taq enzyme  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Taq DNA Ligase
    Description:

    Catalog Number:
    M0208L
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs taq enzyme

    https://www.bioz.com/result/taq enzyme/product/New England Biolabs
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    taq enzyme - by Bioz Stars, 2019-10
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome
    Article Snippet: For the PCR screening, 10 clones were pooled in LB medium (12.5 μg ml−1 chloramphenicol) for a total of 10 MTP pools. .. A standard PCR mixture (25 μl) contained 1× Taq 2× master mix (New England BioLabs, Ipswich, United Kingdom) (12.5 μl), 0.4 μM (each) primer (1 μl degenerated primer) (Sigma-Aldrich, Vienna, Austria) (see Table S1 in the supplemental material), ddH2 O (4.25 μl), 5% (vol/vol) dimethyl sulfoxide (DMSO) (1.25 μl), and 5 μl of pooled template DNA.

    Centrifugation:

    Article Title: Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome
    Article Snippet: Denaturation (15 min at 99°C) of MTP cultures (diluted 1:2 in double-distilled water [ddH2 O]) and centrifugation (4,000 rpm, 5 min) were performed in order to make the fosmid DNA accessible to PCR screening with the two previously reported degenerated NRPS1 and NRPS2 primer pairs ( ) which are given in Table S1 in the supplemental material. .. A standard PCR mixture (25 μl) contained 1× Taq 2× master mix (New England BioLabs, Ipswich, United Kingdom) (12.5 μl), 0.4 μM (each) primer (1 μl degenerated primer) (Sigma-Aldrich, Vienna, Austria) (see Table S1 in the supplemental material), ddH2 O (4.25 μl), 5% (vol/vol) dimethyl sulfoxide (DMSO) (1.25 μl), and 5 μl of pooled template DNA.

    Amplification:

    Article Title: Complexity Reduction of Polymorphic Sequences (CRoPS(TM)): A Novel Approach for Large-Scale Polymorphism Discovery in Complex Genomes
    Article Snippet: In short, ligation reactions were carried out in 10 µl volume containing 200–400 ng total genomic DNA, 1×Taq DNA ligase buffer [20 mM tris-HCl, 25 mM KAc, 10 mM MgAc2 , 10 mM dithiothreitol (DTT), 1 mM NAD, 0.1% triton X-100; pH 7.6 at 25°C; New England Biolabs Inc], 2 U Taq DNA ligase (New England Biolabs Inc) and 0.5 fmol of each of the ligation probes. .. After ligation, the mixture was diluted with 30 µl of 1×Taq DNA ligase buffer to 40 µl.

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: After the completion of the amplification, 1 μl of proteinase K (20 mg/ml) was added, then heated at 70°C for 10 min and quenched at 94°C for 15 min. .. The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O.

    Article Title: The Human Myotrophin Variant Attenuates MicroRNA-Let-7 Binding Ability but Not Risk of Left Ventricular Hypertrophy in Human Essential Hypertension
    Article Snippet: Reactions were performed on a thermal cycler Gene Amp PCR system 9600 (Perkin Elmer, Waltham, MA, USA). .. Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O. .. The LDR conditions included initial denaturing at 95°C for 2 min, followed by 35 cycles of denaturing at 94°C for 30 s and annealing at 50°C for 2 min. LDR products (1 μl) were mixed with 1 μl of ROX (ABI, Foster City, CA, USA) and 1 μl of loading buffer, detected in an ABI PRISM 377 DNA Sequencer, and analyzed with Genemapper (ABI, Foster City, CA, USA).

    Article Title: Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas
    Article Snippet: Following PCR amplification, products were further processed by a ligation detection reaction (LDR) that has been described in detail for a variety of additional studies [ , – ]. .. This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA).

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: The PCR amplification included an initial activation step at 95°C for 15 min, denaturation at 94°C for 30 s, primer annealing at 60°C for 90 s, extension at 72°C for 1 min, and final extension at 60°C for 30 min. .. The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Article Title: Suppression of stress induction of the 78-kilodalton glucose regulated protein (GRP78) in cancer by IT-139, an anti-tumor ruthenium small molecule inhibitor
    Article Snippet: Total RNA was extracted using TRIzol (Fisher Scientific). .. Superscript III and oligo(dT) (Fisher Scientific) was used to perform reverse transcription and cDNA was amplified using DNA Taq (NEB). .. RT-PCR was performed using the following primers: GRP78: Forward: 5′-CAGCACAGACAGATTGACCTAT-3′ and Reverse: p3: 5′-GACATCAGCACCGCACTTCTCA-3′; β- actin: Forward: 5′-TCGTGCGTGACATTAAGGAG-3′ and Reverse: 5′-AGCACTGTGTTGGCGTACAG-3′.

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: Genomic DNA was extracted using the AllPrep kit (Qiagen, Germantown, MD, US). .. The MGAT1 gene was PCR amplified using the primers F_CAGGCAAGCCAAAGGCAGCCTTG and R_CTCAGGGACTGCAGGCCTGTCTC (Eurofins Genomics, Louisville, KY, US) with Taq and dNTPs supplied by New England BioLabs (Ipswich, MA, US). .. The PCR product was gel purified using a Zymoclean kit (Zymo Research, Irvine, CA, US) and then sequenced by Sanger method at UC Berkeley, Berkeley, CA, US.

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: The SNPs I333V, I379V, A665T, and Q687STOP were simultaneously amplified in a 25 μL multiplex PCR using primer sets previously reported ( ). .. Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs).

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: The resulting covalently attached cDNA was amplified by ligation-mediated amplification. .. For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript.

    Article Title: Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase
    Article Snippet: Both sequences were amplified by PCR and restricted with a blunt-end restriction enzyme. .. Taq DNA ligase (New England Biolabs, Beverly, MA) was then added to 12–15 μ g of each product, then thermocycled for 15 cycles as follows: melt at 95°C for 20 s, plunged to 4°C and held for 1 min, ligate at 65°C for 20 min. After digesting any remaining linear DNA using exonucleases I and III (New England Biolabs), the monomeric circular DNA was estimated by denaturing PAGE to comprise ∼99% of the exonuclease-resistant product (see in the ) and was used without further purification.

    Synthesized:

    Article Title: The Regulation of Exosporium-Related Genes in Bacillus thuringiensis
    Article Snippet: PCR was performed using Taq and KOD DNA polymerase (New England BioLabs Ltd., Beijing, China). .. PCR was performed using Taq and KOD DNA polymerase (New England BioLabs Ltd., Beijing, China).

    Electrophoresis:

    Article Title:
    Article Snippet: To measure the length of telomeric 3′ G-tails, genomic DNA was isolated from KB-3-1 cells treated with or without HXDV, followed by an oligonucleotide ligation assay according to the published procedure with slight modifications ( ). .. Briefly, reactions (20 μl each) containing genomic DNA (5 μg), [γ-32 P]ATP-labeled CA18 ((CCCTAA)3 ) (2 μl), and Taq DNA ligase (2 μl, 40 units/μl, New England BioLabs) in 1× Taq DNA ligase buffer (20 m m Tris, pH 7.6, 25 m m potassium acetate, 10 m m magnesium acetate, 10 m m dithiothreitol, 1 m m NAD, and 0.1% Triton X-100) were incubated at 45 °C for 5 h, followed by addition of 15 μl of an alkaline formamide dye solution (90% formamide, 10 m m sodium hydroxide, and 1 m m EDTA) and electrophoresis analysis in 8% urea gel. .. HXDV was shown to exhibit anti-proliferative activity against many tumor cells with IC50 values varying in a narrow range of 0.2 to 0.6 μ m ( ).

    Microarray:

    Article Title: Mapping chromatin interactions with 5C technology
    Article Snippet: We suggest titrating 3C libraries two-fold over a range of 50,000–800,000 haploid genome equivalents as a starting point. .. Cellular 3C library Control 3C library ( required only when probing by microarray hybridization ) Deionized autoclaved water used in all solutions and dilutions Forward 5C primer pool stocks resuspended in 1X TE (desalted) Reverse 5C primer pool stocks resuspended in 1X TE (desalted and phosphorylated) 80 µM universal tail PCR primer stocks ( reverse microarray PCR primers must be fluorescently labeled at their 5’ ends ) 10 mg/mlNEB Buffer 4 10 mg/ml salmon testes DA (Sigma, cat. no. D7656-1ML) Taq DNA ligase and buffer (NEB, cat. no. M0208S) 10X PCR buffer: 600 mM Tris-SO4 , (pH 8.9), 180 mM (NH4 )2 SO4 50 mM MgSO4 25 mM dNTPs (Invitrogen, cat. no. 10297-117) Taq DNA polymerase (NEB, cat. no. M0273L) or AmpliTaq Gold® (Invitrogen, cat. no. 4398808) QIAquick gel extraction kit (Qiagen, cat. no. 28704) or MinElute PCR purification kit (Qiagen, cat. no. 28004) if libraries are analyzed with microarrays. .. Agarose (Wisent, cat. no. 800-015-CG) 10X Tris-borate-EDTA (TBE) buffer: 890 mM Tris Base, 890 mM Boric Acid, 20 mM EDTA 10 mg/ml ethidium bromide solution (Bio-Rad cat. no. 161–0433) 4X agarose gel loading solution: 10% Ficoll, 0.15% Xylene Cyanol.

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: Paragraph title: High-throughput gene expression screen for proximal apoptosis genes and gene expression profiling by microarray ... For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript.

    Incubation:

    Article Title:
    Article Snippet: To measure the length of telomeric 3′ G-tails, genomic DNA was isolated from KB-3-1 cells treated with or without HXDV, followed by an oligonucleotide ligation assay according to the published procedure with slight modifications ( ). .. Briefly, reactions (20 μl each) containing genomic DNA (5 μg), [γ-32 P]ATP-labeled CA18 ((CCCTAA)3 ) (2 μl), and Taq DNA ligase (2 μl, 40 units/μl, New England BioLabs) in 1× Taq DNA ligase buffer (20 m m Tris, pH 7.6, 25 m m potassium acetate, 10 m m magnesium acetate, 10 m m dithiothreitol, 1 m m NAD, and 0.1% Triton X-100) were incubated at 45 °C for 5 h, followed by addition of 15 μl of an alkaline formamide dye solution (90% formamide, 10 m m sodium hydroxide, and 1 m m EDTA) and electrophoresis analysis in 8% urea gel. .. HXDV was shown to exhibit anti-proliferative activity against many tumor cells with IC50 values varying in a narrow range of 0.2 to 0.6 μ m ( ).

    Expressing:

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: Paragraph title: High-throughput gene expression screen for proximal apoptosis genes and gene expression profiling by microarray ... For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript.

    Modification:

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: The reporter probes were modified at the 3′ end by the addition of a 17-base sequence (GTAAAACGACGGCCAGT) that is complementary to a biotin-labeled “universal oligonucleotide.” The multiplex OLA reactions were done according to the protocol provided by Luminex Corporation. .. Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs).

    Hybridization:

    Article Title: Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas
    Article Snippet: This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA). .. This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA).

    Article Title: Mapping chromatin interactions with 5C technology
    Article Snippet: We suggest titrating 3C libraries two-fold over a range of 50,000–800,000 haploid genome equivalents as a starting point. .. Cellular 3C library Control 3C library ( required only when probing by microarray hybridization ) Deionized autoclaved water used in all solutions and dilutions Forward 5C primer pool stocks resuspended in 1X TE (desalted) Reverse 5C primer pool stocks resuspended in 1X TE (desalted and phosphorylated) 80 µM universal tail PCR primer stocks ( reverse microarray PCR primers must be fluorescently labeled at their 5’ ends ) 10 mg/mlNEB Buffer 4 10 mg/ml salmon testes DA (Sigma, cat. no. D7656-1ML) Taq DNA ligase and buffer (NEB, cat. no. M0208S) 10X PCR buffer: 600 mM Tris-SO4 , (pH 8.9), 180 mM (NH4 )2 SO4 50 mM MgSO4 25 mM dNTPs (Invitrogen, cat. no. 10297-117) Taq DNA polymerase (NEB, cat. no. M0273L) or AmpliTaq Gold® (Invitrogen, cat. no. 4398808) QIAquick gel extraction kit (Qiagen, cat. no. 28704) or MinElute PCR purification kit (Qiagen, cat. no. 28004) if libraries are analyzed with microarrays. .. Agarose (Wisent, cat. no. 800-015-CG) 10X Tris-borate-EDTA (TBE) buffer: 890 mM Tris Base, 890 mM Boric Acid, 20 mM EDTA 10 mg/ml ethidium bromide solution (Bio-Rad cat. no. 161–0433) 4X agarose gel loading solution: 10% Ficoll, 0.15% Xylene Cyanol.

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The ligation product was PCR amplified using biotin-conjugated universal primers.

    Ligation:

    Article Title: Complexity Reduction of Polymorphic Sequences (CRoPS(TM)): A Novel Approach for Large-Scale Polymorphism Discovery in Complex Genomes
    Article Snippet: SNPWave reactions were carried out as described previously . .. In short, ligation reactions were carried out in 10 µl volume containing 200–400 ng total genomic DNA, 1×Taq DNA ligase buffer [20 mM tris-HCl, 25 mM KAc, 10 mM MgAc2 , 10 mM dithiothreitol (DTT), 1 mM NAD, 0.1% triton X-100; pH 7.6 at 25°C; New England Biolabs Inc], 2 U Taq DNA ligase (New England Biolabs Inc) and 0.5 fmol of each of the ligation probes. .. Next, 10 cycles of repeated denaturation, probe hybridization and ligation were performed in a Perkin Elmer 9700 thermal cycler (Applied Biosystems) using the following profile: initial denaturation for 2 min at 94°C, followed by 10 cycles of 15 s at 94°C and 60 min at 60°C, and storage at 4°C.

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: After the completion of the amplification, 1 μl of proteinase K (20 mg/ml) was added, then heated at 70°C for 10 min and quenched at 94°C for 15 min. .. The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O. .. The LDR was performed using 25 cycles of 94°C for 30 sec and 55°C for 4 min.

    Article Title: Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas
    Article Snippet: Following PCR amplification, products were further processed by a ligation detection reaction (LDR) that has been described in detail for a variety of additional studies [ , – ]. .. This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA).

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs). .. The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: The reporter probes were phosphorylated at the 5′ end to allow ligation in the presence of the appropriate allele specific probe. .. Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs).

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: The resulting covalently attached cDNA was amplified by ligation-mediated amplification. .. For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The ligation product was PCR amplified using biotin-conjugated universal primers.

    Article Title:
    Article Snippet: Paragraph title: Oligonucleotide Ligation Assay ... Briefly, reactions (20 μl each) containing genomic DNA (5 μg), [γ-32 P]ATP-labeled CA18 ((CCCTAA)3 ) (2 μl), and Taq DNA ligase (2 μl, 40 units/μl, New England BioLabs) in 1× Taq DNA ligase buffer (20 m m Tris, pH 7.6, 25 m m potassium acetate, 10 m m magnesium acetate, 10 m m dithiothreitol, 1 m m NAD, and 0.1% Triton X-100) were incubated at 45 °C for 5 h, followed by addition of 15 μl of an alkaline formamide dye solution (90% formamide, 10 m m sodium hydroxide, and 1 m m EDTA) and electrophoresis analysis in 8% urea gel.

    Article Title: Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase
    Article Snippet: After ligation by a thermophilic DNA ligase, however, the closed minicircle is incapable of melting, and hence accumulates in solution. .. Taq DNA ligase (New England Biolabs, Beverly, MA) was then added to 12–15 μ g of each product, then thermocycled for 15 cycles as follows: melt at 95°C for 20 s, plunged to 4°C and held for 1 min, ligate at 65°C for 20 min. After digesting any remaining linear DNA using exonucleases I and III (New England Biolabs), the monomeric circular DNA was estimated by denaturing PAGE to comprise ∼99% of the exonuclease-resistant product (see in the ) and was used without further purification.

    Genomic Sequencing:

    Article Title: Identification of QTLs Associated with Callogenesis and Embryogenesis in Oil Palm Using Genetic Linkage Maps Improved with SSR Markers
    Article Snippet: SSRs developed from E. guineensis expressed sequence tags (ESTs), E. guineensis genomic sequences, E. oleifera genomic sequences and interspecific hybrid (E. guineensis ×E. oleifera) genomic sequences were labeled sEg, sMg, sMo and sMh, respectively. .. PCR was carried out in a 10.0 ul volume containing 100 ng DNA, 1×PCR buffer (NEB, USA), 2 mM of each dNTP (NEB, USA), 2.5 uM of each primer (Fwd 5′-M13, reverse unlabelled primer and dye-M13 primer) and 0.5 U Taq DNA polymerase (NEB, USA).

    Generated:

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: The resulting covalently attached cDNA was amplified by ligation-mediated amplification. .. For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The ligation product was PCR amplified using biotin-conjugated universal primers.

    other:

    Article Title: Novel Quantitative Real-Time LCR for the Sensitive Detection of SNP Frequencies in Pooled DNA: Method Development, Evaluation and Application
    Article Snippet: Moreover, substitution of Taq DNA ligase (protocol 1) by PFU thermostable ligase (protocol 7) did not lead to any considerable improvement regarding LOD and LOQ values ( ).

    Article Title: Self-regulated 1-butanol production in Escherichia coli based on the endogenous fermentative control
    Article Snippet: Taq DNA ligase, Phusion High-Fidelity DNA polymerase, and T5 exonuclease were obtained from New England Biolabs (Ipswich, MA).

    Article Title: Simultaneous detection of 19 K-ras mutations by free-solution conjugate electrophoresis of ligase detection reaction products on glass microchips
    Article Snippet: The reaction mixture consisted of 50 nM each of the discriminating primer – drag-tag conjugate and the 3′ FAM-labeled common primer, 5 nM of the ssDNA template, 40 U of Taq DNA ligase (M0208 New England Biolabs, Ipswich, Massachusetts), and 1 X Taq ligase buffer (20 mM Tris-HCl, 25 mM potassium acetate, 10 mM magnesium acetate, 10 mM dithiothreitol, 1.0 mM NAD, and 0.1% Triton X-100 at pH 7.6) in a final volume of 20 μL.

    DNA Sequencing:

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O. .. The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O.

    DNA Labeling:

    Article Title: High-throughput single-molecule mapping links subtelomeric variants and long-range haplotypes with specific telomeres
    Article Snippet: Paragraph title: DNA labeling ... After labeling, the nicks were ligated with Taq ligase (NEB) in the presence of dNTPs.

    Sequencing:

    Article Title: Identification of QTLs Associated with Callogenesis and Embryogenesis in Oil Palm Using Genetic Linkage Maps Improved with SSR Markers
    Article Snippet: A 19-bp M13 sequence ( CACGACGTTGTAAAACGAC ) was attached to each of the forward primers (Fwd 5′-M13) and the fluorescent dye (HEX−/6-FAM−/NED-M13). .. PCR was carried out in a 10.0 ul volume containing 100 ng DNA, 1×PCR buffer (NEB, USA), 2 mM of each dNTP (NEB, USA), 2.5 uM of each primer (Fwd 5′-M13, reverse unlabelled primer and dye-M13 primer) and 0.5 U Taq DNA polymerase (NEB, USA).

    Article Title: The Human Myotrophin Variant Attenuates MicroRNA-Let-7 Binding Ability but Not Risk of Left Ventricular Hypertrophy in Human Essential Hypertension
    Article Snippet: Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O. .. Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O.

    Article Title: Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas
    Article Snippet: G6PD genotyping focused on four single nucleotide polymorphism positions identified through Illumina sequence analysis (202G → A, 376A → G, 563C → T and 1311C → T; nucleotide reference information based on wild-type cDNA sequence; GenBank X03674). .. This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA).

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: Paragraph title: SLC25A46 polymorphism routine sequencing ... The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: Paragraph title: Gene sequencing ... The MGAT1 gene was PCR amplified using the primers F_CAGGCAAGCCAAAGGCAGCCTTG and R_CTCAGGGACTGCAGGCCTGTCTC (Eurofins Genomics, Louisville, KY, US) with Taq and dNTPs supplied by New England BioLabs (Ipswich, MA, US).

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: The reporter probes were modified at the 3′ end by the addition of a 17-base sequence (GTAAAACGACGGCCAGT) that is complementary to a biotin-labeled “universal oligonucleotide.” The multiplex OLA reactions were done according to the protocol provided by Luminex Corporation. .. Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs).

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: The resulting covalently attached cDNA was amplified by ligation-mediated amplification. .. For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The ligation product was PCR amplified using biotin-conjugated universal primers.

    Article Title: Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase
    Article Snippet: Briefly, two double-stranded DNA sequences (each the length of the desired minicircle template) were designed such that the first half of one sequence is complementary to the second half of the other. .. Taq DNA ligase (New England Biolabs, Beverly, MA) was then added to 12–15 μ g of each product, then thermocycled for 15 cycles as follows: melt at 95°C for 20 s, plunged to 4°C and held for 1 min, ligate at 65°C for 20 min. After digesting any remaining linear DNA using exonucleases I and III (New England Biolabs), the monomeric circular DNA was estimated by denaturing PAGE to comprise ∼99% of the exonuclease-resistant product (see in the ) and was used without further purification.

    Recombinant:

    Article Title: ComEA Is Essential for the Transfer of External DNA into the Periplasm in Naturally Transformable Vibrio cholerae Cells
    Article Snippet: Paragraph title: Recombinant DNA techniques ... Restriction enzymes and DNA modifying enzymes were obtained from New England Biolabs, Taq DNA polymerase (GoTaq) was obtained from Promega and used for colony PCR, and Pwo DNA Polymerase (Roche) was used for high-fidelity PCR amplifications.

    DNA Extraction:

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: Paragraph title: DNA extraction and genotyping ... The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O.

    Fluorescence:

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The products were subsequently stained with streptavidin-phycoerythrin (SAPE) (Invitrogen, Carlsbad, CA).

    Isolation:

    Article Title:
    Article Snippet: To measure the length of telomeric 3′ G-tails, genomic DNA was isolated from KB-3-1 cells treated with or without HXDV, followed by an oligonucleotide ligation assay according to the published procedure with slight modifications ( ). .. Briefly, reactions (20 μl each) containing genomic DNA (5 μg), [γ-32 P]ATP-labeled CA18 ((CCCTAA)3 ) (2 μl), and Taq DNA ligase (2 μl, 40 units/μl, New England BioLabs) in 1× Taq DNA ligase buffer (20 m m Tris, pH 7.6, 25 m m potassium acetate, 10 m m magnesium acetate, 10 m m dithiothreitol, 1 m m NAD, and 0.1% Triton X-100) were incubated at 45 °C for 5 h, followed by addition of 15 μl of an alkaline formamide dye solution (90% formamide, 10 m m sodium hydroxide, and 1 m m EDTA) and electrophoresis analysis in 8% urea gel.

    Labeling:

    Article Title: Identification of QTLs Associated with Callogenesis and Embryogenesis in Oil Palm Using Genetic Linkage Maps Improved with SSR Markers
    Article Snippet: SSRs developed from E. guineensis expressed sequence tags (ESTs), E. guineensis genomic sequences, E. oleifera genomic sequences and interspecific hybrid (E. guineensis ×E. oleifera) genomic sequences were labeled sEg, sMg, sMo and sMh, respectively. .. PCR was carried out in a 10.0 ul volume containing 100 ng DNA, 1×PCR buffer (NEB, USA), 2 mM of each dNTP (NEB, USA), 2.5 uM of each primer (Fwd 5′-M13, reverse unlabelled primer and dye-M13 primer) and 0.5 U Taq DNA polymerase (NEB, USA).

    Article Title: High-throughput single-molecule mapping links subtelomeric variants and long-range haplotypes with specific telomeres
    Article Snippet: The nicked DNA was labeled with a fluorescent-dUTP nucleotide analog using Taq polymerase (NEB) for 1 h at 72°C. .. After labeling, the nicks were ligated with Taq ligase (NEB) in the presence of dNTPs. .. The backbone of fluorescently labeled DNA was stained with YOYO-1 (Invitrogen).

    Article Title: Mapping chromatin interactions with 5C technology
    Article Snippet: We suggest titrating 3C libraries two-fold over a range of 50,000–800,000 haploid genome equivalents as a starting point. .. Cellular 3C library Control 3C library ( required only when probing by microarray hybridization ) Deionized autoclaved water used in all solutions and dilutions Forward 5C primer pool stocks resuspended in 1X TE (desalted) Reverse 5C primer pool stocks resuspended in 1X TE (desalted and phosphorylated) 80 µM universal tail PCR primer stocks ( reverse microarray PCR primers must be fluorescently labeled at their 5’ ends ) 10 mg/mlNEB Buffer 4 10 mg/ml salmon testes DA (Sigma, cat. no. D7656-1ML) Taq DNA ligase and buffer (NEB, cat. no. M0208S) 10X PCR buffer: 600 mM Tris-SO4 , (pH 8.9), 180 mM (NH4 )2 SO4 50 mM MgSO4 25 mM dNTPs (Invitrogen, cat. no. 10297-117) Taq DNA polymerase (NEB, cat. no. M0273L) or AmpliTaq Gold® (Invitrogen, cat. no. 4398808) QIAquick gel extraction kit (Qiagen, cat. no. 28704) or MinElute PCR purification kit (Qiagen, cat. no. 28004) if libraries are analyzed with microarrays. .. Agarose (Wisent, cat. no. 800-015-CG) 10X Tris-borate-EDTA (TBE) buffer: 890 mM Tris Base, 890 mM Boric Acid, 20 mM EDTA 10 mg/ml ethidium bromide solution (Bio-Rad cat. no. 161–0433) 4X agarose gel loading solution: 10% Ficoll, 0.15% Xylene Cyanol.

    Purification:

    Article Title: High-throughput single-molecule mapping links subtelomeric variants and long-range haplotypes with specific telomeres
    Article Snippet: Specifically, 300 ng of purified genomic DNA was nicked with 7 U nicking endonuclease Nt.BspQI (New England BioLabs, NEB) at 37°C for 2 h in NEB Buffer 3.1. .. After labeling, the nicks were ligated with Taq ligase (NEB) in the presence of dNTPs.

    Article Title: Mapping chromatin interactions with 5C technology
    Article Snippet: We suggest titrating 3C libraries two-fold over a range of 50,000–800,000 haploid genome equivalents as a starting point. .. Cellular 3C library Control 3C library ( required only when probing by microarray hybridization ) Deionized autoclaved water used in all solutions and dilutions Forward 5C primer pool stocks resuspended in 1X TE (desalted) Reverse 5C primer pool stocks resuspended in 1X TE (desalted and phosphorylated) 80 µM universal tail PCR primer stocks ( reverse microarray PCR primers must be fluorescently labeled at their 5’ ends ) 10 mg/mlNEB Buffer 4 10 mg/ml salmon testes DA (Sigma, cat. no. D7656-1ML) Taq DNA ligase and buffer (NEB, cat. no. M0208S) 10X PCR buffer: 600 mM Tris-SO4 , (pH 8.9), 180 mM (NH4 )2 SO4 50 mM MgSO4 25 mM dNTPs (Invitrogen, cat. no. 10297-117) Taq DNA polymerase (NEB, cat. no. M0273L) or AmpliTaq Gold® (Invitrogen, cat. no. 4398808) QIAquick gel extraction kit (Qiagen, cat. no. 28704) or MinElute PCR purification kit (Qiagen, cat. no. 28004) if libraries are analyzed with microarrays. .. Agarose (Wisent, cat. no. 800-015-CG) 10X Tris-borate-EDTA (TBE) buffer: 890 mM Tris Base, 890 mM Boric Acid, 20 mM EDTA 10 mg/ml ethidium bromide solution (Bio-Rad cat. no. 161–0433) 4X agarose gel loading solution: 10% Ficoll, 0.15% Xylene Cyanol.

    Article Title: Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase
    Article Snippet: Both sequences were amplified by PCR and restricted with a blunt-end restriction enzyme. .. Taq DNA ligase (New England Biolabs, Beverly, MA) was then added to 12–15 μ g of each product, then thermocycled for 15 cycles as follows: melt at 95°C for 20 s, plunged to 4°C and held for 1 min, ligate at 65°C for 20 min. After digesting any remaining linear DNA using exonucleases I and III (New England Biolabs), the monomeric circular DNA was estimated by denaturing PAGE to comprise ∼99% of the exonuclease-resistant product (see in the ) and was used without further purification. .. Minicircle template (0.5 nM) was incubated with 8.5 nM T7 RNAP (Fermentas, Hanover, MD) for 10 min in transcription buffer (40 mM Tris-acetate, 10 mM Mg-acetate, 0.05% v/v Tween-20, 10 mM DTT, pH 8.0), supplemented with 1 mM each of ATP, GTP, and CTP (Fermentas) and 20 nM 2′-o-methyl-RNA molecular beacons (Sigma Life Science, The Woodlands, TX); 5 mg/ml heparin (Sigma Life Science) was added to inactivate free T7 RNAP, and incubated for 5 min before the initiation of transcription with the addition of 1 mM UTP (Fermentas).

    Polymerase Chain Reaction:

    Article Title: Identification of QTLs Associated with Callogenesis and Embryogenesis in Oil Palm Using Genetic Linkage Maps Improved with SSR Markers
    Article Snippet: A 19-bp M13 sequence ( CACGACGTTGTAAAACGAC ) was attached to each of the forward primers (Fwd 5′-M13) and the fluorescent dye (HEX−/6-FAM−/NED-M13). .. PCR was carried out in a 10.0 ul volume containing 100 ng DNA, 1×PCR buffer (NEB, USA), 2 mM of each dNTP (NEB, USA), 2.5 uM of each primer (Fwd 5′-M13, reverse unlabelled primer and dye-M13 primer) and 0.5 U Taq DNA polymerase (NEB, USA). .. PCR was carried out as described by .

    Article Title: ComEA Is Essential for the Transfer of External DNA into the Periplasm in Naturally Transformable Vibrio cholerae Cells
    Article Snippet: Standard molecular biology-based methods were used for DNA manipulations. .. Restriction enzymes and DNA modifying enzymes were obtained from New England Biolabs, Taq DNA polymerase (GoTaq) was obtained from Promega and used for colony PCR, and Pwo DNA Polymerase (Roche) was used for high-fidelity PCR amplifications. .. Modified DNA sequences were verified using Sanger sequencing (Microsynth, CH).

    Article Title: Complexity Reduction of Polymorphic Sequences (CRoPS(TM)): A Novel Approach for Large-Scale Polymorphism Discovery in Complex Genomes
    Article Snippet: In short, ligation reactions were carried out in 10 µl volume containing 200–400 ng total genomic DNA, 1×Taq DNA ligase buffer [20 mM tris-HCl, 25 mM KAc, 10 mM MgAc2 , 10 mM dithiothreitol (DTT), 1 mM NAD, 0.1% triton X-100; pH 7.6 at 25°C; New England Biolabs Inc], 2 U Taq DNA ligase (New England Biolabs Inc) and 0.5 fmol of each of the ligation probes. .. After ligation, the mixture was diluted with 30 µl of 1×Taq DNA ligase buffer to 40 µl.

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: The target DNA sequences were amplified using a multiplex PCR method. .. The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O.

    Article Title: The Human Myotrophin Variant Attenuates MicroRNA-Let-7 Binding Ability but Not Risk of Left Ventricular Hypertrophy in Human Essential Hypertension
    Article Snippet: Reactions were performed on a thermal cycler Gene Amp PCR system 9600 (Perkin Elmer, Waltham, MA, USA). .. Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O.

    Article Title: The Regulation of Exosporium-Related Genes in Bacillus thuringiensis
    Article Snippet: The antibiotic concentrations used for bacterial selection were as follows: 100 μg/ml kanamycin and 10 μg/ml erythromycin for Bt, and 100 μg/ml ampicillin for E. coli . .. PCR was performed using Taq and KOD DNA polymerase (New England BioLabs Ltd., Beijing, China). .. Amplified fragments were purified using purification kits (Axygen, Union City, CA, USA).

    Article Title: Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas
    Article Snippet: Following PCR amplification, products were further processed by a ligation detection reaction (LDR) that has been described in detail for a variety of additional studies [ , – ]. .. This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA). .. LDR probes consisted of eight allele-specific oligonucleotides and three fluorescently labelled conserved-sequence oligonucleotides.

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs). .. The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Article Title: Suppression of stress induction of the 78-kilodalton glucose regulated protein (GRP78) in cancer by IT-139, an anti-tumor ruthenium small molecule inhibitor
    Article Snippet: Superscript III and oligo(dT) (Fisher Scientific) was used to perform reverse transcription and cDNA was amplified using DNA Taq (NEB). .. Superscript III and oligo(dT) (Fisher Scientific) was used to perform reverse transcription and cDNA was amplified using DNA Taq (NEB).

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: Genomic DNA was extracted using the AllPrep kit (Qiagen, Germantown, MD, US). .. The MGAT1 gene was PCR amplified using the primers F_CAGGCAAGCCAAAGGCAGCCTTG and R_CTCAGGGACTGCAGGCCTGTCTC (Eurofins Genomics, Louisville, KY, US) with Taq and dNTPs supplied by New England BioLabs (Ipswich, MA, US). .. The PCR product was gel purified using a Zymoclean kit (Zymo Research, Irvine, CA, US) and then sequenced by Sanger method at UC Berkeley, Berkeley, CA, US.

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: The reporter probes were modified at the 3′ end by the addition of a 17-base sequence (GTAAAACGACGGCCAGT) that is complementary to a biotin-labeled “universal oligonucleotide.” The multiplex OLA reactions were done according to the protocol provided by Luminex Corporation. .. Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs). .. The OLA reactions were initially heated at 96°C for 2 min, followed by 30 thermal cycles at 94°C for 15 s then 37.0°C for 1 min.

    Article Title: Mapping chromatin interactions with 5C technology
    Article Snippet: We suggest titrating 3C libraries two-fold over a range of 50,000–800,000 haploid genome equivalents as a starting point. .. Cellular 3C library Control 3C library ( required only when probing by microarray hybridization ) Deionized autoclaved water used in all solutions and dilutions Forward 5C primer pool stocks resuspended in 1X TE (desalted) Reverse 5C primer pool stocks resuspended in 1X TE (desalted and phosphorylated) 80 µM universal tail PCR primer stocks ( reverse microarray PCR primers must be fluorescently labeled at their 5’ ends ) 10 mg/mlNEB Buffer 4 10 mg/ml salmon testes DA (Sigma, cat. no. D7656-1ML) Taq DNA ligase and buffer (NEB, cat. no. M0208S) 10X PCR buffer: 600 mM Tris-SO4 , (pH 8.9), 180 mM (NH4 )2 SO4 50 mM MgSO4 25 mM dNTPs (Invitrogen, cat. no. 10297-117) Taq DNA polymerase (NEB, cat. no. M0273L) or AmpliTaq Gold® (Invitrogen, cat. no. 4398808) QIAquick gel extraction kit (Qiagen, cat. no. 28704) or MinElute PCR purification kit (Qiagen, cat. no. 28004) if libraries are analyzed with microarrays. .. Agarose (Wisent, cat. no. 800-015-CG) 10X Tris-borate-EDTA (TBE) buffer: 890 mM Tris Base, 890 mM Boric Acid, 20 mM EDTA 10 mg/ml ethidium bromide solution (Bio-Rad cat. no. 161–0433) 4X agarose gel loading solution: 10% Ficoll, 0.15% Xylene Cyanol.

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The ligation product was PCR amplified using biotin-conjugated universal primers.

    Article Title: Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome
    Article Snippet: Denaturation (15 min at 99°C) of MTP cultures (diluted 1:2 in double-distilled water [ddH2 O]) and centrifugation (4,000 rpm, 5 min) were performed in order to make the fosmid DNA accessible to PCR screening with the two previously reported degenerated NRPS1 and NRPS2 primer pairs ( ) which are given in Table S1 in the supplemental material. .. A standard PCR mixture (25 μl) contained 1× Taq 2× master mix (New England BioLabs, Ipswich, United Kingdom) (12.5 μl), 0.4 μM (each) primer (1 μl degenerated primer) (Sigma-Aldrich, Vienna, Austria) (see Table S1 in the supplemental material), ddH2 O (4.25 μl), 5% (vol/vol) dimethyl sulfoxide (DMSO) (1.25 μl), and 5 μl of pooled template DNA. .. The following PCR program was used: 95°C for 5 min; 35 cycles of 95°C for 1 min, 57°C for 1 min, and 68°C for 1 min; and elongation at 68°C for 10 min. PCR products were analyzed by 2% agarose–Tris-acetate-EDTA (TAE) gel electrophoresis.

    Article Title: Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase
    Article Snippet: Both sequences were amplified by PCR and restricted with a blunt-end restriction enzyme. .. Taq DNA ligase (New England Biolabs, Beverly, MA) was then added to 12–15 μ g of each product, then thermocycled for 15 cycles as follows: melt at 95°C for 20 s, plunged to 4°C and held for 1 min, ligate at 65°C for 20 min. After digesting any remaining linear DNA using exonucleases I and III (New England Biolabs), the monomeric circular DNA was estimated by denaturing PAGE to comprise ∼99% of the exonuclease-resistant product (see in the ) and was used without further purification.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase
    Article Snippet: Both sequences were amplified by PCR and restricted with a blunt-end restriction enzyme. .. Taq DNA ligase (New England Biolabs, Beverly, MA) was then added to 12–15 μ g of each product, then thermocycled for 15 cycles as follows: melt at 95°C for 20 s, plunged to 4°C and held for 1 min, ligate at 65°C for 20 min. After digesting any remaining linear DNA using exonucleases I and III (New England Biolabs), the monomeric circular DNA was estimated by denaturing PAGE to comprise ∼99% of the exonuclease-resistant product (see in the ) and was used without further purification. .. Minicircle template (0.5 nM) was incubated with 8.5 nM T7 RNAP (Fermentas, Hanover, MD) for 10 min in transcription buffer (40 mM Tris-acetate, 10 mM Mg-acetate, 0.05% v/v Tween-20, 10 mM DTT, pH 8.0), supplemented with 1 mM each of ATP, GTP, and CTP (Fermentas) and 20 nM 2′-o-methyl-RNA molecular beacons (Sigma Life Science, The Woodlands, TX); 5 mg/ml heparin (Sigma Life Science) was added to inactivate free T7 RNAP, and incubated for 5 min before the initiation of transcription with the addition of 1 mM UTP (Fermentas).

    Gel Extraction:

    Article Title: Mapping chromatin interactions with 5C technology
    Article Snippet: We suggest titrating 3C libraries two-fold over a range of 50,000–800,000 haploid genome equivalents as a starting point. .. Cellular 3C library Control 3C library ( required only when probing by microarray hybridization ) Deionized autoclaved water used in all solutions and dilutions Forward 5C primer pool stocks resuspended in 1X TE (desalted) Reverse 5C primer pool stocks resuspended in 1X TE (desalted and phosphorylated) 80 µM universal tail PCR primer stocks ( reverse microarray PCR primers must be fluorescently labeled at their 5’ ends ) 10 mg/mlNEB Buffer 4 10 mg/ml salmon testes DA (Sigma, cat. no. D7656-1ML) Taq DNA ligase and buffer (NEB, cat. no. M0208S) 10X PCR buffer: 600 mM Tris-SO4 , (pH 8.9), 180 mM (NH4 )2 SO4 50 mM MgSO4 25 mM dNTPs (Invitrogen, cat. no. 10297-117) Taq DNA polymerase (NEB, cat. no. M0273L) or AmpliTaq Gold® (Invitrogen, cat. no. 4398808) QIAquick gel extraction kit (Qiagen, cat. no. 28704) or MinElute PCR purification kit (Qiagen, cat. no. 28004) if libraries are analyzed with microarrays. .. Agarose (Wisent, cat. no. 800-015-CG) 10X Tris-borate-EDTA (TBE) buffer: 890 mM Tris Base, 890 mM Boric Acid, 20 mM EDTA 10 mg/ml ethidium bromide solution (Bio-Rad cat. no. 161–0433) 4X agarose gel loading solution: 10% Ficoll, 0.15% Xylene Cyanol.

    Software:

    Article Title: Complexity Reduction of Polymorphic Sequences (CRoPS(TM)): A Novel Approach for Large-Scale Polymorphism Discovery in Complex Genomes
    Article Snippet: Probes were designed for 30 putative SNPs in two multiplex (15-plex) SNPWave assays using ProbeDesigner software (Keygene N.V.) as described previously . .. In short, ligation reactions were carried out in 10 µl volume containing 200–400 ng total genomic DNA, 1×Taq DNA ligase buffer [20 mM tris-HCl, 25 mM KAc, 10 mM MgAc2 , 10 mM dithiothreitol (DTT), 1 mM NAD, 0.1% triton X-100; pH 7.6 at 25°C; New England Biolabs Inc], 2 U Taq DNA ligase (New England Biolabs Inc) and 0.5 fmol of each of the ligation probes.

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs). .. The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: Each allele specific probe was modified at the 5′ end by the addition of a unique 24-base FlexMAP TAG sequence (Luminex Corporation) using TAG-IT software (TM Biosciences). .. Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs).

    Multiplex Assay:

    Article Title: Complexity Reduction of Polymorphic Sequences (CRoPS(TM)): A Novel Approach for Large-Scale Polymorphism Discovery in Complex Genomes
    Article Snippet: Probes were designed for 30 putative SNPs in two multiplex (15-plex) SNPWave assays using ProbeDesigner software (Keygene N.V.) as described previously . .. In short, ligation reactions were carried out in 10 µl volume containing 200–400 ng total genomic DNA, 1×Taq DNA ligase buffer [20 mM tris-HCl, 25 mM KAc, 10 mM MgAc2 , 10 mM dithiothreitol (DTT), 1 mM NAD, 0.1% triton X-100; pH 7.6 at 25°C; New England Biolabs Inc], 2 U Taq DNA ligase (New England Biolabs Inc) and 0.5 fmol of each of the ligation probes.

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: The target DNA sequences were amplified using a multiplex PCR method. .. The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O.

    Article Title: The Human Myotrophin Variant Attenuates MicroRNA-Let-7 Binding Ability but Not Risk of Left Ventricular Hypertrophy in Human Essential Hypertension
    Article Snippet: Reactions were performed on a thermal cycler Gene Amp PCR system 9600 (Perkin Elmer, Waltham, MA, USA). .. Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O. .. The LDR conditions included initial denaturing at 95°C for 2 min, followed by 35 cycles of denaturing at 94°C for 30 s and annealing at 50°C for 2 min. LDR products (1 μl) were mixed with 1 μl of ROX (ABI, Foster City, CA, USA) and 1 μl of loading buffer, detected in an ABI PRISM 377 DNA Sequencer, and analyzed with Genemapper (ABI, Foster City, CA, USA).

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: The PCR amplification was performed in a final volume of 10 μl using a Qiagen Multiplex PCR Kit, 10−50 ng of template DNA and 2.0 pmol of each primer. .. The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: Paragraph title: Multiplex PCR and OLA ... Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs).

    Selection:

    Article Title: The Human Myotrophin Variant Attenuates MicroRNA-Let-7 Binding Ability but Not Risk of Left Ventricular Hypertrophy in Human Essential Hypertension
    Article Snippet: Paragraph title: Gene variant selection and genotyping ... Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O.

    Agarose Gel Electrophoresis:

    Article Title: Suppression of stress induction of the 78-kilodalton glucose regulated protein (GRP78) in cancer by IT-139, an anti-tumor ruthenium small molecule inhibitor
    Article Snippet: Superscript III and oligo(dT) (Fisher Scientific) was used to perform reverse transcription and cDNA was amplified using DNA Taq (NEB). .. Superscript III and oligo(dT) (Fisher Scientific) was used to perform reverse transcription and cDNA was amplified using DNA Taq (NEB).

    Activation Assay:

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: The PCR amplification included an initial activation step at 95°C for 15 min, denaturation at 94°C for 30 s, primer annealing at 60°C for 90 s, extension at 72°C for 1 min, and final extension at 60°C for 30 min. .. The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Concentration Assay:

    Article Title: Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome
    Article Snippet: MTP cultures were grown at 37°C overnight with shaking at 225 rpm and were finally stored at −70°C after addition of glycerol to each well to achieve a final concentration of 25% (vol/vol). .. A standard PCR mixture (25 μl) contained 1× Taq 2× master mix (New England BioLabs, Ipswich, United Kingdom) (12.5 μl), 0.4 μM (each) primer (1 μl degenerated primer) (Sigma-Aldrich, Vienna, Austria) (see Table S1 in the supplemental material), ddH2 O (4.25 μl), 5% (vol/vol) dimethyl sulfoxide (DMSO) (1.25 μl), and 5 μl of pooled template DNA.

    DNA Purification:

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: Genomic DNA was extracted from whole blood using the Maxwell 16 DNA Purification Kit (Promega Corporation, Madison, WI). .. The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O.

    High Throughput Screening Assay:

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: Paragraph title: High-throughput gene expression screen for proximal apoptosis genes and gene expression profiling by microarray ... For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript.

    Staining:

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The PCR products were then captured by hybridization to probes complementary to the barcodes that were linked to uniquely colored polystyrene beads (Luminex, Austin, TX).

    Variant Assay:

    Article Title: The Human Myotrophin Variant Attenuates MicroRNA-Let-7 Binding Ability but Not Risk of Left Ventricular Hypertrophy in Human Essential Hypertension
    Article Snippet: Paragraph title: Gene variant selection and genotyping ... Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O.

    Luminex:

    Article Title: Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas
    Article Snippet: This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA). .. This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA).

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The ligation product was PCR amplified using biotin-conjugated universal primers.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs taq α i restriction endonuclease
    Alignment of Mu Terminal Inverted Repeats (TIRs). ClustalW was used to align all known active and potentially active Mu elements. Strings of four or more consecutive bases that are entirely conserved among all elements are shaded in red. The conserved <t>Taq</t> α I site is shaded in blue. Mu4, 5, and 6 are inactive and are not included [reviewed in [5] ]. Mu9 is MuDR. Only the first 39 bp of the Mu10, 11, and 12 TIRs have been sequenced [62] . However, the primer used to amplify the TIR ended in a 3′ GTC, allowing for the assumption that the sequence continues as GAC (shown as small case) and that the Taq α I site remains intact. Of the most recently discovered Mu elements (13–19), only Mu13 has been confirmed to actively move and create new mutations [58] . TIR sequences obtained from [3] , [58] , [62] – [68] .
    Taq α I Restriction Endonuclease, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq α i restriction endonuclease/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    taq α i restriction endonuclease - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs restriction enzyme taq i
    Restriction enzyme digestion patterns obtained with Ear I. For B clarridgeiae , B. elizabethae , and B. vinsonii subsp. berkhoffii , positive identification is facilitated by obtaining the digestion pattern with Ear I in addition to <t>Taq</t> I.
    Restriction Enzyme Taq I, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/restriction enzyme taq i/product/New England Biolabs
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    restriction enzyme taq i - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Alignment of Mu Terminal Inverted Repeats (TIRs). ClustalW was used to align all known active and potentially active Mu elements. Strings of four or more consecutive bases that are entirely conserved among all elements are shaded in red. The conserved Taq α I site is shaded in blue. Mu4, 5, and 6 are inactive and are not included [reviewed in [5] ]. Mu9 is MuDR. Only the first 39 bp of the Mu10, 11, and 12 TIRs have been sequenced [62] . However, the primer used to amplify the TIR ended in a 3′ GTC, allowing for the assumption that the sequence continues as GAC (shown as small case) and that the Taq α I site remains intact. Of the most recently discovered Mu elements (13–19), only Mu13 has been confirmed to actively move and create new mutations [58] . TIR sequences obtained from [3] , [58] , [62] – [68] .

    Journal: PLoS ONE

    Article Title: Identification of the Maize Gravitropism Gene lazy plant1 by a Transposon-Tagging Genome Resequencing Strategy

    doi: 10.1371/journal.pone.0087053

    Figure Lengend Snippet: Alignment of Mu Terminal Inverted Repeats (TIRs). ClustalW was used to align all known active and potentially active Mu elements. Strings of four or more consecutive bases that are entirely conserved among all elements are shaded in red. The conserved Taq α I site is shaded in blue. Mu4, 5, and 6 are inactive and are not included [reviewed in [5] ]. Mu9 is MuDR. Only the first 39 bp of the Mu10, 11, and 12 TIRs have been sequenced [62] . However, the primer used to amplify the TIR ended in a 3′ GTC, allowing for the assumption that the sequence continues as GAC (shown as small case) and that the Taq α I site remains intact. Of the most recently discovered Mu elements (13–19), only Mu13 has been confirmed to actively move and create new mutations [58] . TIR sequences obtained from [3] , [58] , [62] – [68] .

    Article Snippet: Approximately 5 µg of DNA was digested by 30 units Taq α I restriction endonuclease (New England BioLabs, Inc.) according to the manufacturer’s instructions.

    Techniques: Sequencing

    Manhattan plot of la1-mu1 Taq α I sequencing. ( A ) Manhattan plot showing the distribution of reads from la1-mu1 genomic DNA mapped throughout the B73 genome. Alternating colors represent each of the ten maize chromosomes. Each x-axis pixel represents a bin of 1 Mb and the logarithmic y-axis denotes the number of reads mapping to each bin. The red line represents the known genetic map position for the la1 reference mutation. Each triangle below the plot represents the approximate location of mapped MFS. ( B ) Expanded Manhattan plot of a 1 Mb interval corresponding to the approximate map position of la1 . Same as top with each x-axis pixel representing a bin of 1 kb. Filtered genes in the 1 Mb interval are shown as black rectangles. MFS mapping to this interval are shown as inverted red triangles.

    Journal: PLoS ONE

    Article Title: Identification of the Maize Gravitropism Gene lazy plant1 by a Transposon-Tagging Genome Resequencing Strategy

    doi: 10.1371/journal.pone.0087053

    Figure Lengend Snippet: Manhattan plot of la1-mu1 Taq α I sequencing. ( A ) Manhattan plot showing the distribution of reads from la1-mu1 genomic DNA mapped throughout the B73 genome. Alternating colors represent each of the ten maize chromosomes. Each x-axis pixel represents a bin of 1 Mb and the logarithmic y-axis denotes the number of reads mapping to each bin. The red line represents the known genetic map position for the la1 reference mutation. Each triangle below the plot represents the approximate location of mapped MFS. ( B ) Expanded Manhattan plot of a 1 Mb interval corresponding to the approximate map position of la1 . Same as top with each x-axis pixel representing a bin of 1 kb. Filtered genes in the 1 Mb interval are shown as black rectangles. MFS mapping to this interval are shown as inverted red triangles.

    Article Snippet: Approximately 5 µg of DNA was digested by 30 units Taq α I restriction endonuclease (New England BioLabs, Inc.) according to the manufacturer’s instructions.

    Techniques: Sequencing, Mutagenesis

    Mu - Taq α I Library Construction. Digesting genomic DNA with Taq α I creates a library of fragments. Fragments containing a Mu -MFS junction will all contain a degenerate 39 nt Mu TIR tag along with 31–35 nt of flanking genomic sequence at one end of the 2×75 nt paired-end read. These fragments are computationally identified and the Mu flanking sequence (MFS) is mapped to the maize reference genome.

    Journal: PLoS ONE

    Article Title: Identification of the Maize Gravitropism Gene lazy plant1 by a Transposon-Tagging Genome Resequencing Strategy

    doi: 10.1371/journal.pone.0087053

    Figure Lengend Snippet: Mu - Taq α I Library Construction. Digesting genomic DNA with Taq α I creates a library of fragments. Fragments containing a Mu -MFS junction will all contain a degenerate 39 nt Mu TIR tag along with 31–35 nt of flanking genomic sequence at one end of the 2×75 nt paired-end read. These fragments are computationally identified and the Mu flanking sequence (MFS) is mapped to the maize reference genome.

    Article Snippet: Approximately 5 µg of DNA was digested by 30 units Taq α I restriction endonuclease (New England BioLabs, Inc.) according to the manufacturer’s instructions.

    Techniques: Sequencing

    A chromatogram screenshot of the DNA sequence (partial) of MdACS3a encompassing SNPs G 866 /T 866 and C 870 /T 870 in six apple cultivars—‘Florina’, ’Fuji red sport’, ‘Gala’, ‘Golden Delicious’ and ‘Granny Smith’. The oval circles in brown and red indicate the homozygous or heterozygous status at the 866th and 870th nucleotides in the coding sequence of MdACS3a , respectively. The recognition sites of restriction enzymes Bst NI and Taq α I are provided to show that the mutation from G 866 to T 866 abolishes the restriction site of Bst NI while the mutation from C 870 to T 870 gives rise to a restriction site for Taq α I. The right panel shows allelotypes of MdACS3a as represented by the SNP alleles, where G 866 stands for allele MdACS3a (wild type), T 866 for MdACS3a-G289V (functional null allele), C 870 also for allele MdACS3a and T 870 for Mdacs3a (transcriptional null allele).

    Journal: Horticulture Research

    Article Title: Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus

    doi: 10.1038/hortres.2016.24

    Figure Lengend Snippet: A chromatogram screenshot of the DNA sequence (partial) of MdACS3a encompassing SNPs G 866 /T 866 and C 870 /T 870 in six apple cultivars—‘Florina’, ’Fuji red sport’, ‘Gala’, ‘Golden Delicious’ and ‘Granny Smith’. The oval circles in brown and red indicate the homozygous or heterozygous status at the 866th and 870th nucleotides in the coding sequence of MdACS3a , respectively. The recognition sites of restriction enzymes Bst NI and Taq α I are provided to show that the mutation from G 866 to T 866 abolishes the restriction site of Bst NI while the mutation from C 870 to T 870 gives rise to a restriction site for Taq α I. The right panel shows allelotypes of MdACS3a as represented by the SNP alleles, where G 866 stands for allele MdACS3a (wild type), T 866 for MdACS3a-G289V (functional null allele), C 870 also for allele MdACS3a and T 870 for Mdacs3a (transcriptional null allele).

    Article Snippet: To detect alleles MdACS3a-G289V and Mdacs3a , the PCR products were restricted with enzymes Bst NI and Taq α I (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s instruction, respectively.

    Techniques: Sequencing, Mutagenesis, Functional Assay

    Agarose gel analyses of markers ACS1 ( a ), CAPS 866 ( b ) and CAPS 870 ( c ). For marker ACS1, the PCR products amplified by primers ACS1–5F/R were directly analyzed. Allelotypes MdACS1-1/1 , MdACS1–2/2 and MdACS1-1/2 are denoted with ‘1/1’, ‘2/2’ and ‘1/2’, respectively. For marker CAPS 866 , the PCR products were first amplified by primers ACS3a-289F/R and then digested with enzyme Bst NI, which restricts the MdACS3a (G 866 ) allele into the two lower bands. Allelotypes MdACS3a / MdACS3a (G 866 /G 866 ), MdACS3a / MdACS3a-G289V (G 866 /T 866 ) and MdACS3a-G289V/G289V (T 866 /T 866 ) are noted with ‘G/G’, ‘G/T’ and ‘T/T’, respectively. For marker CAPS 870 , enzyme Taq α I restricts the Mdacs3a (T 870 ) allele into the two lower bands. Allelotypes MdACS3a / MdACS3a (C 870 /C 870 ), MdACS3a / mdacs3a (C 870 /T 870 ) and mdacs3a/mdacs3a (T 870 /T 870 ) are noted with ‘C/C’, ‘C/T’ and ‘T/T’, respectively.

    Journal: Horticulture Research

    Article Title: Assessing the allelotypic effect of two aminocyclopropane carboxylic acid synthase-encoding genes MdACS1 and MdACS3a on fruit ethylene production and softening in Malus

    doi: 10.1038/hortres.2016.24

    Figure Lengend Snippet: Agarose gel analyses of markers ACS1 ( a ), CAPS 866 ( b ) and CAPS 870 ( c ). For marker ACS1, the PCR products amplified by primers ACS1–5F/R were directly analyzed. Allelotypes MdACS1-1/1 , MdACS1–2/2 and MdACS1-1/2 are denoted with ‘1/1’, ‘2/2’ and ‘1/2’, respectively. For marker CAPS 866 , the PCR products were first amplified by primers ACS3a-289F/R and then digested with enzyme Bst NI, which restricts the MdACS3a (G 866 ) allele into the two lower bands. Allelotypes MdACS3a / MdACS3a (G 866 /G 866 ), MdACS3a / MdACS3a-G289V (G 866 /T 866 ) and MdACS3a-G289V/G289V (T 866 /T 866 ) are noted with ‘G/G’, ‘G/T’ and ‘T/T’, respectively. For marker CAPS 870 , enzyme Taq α I restricts the Mdacs3a (T 870 ) allele into the two lower bands. Allelotypes MdACS3a / MdACS3a (C 870 /C 870 ), MdACS3a / mdacs3a (C 870 /T 870 ) and mdacs3a/mdacs3a (T 870 /T 870 ) are noted with ‘C/C’, ‘C/T’ and ‘T/T’, respectively.

    Article Snippet: To detect alleles MdACS3a-G289V and Mdacs3a , the PCR products were restricted with enzymes Bst NI and Taq α I (New England Biolabs, Ipswich, MA, USA) following the manufacturer’s instruction, respectively.

    Techniques: Agarose Gel Electrophoresis, Marker, Polymerase Chain Reaction, Amplification

    Restriction enzyme digestion patterns obtained with Ear I. For B clarridgeiae , B. elizabethae , and B. vinsonii subsp. berkhoffii , positive identification is facilitated by obtaining the digestion pattern with Ear I in addition to Taq I.

    Journal:

    Article Title: Detection and Identification of Bartonella Species Pathogenic for Humans by PCR Amplification Targeting the Riboflavin Synthase Gene (ribC)

    doi: 10.1128/JCM.41.3.1069-1072.2003

    Figure Lengend Snippet: Restriction enzyme digestion patterns obtained with Ear I. For B clarridgeiae , B. elizabethae , and B. vinsonii subsp. berkhoffii , positive identification is facilitated by obtaining the digestion pattern with Ear I in addition to Taq I.

    Article Snippet: Each reaction mixture in which amplicons were detected was subjected to digestion with the restriction enzyme Taq I (New England Biolabs).

    Techniques:

    Restriction enzyme digestion patterns obtained with Taq I. Digestion mixtures were electrophoresed on 1.5% agarose gels. On each panel, the gel is flanked by a 100-bp ladder (Invitrogen Life Technologies) (lane MW). (A) The three species illustrated are unambiguously identified by the Taq I pattern. However, for the species illustrated in panel B, the Taq I patterns are similar to one another, although clearly distinct from that of the species in panel A.

    Journal:

    Article Title: Detection and Identification of Bartonella Species Pathogenic for Humans by PCR Amplification Targeting the Riboflavin Synthase Gene (ribC)

    doi: 10.1128/JCM.41.3.1069-1072.2003

    Figure Lengend Snippet: Restriction enzyme digestion patterns obtained with Taq I. Digestion mixtures were electrophoresed on 1.5% agarose gels. On each panel, the gel is flanked by a 100-bp ladder (Invitrogen Life Technologies) (lane MW). (A) The three species illustrated are unambiguously identified by the Taq I pattern. However, for the species illustrated in panel B, the Taq I patterns are similar to one another, although clearly distinct from that of the species in panel A.

    Article Snippet: Each reaction mixture in which amplicons were detected was subjected to digestion with the restriction enzyme Taq I (New England Biolabs).

    Techniques:

    Detection of VDR gene Taq I polymorphism. PCR amplification of the genomic DNA was carried out and the products of amplification were cleaved with restriction enzyme Taq I (details given in Methods ). Lane 1, phiX174 Hae III cut M r markers; lane 2, uncleaved PCR product, lanes 3,8 Taq I cleavage pattern from subjects with heterozygous TC genotype; lanes 4,7 Taq I cleaved PCR product from subjects with CC genotype; lanes 5,9–10 Taq I cleaved PCR products from a subject with TT genotype, lane 6, no sample. The products were analyzed on 2% agarose gel and visualized under UV light after staining with ethidium bromide. The number on the right side indicate the product sizes (bp)

    Journal: BMC Pediatrics

    Article Title: Relationship of four vitamin D receptor gene polymorphisms with type 1 diabetes mellitus susceptibility in Kuwaiti children

    doi: 10.1186/s12887-019-1448-0

    Figure Lengend Snippet: Detection of VDR gene Taq I polymorphism. PCR amplification of the genomic DNA was carried out and the products of amplification were cleaved with restriction enzyme Taq I (details given in Methods ). Lane 1, phiX174 Hae III cut M r markers; lane 2, uncleaved PCR product, lanes 3,8 Taq I cleavage pattern from subjects with heterozygous TC genotype; lanes 4,7 Taq I cleaved PCR product from subjects with CC genotype; lanes 5,9–10 Taq I cleaved PCR products from a subject with TT genotype, lane 6, no sample. The products were analyzed on 2% agarose gel and visualized under UV light after staining with ethidium bromide. The number on the right side indicate the product sizes (bp)

    Article Snippet: The same PCR product was digested with restriction enzyme Taq I (New England BioLabs) at 65 °C for 75 min to detect the Taq I polymorphism [ ].

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Staining