taq hotstart dna polymerase qiagen  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    HotStarTaq DNA Polymerase
    Description:
    For highly specific amplification with minimal optimization. Kit contents: Qiagen HotStarTaq DNA Polymerase, 250U, 5U/L, 10 min. at 97C. 60 min. at 94C Half-life, 2 to 4 kb/min. at 72C Extension Rate, Genomic DNA and cDNA Sample, Recombinant Enzyme, Extra A Addition, PCR Amplification Reaction Type, High PCR Specificity, For Highly Specific Amplification with Minimal Optimization, Includes HotStarTaq DNA Polymerase, 10x PCR Buffer, 5x Q-Solution, 25mM MgCl2. Benefits: Minimal optimization requirements. High PCR specificity. Easy handling and room-temperature setup
    Catalog Number:
    203203
    Price:
    None
    Category:
    HotStarTaq DNA Polymerase
    Score:
    85
    Buy from Supplier


    Structured Review

    Qiagen taq hotstart dna polymerase qiagen
    HotStarTaq DNA Polymerase
    For highly specific amplification with minimal optimization. Kit contents: Qiagen HotStarTaq DNA Polymerase, 250U, 5U/L, 10 min. at 97C. 60 min. at 94C Half-life, 2 to 4 kb/min. at 72C Extension Rate, Genomic DNA and cDNA Sample, Recombinant Enzyme, Extra A Addition, PCR Amplification Reaction Type, High PCR Specificity, For Highly Specific Amplification with Minimal Optimization, Includes HotStarTaq DNA Polymerase, 10x PCR Buffer, 5x Q-Solution, 25mM MgCl2. Benefits: Minimal optimization requirements. High PCR specificity. Easy handling and room-temperature setup
    https://www.bioz.com/result/taq hotstart dna polymerase qiagen/product/Qiagen
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    taq hotstart dna polymerase qiagen - by Bioz Stars, 2019-12
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Ddx42p--a human DEAD box protein with RNA chaperone activities
    Article Snippet: HotStarTaq DNA polymerase was obtained from Qiagen. .. First strand cDNA synthesis and PCR were performed according to manufacturer's instructions.

    Article Title: Population Bottlenecks during the Infectious Cycle of the Lyme Disease Spirochete Borrelia burgdorferi
    Article Snippet: Seven PCR primer pairs specific for the unique tag in each BbITS clone ( ) were used individually with HotStarTaq DNA Polymerase (Qiagen) and the manufacturer's reagents and recommended reaction conditions. .. The following PCR parameters were used: an initial denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 45 seconds, 55°C for 45 seconds, 72°C for 1 minute, and a final extension at 72°C for 10 minutes.

    Centrifugation:

    Article Title: The Chromatin "Landscape" of a Murine Adult ?-Globin Gene Is Unaffected by Deletion of Either the Gene Promoter or a Downstream Enhancer
    Article Snippet: Genotyping PCR was performed using the HotStarTaq kit (Qiagen ) with primers that either spanned the deletion or were located within it, in order to distinguish wildtype from mutants. .. Genotyping PCR was performed using the HotStarTaq kit (Qiagen ) with primers that either spanned the deletion or were located within it, in order to distinguish wildtype from mutants.

    Amplification:

    Article Title: An Intrinsic Propensity of Murine Peritoneal B1b Cells to Switch to IgA in Presence of TGF-? and Retinoic Acid
    Article Snippet: DNase (Qiagen) treated RNA was reverse transcribed using oligo-d(T)12–18 (Thermo Scientific) and RevertAid™ reverse transcriptase (Fermentas). .. PCR amplification of cDNA was performed using HotstarTaq™ DNA polymerase (Qiagen). and the following primers: Igµ/α heavy chain variable (VH) region, for VHcons 5′-GAGGTGCAGCTGCAGGAGTCTGG-3′ rev Cµ2 5′-CATTTGGGAAGGACTGA-3′ or Cα2 5′-GAGCTGGTGGGAGTGTCAGTG-3′ . .. RT-PCR products of IgVH chain transcripts from 4 days cultured cells were cloned using TOPO TA Cloning® kit (Invitrogen) following manufacturer's protocol.

    Article Title: Distribution of selected gene polymorphisms of UGT1A1 in a Saudi population
    Article Snippet: DNA extraction was carried out using Puregene Blood Core Kit C (Qiagen, Germantown, MD, USA) following the manufacturer's instructions and quantified using a Nanodrop 2000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). .. The indicated polymorphic variants were amplified in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City CA, USA) in a total volume of 25 µl, containing 20 ng DNA, 0.25 µl (2.5 mM) of dNTPs (Epicentre Biotechnologies, Madison, WI, USA), 2 µl (10 pM) of primers (Metabion, Martinsried, Germany) and 0.3 µl (5 U/µl) of HotstarTaq DNA polymerase (Qiagen, Germantown, MD, USA). .. For PCR, an initial denaturation step at 95°C for 10 min was followed by 35 cycles of denaturation at 94°C for 40 s, annealing at the indicated temperature for 40 s, and extension at 72°C for 45 s, followed by a final extension step of 72°C for 10 min. Primer sequences and their annealing temperatures are listed in .

    Article Title: Population Bottlenecks during the Infectious Cycle of the Lyme Disease Spirochete Borrelia burgdorferi
    Article Snippet: Seven PCR primer pairs specific for the unique tag in each BbITS clone ( ) were used individually with HotStarTaq DNA Polymerase (Qiagen) and the manufacturer's reagents and recommended reaction conditions. .. The following PCR parameters were used: an initial denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 45 seconds, 55°C for 45 seconds, 72°C for 1 minute, and a final extension at 72°C for 10 minutes.

    Article Title: Global DNA Hypermethylation in Down Syndrome Placenta
    Article Snippet: Briefly, bisulfite conversion was performed on 1 µg genomic DNA with the EZ DNA Methylation-Gold Kit (Zymo Research, USA). .. The converted DNA was amplified using HotStarTaq DNA Polymerase Kit (QIAGEN GmbH), with 1× reaction buffer, 1.5 or 2.5 mM of additional MgCl2 , 200 µM of dNTP mix, 200 nM each of forward and reverse primers , and 1 unit of HotStarTaq DNA polymerase. .. The thermocycling condition was 15 min at 94°C for heat activation, and 50 cycles of 20 sec at 94°C, 30 sec at 50 or 55°C and 1 min at 72°C, followed by a 3 min final extension at 72°C.

    Article Title: Genome amplification of single sperm using multiple displacement amplification
    Article Snippet: A 20 μl mixture was prepared for each reaction and included 1× HotStarTaq buffer, 2.5 mM Mg2+ , 0.2 mM dNTP, 0.3 μM of each primer, 1 U HotStarTaq polymerase (Qiagen Inc.) and 1 μl template DNA. .. A 20 μl mixture was prepared for each reaction and included 1× HotStarTaq buffer, 2.5 mM Mg2+ , 0.2 mM dNTP, 0.3 μM of each primer, 1 U HotStarTaq polymerase (Qiagen Inc.) and 1 μl template DNA.

    Article Title: Detection of TP53 R249 Mutation in Iranian Patients with Pancreatic Cancer
    Article Snippet: DNA was extracted from 200 μ L of plasma using a QiAamp blood kit (Qiagen Company) according to the manufacturer procedure. .. The standard PCR was performed in a total volume of 50 μ L as described previously [ ] in which 50 ng template DNA, 10 pmol of each primer (sense: 5-CTTGCCACAGGTCTCCCCAA-3 and antisense: 5-AGGGGTCAGCGGCAAGCAGA-3), 0.25 mM of each dNTP, 2.5 mM MgCl2 , 5 units of HotStarTaq polymerase (Qiagen), and the appropriate volume of H2 O were used for amplification of a 236 bp region of exon 7 of the p53 gene in a “Touchdown” PCR program. .. The thermocycling conditions were 1 cycle of denaturation (5 min at 94°C), 20 cycles of denaturation (94°C for 45 s), annealing (63°C for 45 s, with –0.5°C per cycle), and extension (72°C for 1 min), followed by 30 cycles of denaturation (94°C for 45 s), annealing (60°C, 45 s), and extension (72°C for 1 min), and a final extension cycle of 72°C for 10 min.

    Article Title: Surveillance of Bovine Tuberculosis and Risk Estimation of a Future Reservoir Formation in Wildlife in Switzerland and Liechtenstein
    Article Snippet: If DNA specific for MTBC mycobacteria was successfully amplified from cultured material, genotyping was performed using the GenoType® MTBC kit (HainLifescience GmbH, Nehren, Germany) according to the manufacturer's protocol. .. Briefly, PCR amplification was carried out in reaction mixtures containing 35 μl of primer-nucleotide-mix (Hain Lifescience GmbH, Nehren, Germany), 5 μl 10x PCR buffer for HotStarTaq (Qiagen GmbH, Hilden, Germany), 2 μl 25 mM MgCl2 solution (Qiagen GmbH, Hilden, Germany), 0.2 μl HotStarTaq (Qiagen GmbH, Hilden, Germany), 3 μl H2 O and 5 μl of DNA positively tested in the PCR assay. .. Reverse hybridization of the amplified products was performed and the test strips were interpreted, both in accordance with the protocol provided by the manufacturer.

    Article Title: Tumor Development, Growth Characteristics and Spectrum of Genetic Aberrations in the TH-MYCN Mouse Model of Neuroblastoma
    Article Snippet: The MYCN insert was amplified using the forward primer 5′nmyc 1 and reverse primer 3′nmyc 1, as outlined above. .. Amplification was performed in a 20 µL total volume of reaction, containing 2.5 units of HotStarTaq (Qiagen), 40 ng DNA, 0.5 µM of each primer and Q solution (Qiagen). .. PCR products were separated by 1.5% agarose gel electrophoresis and photographed under UV light.

    Positive Control:

    Article Title: DNA methylation in interleukin-11 predicts clinical response to antidepressants in GENDEP
    Article Snippet: For each 10 μl reaction, the polymerase chain reaction mastermix consisted of the following: 1 μl 10 × buffer (Qiagen, Crawley, UK), 0.2 μl dNTPs (10 μM ; Thermo Scientific, Northumberland, UK), 0.2 μl MgCl2 (Thermo Scientific, UK), 0.1 μl HotStarTaq Polymerase (Qiagen), 1 μl IL11 forward primer (Sigma-Aldrich, Poole, UK), 1 μl IL11 reverse primer (Sigma-Aldrich), 2 μl DNA and 4.5 μl water. .. Thermal cycling conditions consisted of an initial enzyme activation stage (95 °C for 10 min); followed by 35 cycles of denaturation (95 °C for 30 s), hybridization (58 °C for 30 s) and extension (72 °C for 1 min); and a final single-extension step (72 °C for 4 min) and cool-down step (4 °C for 10 min).

    Electrophoresis:

    Article Title: Ddx42p--a human DEAD box protein with RNA chaperone activities
    Article Snippet: HotStarTaq DNA polymerase was obtained from Qiagen. .. First strand cDNA synthesis and PCR were performed according to manufacturer's instructions.

    Article Title: Distribution of selected gene polymorphisms of UGT1A1 in a Saudi population
    Article Snippet: The indicated polymorphic variants were amplified in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City CA, USA) in a total volume of 25 µl, containing 20 ng DNA, 0.25 µl (2.5 mM) of dNTPs (Epicentre Biotechnologies, Madison, WI, USA), 2 µl (10 pM) of primers (Metabion, Martinsried, Germany) and 0.3 µl (5 U/µl) of HotstarTaq DNA polymerase (Qiagen, Germantown, MD, USA). .. The indicated polymorphic variants were amplified in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City CA, USA) in a total volume of 25 µl, containing 20 ng DNA, 0.25 µl (2.5 mM) of dNTPs (Epicentre Biotechnologies, Madison, WI, USA), 2 µl (10 pM) of primers (Metabion, Martinsried, Germany) and 0.3 µl (5 U/µl) of HotstarTaq DNA polymerase (Qiagen, Germantown, MD, USA).

    Incubation:

    Article Title: Detection of TP53 R249 Mutation in Iranian Patients with Pancreatic Cancer
    Article Snippet: The standard PCR was performed in a total volume of 50 μ L as described previously [ ] in which 50 ng template DNA, 10 pmol of each primer (sense: 5-CTTGCCACAGGTCTCCCCAA-3 and antisense: 5-AGGGGTCAGCGGCAAGCAGA-3), 0.25 mM of each dNTP, 2.5 mM MgCl2 , 5 units of HotStarTaq polymerase (Qiagen), and the appropriate volume of H2 O were used for amplification of a 236 bp region of exon 7 of the p53 gene in a “Touchdown” PCR program. .. However mutation at codon 249 would lose the HaeIII restriction endonuclease site.

    Article Title: Intratumoral genetic heterogeneity in metastatic melanoma is accompanied by variation in malignant behaviors
    Article Snippet: For UDG treatment, 0.5 × UDG buffer and 0.5 U of uracil-DNA glycosylase (New England Biolabs) were added to the PCR master mix. .. The same PCR conditions were used except an addition of initial incubation at 37°C for 30 min before the activation of HotStarTaq polymerase. .. A PIK3CA E549D mutation detected at a low frequency (4%) in the Core 2 of Tumor 2 by AmpliSeq was analysed by limited copy number (LCN)-HRM [ ].

    Infection:

    Article Title: Population Bottlenecks during the Infectious Cycle of the Lyme Disease Spirochete Borrelia burgdorferi
    Article Snippet: Genomic DNA was extracted from B. burgdorferi directly cultured from infected mouse tissues or crushed ticks (8 ml at 108 /ml) using the Wizard genomic DNA kit (Promega) per the manufacturer's instructions. .. Seven PCR primer pairs specific for the unique tag in each BbITS clone ( ) were used individually with HotStarTaq DNA Polymerase (Qiagen) and the manufacturer's reagents and recommended reaction conditions.

    Touchdown PCR:

    Article Title: Detection of TP53 R249 Mutation in Iranian Patients with Pancreatic Cancer
    Article Snippet: DNA was extracted from 200 μ L of plasma using a QiAamp blood kit (Qiagen Company) according to the manufacturer procedure. .. The standard PCR was performed in a total volume of 50 μ L as described previously [ ] in which 50 ng template DNA, 10 pmol of each primer (sense: 5-CTTGCCACAGGTCTCCCCAA-3 and antisense: 5-AGGGGTCAGCGGCAAGCAGA-3), 0.25 mM of each dNTP, 2.5 mM MgCl2 , 5 units of HotStarTaq polymerase (Qiagen), and the appropriate volume of H2 O were used for amplification of a 236 bp region of exon 7 of the p53 gene in a “Touchdown” PCR program. .. The thermocycling conditions were 1 cycle of denaturation (5 min at 94°C), 20 cycles of denaturation (94°C for 45 s), annealing (63°C for 45 s, with –0.5°C per cycle), and extension (72°C for 1 min), followed by 30 cycles of denaturation (94°C for 45 s), annealing (60°C, 45 s), and extension (72°C for 1 min), and a final extension cycle of 72°C for 10 min.

    Modification:

    Article Title: The loss of NKX3.1 expression in testicular - and prostate - cancers is not caused by promoter hypermethylation
    Article Snippet: Bisulphite sequencing allows a positive display of 5-methyl cytosines in the gene promoter after bisulphite modification as unmethylated cytosines appear as thymines, while 5-methylcytosines appear as cytosines in the final sequence [ ]. .. The Mg2+ content of the reaction was 1.3 mM, the enzyme used was HotStarTaq™ DNA polymerase (QIAGEN Inc., Valencia, CA, USA), and the annealing temperature 52°C.

    Western Blot:

    Article Title: Ddx42p--a human DEAD box protein with RNA chaperone activities
    Article Snippet: HotStarTaq DNA polymerase was obtained from Qiagen. .. First strand cDNA synthesis and PCR were performed according to manufacturer's instructions.

    Bisulfite Sequencing:

    Article Title: The loss of NKX3.1 expression in testicular - and prostate - cancers is not caused by promoter hypermethylation
    Article Snippet: Paragraph title: Bisulphite sequencing ... The Mg2+ content of the reaction was 1.3 mM, the enzyme used was HotStarTaq™ DNA polymerase (QIAGEN Inc., Valencia, CA, USA), and the annealing temperature 52°C.

    Cell Culture:

    Article Title: Population Bottlenecks during the Infectious Cycle of the Lyme Disease Spirochete Borrelia burgdorferi
    Article Snippet: Genomic DNA was extracted from B. burgdorferi directly cultured from infected mouse tissues or crushed ticks (8 ml at 108 /ml) using the Wizard genomic DNA kit (Promega) per the manufacturer's instructions. .. Seven PCR primer pairs specific for the unique tag in each BbITS clone ( ) were used individually with HotStarTaq DNA Polymerase (Qiagen) and the manufacturer's reagents and recommended reaction conditions.

    Article Title: Surveillance of Bovine Tuberculosis and Risk Estimation of a Future Reservoir Formation in Wildlife in Switzerland and Liechtenstein
    Article Snippet: If DNA specific for MTBC mycobacteria was successfully amplified from cultured material, genotyping was performed using the GenoType® MTBC kit (HainLifescience GmbH, Nehren, Germany) according to the manufacturer's protocol. .. Briefly, PCR amplification was carried out in reaction mixtures containing 35 μl of primer-nucleotide-mix (Hain Lifescience GmbH, Nehren, Germany), 5 μl 10x PCR buffer for HotStarTaq (Qiagen GmbH, Hilden, Germany), 2 μl 25 mM MgCl2 solution (Qiagen GmbH, Hilden, Germany), 0.2 μl HotStarTaq (Qiagen GmbH, Hilden, Germany), 3 μl H2 O and 5 μl of DNA positively tested in the PCR assay.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: An Intrinsic Propensity of Murine Peritoneal B1b Cells to Switch to IgA in Presence of TGF-? and Retinoic Acid
    Article Snippet: Paragraph title: RT-PCR ... PCR amplification of cDNA was performed using HotstarTaq™ DNA polymerase (Qiagen). and the following primers: Igµ/α heavy chain variable (VH) region, for VHcons 5′-GAGGTGCAGCTGCAGGAGTCTGG-3′ rev Cµ2 5′-CATTTGGGAAGGACTGA-3′ or Cα2 5′-GAGCTGGTGGGAGTGTCAGTG-3′ .

    Article Title: Hypersensitive K303R oestrogen receptor-? variant not found in invasive carcinomas
    Article Snippet: These primers are located in exons 4 and 6 of ER-α and generate a 491-bp RT–PCR product. .. PCR reactions contained 2 μl of a 1:20 dilution of the RT reaction, 0.2 mM dNTPs, each primer at 1 μM, 0.5 units of HotstarTaq DNA polymerase (Qiagen) and 1× PCR Buffer (containing 1.5 mM MgCl2 ; Qiagen).

    Multiple Displacement Amplification:

    Article Title: Genome amplification of single sperm using multiple displacement amplification
    Article Snippet: In order to determine the aliquots that were successfully pre-amplified by MDA, three genes—TOP1, P53 and CYP1A2—were selected for PCR testing using 1 μl of 1/5C0 MDA product. .. A 20 μl mixture was prepared for each reaction and included 1× HotStarTaq buffer, 2.5 mM Mg2+ , 0.2 mM dNTP, 0.3 μM of each primer, 1 U HotStarTaq polymerase (Qiagen Inc.) and 1 μl template DNA.

    CpG Methylation Assay:

    Article Title: Early Onset Pre-Eclampsia Is Associated with Altered DNA Methylation of Cortisol-Signalling and Steroidogenic Genes in the Placenta
    Article Snippet: To assess CpG methylation in our extended cohort of controls and cases, placental DNA samples were analysed using bisulfite pyrosequencing. .. PCR reactions consisted of ∼20 ng bisulfite-converted DNA, 1× PCR buffer (Qiagen Ltd.), 0.2 mM dNTPs (Invitrogen, Carlsbad, CA), 0.4 µM forward and reverse primers (Integrated DNA Technologies Inc., Coralville, IA) and 0.18 U DNA polymerase (HotStarTaq, Qiagen Ltd.).

    Sequencing:

    Article Title: The loss of NKX3.1 expression in testicular - and prostate - cancers is not caused by promoter hypermethylation
    Article Snippet: The NKX3.1 bisulphite sequence fragment (Gene bank accession number NT_023666 (minus strand), bases 1914526 to 1914961) was 436 bp long and covered 52 CpG sites in the promoter and first exon of the gene. .. The Mg2+ content of the reaction was 1.3 mM, the enzyme used was HotStarTaq™ DNA polymerase (QIAGEN Inc., Valencia, CA, USA), and the annealing temperature 52°C.

    Article Title: Hypersensitive K303R oestrogen receptor-? variant not found in invasive carcinomas
    Article Snippet: RT–PCR reactions were performed with cDNA-specific primers designed to cross intron–exon boundaries (ERARNA1, 5'-AAG TGG GAA TGA TGA AAG GT-3'; ERARNA2, 5'-CAA GAG CAA GTT AGG AGC AA-3') and that better allowed sequence determination in both directions. .. PCR reactions contained 2 μl of a 1:20 dilution of the RT reaction, 0.2 mM dNTPs, each primer at 1 μM, 0.5 units of HotstarTaq DNA polymerase (Qiagen) and 1× PCR Buffer (containing 1.5 mM MgCl2 ; Qiagen).

    Article Title: Distribution of selected gene polymorphisms of UGT1A1 in a Saudi population
    Article Snippet: The indicated polymorphic variants were amplified in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City CA, USA) in a total volume of 25 µl, containing 20 ng DNA, 0.25 µl (2.5 mM) of dNTPs (Epicentre Biotechnologies, Madison, WI, USA), 2 µl (10 pM) of primers (Metabion, Martinsried, Germany) and 0.3 µl (5 U/µl) of HotstarTaq DNA polymerase (Qiagen, Germantown, MD, USA). .. The PCR amplicons were evaluated by 2% agarose gel electrophoresis and then purified using an MCE-membrane MultiScreen plate (Millipore, Billerica, MA, USA) pre-packed with G-50 superfine Sephadex (GE Healthcare, Piscataway, NJ, USA).

    Article Title: Circadian and Circalunar Clock Interactions in a Marine Annelid
    Article Snippet: Pdu -4-6-photolyase: upper primer: 5′ TTGCACAGCTTTGCAGAGAATCCAC 3′, lower primer: 5′ GATCTAATAACAACAATGAACACATAG 3′ Tm: 58°C (full sequence). .. Fragments of all other genes were first identified by degenerated PCR, and (if necessary) expanded by RACE PCR using QIAGEN Hot Star Taq (203205).

    Article Title: DNA methylation in interleukin-11 predicts clinical response to antidepressants in GENDEP
    Article Snippet: Reverse primers consisted of the following sequence 5′-ACCCATAACTCTACCCCTCTCC-3′. .. For each 10 μl reaction, the polymerase chain reaction mastermix consisted of the following: 1 μl 10 × buffer (Qiagen, Crawley, UK), 0.2 μl dNTPs (10 μM ; Thermo Scientific, Northumberland, UK), 0.2 μl MgCl2 (Thermo Scientific, UK), 0.1 μl HotStarTaq Polymerase (Qiagen), 1 μl IL11 forward primer (Sigma-Aldrich, Poole, UK), 1 μl IL11 reverse primer (Sigma-Aldrich), 2 μl DNA and 4.5 μl water.

    Article Title: Genome amplification of single sperm using multiple displacement amplification
    Article Snippet: Paragraph title: PCR and sequencing analysis ... A 20 μl mixture was prepared for each reaction and included 1× HotStarTaq buffer, 2.5 mM Mg2+ , 0.2 mM dNTP, 0.3 μM of each primer, 1 U HotStarTaq polymerase (Qiagen Inc.) and 1 μl template DNA.

    Article Title: Detection of TP53 R249 Mutation in Iranian Patients with Pancreatic Cancer
    Article Snippet: The standard PCR was performed in a total volume of 50 μ L as described previously [ ] in which 50 ng template DNA, 10 pmol of each primer (sense: 5-CTTGCCACAGGTCTCCCCAA-3 and antisense: 5-AGGGGTCAGCGGCAAGCAGA-3), 0.25 mM of each dNTP, 2.5 mM MgCl2 , 5 units of HotStarTaq polymerase (Qiagen), and the appropriate volume of H2 O were used for amplification of a 236 bp region of exon 7 of the p53 gene in a “Touchdown” PCR program. .. The standard PCR was performed in a total volume of 50 μ L as described previously [ ] in which 50 ng template DNA, 10 pmol of each primer (sense: 5-CTTGCCACAGGTCTCCCCAA-3 and antisense: 5-AGGGGTCAGCGGCAAGCAGA-3), 0.25 mM of each dNTP, 2.5 mM MgCl2 , 5 units of HotStarTaq polymerase (Qiagen), and the appropriate volume of H2 O were used for amplification of a 236 bp region of exon 7 of the p53 gene in a “Touchdown” PCR program.

    Article Title: Early Onset Pre-Eclampsia Is Associated with Altered DNA Methylation of Cortisol-Signalling and Steroidogenic Genes in the Placenta
    Article Snippet: Forward, reverse and sequencing primers for bisulfite converted DNA were designed with the aid of Pyro Q-CpG software (Qiagen Ltd., GmbH, Hilden, Germany; ). .. PCR reactions consisted of ∼20 ng bisulfite-converted DNA, 1× PCR buffer (Qiagen Ltd.), 0.2 mM dNTPs (Invitrogen, Carlsbad, CA), 0.4 µM forward and reverse primers (Integrated DNA Technologies Inc., Coralville, IA) and 0.18 U DNA polymerase (HotStarTaq, Qiagen Ltd.).

    Article Title: Transcriptional Characterization of Porcine Leptin and Leptin Receptor Genes
    Article Snippet: Paragraph title: Promoters Sequence Analyses and Polymorphisms Identification ... PCRs were carried out in a 25 µl final volume containing 100 ng of DNA, 1 unit of polymerase (Biotools) or HotStart polymerase (Quiagen), specific buffer, 2 mM of dNTPs and 0.5 µM of each primer.

    Article Title: Worldwide population genetic structure of the oriental fruit moth (Grapholita molesta), a globally invasive pest
    Article Snippet: Paragraph title: DNA Extraction and Simple Sequence Repeat (SSR) genotyping ... Reactions for these four loci were carried out in a mix of 5.4 μL ddH2 O, 1.0 μL PCR buffer (Qiagen, Hombrechtikon, Switzerland), 2.0 μL dNTPs (2.5 mM, Qiagen), 0.5 μL of each forward and reverse primer (2 μM), 0.1 μL HotstarTaq (5U, Qiagen) and 0.5 μL DNA (10–35 ng⁄ μL).

    Article Title: Tumor Development, Growth Characteristics and Spectrum of Genetic Aberrations in the TH-MYCN Mouse Model of Neuroblastoma
    Article Snippet: Paragraph title: Sequencing ... Amplification was performed in a 20 µL total volume of reaction, containing 2.5 units of HotStarTaq (Qiagen), 40 ng DNA, 0.5 µM of each primer and Q solution (Qiagen).

    Recombinant:

    Article Title: Hypersensitive K303R oestrogen receptor-? variant not found in invasive carcinomas
    Article Snippet: RT reactions incorporated Superscript II Reverse Transcriptase (Invitrogen), 0.5 μg of oligo (dT)17 and 0.5 μl of Prime Recombinant Ribonuclease Inhibitor (Eppendorf). .. PCR reactions contained 2 μl of a 1:20 dilution of the RT reaction, 0.2 mM dNTPs, each primer at 1 μM, 0.5 units of HotstarTaq DNA polymerase (Qiagen) and 1× PCR Buffer (containing 1.5 mM MgCl2 ; Qiagen).

    Cellular Antioxidant Activity Assay:

    Article Title: Hypersensitive K303R oestrogen receptor-? variant not found in invasive carcinomas
    Article Snippet: RT–PCR reactions were performed with cDNA-specific primers designed to cross intron–exon boundaries (ERARNA1, 5'-AAG TGG GAA TGA TGA AAG GT-3'; ERARNA2, 5'-CAA GAG CAA GTT AGG AGC AA-3') and that better allowed sequence determination in both directions. .. PCR reactions contained 2 μl of a 1:20 dilution of the RT reaction, 0.2 mM dNTPs, each primer at 1 μM, 0.5 units of HotstarTaq DNA polymerase (Qiagen) and 1× PCR Buffer (containing 1.5 mM MgCl2 ; Qiagen).

    DNA Extraction:

    Article Title: Distribution of selected gene polymorphisms of UGT1A1 in a Saudi population
    Article Snippet: DNA extraction was carried out using Puregene Blood Core Kit C (Qiagen, Germantown, MD, USA) following the manufacturer's instructions and quantified using a Nanodrop 2000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). .. The indicated polymorphic variants were amplified in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City CA, USA) in a total volume of 25 µl, containing 20 ng DNA, 0.25 µl (2.5 mM) of dNTPs (Epicentre Biotechnologies, Madison, WI, USA), 2 µl (10 pM) of primers (Metabion, Martinsried, Germany) and 0.3 µl (5 U/µl) of HotstarTaq DNA polymerase (Qiagen, Germantown, MD, USA).

    Article Title: Worldwide population genetic structure of the oriental fruit moth (Grapholita molesta), a globally invasive pest
    Article Snippet: Paragraph title: DNA Extraction and Simple Sequence Repeat (SSR) genotyping ... Reactions for these four loci were carried out in a mix of 5.4 μL ddH2 O, 1.0 μL PCR buffer (Qiagen, Hombrechtikon, Switzerland), 2.0 μL dNTPs (2.5 mM, Qiagen), 0.5 μL of each forward and reverse primer (2 μM), 0.1 μL HotstarTaq (5U, Qiagen) and 0.5 μL DNA (10–35 ng⁄ μL).

    Methylation:

    Article Title: The loss of NKX3.1 expression in testicular - and prostate - cancers is not caused by promoter hypermethylation
    Article Snippet: Additionally, NB and IVD were bisulphite sequenced as positive controls for unmethylated and methylated sequence, respectively. .. The Mg2+ content of the reaction was 1.3 mM, the enzyme used was HotStarTaq™ DNA polymerase (QIAGEN Inc., Valencia, CA, USA), and the annealing temperature 52°C.

    Article Title: Global DNA Hypermethylation in Down Syndrome Placenta
    Article Snippet: Briefly, bisulfite conversion was performed on 1 µg genomic DNA with the EZ DNA Methylation-Gold Kit (Zymo Research, USA). .. The converted DNA was amplified using HotStarTaq DNA Polymerase Kit (QIAGEN GmbH), with 1× reaction buffer, 1.5 or 2.5 mM of additional MgCl2 , 200 µM of dNTP mix, 200 nM each of forward and reverse primers , and 1 unit of HotStarTaq DNA polymerase.

    Mutagenesis:

    Article Title: Hypersensitive K303R oestrogen receptor-? variant not found in invasive carcinomas
    Article Snippet: PCR reactions contained 2 μl of a 1:20 dilution of the RT reaction, 0.2 mM dNTPs, each primer at 1 μM, 0.5 units of HotstarTaq DNA polymerase (Qiagen) and 1× PCR Buffer (containing 1.5 mM MgCl2 ; Qiagen). .. PCR cycling conditions were the same as for genomic DNA from breast cancers.

    Article Title: Detection of TP53 R249 Mutation in Iranian Patients with Pancreatic Cancer
    Article Snippet: Paragraph title: 2.3. Amplification of Exon 7 of TP53 and Mutation Detection ... The standard PCR was performed in a total volume of 50 μ L as described previously [ ] in which 50 ng template DNA, 10 pmol of each primer (sense: 5-CTTGCCACAGGTCTCCCCAA-3 and antisense: 5-AGGGGTCAGCGGCAAGCAGA-3), 0.25 mM of each dNTP, 2.5 mM MgCl2 , 5 units of HotStarTaq polymerase (Qiagen), and the appropriate volume of H2 O were used for amplification of a 236 bp region of exon 7 of the p53 gene in a “Touchdown” PCR program.

    Isolation:

    Article Title: Tumor Development, Growth Characteristics and Spectrum of Genetic Aberrations in the TH-MYCN Mouse Model of Neuroblastoma
    Article Snippet: For sequencing mouse genomic DNA, DNA was isolated as described above. .. Amplification was performed in a 20 µL total volume of reaction, containing 2.5 units of HotStarTaq (Qiagen), 40 ng DNA, 0.5 µM of each primer and Q solution (Qiagen).

    Labeling:

    Article Title: Worldwide population genetic structure of the oriental fruit moth (Grapholita molesta), a globally invasive pest
    Article Snippet: The forward primers of the loci GM02 , GM05 , GM07 , and GM10 were fluorescently labeled with joe, fam, fam, and hex respectively. .. Reactions for these four loci were carried out in a mix of 5.4 μL ddH2 O, 1.0 μL PCR buffer (Qiagen, Hombrechtikon, Switzerland), 2.0 μL dNTPs (2.5 mM, Qiagen), 0.5 μL of each forward and reverse primer (2 μM), 0.1 μL HotstarTaq (5U, Qiagen) and 0.5 μL DNA (10–35 ng⁄ μL).

    Purification:

    Article Title: Distribution of selected gene polymorphisms of UGT1A1 in a Saudi population
    Article Snippet: The indicated polymorphic variants were amplified in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City CA, USA) in a total volume of 25 µl, containing 20 ng DNA, 0.25 µl (2.5 mM) of dNTPs (Epicentre Biotechnologies, Madison, WI, USA), 2 µl (10 pM) of primers (Metabion, Martinsried, Germany) and 0.3 µl (5 U/µl) of HotstarTaq DNA polymerase (Qiagen, Germantown, MD, USA). .. The indicated polymorphic variants were amplified in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City CA, USA) in a total volume of 25 µl, containing 20 ng DNA, 0.25 µl (2.5 mM) of dNTPs (Epicentre Biotechnologies, Madison, WI, USA), 2 µl (10 pM) of primers (Metabion, Martinsried, Germany) and 0.3 µl (5 U/µl) of HotstarTaq DNA polymerase (Qiagen, Germantown, MD, USA).

    Article Title: The Rac1 splice form Rac1b promotes K-ras-induced lung tumorigenesis
    Article Snippet: 100ng of genomic DNA were used as template in a PCR reaction using the HotStarTaq polymerase and buffer (Qiagen) and primers to amplify K-ras exon 2: 5′-AAGGCCTGCTGAAAATGACTG-3′ and 5′-CAAAGAATGGTCCTGCACCAG-3′. .. PCR products were run on a gel to verify a single amplification product (173bp) and purified using the MinElute PCR purification Kit (Qiagen).

    Article Title: Transcriptional Characterization of Porcine Leptin and Leptin Receptor Genes
    Article Snippet: PCRs were carried out in a 25 µl final volume containing 100 ng of DNA, 1 unit of polymerase (Biotools) or HotStart polymerase (Quiagen), specific buffer, 2 mM of dNTPs and 0.5 µM of each primer. .. The PCR reactions were carried out in a GeneAmp PCR System 9700 (Applied Biosystems, Warrington, UK).

    Polymerase Chain Reaction:

    Article Title: An Intrinsic Propensity of Murine Peritoneal B1b Cells to Switch to IgA in Presence of TGF-? and Retinoic Acid
    Article Snippet: DNase (Qiagen) treated RNA was reverse transcribed using oligo-d(T)12–18 (Thermo Scientific) and RevertAid™ reverse transcriptase (Fermentas). .. PCR amplification of cDNA was performed using HotstarTaq™ DNA polymerase (Qiagen). and the following primers: Igµ/α heavy chain variable (VH) region, for VHcons 5′-GAGGTGCAGCTGCAGGAGTCTGG-3′ rev Cµ2 5′-CATTTGGGAAGGACTGA-3′ or Cα2 5′-GAGCTGGTGGGAGTGTCAGTG-3′ . .. RT-PCR products of IgVH chain transcripts from 4 days cultured cells were cloned using TOPO TA Cloning® kit (Invitrogen) following manufacturer's protocol.

    Article Title: Hypersensitive K303R oestrogen receptor-? variant not found in invasive carcinomas
    Article Snippet: The same primers occasionally amplify additional, minor, shorter products arising from splice variants in which exon 5 is absent. .. PCR reactions contained 2 μl of a 1:20 dilution of the RT reaction, 0.2 mM dNTPs, each primer at 1 μM, 0.5 units of HotstarTaq DNA polymerase (Qiagen) and 1× PCR Buffer (containing 1.5 mM MgCl2 ; Qiagen). .. PCR cycling conditions were the same as for genomic DNA from breast cancers.

    Article Title: Ddx42p--a human DEAD box protein with RNA chaperone activities
    Article Snippet: HotStarTaq DNA polymerase was obtained from Qiagen. .. HotStarTaq DNA polymerase was obtained from Qiagen.

    Article Title: Distribution of selected gene polymorphisms of UGT1A1 in a Saudi population
    Article Snippet: The indicated polymorphic variants were amplified in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City CA, USA) in a total volume of 25 µl, containing 20 ng DNA, 0.25 µl (2.5 mM) of dNTPs (Epicentre Biotechnologies, Madison, WI, USA), 2 µl (10 pM) of primers (Metabion, Martinsried, Germany) and 0.3 µl (5 U/µl) of HotstarTaq DNA polymerase (Qiagen, Germantown, MD, USA). .. The indicated polymorphic variants were amplified in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City CA, USA) in a total volume of 25 µl, containing 20 ng DNA, 0.25 µl (2.5 mM) of dNTPs (Epicentre Biotechnologies, Madison, WI, USA), 2 µl (10 pM) of primers (Metabion, Martinsried, Germany) and 0.3 µl (5 U/µl) of HotstarTaq DNA polymerase (Qiagen, Germantown, MD, USA).

    Article Title: Population Bottlenecks during the Infectious Cycle of the Lyme Disease Spirochete Borrelia burgdorferi
    Article Snippet: Genomic DNA was eluted in a final volume of 100 microliters and 3 microliters (equivalence of 2.4×107 spirochetes) was used per PCR reaction to determine BbITS composition. .. Seven PCR primer pairs specific for the unique tag in each BbITS clone ( ) were used individually with HotStarTaq DNA Polymerase (Qiagen) and the manufacturer's reagents and recommended reaction conditions. .. The following PCR parameters were used: an initial denaturation at 95°C for 5 min, followed by 30 cycles of 95°C for 45 seconds, 55°C for 45 seconds, 72°C for 1 minute, and a final extension at 72°C for 10 minutes.

    Article Title: Circadian and Circalunar Clock Interactions in a Marine Annelid
    Article Snippet: Pdu -ck 1δ/ε: upper primer: 5′ GAATTCCCGGGATGTAAATAATGGCG 3′, lower primer: 5′ TAGGCCTCGGAGTTGGTCATGACAC 3′ Tm: 61°C. .. Fragments of all other genes were first identified by degenerated PCR, and (if necessary) expanded by RACE PCR using QIAGEN Hot Star Taq (203205). .. Degenerated PCR program: 15min 95°C /5 cycles with 1min 94°C, 2min Tm −5°C, 1min 94°C / 35 cycles with 1min 94°C, 2min Tm, 4min 72°C/ final elongation of 10min 72°C.

    Article Title: Global DNA Hypermethylation in Down Syndrome Placenta
    Article Snippet: The converted DNA was amplified using HotStarTaq DNA Polymerase Kit (QIAGEN GmbH), with 1× reaction buffer, 1.5 or 2.5 mM of additional MgCl2 , 200 µM of dNTP mix, 200 nM each of forward and reverse primers , and 1 unit of HotStarTaq DNA polymerase. .. The converted DNA was amplified using HotStarTaq DNA Polymerase Kit (QIAGEN GmbH), with 1× reaction buffer, 1.5 or 2.5 mM of additional MgCl2 , 200 µM of dNTP mix, 200 nM each of forward and reverse primers , and 1 unit of HotStarTaq DNA polymerase.

    Article Title: The Rac1 splice form Rac1b promotes K-ras-induced lung tumorigenesis
    Article Snippet: Genomic DNA was extracted from tumor samples using the GenElute Mammalian Genomic DNA Miniprep kit, according to the manufacturer’s instructions (Sigma-Aldrich). .. 100ng of genomic DNA were used as template in a PCR reaction using the HotStarTaq polymerase and buffer (Qiagen) and primers to amplify K-ras exon 2: 5′-AAGGCCTGCTGAAAATGACTG-3′ and 5′-CAAAGAATGGTCCTGCACCAG-3′. .. PCR products were run on a gel to verify a single amplification product (173bp) and purified using the MinElute PCR purification Kit (Qiagen).

    Article Title: DNA methylation in interleukin-11 predicts clinical response to antidepressants in GENDEP
    Article Snippet: Reverse primers consisted of the following sequence 5′-ACCCATAACTCTACCCCTCTCC-3′. .. For each 10 μl reaction, the polymerase chain reaction mastermix consisted of the following: 1 μl 10 × buffer (Qiagen, Crawley, UK), 0.2 μl dNTPs (10 μM ; Thermo Scientific, Northumberland, UK), 0.2 μl MgCl2 (Thermo Scientific, UK), 0.1 μl HotStarTaq Polymerase (Qiagen), 1 μl IL11 forward primer (Sigma-Aldrich, Poole, UK), 1 μl IL11 reverse primer (Sigma-Aldrich), 2 μl DNA and 4.5 μl water. .. Thermal cycling conditions consisted of an initial enzyme activation stage (95 °C for 10 min); followed by 35 cycles of denaturation (95 °C for 30 s), hybridization (58 °C for 30 s) and extension (72 °C for 1 min); and a final single-extension step (72 °C for 4 min) and cool-down step (4 °C for 10 min).

    Article Title: Genome amplification of single sperm using multiple displacement amplification
    Article Snippet: Paragraph title: PCR and sequencing analysis ... A 20 μl mixture was prepared for each reaction and included 1× HotStarTaq buffer, 2.5 mM Mg2+ , 0.2 mM dNTP, 0.3 μM of each primer, 1 U HotStarTaq polymerase (Qiagen Inc.) and 1 μl template DNA.

    Article Title: Detection of TP53 R249 Mutation in Iranian Patients with Pancreatic Cancer
    Article Snippet: DNA was extracted from 200 μ L of plasma using a QiAamp blood kit (Qiagen Company) according to the manufacturer procedure. .. The standard PCR was performed in a total volume of 50 μ L as described previously [ ] in which 50 ng template DNA, 10 pmol of each primer (sense: 5-CTTGCCACAGGTCTCCCCAA-3 and antisense: 5-AGGGGTCAGCGGCAAGCAGA-3), 0.25 mM of each dNTP, 2.5 mM MgCl2 , 5 units of HotStarTaq polymerase (Qiagen), and the appropriate volume of H2 O were used for amplification of a 236 bp region of exon 7 of the p53 gene in a “Touchdown” PCR program. .. The thermocycling conditions were 1 cycle of denaturation (5 min at 94°C), 20 cycles of denaturation (94°C for 45 s), annealing (63°C for 45 s, with –0.5°C per cycle), and extension (72°C for 1 min), followed by 30 cycles of denaturation (94°C for 45 s), annealing (60°C, 45 s), and extension (72°C for 1 min), and a final extension cycle of 72°C for 10 min.

    Article Title: Intratumoral genetic heterogeneity in metastatic melanoma is accompanied by variation in malignant behaviors
    Article Snippet: For UDG treatment, 0.5 × UDG buffer and 0.5 U of uracil-DNA glycosylase (New England Biolabs) were added to the PCR master mix. .. The same PCR conditions were used except an addition of initial incubation at 37°C for 30 min before the activation of HotStarTaq polymerase. .. A PIK3CA E549D mutation detected at a low frequency (4%) in the Core 2 of Tumor 2 by AmpliSeq was analysed by limited copy number (LCN)-HRM [ ].

    Article Title: A multisite blinded study for the detection of BRAF mutations in formalin-fixed, paraffin-embedded malignant melanoma
    Article Snippet: PCR cycling and HRM were performed on the RotorGene Q (Qiagen) and positive LCN-HRM reactions showing aberrant melting profiles were chosen for Sanger sequencing. .. The LCN-HRM reaction mixture in a total volume of 20 μL was prepared as follows for an estimated 2–4 copies of template: 1× PCR buffer, 2.5 μM MgCl2 , 400 nM of each primer, 200 μM of dNTPs, 5 μM of SYTO 9 and 0.5 U of HotStarTaq polymerase. .. PCR conditions included an activation step of 15 min at 95°C followed by 60 cycles of 95°C for 10 sec, annealing for 20 sec comprising 10 cycles of a touchdown from 65°C to 60°C at 0.5°C/cycle followed by 50 cycles at 60°C, and extension at 72°C for 30 sec. Each sample was tested in 66 LCN-HRM replicates.

    Article Title: Early Onset Pre-Eclampsia Is Associated with Altered DNA Methylation of Cortisol-Signalling and Steroidogenic Genes in the Placenta
    Article Snippet: Forward, reverse and sequencing primers for bisulfite converted DNA were designed with the aid of Pyro Q-CpG software (Qiagen Ltd., GmbH, Hilden, Germany; ). .. PCR reactions consisted of ∼20 ng bisulfite-converted DNA, 1× PCR buffer (Qiagen Ltd.), 0.2 mM dNTPs (Invitrogen, Carlsbad, CA), 0.4 µM forward and reverse primers (Integrated DNA Technologies Inc., Coralville, IA) and 0.18 U DNA polymerase (HotStarTaq, Qiagen Ltd.). .. Optimised PCR conditions consisted of 95°C for 15 min, 40 cycles of 95°C for 30 sec, variable annealing temperature (Ta) for 30 sec, 72°C for 30 sec, and finally 72°C for 10 min.

    Article Title: Transcriptional Characterization of Porcine Leptin and Leptin Receptor Genes
    Article Snippet: PCRs were carried out in a 25 µl final volume containing 100 ng of DNA, 1 unit of polymerase (Biotools) or HotStart polymerase (Quiagen), specific buffer, 2 mM of dNTPs and 0.5 µM of each primer. .. PCRs were carried out in a 25 µl final volume containing 100 ng of DNA, 1 unit of polymerase (Biotools) or HotStart polymerase (Quiagen), specific buffer, 2 mM of dNTPs and 0.5 µM of each primer.

    Article Title: Surveillance of Bovine Tuberculosis and Risk Estimation of a Future Reservoir Formation in Wildlife in Switzerland and Liechtenstein
    Article Snippet: If DNA specific for MTBC mycobacteria was successfully amplified from cultured material, genotyping was performed using the GenoType® MTBC kit (HainLifescience GmbH, Nehren, Germany) according to the manufacturer's protocol. .. Briefly, PCR amplification was carried out in reaction mixtures containing 35 μl of primer-nucleotide-mix (Hain Lifescience GmbH, Nehren, Germany), 5 μl 10x PCR buffer for HotStarTaq (Qiagen GmbH, Hilden, Germany), 2 μl 25 mM MgCl2 solution (Qiagen GmbH, Hilden, Germany), 0.2 μl HotStarTaq (Qiagen GmbH, Hilden, Germany), 3 μl H2 O and 5 μl of DNA positively tested in the PCR assay. .. Reverse hybridization of the amplified products was performed and the test strips were interpreted, both in accordance with the protocol provided by the manufacturer.

    Article Title: Worldwide population genetic structure of the oriental fruit moth (Grapholita molesta), a globally invasive pest
    Article Snippet: The forward primers of the loci GM02 , GM05 , GM07 , and GM10 were fluorescently labeled with joe, fam, fam, and hex respectively. .. Reactions for these four loci were carried out in a mix of 5.4 μL ddH2 O, 1.0 μL PCR buffer (Qiagen, Hombrechtikon, Switzerland), 2.0 μL dNTPs (2.5 mM, Qiagen), 0.5 μL of each forward and reverse primer (2 μM), 0.1 μL HotstarTaq (5U, Qiagen) and 0.5 μL DNA (10–35 ng⁄ μL). .. Reactions for the remaining nine newly developed loci were carried out in a mix of 5.7 μL ddH2 O, 1.0 μL PCR buffer (Qiagen), 1.0 μL dNTPs (2.5 mM, Qiagen), 0.2 μL of each forward primer (2 μM), 0.5 μL of each reverse primer (2 μM), 0.5 μL M13 primer (2 μM, fluorescently labeled with fam, Microsynth, Balgach, Switzerland), 0.1 μL HotstarTaq (5U, Qiagen) and 0.5 μL DNA (10–35 ng⁄ μL).

    IA:

    Article Title: Early Onset Pre-Eclampsia Is Associated with Altered DNA Methylation of Cortisol-Signalling and Steroidogenic Genes in the Placenta
    Article Snippet: Forward, reverse and sequencing primers for bisulfite converted DNA were designed with the aid of Pyro Q-CpG software (Qiagen Ltd., GmbH, Hilden, Germany; ). .. PCR reactions consisted of ∼20 ng bisulfite-converted DNA, 1× PCR buffer (Qiagen Ltd.), 0.2 mM dNTPs (Invitrogen, Carlsbad, CA), 0.4 µM forward and reverse primers (Integrated DNA Technologies Inc., Coralville, IA) and 0.18 U DNA polymerase (HotStarTaq, Qiagen Ltd.). .. Optimised PCR conditions consisted of 95°C for 15 min, 40 cycles of 95°C for 30 sec, variable annealing temperature (Ta) for 30 sec, 72°C for 30 sec, and finally 72°C for 10 min.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Genome amplification of single sperm using multiple displacement amplification
    Article Snippet: A 20 μl mixture was prepared for each reaction and included 1× HotStarTaq buffer, 2.5 mM Mg2+ , 0.2 mM dNTP, 0.3 μM of each primer, 1 U HotStarTaq polymerase (Qiagen Inc.) and 1 μl template DNA. .. For the aliquots of the 0.8 cells/3 μl dilution, those MDA products in which at least one of the three genes got amplified were selected for further analyses.

    Plasmid Preparation:

    Article Title: Ddx42p--a human DEAD box protein with RNA chaperone activities
    Article Snippet: HotStarTaq DNA polymerase was obtained from Qiagen. .. First strand cDNA synthesis and PCR were performed according to manufacturer's instructions.

    Software:

    Article Title: Global DNA Hypermethylation in Down Syndrome Placenta
    Article Snippet: The converted DNA was amplified using HotStarTaq DNA Polymerase Kit (QIAGEN GmbH), with 1× reaction buffer, 1.5 or 2.5 mM of additional MgCl2 , 200 µM of dNTP mix, 200 nM each of forward and reverse primers , and 1 unit of HotStarTaq DNA polymerase. .. The converted DNA was amplified using HotStarTaq DNA Polymerase Kit (QIAGEN GmbH), with 1× reaction buffer, 1.5 or 2.5 mM of additional MgCl2 , 200 µM of dNTP mix, 200 nM each of forward and reverse primers , and 1 unit of HotStarTaq DNA polymerase.

    Article Title: The Rac1 splice form Rac1b promotes K-ras-induced lung tumorigenesis
    Article Snippet: 100ng of genomic DNA were used as template in a PCR reaction using the HotStarTaq polymerase and buffer (Qiagen) and primers to amplify K-ras exon 2: 5′-AAGGCCTGCTGAAAATGACTG-3′ and 5′-CAAAGAATGGTCCTGCACCAG-3′. .. PCR products were run on a gel to verify a single amplification product (173bp) and purified using the MinElute PCR purification Kit (Qiagen).

    Article Title: Early Onset Pre-Eclampsia Is Associated with Altered DNA Methylation of Cortisol-Signalling and Steroidogenic Genes in the Placenta
    Article Snippet: Forward, reverse and sequencing primers for bisulfite converted DNA were designed with the aid of Pyro Q-CpG software (Qiagen Ltd., GmbH, Hilden, Germany; ). .. PCR reactions consisted of ∼20 ng bisulfite-converted DNA, 1× PCR buffer (Qiagen Ltd.), 0.2 mM dNTPs (Invitrogen, Carlsbad, CA), 0.4 µM forward and reverse primers (Integrated DNA Technologies Inc., Coralville, IA) and 0.18 U DNA polymerase (HotStarTaq, Qiagen Ltd.).

    Article Title: Transcriptional Characterization of Porcine Leptin and Leptin Receptor Genes
    Article Snippet: The Promoter Scan tool, PROSCAN version 1.7 , and Promoter Inspector software , were used to validate putative promoter regions in the 5′UTR of LEP and LEPR genes, in order to confirm the previously described location of the promoters of both genes. .. PCRs were carried out in a 25 µl final volume containing 100 ng of DNA, 1 unit of polymerase (Biotools) or HotStart polymerase (Quiagen), specific buffer, 2 mM of dNTPs and 0.5 µM of each primer.

    Article Title: Worldwide population genetic structure of the oriental fruit moth (Grapholita molesta), a globally invasive pest
    Article Snippet: Reactions for these four loci were carried out in a mix of 5.4 μL ddH2 O, 1.0 μL PCR buffer (Qiagen, Hombrechtikon, Switzerland), 2.0 μL dNTPs (2.5 mM, Qiagen), 0.5 μL of each forward and reverse primer (2 μM), 0.1 μL HotstarTaq (5U, Qiagen) and 0.5 μL DNA (10–35 ng⁄ μL). .. Genotyping was carried out by denaturing 1 μL PCR product in 9 μL formamide (deionized, 99.5% minimum, Sigma-Aldrich, Buchs, Switzerland) with 0.09 μL Gene Scan 500 LIZ size standard (Applied Biosystems, Foster City, CA, USA), and running the products on a laser detection system (3730xl DNA Analyzer, Applied Biosystems).

    Agarose Gel Electrophoresis:

    Article Title: Distribution of selected gene polymorphisms of UGT1A1 in a Saudi population
    Article Snippet: The indicated polymorphic variants were amplified in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City CA, USA) in a total volume of 25 µl, containing 20 ng DNA, 0.25 µl (2.5 mM) of dNTPs (Epicentre Biotechnologies, Madison, WI, USA), 2 µl (10 pM) of primers (Metabion, Martinsried, Germany) and 0.3 µl (5 U/µl) of HotstarTaq DNA polymerase (Qiagen, Germantown, MD, USA). .. The indicated polymorphic variants were amplified in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City CA, USA) in a total volume of 25 µl, containing 20 ng DNA, 0.25 µl (2.5 mM) of dNTPs (Epicentre Biotechnologies, Madison, WI, USA), 2 µl (10 pM) of primers (Metabion, Martinsried, Germany) and 0.3 µl (5 U/µl) of HotstarTaq DNA polymerase (Qiagen, Germantown, MD, USA).

    Spectrophotometry:

    Article Title: Distribution of selected gene polymorphisms of UGT1A1 in a Saudi population
    Article Snippet: DNA extraction was carried out using Puregene Blood Core Kit C (Qiagen, Germantown, MD, USA) following the manufacturer's instructions and quantified using a Nanodrop 2000 Spectrophotometer (Thermo Scientific, Wilmington, DE, USA). .. The indicated polymorphic variants were amplified in a Veriti® 96-Well Fast Thermal Cycler (Applied Biosystems, Foster City CA, USA) in a total volume of 25 µl, containing 20 ng DNA, 0.25 µl (2.5 mM) of dNTPs (Epicentre Biotechnologies, Madison, WI, USA), 2 µl (10 pM) of primers (Metabion, Martinsried, Germany) and 0.3 µl (5 U/µl) of HotstarTaq DNA polymerase (Qiagen, Germantown, MD, USA).

    DNA Methylation Assay:

    Article Title: Global DNA Hypermethylation in Down Syndrome Placenta
    Article Snippet: Paragraph title: DNA methylation validation by EpiTYPER assays ... The converted DNA was amplified using HotStarTaq DNA Polymerase Kit (QIAGEN GmbH), with 1× reaction buffer, 1.5 or 2.5 mM of additional MgCl2 , 200 µM of dNTP mix, 200 nM each of forward and reverse primers , and 1 unit of HotStarTaq DNA polymerase.

    Article Title: DNA methylation in interleukin-11 predicts clinical response to antidepressants in GENDEP
    Article Snippet: Paragraph title: DNA methylation ... For each 10 μl reaction, the polymerase chain reaction mastermix consisted of the following: 1 μl 10 × buffer (Qiagen, Crawley, UK), 0.2 μl dNTPs (10 μM ; Thermo Scientific, Northumberland, UK), 0.2 μl MgCl2 (Thermo Scientific, UK), 0.1 μl HotStarTaq Polymerase (Qiagen), 1 μl IL11 forward primer (Sigma-Aldrich, Poole, UK), 1 μl IL11 reverse primer (Sigma-Aldrich), 2 μl DNA and 4.5 μl water.

    Article Title: Early Onset Pre-Eclampsia Is Associated with Altered DNA Methylation of Cortisol-Signalling and Steroidogenic Genes in the Placenta
    Article Snippet: PCR reactions consisted of ∼20 ng bisulfite-converted DNA, 1× PCR buffer (Qiagen Ltd.), 0.2 mM dNTPs (Invitrogen, Carlsbad, CA), 0.4 µM forward and reverse primers (Integrated DNA Technologies Inc., Coralville, IA) and 0.18 U DNA polymerase (HotStarTaq, Qiagen Ltd.). .. The optimal Ta was 51°C for CYP19 , 55°C for NR3C1 assay 1 and 2, CRHBP , CYP11A1 , HSD3B1 , HSD11B2 and TEAD3, and 57°C for CRH PCR reactions.

    Activation Assay:

    Article Title: Intratumoral genetic heterogeneity in metastatic melanoma is accompanied by variation in malignant behaviors
    Article Snippet: For UDG treatment, 0.5 × UDG buffer and 0.5 U of uracil-DNA glycosylase (New England Biolabs) were added to the PCR master mix. .. The same PCR conditions were used except an addition of initial incubation at 37°C for 30 min before the activation of HotStarTaq polymerase. .. A PIK3CA E549D mutation detected at a low frequency (4%) in the Core 2 of Tumor 2 by AmpliSeq was analysed by limited copy number (LCN)-HRM [ ].

    DNA Purification:

    Article Title: Transcriptional Characterization of Porcine Leptin and Leptin Receptor Genes
    Article Snippet: PCRs were carried out in a 25 µl final volume containing 100 ng of DNA, 1 unit of polymerase (Biotools) or HotStart polymerase (Quiagen), specific buffer, 2 mM of dNTPs and 0.5 µM of each primer. .. The PCR reactions were carried out in a GeneAmp PCR System 9700 (Applied Biosystems, Warrington, UK).

    In Silico:

    Article Title: DNA methylation in interleukin-11 predicts clinical response to antidepressants in GENDEP
    Article Snippet: IL11 primer design was based on in-silico bisulfite-amplicon prediction using the Mass array package (Bioconductor, www.bioconductor.org ) in R ( http://www.R-project.org ). .. For each 10 μl reaction, the polymerase chain reaction mastermix consisted of the following: 1 μl 10 × buffer (Qiagen, Crawley, UK), 0.2 μl dNTPs (10 μM ; Thermo Scientific, Northumberland, UK), 0.2 μl MgCl2 (Thermo Scientific, UK), 0.1 μl HotStarTaq Polymerase (Qiagen), 1 μl IL11 forward primer (Sigma-Aldrich, Poole, UK), 1 μl IL11 reverse primer (Sigma-Aldrich), 2 μl DNA and 4.5 μl water.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Qiagen hotstar taq dna polymerase
    DNase I hypersensitivity of the murine PWS-IC. DNase hypersensitive sites (DHS) were mapped by Southern blotting and indirect end-labeling after DNase I treatment of primary brain cells. The maternal and paternal alleles were analyzed separately using brain cells prepared from mice carrying a 35 kb PWS-IC deletion on either the paternal or maternal chromosome, respectively [8] , [18] . Cells were treated with increasing concentrations of DNase I; 0 DNase samples were purified genomic <t>DNA</t> from untreated brain cells. (A) Analysis by EcoRI digestion and hybridization with probe A. The thick arrows indicate the positions and sizes of prominent reproducible DNase I hypersensitive bands. Paternal indicates samples carrying a maternal PWS-IC deletion; Maternal indicates samples carrying a paternal PWS-C deletion. B) Analysis by <t>Taq</t> I digestion and hybridization with probe B. C) Analysis by Nco I digestion and hybridization with probe C. D) Summary of DNase I hypersensitive sites and their locations. The diagram depicts the Snrpn 5′ region showing relevant restriction enzyme sites and the positions of hybridization probes A, B and C (probe B is contained within probe C). The relative positions of DHS1-6 are indicated by short horizontal bars above the gene; all prominent DH sites (DHS1-DS6) are specific to the paternal chromosome. CAS denotes the conserved activator sequence [17] that co-localizes with DHS5. Thin horizontal lines below the gene depict regions deleted by targeted knockouts of the Snrpn locus [38] , [39] . The bent arrow depicts the location of the transcription initiation site. The position of each DH site relative to the transcription initiation site is estimated to be: DHS1, −3.2 kb; DHS2 includes the transcription initiation site; DHS3, +0.8 kb; DHS4, +1.4 kb; DHS5, +1.7 kb; DHS6, +4.1 kb; the positions of DHS1-DHS6 in the Snrpn gene were calculated as an average of at least two independent experiments and/or different restriction enzymes and probes. The same DH sites mapped by different experiments, restriction enzymes, and/or blots generally localized within 200–300 bp of each other, a variation within the range expected by estimating positions derived from band sizes in Southern blots.
    Hotstar Taq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstar taq dna polymerase/product/Qiagen
    Average 99 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    hotstar taq dna polymerase - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    Qiagen hotstartaq plus dna polymerase
    DNase I hypersensitivity of the murine PWS-IC. DNase hypersensitive sites (DHS) were mapped by Southern blotting and indirect end-labeling after DNase I treatment of primary brain cells. The maternal and paternal alleles were analyzed separately using brain cells prepared from mice carrying a 35 kb PWS-IC deletion on either the paternal or maternal chromosome, respectively [8] , [18] . Cells were treated with increasing concentrations of DNase I; 0 DNase samples were purified genomic <t>DNA</t> from untreated brain cells. (A) Analysis by EcoRI digestion and hybridization with probe A. The thick arrows indicate the positions and sizes of prominent reproducible DNase I hypersensitive bands. Paternal indicates samples carrying a maternal PWS-IC deletion; Maternal indicates samples carrying a paternal PWS-C deletion. B) Analysis by <t>Taq</t> I digestion and hybridization with probe B. C) Analysis by Nco I digestion and hybridization with probe C. D) Summary of DNase I hypersensitive sites and their locations. The diagram depicts the Snrpn 5′ region showing relevant restriction enzyme sites and the positions of hybridization probes A, B and C (probe B is contained within probe C). The relative positions of DHS1-6 are indicated by short horizontal bars above the gene; all prominent DH sites (DHS1-DS6) are specific to the paternal chromosome. CAS denotes the conserved activator sequence [17] that co-localizes with DHS5. Thin horizontal lines below the gene depict regions deleted by targeted knockouts of the Snrpn locus [38] , [39] . The bent arrow depicts the location of the transcription initiation site. The position of each DH site relative to the transcription initiation site is estimated to be: DHS1, −3.2 kb; DHS2 includes the transcription initiation site; DHS3, +0.8 kb; DHS4, +1.4 kb; DHS5, +1.7 kb; DHS6, +4.1 kb; the positions of DHS1-DHS6 in the Snrpn gene were calculated as an average of at least two independent experiments and/or different restriction enzymes and probes. The same DH sites mapped by different experiments, restriction enzymes, and/or blots generally localized within 200–300 bp of each other, a variation within the range expected by estimating positions derived from band sizes in Southern blots.
    Hotstartaq Plus Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 97 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/hotstartaq plus dna polymerase/product/Qiagen
    Average 99 stars, based on 97 article reviews
    Price from $9.99 to $1999.99
    hotstartaq plus dna polymerase - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    DNase I hypersensitivity of the murine PWS-IC. DNase hypersensitive sites (DHS) were mapped by Southern blotting and indirect end-labeling after DNase I treatment of primary brain cells. The maternal and paternal alleles were analyzed separately using brain cells prepared from mice carrying a 35 kb PWS-IC deletion on either the paternal or maternal chromosome, respectively [8] , [18] . Cells were treated with increasing concentrations of DNase I; 0 DNase samples were purified genomic DNA from untreated brain cells. (A) Analysis by EcoRI digestion and hybridization with probe A. The thick arrows indicate the positions and sizes of prominent reproducible DNase I hypersensitive bands. Paternal indicates samples carrying a maternal PWS-IC deletion; Maternal indicates samples carrying a paternal PWS-C deletion. B) Analysis by Taq I digestion and hybridization with probe B. C) Analysis by Nco I digestion and hybridization with probe C. D) Summary of DNase I hypersensitive sites and their locations. The diagram depicts the Snrpn 5′ region showing relevant restriction enzyme sites and the positions of hybridization probes A, B and C (probe B is contained within probe C). The relative positions of DHS1-6 are indicated by short horizontal bars above the gene; all prominent DH sites (DHS1-DS6) are specific to the paternal chromosome. CAS denotes the conserved activator sequence [17] that co-localizes with DHS5. Thin horizontal lines below the gene depict regions deleted by targeted knockouts of the Snrpn locus [38] , [39] . The bent arrow depicts the location of the transcription initiation site. The position of each DH site relative to the transcription initiation site is estimated to be: DHS1, −3.2 kb; DHS2 includes the transcription initiation site; DHS3, +0.8 kb; DHS4, +1.4 kb; DHS5, +1.7 kb; DHS6, +4.1 kb; the positions of DHS1-DHS6 in the Snrpn gene were calculated as an average of at least two independent experiments and/or different restriction enzymes and probes. The same DH sites mapped by different experiments, restriction enzymes, and/or blots generally localized within 200–300 bp of each other, a variation within the range expected by estimating positions derived from band sizes in Southern blots.

    Journal: PLoS ONE

    Article Title: Regulatory Elements Associated with Paternally-Expressed Genes in the Imprinted Murine Angelman/Prader-Willi Syndrome Domain

    doi: 10.1371/journal.pone.0052390

    Figure Lengend Snippet: DNase I hypersensitivity of the murine PWS-IC. DNase hypersensitive sites (DHS) were mapped by Southern blotting and indirect end-labeling after DNase I treatment of primary brain cells. The maternal and paternal alleles were analyzed separately using brain cells prepared from mice carrying a 35 kb PWS-IC deletion on either the paternal or maternal chromosome, respectively [8] , [18] . Cells were treated with increasing concentrations of DNase I; 0 DNase samples were purified genomic DNA from untreated brain cells. (A) Analysis by EcoRI digestion and hybridization with probe A. The thick arrows indicate the positions and sizes of prominent reproducible DNase I hypersensitive bands. Paternal indicates samples carrying a maternal PWS-IC deletion; Maternal indicates samples carrying a paternal PWS-C deletion. B) Analysis by Taq I digestion and hybridization with probe B. C) Analysis by Nco I digestion and hybridization with probe C. D) Summary of DNase I hypersensitive sites and their locations. The diagram depicts the Snrpn 5′ region showing relevant restriction enzyme sites and the positions of hybridization probes A, B and C (probe B is contained within probe C). The relative positions of DHS1-6 are indicated by short horizontal bars above the gene; all prominent DH sites (DHS1-DS6) are specific to the paternal chromosome. CAS denotes the conserved activator sequence [17] that co-localizes with DHS5. Thin horizontal lines below the gene depict regions deleted by targeted knockouts of the Snrpn locus [38] , [39] . The bent arrow depicts the location of the transcription initiation site. The position of each DH site relative to the transcription initiation site is estimated to be: DHS1, −3.2 kb; DHS2 includes the transcription initiation site; DHS3, +0.8 kb; DHS4, +1.4 kb; DHS5, +1.7 kb; DHS6, +4.1 kb; the positions of DHS1-DHS6 in the Snrpn gene were calculated as an average of at least two independent experiments and/or different restriction enzymes and probes. The same DH sites mapped by different experiments, restriction enzymes, and/or blots generally localized within 200–300 bp of each other, a variation within the range expected by estimating positions derived from band sizes in Southern blots.

    Article Snippet: For a 25 ul PCR reaction using 3C primers, 1–2 µl template DNA was mixed with 10 pmol of each primer, 5 nmol of each dATP, dTTP, dGTP, dCTP, 0.625 units of Hotstar Taq DNA polymerase (Qiagen).

    Techniques: Southern Blot, End Labeling, Mouse Assay, Purification, Hybridization, Sequencing, Derivative Assay

    Optimisation of the PPLMD method . The y-axis represents the average background-subtracted pixel density (0–64,000). A. Introduction of SpikeTarget DNA reduced background in negative control (purple vs. yellow). Blue: genomic DNA (containing RRS and MON810) + SpikeTarget, purple: MQ, yellow: MQ with SpikeTarget. All 4 padlock probes were present in the mix. HotStar Taq DNA polymerase was used to amplify in 40 LATE cycles. B. 80 LATE cycles increased signal compared to 40 cycles. Purple: 40 LATE cycles, blue: 80 LATE cycles. All 4 padlock probes were present in the mix (containing RRS and MON810). Vent ® exo - DNA polymerase was used.

    Journal: BMC Genomics

    Article Title: Optimised padlock probe ligation and microarray detection of multiple (non-authorised) GMOs in a single reaction

    doi: 10.1186/1471-2164-9-584

    Figure Lengend Snippet: Optimisation of the PPLMD method . The y-axis represents the average background-subtracted pixel density (0–64,000). A. Introduction of SpikeTarget DNA reduced background in negative control (purple vs. yellow). Blue: genomic DNA (containing RRS and MON810) + SpikeTarget, purple: MQ, yellow: MQ with SpikeTarget. All 4 padlock probes were present in the mix. HotStar Taq DNA polymerase was used to amplify in 40 LATE cycles. B. 80 LATE cycles increased signal compared to 40 cycles. Purple: 40 LATE cycles, blue: 80 LATE cycles. All 4 padlock probes were present in the mix (containing RRS and MON810). Vent ® exo - DNA polymerase was used.

    Article Snippet: The initial standard protocol with HotStar Taq DNA polymerase (Qiagen) as to amplify the circular padlock probe was altered by application of the 5'-3' exonuclease-deficient Vent® exo- DNA polymerase, theoretically allowing extended linear amplification of the circular padlock target molecule and subsequent logarithmic PCR amplification.

    Techniques: Negative Control