 nM each of the four dNTPs, 1 mM NAD, 0.08 U T5 exo (Epicentre), 80 U Taq ligase and 0.5 U Phusion polymerase (NEB).

    Article Title: A split fluorescent reporter with rapid and reversible complementation
    Article Snippet: General Synthetic oligonucleotides used for cloning were purchased from Sigma-Aldrich or Integrated DNA Technology. .. Restriction endonucleases, T4 ligase, Phusion polymerase, Taq ligase, and Taq exonuclease were purchased from New England Biolabs and used with accompanying buffers and according to the manufacturer’s protocols.

    Amplification:

    Article Title: Disease-associated short tandem repeats co-localize with chromatin domain boundaries
    Article Snippet: .. Primers were denatured at 95°C for 5 min and then annealed to the 3C template at 55°C for 16 h. Annealed 5C primers were ligated across HindIII sites via incubation with 10 U of Taq Ligase at 55°C for 1 h. Taq Ligase was then inactivated at 75°C for 10 min. Ligation products were combined with PCR mix (5μl 5x HF buffer, 0.2μl 25mM dNTP, 1.5μl 80μM Emusion forward primers, 1.5μl 80μM Emulsion phosphorylated reverse primers, 0.25μl Phusion polymerase (NEB), 10.55μl water) and amplified in 3 stages: 1 cycle - 95°C for 5 min, 30 cycles - 98°C for 10 s, 62°C for 30 s, 72°C for 30 s, 1 cycle - 72°C for 10 min, 4°C thereafter. .. Size selection of the 100 bp 5C library was performed using AMPure XP beads and library preparation was performed with NEBNext Ultra DNA Library Prep Kit according to manufacturer protocol (NEB #7370).

    Article Title: A load driver device for engineering modularity in biological networks
    Article Snippet: Nucleic acid manipulation AccuPrime Pfx SuperMix from Life Technologies and oligonucleotides manufactured by Integrated DNA Technologies were used for all PCR amplification. .. Taq ligase, NAD+, dNTPs, and Phusion Polymerase from New England Biolabs and T5 Exonucelase from Epicentre Biotechnologies were used for Gibson assembly reactions .

    Article Title: 5C analysis of the Epidermal Differentiation Complex locus reveals distinct chromatin interaction networks between gene-rich and gene-poor TADs in skin epithelial cells
    Article Snippet: The annealed probes were nick ligated with 10 U of Taq ligase in 1x Taq ligase buffer (New England Biolabs) at 48°C for 1 hour. .. The resulting 5C library was amplified by PCR with 25 cycles using universal T7 (TAATACGACTCACTATAGCC) and T3 (TATTAACCCTCACTAAAGGGA) primers.

    Article Title: Genome Location Dictates the Transcriptional Response to PolC Inhibition in Clostridium difficile
    Article Snippet: The plasmid backbone of pAP24 was linearized by PCR using primers oWKS-1580/oWKS-1582, and the predicted promoter areas of CD0350, CD2962, CD3614, and CD0007 were amplified with primers oIB-80/oIB-94, oIB-82/oIB-95, oIB-92/oIB-100, and oPH-19/oPH-20, respectively. .. For the assembly, 100 ng of vector DNA was assembled to a 5-fold molar excess of the PCR fragment of the desired promoter using a homemade Gibson Assembly master mix at 50°C for 30 min (final concentrations, 4 U/μl Taq ligase [Westburg], 0.004 U/μl T5 exonuclease [New England BioLabs], 0.025 U/μl Phusion polymerase [Bioké], 5% polyethylene glycol 8000 [PEG-8000], 10 mM MgCl2 , 100 mM Tris-HCl [pH 7.5], 10 mM dithiothreitol, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dCTP, 0.2 mM dGTP, and 1 mM β-NAD) and transformed into E. coli DH5α.

    Construct:

    Article Title: The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance
    Article Snippet: Equimolar ratios of 5′ and 3′ cwpV fragments and linearized pRPF144E were pooled in a total volume of 5 μl and mixed with 15 μl of Gibson enzyme–reagent master mix containing 5% PEG‐8000, 100 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 10 mM DTT, 200 nM each of the four dNTPs, 1 mM NAD, 0.08 U T5 exo (Epicentre), 80 U Taq ligase and 0.5 U Phusion polymerase (NEB). .. Positive clones carrying the correct constructs were verified by DNA sequencing and subsequently transferred by conjugation into C. difficile R20291OFF as described previously (Sekulovic and Fortier, ).

    Article Title: 5C analysis of the Epidermal Differentiation Complex locus reveals distinct chromatin interaction networks between gene-rich and gene-poor TADs in skin epithelial cells
    Article Snippet: To construct 5C libraries, first probes were annealed to the 3C templates at 48°C for 16 hours. .. The annealed probes were nick ligated with 10 U of Taq ligase in 1x Taq ligase buffer (New England Biolabs) at 48°C for 1 hour.

    Article Title: Genome Location Dictates the Transcriptional Response to PolC Inhibition in Clostridium difficile
    Article Snippet: Plasmids pIB68 (PCD0350 ), pIB69 (PCD2963 ), pIB74 (PCD3614 ), and pPH28 (PCD0007 ) were constructed using a Gibson assembly ( ). .. For the assembly, 100 ng of vector DNA was assembled to a 5-fold molar excess of the PCR fragment of the desired promoter using a homemade Gibson Assembly master mix at 50°C for 30 min (final concentrations, 4 U/μl Taq ligase [Westburg], 0.004 U/μl T5 exonuclease [New England BioLabs], 0.025 U/μl Phusion polymerase [Bioké], 5% polyethylene glycol 8000 [PEG-8000], 10 mM MgCl2 , 100 mM Tris-HCl [pH 7.5], 10 mM dithiothreitol, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dCTP, 0.2 mM dGTP, and 1 mM β-NAD) and transformed into E. coli DH5α.

    Incubation:

    Article Title: Disease-associated short tandem repeats co-localize with chromatin domain boundaries
    Article Snippet: .. Primers were denatured at 95°C for 5 min and then annealed to the 3C template at 55°C for 16 h. Annealed 5C primers were ligated across HindIII sites via incubation with 10 U of Taq Ligase at 55°C for 1 h. Taq Ligase was then inactivated at 75°C for 10 min. Ligation products were combined with PCR mix (5μl 5x HF buffer, 0.2μl 25mM dNTP, 1.5μl 80μM Emusion forward primers, 1.5μl 80μM Emulsion phosphorylated reverse primers, 0.25μl Phusion polymerase (NEB), 10.55μl water) and amplified in 3 stages: 1 cycle - 95°C for 5 min, 30 cycles - 98°C for 10 s, 62°C for 30 s, 72°C for 30 s, 1 cycle - 72°C for 10 min, 4°C thereafter. .. Size selection of the 100 bp 5C library was performed using AMPure XP beads and library preparation was performed with NEBNext Ultra DNA Library Prep Kit according to manufacturer protocol (NEB #7370).

    Article Title: The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance
    Article Snippet: Equimolar ratios of 5′ and 3′ cwpV fragments and linearized pRPF144E were pooled in a total volume of 5 μl and mixed with 15 μl of Gibson enzyme–reagent master mix containing 5% PEG‐8000, 100 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 10 mM DTT, 200 nM each of the four dNTPs, 1 mM NAD, 0.08 U T5 exo (Epicentre), 80 U Taq ligase and 0.5 U Phusion polymerase (NEB). .. The reaction mix was incubated at 50°C for 1 h, and 1 μl was used to transform E. coli CA434 competent cells using standard procedures (Sambrook and Russell, ).

    Luciferase:

    Article Title: Genome Location Dictates the Transcriptional Response to PolC Inhibition in Clostridium difficile
    Article Snippet: Paragraph title: Construction of luciferase-reporter fusion plasmids. ... For the assembly, 100 ng of vector DNA was assembled to a 5-fold molar excess of the PCR fragment of the desired promoter using a homemade Gibson Assembly master mix at 50°C for 30 min (final concentrations, 4 U/μl Taq ligase [Westburg], 0.004 U/μl T5 exonuclease [New England BioLabs], 0.025 U/μl Phusion polymerase [Bioké], 5% polyethylene glycol 8000 [PEG-8000], 10 mM MgCl2 , 100 mM Tris-HCl [pH 7.5], 10 mM dithiothreitol, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dCTP, 0.2 mM dGTP, and 1 mM β-NAD) and transformed into E. coli DH5α.

    Expressing:

    Article Title: The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance
    Article Snippet: Paragraph title: Cloning and expression of CwpV ‐related constructions ... Equimolar ratios of 5′ and 3′ cwpV fragments and linearized pRPF144E were pooled in a total volume of 5 μl and mixed with 15 μl of Gibson enzyme–reagent master mix containing 5% PEG‐8000, 100 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 10 mM DTT, 200 nM each of the four dNTPs, 1 mM NAD, 0.08 U T5 exo (Epicentre), 80 U Taq ligase and 0.5 U Phusion polymerase (NEB).

    Modification:

    Article Title: The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance
    Article Snippet: A Gibson isothermal assembly procedure (Gibson et al ., ) was then used to clone the two PCR fragments into a modified pRPF144 backbone. .. Equimolar ratios of 5′ and 3′ cwpV fragments and linearized pRPF144E were pooled in a total volume of 5 μl and mixed with 15 μl of Gibson enzyme–reagent master mix containing 5% PEG‐8000, 100 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 10 mM DTT, 200 nM each of the four dNTPs, 1 mM NAD, 0.08 U T5 exo (Epicentre), 80 U Taq ligase and 0.5 U Phusion polymerase (NEB).

    Transformation Assay:

    Article Title: Genome Location Dictates the Transcriptional Response to PolC Inhibition in Clostridium difficile
    Article Snippet: .. For the assembly, 100 ng of vector DNA was assembled to a 5-fold molar excess of the PCR fragment of the desired promoter using a homemade Gibson Assembly master mix at 50°C for 30 min (final concentrations, 4 U/μl Taq ligase [Westburg], 0.004 U/μl T5 exonuclease [New England BioLabs], 0.025 U/μl Phusion polymerase [Bioké], 5% polyethylene glycol 8000 [PEG-8000], 10 mM MgCl2 , 100 mM Tris-HCl [pH 7.5], 10 mM dithiothreitol, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dCTP, 0.2 mM dGTP, and 1 mM β-NAD) and transformed into E. coli DH5α. .. Transformants were screened by colony PCR using primers oWKS-1240/oWKS-1241.

    Conjugation Assay:

    Article Title: The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance
    Article Snippet: Equimolar ratios of 5′ and 3′ cwpV fragments and linearized pRPF144E were pooled in a total volume of 5 μl and mixed with 15 μl of Gibson enzyme–reagent master mix containing 5% PEG‐8000, 100 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 10 mM DTT, 200 nM each of the four dNTPs, 1 mM NAD, 0.08 U T5 exo (Epicentre), 80 U Taq ligase and 0.5 U Phusion polymerase (NEB). .. Positive clones carrying the correct constructs were verified by DNA sequencing and subsequently transferred by conjugation into C. difficile R20291OFF as described previously (Sekulovic and Fortier, ).

    Ligation:

    Article Title: Disease-associated short tandem repeats co-localize with chromatin domain boundaries
    Article Snippet: .. Primers were denatured at 95°C for 5 min and then annealed to the 3C template at 55°C for 16 h. Annealed 5C primers were ligated across HindIII sites via incubation with 10 U of Taq Ligase at 55°C for 1 h. Taq Ligase was then inactivated at 75°C for 10 min. Ligation products were combined with PCR mix (5μl 5x HF buffer, 0.2μl 25mM dNTP, 1.5μl 80μM Emusion forward primers, 1.5μl 80μM Emulsion phosphorylated reverse primers, 0.25μl Phusion polymerase (NEB), 10.55μl water) and amplified in 3 stages: 1 cycle - 95°C for 5 min, 30 cycles - 98°C for 10 s, 62°C for 30 s, 72°C for 30 s, 1 cycle - 72°C for 10 min, 4°C thereafter. .. Size selection of the 100 bp 5C library was performed using AMPure XP beads and library preparation was performed with NEBNext Ultra DNA Library Prep Kit according to manufacturer protocol (NEB #7370).

    Article Title: 5C analysis of the Epidermal Differentiation Complex locus reveals distinct chromatin interaction networks between gene-rich and gene-poor TADs in skin epithelial cells
    Article Snippet: The annealed probes were nick ligated with 10 U of Taq ligase in 1x Taq ligase buffer (New England Biolabs) at 48°C for 1 hour. .. 15 ligation reactions amplified in 6 PCR reactions each were performed to generate each 5C library.

    DNA Sequencing:

    Article Title: The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance
    Article Snippet: Equimolar ratios of 5′ and 3′ cwpV fragments and linearized pRPF144E were pooled in a total volume of 5 μl and mixed with 15 μl of Gibson enzyme–reagent master mix containing 5% PEG‐8000, 100 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 10 mM DTT, 200 nM each of the four dNTPs, 1 mM NAD, 0.08 U T5 exo (Epicentre), 80 U Taq ligase and 0.5 U Phusion polymerase (NEB). .. Positive clones carrying the correct constructs were verified by DNA sequencing and subsequently transferred by conjugation into C. difficile R20291OFF as described previously (Sekulovic and Fortier, ).

    Polymerase Chain Reaction:

    Article Title: Disease-associated short tandem repeats co-localize with chromatin domain boundaries
    Article Snippet: .. Primers were denatured at 95°C for 5 min and then annealed to the 3C template at 55°C for 16 h. Annealed 5C primers were ligated across HindIII sites via incubation with 10 U of Taq Ligase at 55°C for 1 h. Taq Ligase was then inactivated at 75°C for 10 min. Ligation products were combined with PCR mix (5μl 5x HF buffer, 0.2μl 25mM dNTP, 1.5μl 80μM Emusion forward primers, 1.5μl 80μM Emulsion phosphorylated reverse primers, 0.25μl Phusion polymerase (NEB), 10.55μl water) and amplified in 3 stages: 1 cycle - 95°C for 5 min, 30 cycles - 98°C for 10 s, 62°C for 30 s, 72°C for 30 s, 1 cycle - 72°C for 10 min, 4°C thereafter. .. Size selection of the 100 bp 5C library was performed using AMPure XP beads and library preparation was performed with NEBNext Ultra DNA Library Prep Kit according to manufacturer protocol (NEB #7370).

    Article Title: The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance
    Article Snippet: A Gibson isothermal assembly procedure (Gibson et al ., ) was then used to clone the two PCR fragments into a modified pRPF144 backbone. .. Equimolar ratios of 5′ and 3′ cwpV fragments and linearized pRPF144E were pooled in a total volume of 5 μl and mixed with 15 μl of Gibson enzyme–reagent master mix containing 5% PEG‐8000, 100 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 10 mM DTT, 200 nM each of the four dNTPs, 1 mM NAD, 0.08 U T5 exo (Epicentre), 80 U Taq ligase and 0.5 U Phusion polymerase (NEB).

    Article Title: A split fluorescent reporter with rapid and reversible complementation
    Article Snippet: PCR products were purified using QIAquick PCR purification kit (Qiagen). .. Restriction endonucleases, T4 ligase, Phusion polymerase, Taq ligase, and Taq exonuclease were purchased from New England Biolabs and used with accompanying buffers and according to the manufacturer’s protocols.

    Article Title: A load driver device for engineering modularity in biological networks
    Article Snippet: Oligonucleotides used in PCR are listed in , used for sequencing are listed in , and used to generate yeast knock-out are listed in . .. Taq ligase, NAD+, dNTPs, and Phusion Polymerase from New England Biolabs and T5 Exonucelase from Epicentre Biotechnologies were used for Gibson assembly reactions .

    Article Title: 5C analysis of the Epidermal Differentiation Complex locus reveals distinct chromatin interaction networks between gene-rich and gene-poor TADs in skin epithelial cells
    Article Snippet: The annealed probes were nick ligated with 10 U of Taq ligase in 1x Taq ligase buffer (New England Biolabs) at 48°C for 1 hour. .. The resulting 5C library was amplified by PCR with 25 cycles using universal T7 (TAATACGACTCACTATAGCC) and T3 (TATTAACCCTCACTAAAGGGA) primers.

    Article Title: Genome Location Dictates the Transcriptional Response to PolC Inhibition in Clostridium difficile
    Article Snippet: .. For the assembly, 100 ng of vector DNA was assembled to a 5-fold molar excess of the PCR fragment of the desired promoter using a homemade Gibson Assembly master mix at 50°C for 30 min (final concentrations, 4 U/μl Taq ligase [Westburg], 0.004 U/μl T5 exonuclease [New England BioLabs], 0.025 U/μl Phusion polymerase [Bioké], 5% polyethylene glycol 8000 [PEG-8000], 10 mM MgCl2 , 100 mM Tris-HCl [pH 7.5], 10 mM dithiothreitol, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dCTP, 0.2 mM dGTP, and 1 mM β-NAD) and transformed into E. coli DH5α. .. Transformants were screened by colony PCR using primers oWKS-1240/oWKS-1241.

    Binding Assay:

    Article Title: The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance
    Article Snippet: A 3′ fragment downstream of the signal peptide and including the N‐terminal cell wall binding domain, C‐terminal repeats and a putative transcriptional terminator was PCR‐amplified with primers LCF 943 and LCF 944. .. Equimolar ratios of 5′ and 3′ cwpV fragments and linearized pRPF144E were pooled in a total volume of 5 μl and mixed with 15 μl of Gibson enzyme–reagent master mix containing 5% PEG‐8000, 100 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 10 mM DTT, 200 nM each of the four dNTPs, 1 mM NAD, 0.08 U T5 exo (Epicentre), 80 U Taq ligase and 0.5 U Phusion polymerase (NEB).

    DNA Extraction:

    Article Title: Disease-associated short tandem repeats co-localize with chromatin domain boundaries
    Article Snippet: Prior to DNA extraction, RNaseA was used to degrade RNA. .. Primers were denatured at 95°C for 5 min and then annealed to the 3C template at 55°C for 16 h. Annealed 5C primers were ligated across HindIII sites via incubation with 10 U of Taq Ligase at 55°C for 1 h. Taq Ligase was then inactivated at 75°C for 10 min. Ligation products were combined with PCR mix (5μl 5x HF buffer, 0.2μl 25mM dNTP, 1.5μl 80μM Emusion forward primers, 1.5μl 80μM Emulsion phosphorylated reverse primers, 0.25μl Phusion polymerase (NEB), 10.55μl water) and amplified in 3 stages: 1 cycle - 95°C for 5 min, 30 cycles - 98°C for 10 s, 62°C for 30 s, 72°C for 30 s, 1 cycle - 72°C for 10 min, 4°C thereafter.

    Nucleic Acid Electrophoresis:

    Article Title: A split fluorescent reporter with rapid and reversible complementation
    Article Snippet: The products of restriction enzyme digests were purified by preparative gel electrophoresis followed by QIAquick gel extraction kit (Qiagen). .. Restriction endonucleases, T4 ligase, Phusion polymerase, Taq ligase, and Taq exonuclease were purchased from New England Biolabs and used with accompanying buffers and according to the manufacturer’s protocols.

    Isolation:

    Article Title: A split fluorescent reporter with rapid and reversible complementation
    Article Snippet: Restriction endonucleases, T4 ligase, Phusion polymerase, Taq ligase, and Taq exonuclease were purchased from New England Biolabs and used with accompanying buffers and according to the manufacturer’s protocols. .. Small-scale isolation of plasmid DNA was done using QIAprep miniprep kit (Qiagen) from 2 mL of overnight culture.

    Purification:

    Article Title: The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance
    Article Snippet: The plasmid was linearized with BamHI and purified by EZ‐10 spin column DNA cleanup kit (BioBasic). .. Equimolar ratios of 5′ and 3′ cwpV fragments and linearized pRPF144E were pooled in a total volume of 5 μl and mixed with 15 μl of Gibson enzyme–reagent master mix containing 5% PEG‐8000, 100 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 10 mM DTT, 200 nM each of the four dNTPs, 1 mM NAD, 0.08 U T5 exo (Epicentre), 80 U Taq ligase and 0.5 U Phusion polymerase (NEB).

    Article Title: A split fluorescent reporter with rapid and reversible complementation
    Article Snippet: The products of restriction enzyme digests were purified by preparative gel electrophoresis followed by QIAquick gel extraction kit (Qiagen). .. Restriction endonucleases, T4 ligase, Phusion polymerase, Taq ligase, and Taq exonuclease were purchased from New England Biolabs and used with accompanying buffers and according to the manufacturer’s protocols.

    Sequencing:

    Article Title: Disease-associated short tandem repeats co-localize with chromatin domain boundaries
    Article Snippet: Paragraph title: 5C library generation and sequencing ... Primers were denatured at 95°C for 5 min and then annealed to the 3C template at 55°C for 16 h. Annealed 5C primers were ligated across HindIII sites via incubation with 10 U of Taq Ligase at 55°C for 1 h. Taq Ligase was then inactivated at 75°C for 10 min. Ligation products were combined with PCR mix (5μl 5x HF buffer, 0.2μl 25mM dNTP, 1.5μl 80μM Emusion forward primers, 1.5μl 80μM Emulsion phosphorylated reverse primers, 0.25μl Phusion polymerase (NEB), 10.55μl water) and amplified in 3 stages: 1 cycle - 95°C for 5 min, 30 cycles - 98°C for 10 s, 62°C for 30 s, 72°C for 30 s, 1 cycle - 72°C for 10 min, 4°C thereafter.

    Article Title: A load driver device for engineering modularity in biological networks
    Article Snippet: Oligonucleotides used in PCR are listed in , used for sequencing are listed in , and used to generate yeast knock-out are listed in . .. Taq ligase, NAD+, dNTPs, and Phusion Polymerase from New England Biolabs and T5 Exonucelase from Epicentre Biotechnologies were used for Gibson assembly reactions .

    Article Title: 5C analysis of the Epidermal Differentiation Complex locus reveals distinct chromatin interaction networks between gene-rich and gene-poor TADs in skin epithelial cells
    Article Snippet: Paragraph title: 5C library construction and sequencing ... The annealed probes were nick ligated with 10 U of Taq ligase in 1x Taq ligase buffer (New England Biolabs) at 48°C for 1 hour.

    Article Title: Genome Location Dictates the Transcriptional Response to PolC Inhibition in Clostridium difficile
    Article Snippet: For the assembly, 100 ng of vector DNA was assembled to a 5-fold molar excess of the PCR fragment of the desired promoter using a homemade Gibson Assembly master mix at 50°C for 30 min (final concentrations, 4 U/μl Taq ligase [Westburg], 0.004 U/μl T5 exonuclease [New England BioLabs], 0.025 U/μl Phusion polymerase [Bioké], 5% polyethylene glycol 8000 [PEG-8000], 10 mM MgCl2 , 100 mM Tris-HCl [pH 7.5], 10 mM dithiothreitol, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dCTP, 0.2 mM dGTP, and 1 mM β-NAD) and transformed into E. coli DH5α. .. Transformants yielding PCR fragments of the correct size were verified by Sanger sequencing.

    Plasmid Preparation:

    Article Title: The Clostridium difficile cell wall protein CwpV confers phase‐variable phage resistance
    Article Snippet: The plasmid was linearized with BamHI and purified by EZ‐10 spin column DNA cleanup kit (BioBasic). .. Equimolar ratios of 5′ and 3′ cwpV fragments and linearized pRPF144E were pooled in a total volume of 5 μl and mixed with 15 μl of Gibson enzyme–reagent master mix containing 5% PEG‐8000, 100 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 10 mM DTT, 200 nM each of the four dNTPs, 1 mM NAD, 0.08 U T5 exo (Epicentre), 80 U Taq ligase and 0.5 U Phusion polymerase (NEB).

    Article Title: A split fluorescent reporter with rapid and reversible complementation
    Article Snippet: Restriction endonucleases, T4 ligase, Phusion polymerase, Taq ligase, and Taq exonuclease were purchased from New England Biolabs and used with accompanying buffers and according to the manufacturer’s protocols. .. Small-scale isolation of plasmid DNA was done using QIAprep miniprep kit (Qiagen) from 2 mL of overnight culture.

    Article Title: Genome Location Dictates the Transcriptional Response to PolC Inhibition in Clostridium difficile
    Article Snippet: .. For the assembly, 100 ng of vector DNA was assembled to a 5-fold molar excess of the PCR fragment of the desired promoter using a homemade Gibson Assembly master mix at 50°C for 30 min (final concentrations, 4 U/μl Taq ligase [Westburg], 0.004 U/μl T5 exonuclease [New England BioLabs], 0.025 U/μl Phusion polymerase [Bioké], 5% polyethylene glycol 8000 [PEG-8000], 10 mM MgCl2 , 100 mM Tris-HCl [pH 7.5], 10 mM dithiothreitol, 0.2 mM dATP, 0.2 mM dTTP, 0.2 mM dCTP, 0.2 mM dGTP, and 1 mM β-NAD) and transformed into E. coli DH5α. .. Transformants were screened by colony PCR using primers oWKS-1240/oWKS-1241.

    Software:

    Article Title: Disease-associated short tandem repeats co-localize with chromatin domain boundaries
    Article Snippet: Double-alternating 5C primers were designed to a 6.4 Mb-sized region around the FMR1 locus in the hg19 reference genome with the my5C primer design software ( ). .. Primers were denatured at 95°C for 5 min and then annealed to the 3C template at 55°C for 16 h. Annealed 5C primers were ligated across HindIII sites via incubation with 10 U of Taq Ligase at 55°C for 1 h. Taq Ligase was then inactivated at 75°C for 10 min. Ligation products were combined with PCR mix (5μl 5x HF buffer, 0.2μl 25mM dNTP, 1.5μl 80μM Emusion forward primers, 1.5μl 80μM Emulsion phosphorylated reverse primers, 0.25μl Phusion polymerase (NEB), 10.55μl water) and amplified in 3 stages: 1 cycle - 95°C for 5 min, 30 cycles - 98°C for 10 s, 62°C for 30 s, 72°C for 30 s, 1 cycle - 72°C for 10 min, 4°C thereafter.

    Multiplex Assay:

    Article Title: 5C analysis of the Epidermal Differentiation Complex locus reveals distinct chromatin interaction networks between gene-rich and gene-poor TADs in skin epithelial cells
    Article Snippet: Each multiplex annealing reaction contained 1xNEBuffer4 (New England Biolabs), 560 ng of 3C template and 0.4 fmole of each 5C probe. .. The annealed probes were nick ligated with 10 U of Taq ligase in 1x Taq ligase buffer (New England Biolabs) at 48°C for 1 hour.

    Selection:

    Article Title: Disease-associated short tandem repeats co-localize with chromatin domain boundaries
    Article Snippet: Primers were denatured at 95°C for 5 min and then annealed to the 3C template at 55°C for 16 h. Annealed 5C primers were ligated across HindIII sites via incubation with 10 U of Taq Ligase at 55°C for 1 h. Taq Ligase was then inactivated at 75°C for 10 min. Ligation products were combined with PCR mix (5μl 5x HF buffer, 0.2μl 25mM dNTP, 1.5μl 80μM Emusion forward primers, 1.5μl 80μM Emulsion phosphorylated reverse primers, 0.25μl Phusion polymerase (NEB), 10.55μl water) and amplified in 3 stages: 1 cycle - 95°C for 5 min, 30 cycles - 98°C for 10 s, 62°C for 30 s, 72°C for 30 s, 1 cycle - 72°C for 10 min, 4°C thereafter. .. Size selection of the 100 bp 5C library was performed using AMPure XP beads and library preparation was performed with NEBNext Ultra DNA Library Prep Kit according to manufacturer protocol (NEB #7370).

    Knock-Out:

    Article Title: A load driver device for engineering modularity in biological networks
    Article Snippet: Oligonucleotides used in PCR are listed in , used for sequencing are listed in , and used to generate yeast knock-out are listed in . .. Taq ligase, NAD+, dNTPs, and Phusion Polymerase from New England Biolabs and T5 Exonucelase from Epicentre Biotechnologies were used for Gibson assembly reactions .

    Gel Extraction:

    Article Title: A split fluorescent reporter with rapid and reversible complementation
    Article Snippet: The products of restriction enzyme digests were purified by preparative gel electrophoresis followed by QIAquick gel extraction kit (Qiagen). .. Restriction endonucleases, T4 ligase, Phusion polymerase, Taq ligase, and Taq exonuclease were purchased from New England Biolabs and used with accompanying buffers and according to the manufacturer’s protocols.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs taq ligase
    Biodyne C membrane-macroarray images obtained for optimization experiments with biotin labeling and different ligase enzymes: (a) pfu DNA ligase, (b) <t>taq</t> DNA ligase, and (c) <t>ampligase.</t>
    Taq Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 80 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq ligase/product/New England Biolabs
    Average 90 stars, based on 80 article reviews
    Price from $9.99 to $1999.99
    taq ligase - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results


    Biodyne C membrane-macroarray images obtained for optimization experiments with biotin labeling and different ligase enzymes: (a) pfu DNA ligase, (b) taq DNA ligase, and (c) ampligase.

    Journal: BioMed Research International

    Article Title: Detection of Food Spoilage and Pathogenic Bacteria Based on Ligation Detection Reaction Coupled to Flow-Through Hybridization on Membranes

    doi: 10.1155/2014/156323

    Figure Lengend Snippet: Biodyne C membrane-macroarray images obtained for optimization experiments with biotin labeling and different ligase enzymes: (a) pfu DNA ligase, (b) taq DNA ligase, and (c) ampligase.

    Article Snippet: Three ligase enzymes were tested: pfu DNA ligase (Stratagene, La Jolla, CA, USA), ampligase (Epicentre, Madison, WI, USA), and taq ligase (New England Biolabs, Beverly, MA, USA).

    Techniques: Labeling

    Synthesis of a functional chloramphenicol acetyltransferase gene with changed codon composition. The ratio r of ‘active clones’ to ‘analyzed clones’ as described in the text is shown for different gene synthesis methods with or without an EMC step. A significant increase of r can be observed only in the cases where EMC is combined with an exonuclease activity present in the reaction or in the later amplification reaction. Prolonged incubation with E.coli endonuclease V results in no detectable product after the amplification steps (ss, single-stranded synthesis, ds, double-stranded synthesis; VII, T4 endonuclease VII; V, E.coli endonuclease V; T, Taq DNA polymerase; and Vn, Vent DNA polymerase).

    Journal: Nucleic Acids Research

    Article Title: Removal of mismatched bases from synthetic genes by enzymatic mismatch cleavage

    doi: 10.1093/nar/gni058

    Figure Lengend Snippet: Synthesis of a functional chloramphenicol acetyltransferase gene with changed codon composition. The ratio r of ‘active clones’ to ‘analyzed clones’ as described in the text is shown for different gene synthesis methods with or without an EMC step. A significant increase of r can be observed only in the cases where EMC is combined with an exonuclease activity present in the reaction or in the later amplification reaction. Prolonged incubation with E.coli endonuclease V results in no detectable product after the amplification steps (ss, single-stranded synthesis, ds, double-stranded synthesis; VII, T4 endonuclease VII; V, E.coli endonuclease V; T, Taq DNA polymerase; and Vn, Vent DNA polymerase).

    Article Snippet: Synthesis of double-stranded DNA was performed by thermal cycling of 10 μl phosphorylated sense oligonucleotides, 10 μl phosphorylated antisense oligonucleotides, 3 μl 10× Taq DNA ligase buffer (NEB) in a total volume of 30 μl.

    Techniques: Functional Assay, Clone Assay, Activity Assay, Amplification, Incubation

    Principle of the SNPWave method. Allele-specific ligation probes are hybridized to denatured genomic DNA. SNP allele discrimination is based on the specificity of the Taq ( Thermus aquaticus ) DNA ligase. ( A and B ) Closed circular probes are formed only

    Journal: Nucleic Acids Research

    Article Title: SNPWaveTM: a flexible multiplexed SNP genotyping technology

    doi: 10.1093/nar/gnh045

    Figure Lengend Snippet: Principle of the SNPWave method. Allele-specific ligation probes are hybridized to denatured genomic DNA. SNP allele discrimination is based on the specificity of the Taq ( Thermus aquaticus ) DNA ligase. ( A and B ) Closed circular probes are formed only

    Article Snippet: Ligation reactions for Arabidopsis polymorphisms were performed in a 25 µl volume containing 625 ng of Arabidopsis DNA, 1× Taq DNA ligase buffer [20 mM Tris–HCl, 25 mM KAc, 10 mM MgAc2 , 10 mM dithiothreitol (DTT), 1 mM NAD, 0.1% Triton X-100; pH 7.6 at 25°C; New England Biolabs Inc., Beverly, MA], 0.2 U/µl Taq DNA ligase (NEB) and 0.05 fmol/µl of each of 200 ligation probes.

    Techniques: Ligation

    FEN1 protein facilitates cccDNA formation in vitro . (A) Schematic presentation of in vitro cccDNA formation assay. Purified NC-DNA (10 8 copies) was incubated with recombinant FEN1, Bst DNA polymerase, and Taq DNA ligase. Following incubation, the DNA was purified and analyzed (B–F). Regions for qPCR amplification (E and F) were indicated as p. The 5.4-kb PstI fragment in HBV plasmid (Control) has a partial HBV sequence but does not have core and intact P genes. (B) cccDNA-selective qPCR. Each result represents the mean ± SEM of three independent experiments. Asterisks indicate statistically significant differences; *** P

    Journal: PLoS Pathogens

    Article Title: Flap endonuclease 1 is involved in cccDNA formation in the hepatitis B virus

    doi: 10.1371/journal.ppat.1007124

    Figure Lengend Snippet: FEN1 protein facilitates cccDNA formation in vitro . (A) Schematic presentation of in vitro cccDNA formation assay. Purified NC-DNA (10 8 copies) was incubated with recombinant FEN1, Bst DNA polymerase, and Taq DNA ligase. Following incubation, the DNA was purified and analyzed (B–F). Regions for qPCR amplification (E and F) were indicated as p. The 5.4-kb PstI fragment in HBV plasmid (Control) has a partial HBV sequence but does not have core and intact P genes. (B) cccDNA-selective qPCR. Each result represents the mean ± SEM of three independent experiments. Asterisks indicate statistically significant differences; *** P

    Article Snippet: NC-DNA (108 copies) was incubated with 32 units (U) of Thermostable FEN1 in ThermoPol Buffer (New England Biolabs) at 65°C for 10 min, followed by incubation with 8 U of Bst DNA polymerase, 40 U of Taq DNA ligase, 100 μM dNTPs, and NAD+ (all from New England Biolabs).

    Techniques: In Vitro, Tube Formation Assay, Purification, Incubation, Recombinant, Real-time Polymerase Chain Reaction, Amplification, Plasmid Preparation, Sequencing