taq dna polymerase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Taq polymerase
    Description:

    Catalog Number:
    TP1360476
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher taq dna polymerase
    A mobility shift assay for TaqS <t>DNA</t> polymerase (A) and NeqSSB-TaqS DNA polymerase (B) with ssDNA and dsDNA. The output products were analyzed on a 2% agarose gel with ethidium bromide in the UV light. The reaction mix contained 10 pmol Oligo (dT) 76 and/or 2.5 pmol PCR product with a length of 100 bp. In panel A: 1. Oligo (dT) 76 and 0 pmol TaqS DNA polymerase; 2. 100 bp PCR product and 0 pmol DNA polymerase; 3–9. Oligo (dT) 76 and 100 bp PCR product with 24,6; 49,2; 98,4; 196,8; 393,6; 787,2; 1574,4 pmol of TaqS DNA polymerase, respectively. In panel B: 11. Oligo (dT) 76 and 0 pmol NeqSSB-TaqS DNA polymerase. 12. 100 bp PCR product and 0 pmol NeqSSB-TaqS DNA polymerase. 13–19. Oligo (dT) 76 and 100 bp PCR product with 3,3; 6,6; 13,2; 26,4; 52,8; 105,6; 211,2 pmol Neq SSB- <t>Taq</t> S DNA polymerase, respectively.

    https://www.bioz.com/result/taq dna polymerase/product/Thermo Fisher
    Average 99 stars, based on 3839 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization"

    Article Title: Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0184162

    A mobility shift assay for TaqS DNA polymerase (A) and NeqSSB-TaqS DNA polymerase (B) with ssDNA and dsDNA. The output products were analyzed on a 2% agarose gel with ethidium bromide in the UV light. The reaction mix contained 10 pmol Oligo (dT) 76 and/or 2.5 pmol PCR product with a length of 100 bp. In panel A: 1. Oligo (dT) 76 and 0 pmol TaqS DNA polymerase; 2. 100 bp PCR product and 0 pmol DNA polymerase; 3–9. Oligo (dT) 76 and 100 bp PCR product with 24,6; 49,2; 98,4; 196,8; 393,6; 787,2; 1574,4 pmol of TaqS DNA polymerase, respectively. In panel B: 11. Oligo (dT) 76 and 0 pmol NeqSSB-TaqS DNA polymerase. 12. 100 bp PCR product and 0 pmol NeqSSB-TaqS DNA polymerase. 13–19. Oligo (dT) 76 and 100 bp PCR product with 3,3; 6,6; 13,2; 26,4; 52,8; 105,6; 211,2 pmol Neq SSB- Taq S DNA polymerase, respectively.
    Figure Legend Snippet: A mobility shift assay for TaqS DNA polymerase (A) and NeqSSB-TaqS DNA polymerase (B) with ssDNA and dsDNA. The output products were analyzed on a 2% agarose gel with ethidium bromide in the UV light. The reaction mix contained 10 pmol Oligo (dT) 76 and/or 2.5 pmol PCR product with a length of 100 bp. In panel A: 1. Oligo (dT) 76 and 0 pmol TaqS DNA polymerase; 2. 100 bp PCR product and 0 pmol DNA polymerase; 3–9. Oligo (dT) 76 and 100 bp PCR product with 24,6; 49,2; 98,4; 196,8; 393,6; 787,2; 1574,4 pmol of TaqS DNA polymerase, respectively. In panel B: 11. Oligo (dT) 76 and 0 pmol NeqSSB-TaqS DNA polymerase. 12. 100 bp PCR product and 0 pmol NeqSSB-TaqS DNA polymerase. 13–19. Oligo (dT) 76 and 100 bp PCR product with 3,3; 6,6; 13,2; 26,4; 52,8; 105,6; 211,2 pmol Neq SSB- Taq S DNA polymerase, respectively.

    Techniques Used: Mobility Shift, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    Evaluation of PCR amplification rate. Comparison of the PCR amplification rates of a fusion Neq SSB -TaqS DNA polymerase for 300 bp (A), 500 bp (B), 1000 bp (C) products and a Taq S DNA polymerase for 300 bp (D), 500 bp (E), 1000 bp (F) products. The elongation times used for the PCR amplification are indicated at the top. Lane M: the DNA molecular size marker (50–2000 bp).
    Figure Legend Snippet: Evaluation of PCR amplification rate. Comparison of the PCR amplification rates of a fusion Neq SSB -TaqS DNA polymerase for 300 bp (A), 500 bp (B), 1000 bp (C) products and a Taq S DNA polymerase for 300 bp (D), 500 bp (E), 1000 bp (F) products. The elongation times used for the PCR amplification are indicated at the top. Lane M: the DNA molecular size marker (50–2000 bp).

    Techniques Used: Polymerase Chain Reaction, Amplification, Marker

    Characterization of a fusion Neq SSB -TaqS DNA polymerase in comparison to a Taq S DNA polymerase. The effect of (A) MgCl 2 , (B) KCl, (C) (NH 4 ) 2 SO 4 , (D) pH and (E) temperature on the polymerase activity. The results for the NeqSSB-TaqS DNA polymerase are marked with black circles, whilst for the Taq S DNA polymerase with black tringles. Error bars for the TaqS DNA polymerase have the end bar whilst for the Neq - Taq S DNA polymerase does not have the end bar.
    Figure Legend Snippet: Characterization of a fusion Neq SSB -TaqS DNA polymerase in comparison to a Taq S DNA polymerase. The effect of (A) MgCl 2 , (B) KCl, (C) (NH 4 ) 2 SO 4 , (D) pH and (E) temperature on the polymerase activity. The results for the NeqSSB-TaqS DNA polymerase are marked with black circles, whilst for the Taq S DNA polymerase with black tringles. Error bars for the TaqS DNA polymerase have the end bar whilst for the Neq - Taq S DNA polymerase does not have the end bar.

    Techniques Used: Activity Assay

    2) Product Images from "Functional Characterization of the Stringent Response Regulatory Gene dksA of Vibrio cholerae and Its Role in Modulation of Virulence Phenotypes"

    Article Title: Functional Characterization of the Stringent Response Regulatory Gene dksA of Vibrio cholerae and Its Role in Modulation of Virulence Phenotypes

    Journal:

    doi: 10.1128/JB.00518-12

    (A) Growth complementation of the Δ dksAEc strain with a functional dksAVc gene in M9M medium. E. coli strains used are as follows: Wt, CF1648; ΔdksA, CF9240; ΔdksA+pDksAvc, CF9240(pDDKW1); ΔdksA+pDksAec, CF9240(pJK537); ΔdksA+pEmpty, CF9240(pDrive). Error bars indicate standard deviations. (B) Genomic arrangement of the dksA gene (gray arrow), including its flanking genetic determinants (VC0590 to VC0600), in V. cholerae . The direction of each arrow indicates the direction of transcription of a gene. VC0598 and VC0599 are two small hypothetical ORFs (white arrows). The insertion location of the kanamycin resistance gene ( kan ) cassette (small filled triangle) and its direction of transcription are also shown. (C) RT-PCR analysis to show that the deletion of dksAVc did not hamper transcription of downstream genes. V. cholerae strains used are the Wt (C6709) and the Δ dksAVc mutant (C-DksA1). Lanes: M, pBluescript II KS(+) plasmid DNA digested with HaeIII, used as markers; sizes (in kb) of the DNA fragments are given in the left margin; R, RT with Taq DNA polymerase; N, only Taq DNA polymerase (used as a negative control).
    Figure Legend Snippet: (A) Growth complementation of the Δ dksAEc strain with a functional dksAVc gene in M9M medium. E. coli strains used are as follows: Wt, CF1648; ΔdksA, CF9240; ΔdksA+pDksAvc, CF9240(pDDKW1); ΔdksA+pDksAec, CF9240(pJK537); ΔdksA+pEmpty, CF9240(pDrive). Error bars indicate standard deviations. (B) Genomic arrangement of the dksA gene (gray arrow), including its flanking genetic determinants (VC0590 to VC0600), in V. cholerae . The direction of each arrow indicates the direction of transcription of a gene. VC0598 and VC0599 are two small hypothetical ORFs (white arrows). The insertion location of the kanamycin resistance gene ( kan ) cassette (small filled triangle) and its direction of transcription are also shown. (C) RT-PCR analysis to show that the deletion of dksAVc did not hamper transcription of downstream genes. V. cholerae strains used are the Wt (C6709) and the Δ dksAVc mutant (C-DksA1). Lanes: M, pBluescript II KS(+) plasmid DNA digested with HaeIII, used as markers; sizes (in kb) of the DNA fragments are given in the left margin; R, RT with Taq DNA polymerase; N, only Taq DNA polymerase (used as a negative control).

    Techniques Used: Functional Assay, Reverse Transcription Polymerase Chain Reaction, Mutagenesis, Plasmid Preparation, Negative Control

    3) Product Images from "Selective control of primer usage in multiplex one-step reverse transcription PCR"

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-10-113

    Real-time one-step RT-PCR evaluation of cDNA priming strategies and the effect of unbalanced target concentrations . A) Real-time one-step RT-PCR evaluation of the effect of different RT primers on quantification of RNA expression in singleplex and in triplex. Reactions employed either an oligo(dT) 18 RT primer, a random decamer RT primer, or a combination of oligo(dT) 18 and random decamer RT primers for cDNA synthesis. In addition, each one-step RT-PCR protocol employed Taq DNA polymerase, M-MLV RT, 0.8 μg of human thymus total RNA, and CleanAmp™ Precision PCR primers. Reactions were performed in triplicate. B) Real-time one-step RT-PCR evaluation of triplex one-step RT-PCR amplifications using different custom prepared mixes containing three RNA standards in different ratios. The relative abundance for each mixture A through H is represented in the following format: (X:Y:Z), where the copies of the ABCA5 RNA standard is present at 10^X copies, the ABCA6 RNA standard is present at 10^Y copies, and the ABCA7 RNA standard is present at 10^Z copies. The observed copy number for each reaction, which was performed in triplicate, was obtained by extrapolation of the Cq to a standard curve for the ABCA5, ABCA6, and ABCA7 RNA standards. The resultant data for each RNA sample was normalized to ABCA7 and was plotted graphically.
    Figure Legend Snippet: Real-time one-step RT-PCR evaluation of cDNA priming strategies and the effect of unbalanced target concentrations . A) Real-time one-step RT-PCR evaluation of the effect of different RT primers on quantification of RNA expression in singleplex and in triplex. Reactions employed either an oligo(dT) 18 RT primer, a random decamer RT primer, or a combination of oligo(dT) 18 and random decamer RT primers for cDNA synthesis. In addition, each one-step RT-PCR protocol employed Taq DNA polymerase, M-MLV RT, 0.8 μg of human thymus total RNA, and CleanAmp™ Precision PCR primers. Reactions were performed in triplicate. B) Real-time one-step RT-PCR evaluation of triplex one-step RT-PCR amplifications using different custom prepared mixes containing three RNA standards in different ratios. The relative abundance for each mixture A through H is represented in the following format: (X:Y:Z), where the copies of the ABCA5 RNA standard is present at 10^X copies, the ABCA6 RNA standard is present at 10^Y copies, and the ABCA7 RNA standard is present at 10^Z copies. The observed copy number for each reaction, which was performed in triplicate, was obtained by extrapolation of the Cq to a standard curve for the ABCA5, ABCA6, and ABCA7 RNA standards. The resultant data for each RNA sample was normalized to ABCA7 and was plotted graphically.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, RNA Expression, Polymerase Chain Reaction

    One-step RT-PCR evaluation of unmodified and thermolabile CleanAmp™ Precision primers to amplify three different targets of ABCA transporters in singleplex, duplex, and triplex amplifications . For each gene of interest (ABCA5, ABCA6, and ABCA7), the PCR primers were unmodified or contained CleanAmp™ Precision modifications. Reverse transcription utilized an oligo(dT) 18 primer. Reactions contained Taq DNA polymerase, the appropriate reverse transcriptase, and 0.82 μg of human trachea total RNA. A) Reactions employed M-MLV reverse transcriptase and utilized an RT extension temperature of 42°C. B) Reactions employed SuperScript ® III reverse transcriptase (SSIII RT) and utilized an RT extension temperature of 55°C.
    Figure Legend Snippet: One-step RT-PCR evaluation of unmodified and thermolabile CleanAmp™ Precision primers to amplify three different targets of ABCA transporters in singleplex, duplex, and triplex amplifications . For each gene of interest (ABCA5, ABCA6, and ABCA7), the PCR primers were unmodified or contained CleanAmp™ Precision modifications. Reverse transcription utilized an oligo(dT) 18 primer. Reactions contained Taq DNA polymerase, the appropriate reverse transcriptase, and 0.82 μg of human trachea total RNA. A) Reactions employed M-MLV reverse transcriptase and utilized an RT extension temperature of 42°C. B) Reactions employed SuperScript ® III reverse transcriptase (SSIII RT) and utilized an RT extension temperature of 55°C.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

    Hot Start DNA polymerase evaluation in triplex one-step RT-PCR amplification of ABCA5, ABCA6 and ABCA7 targets . Reactions contained 0.82 μg of human trachea total RNA and an unmodified oligo(dT) 18 RT primer. The PCR primers were either unmodified, or contained CleanAmp™ Precision modifications. These reactions contained one of the following DNA polymerases: Taq , Platinum ® Taq , or AmpliTaq Gold ® and one of the following reverse transcriptases: M-MLV or SSIII. Reactions with M-MLV were incubated at 42°C, while reactions with SSIII were incubated at 55°C.
    Figure Legend Snippet: Hot Start DNA polymerase evaluation in triplex one-step RT-PCR amplification of ABCA5, ABCA6 and ABCA7 targets . Reactions contained 0.82 μg of human trachea total RNA and an unmodified oligo(dT) 18 RT primer. The PCR primers were either unmodified, or contained CleanAmp™ Precision modifications. These reactions contained one of the following DNA polymerases: Taq , Platinum ® Taq , or AmpliTaq Gold ® and one of the following reverse transcriptases: M-MLV or SSIII. Reactions with M-MLV were incubated at 42°C, while reactions with SSIII were incubated at 55°C.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Incubation

    Singleplex and triplex real-time one-step RT-PCR detection of ABCA5, ABCA6, and ABCA7 in three different tissues . Reactions, which were performed in triplicate, contained M-MLV reverse transcriptase, an unmodified oligo(dT) 18 primer, Taq DNA polymerase and CleanAmp™ Precision PCR primers for the ABCA5, ABCA6 and ABCA7 genes. A standard curve for ABCA5, ABCA6, and ABCA7 was determined by employing ~10 1 to ~10 8 copies of the appropriate RNA standard. Each of the three human total RNA tissue samples (brain (0.78 μg), thymus (0.8 μg), and trachea (0.82 μg)) was amplified in singleplex and triplex format for detection of ABCA5, ABCA6, and ABCA7. The number of copies of each target in a given tissue was determined by extrapolating the resultant Cq values to the standard curve and normalizing the resultant values to the micrograms of input total RNA. A) The relative number of copies per microgram and standard deviation for each target in brain, thymus, and trachea total RNA is represented in a bar graph, which displays the results for singleplex and triplex amplifications. B) The corresponding agarose gel analysis of the three tissue samples amplified in singleplex and in triplex.
    Figure Legend Snippet: Singleplex and triplex real-time one-step RT-PCR detection of ABCA5, ABCA6, and ABCA7 in three different tissues . Reactions, which were performed in triplicate, contained M-MLV reverse transcriptase, an unmodified oligo(dT) 18 primer, Taq DNA polymerase and CleanAmp™ Precision PCR primers for the ABCA5, ABCA6 and ABCA7 genes. A standard curve for ABCA5, ABCA6, and ABCA7 was determined by employing ~10 1 to ~10 8 copies of the appropriate RNA standard. Each of the three human total RNA tissue samples (brain (0.78 μg), thymus (0.8 μg), and trachea (0.82 μg)) was amplified in singleplex and triplex format for detection of ABCA5, ABCA6, and ABCA7. The number of copies of each target in a given tissue was determined by extrapolating the resultant Cq values to the standard curve and normalizing the resultant values to the micrograms of input total RNA. A) The relative number of copies per microgram and standard deviation for each target in brain, thymus, and trachea total RNA is represented in a bar graph, which displays the results for singleplex and triplex amplifications. B) The corresponding agarose gel analysis of the three tissue samples amplified in singleplex and in triplex.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Standard Deviation, Agarose Gel Electrophoresis

    Evaluation of M-MLV and SSIII reverse transcriptases in multiplex one-step RT-PCR amplification of up to five targets . The amplification of increasing number of targets was evaluated by using either M-MLV RT (42°C) or SSIII RT (55°C). Reactions contained an oligo(dT) 18 primer, 0.82 μg of human trachea total RNA, CleanAmp™ Precision primers, and Taq DNA polymerase.
    Figure Legend Snippet: Evaluation of M-MLV and SSIII reverse transcriptases in multiplex one-step RT-PCR amplification of up to five targets . The amplification of increasing number of targets was evaluated by using either M-MLV RT (42°C) or SSIII RT (55°C). Reactions contained an oligo(dT) 18 primer, 0.82 μg of human trachea total RNA, CleanAmp™ Precision primers, and Taq DNA polymerase.

    Techniques Used: Multiplex Assay, Reverse Transcription Polymerase Chain Reaction, Amplification

    4) Product Images from "A Ubiquitin Ligase Complex Regulates Caspase Activation During Sperm Differentiation in DrosophilaA Protein Complex Restrains a Homicidal Enzyme during Sperm Differentiation"

    Article Title: A Ubiquitin Ligase Complex Regulates Caspase Activation During Sperm Differentiation in DrosophilaA Protein Complex Restrains a Homicidal Enzyme during Sperm Differentiation

    Journal: PLoS Biology

    doi: 10.1371/journal.pbio.0050251

    cul3 Testis but Not cul3 Soma Can Restore Caspase Activation and Spermatid Individualization to cul3 Testis Null Mutants (A) Schematic structure of the rescue constructs for cul3 Testis −/− male sterile flies. The constructs tr-cul3 Testis and tr-cul3 Soma are composed of the cul3 Testis isoform's promoter region (dark blue, consists of the intronic sequences flanked by exons 2 and 1D) and 5′ UTR (light blue) that were fused upstream of the coding regions (ORFs) of either cul3 Testis or cul3 Soma followed by the 3′ UTR of cul3 Testis . (B and C) Transcriptional expression from the transgenes was confirmed by RT–PCR analyses on RNA from testes of the indicated genotypes. The relative locations of the primers are indicated with black arrows in (A). “RT+Taq” and “Taq” indicate reactions with reverse transcriptase or without it, respectively, to control for possible genomic DNA contamination. (B) To differentiate between the cul3 Testis endogenous (endog.) and transgenic (transg.) cDNAs, we cleaved the RT-PCR fragments with XhoI, a unique restriction site in the transgene. Note that the RT-PCR product from cul3 mds1 ; tr-cul3 Testis but not from WT testes was cleaved by XhoI, confirming its transgenic source. (C) Transgenic expression of cul3 Soma ( tr - cul3 Soma ) in adult testis. Note the absence of the endogenous cul3 Testis cDNA band and in contrast, the presence of the transgenic cul3 Soma band in cul3 mds1 ; tr - cul3 Soma /+ testes. (D–I) Testes stained for cleaved caspase-3 (CM1, green) and spermatid's tail and ICs (phalloidin, red). (D) Mutant spermatids for cul3 Testis ( cul3 mds1 −/− ) manifest a block in caspase activation and spermatid individualization. (E) Either one or (F) two copies of transgenic cul3 Testis ( tr-cul3 Testis ) restores caspase activation, spermatid individualization, and fertility of cul3 mds1 −/− male flies. (G) Wild-type control testes. Note the CBs and WBs (green oval structures). (H–I) In contrast, dramatically reduced CM1-positive cysts are found in cul3 mds1 mutants, which ectopically express (H) one or (I) two copies of the cul3 Soma transgene ( tr-cul3 Soma ). These spermatids failed to individualize, no CBs and WBs are detected and the males are sterile. Scale bars 200 μm.
    Figure Legend Snippet: cul3 Testis but Not cul3 Soma Can Restore Caspase Activation and Spermatid Individualization to cul3 Testis Null Mutants (A) Schematic structure of the rescue constructs for cul3 Testis −/− male sterile flies. The constructs tr-cul3 Testis and tr-cul3 Soma are composed of the cul3 Testis isoform's promoter region (dark blue, consists of the intronic sequences flanked by exons 2 and 1D) and 5′ UTR (light blue) that were fused upstream of the coding regions (ORFs) of either cul3 Testis or cul3 Soma followed by the 3′ UTR of cul3 Testis . (B and C) Transcriptional expression from the transgenes was confirmed by RT–PCR analyses on RNA from testes of the indicated genotypes. The relative locations of the primers are indicated with black arrows in (A). “RT+Taq” and “Taq” indicate reactions with reverse transcriptase or without it, respectively, to control for possible genomic DNA contamination. (B) To differentiate between the cul3 Testis endogenous (endog.) and transgenic (transg.) cDNAs, we cleaved the RT-PCR fragments with XhoI, a unique restriction site in the transgene. Note that the RT-PCR product from cul3 mds1 ; tr-cul3 Testis but not from WT testes was cleaved by XhoI, confirming its transgenic source. (C) Transgenic expression of cul3 Soma ( tr - cul3 Soma ) in adult testis. Note the absence of the endogenous cul3 Testis cDNA band and in contrast, the presence of the transgenic cul3 Soma band in cul3 mds1 ; tr - cul3 Soma /+ testes. (D–I) Testes stained for cleaved caspase-3 (CM1, green) and spermatid's tail and ICs (phalloidin, red). (D) Mutant spermatids for cul3 Testis ( cul3 mds1 −/− ) manifest a block in caspase activation and spermatid individualization. (E) Either one or (F) two copies of transgenic cul3 Testis ( tr-cul3 Testis ) restores caspase activation, spermatid individualization, and fertility of cul3 mds1 −/− male flies. (G) Wild-type control testes. Note the CBs and WBs (green oval structures). (H–I) In contrast, dramatically reduced CM1-positive cysts are found in cul3 mds1 mutants, which ectopically express (H) one or (I) two copies of the cul3 Soma transgene ( tr-cul3 Soma ). These spermatids failed to individualize, no CBs and WBs are detected and the males are sterile. Scale bars 200 μm.

    Techniques Used: Activation Assay, Construct, Expressing, Reverse Transcription Polymerase Chain Reaction, Transgenic Assay, Staining, Mutagenesis, Blocking Assay

    5) Product Images from "An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV"

    Article Title: An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV

    Journal: Retrovirology

    doi: 10.1186/1742-4690-7-110

    One-step RT-PCR for identification of contaminants in Kit I and Platinum Taq . (A-C) One-step RT-PCR for identification of a contaminated component in Kit I. The experiments were conducted in two independent laboratories, IVR and JRC. In IVR, nucleic acids were extracted from 50 μl of the enzyme mix of the RT-PCR Kit I using an RNA purification column (QIAamp viral RNA mini kit [Cat. no. 52904] [QIAGEN]) and the presence of polytropic endogenous MLV was examined by using the RT-PCR Kit T (A) and Kit P (B). In JRC, nucleic acids were extracted from 75 μl of the enzyme mix of RT-PCR Kit I using an RNA/DNA purification column (PureLink™ Viral RNA/DNA Kit [Cat. no. 12280-050] [Invitrogen]), and the presence of polytropic endogenous MLV was examined using Kit Q (C). Five μl of test samples were examined with primers indicated below the corresponding lanes. The RT-PCR conditions for Kit T and Kit P were the same as in Figure 1B. The RT-PCR conditions for Kit Q were as follows: reverse transcription at 50°C for 30 minutes; activation at 95°C for 15 minutes; 45 cycles of the following steps: 94°C for 30 s, 57°C for 30 s, and 72°C for 1 minute; and a final extension at 72°C for 10 minutes. Lanes 1 and 5, DW; lanes 2 and 6, column-purified carrier RNA (carrier); lanes 3 and 7, column-purified nucleic acids from enzyme mix (enzyme) of the Kit I; lanes 4 and 8, 1 μl buffer of the Kit I plus 4 μl DW (buffer). (D) One-step RT-PCR for the detection of MLV RNA in Platinum Taq. Nucleic acids were extracted from 50 μl of the Platinum Taq using an RNA purification column (QIAamp viral RNA mini kit [QIAGEN]) and the presence of MLV RNA was examined by using the RT-PCR Kit P. Five μl of test samples were examined with primers indicated below the corresponding lanes. The RT-PCR condition was the same as in Figure 1B with the exception of the PCR cycles (60 cycles instead of 45 cycles). Abbreviation; DW: distilled water. M: DNA size marker.
    Figure Legend Snippet: One-step RT-PCR for identification of contaminants in Kit I and Platinum Taq . (A-C) One-step RT-PCR for identification of a contaminated component in Kit I. The experiments were conducted in two independent laboratories, IVR and JRC. In IVR, nucleic acids were extracted from 50 μl of the enzyme mix of the RT-PCR Kit I using an RNA purification column (QIAamp viral RNA mini kit [Cat. no. 52904] [QIAGEN]) and the presence of polytropic endogenous MLV was examined by using the RT-PCR Kit T (A) and Kit P (B). In JRC, nucleic acids were extracted from 75 μl of the enzyme mix of RT-PCR Kit I using an RNA/DNA purification column (PureLink™ Viral RNA/DNA Kit [Cat. no. 12280-050] [Invitrogen]), and the presence of polytropic endogenous MLV was examined using Kit Q (C). Five μl of test samples were examined with primers indicated below the corresponding lanes. The RT-PCR conditions for Kit T and Kit P were the same as in Figure 1B. The RT-PCR conditions for Kit Q were as follows: reverse transcription at 50°C for 30 minutes; activation at 95°C for 15 minutes; 45 cycles of the following steps: 94°C for 30 s, 57°C for 30 s, and 72°C for 1 minute; and a final extension at 72°C for 10 minutes. Lanes 1 and 5, DW; lanes 2 and 6, column-purified carrier RNA (carrier); lanes 3 and 7, column-purified nucleic acids from enzyme mix (enzyme) of the Kit I; lanes 4 and 8, 1 μl buffer of the Kit I plus 4 μl DW (buffer). (D) One-step RT-PCR for the detection of MLV RNA in Platinum Taq. Nucleic acids were extracted from 50 μl of the Platinum Taq using an RNA purification column (QIAamp viral RNA mini kit [QIAGEN]) and the presence of MLV RNA was examined by using the RT-PCR Kit P. Five μl of test samples were examined with primers indicated below the corresponding lanes. The RT-PCR condition was the same as in Figure 1B with the exception of the PCR cycles (60 cycles instead of 45 cycles). Abbreviation; DW: distilled water. M: DNA size marker.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Purification, DNA Purification, Activation Assay, Polymerase Chain Reaction, Marker

    6) Product Images from "Large scale multiplex PCR improves pathogen detection by DNA microarrays"

    Article Title: Large scale multiplex PCR improves pathogen detection by DNA microarrays

    Journal: BMC Microbiology

    doi: 10.1186/1471-2180-9-1

    Large scale multiplex PCR with 800 primer pairs . Gel electrophoresis of PCR products obtained with high complexity 800-primer pair mix (Additional file 1 ) with a final concentration of 0.02 μM for each individual primer pair and using Taq polymerase (standard LSplex) (A) or using vent exo-polymerase (B and C). Efficiency of LSplex using primer mix with different individual primer concentrations (B). Optimized LSplex amplification of various DNA templates from Gram-negative, Gram-positive bacteria and Candida albicans (C). 100 ng genomic DNA from each indicated species served as template.
    Figure Legend Snippet: Large scale multiplex PCR with 800 primer pairs . Gel electrophoresis of PCR products obtained with high complexity 800-primer pair mix (Additional file 1 ) with a final concentration of 0.02 μM for each individual primer pair and using Taq polymerase (standard LSplex) (A) or using vent exo-polymerase (B and C). Efficiency of LSplex using primer mix with different individual primer concentrations (B). Optimized LSplex amplification of various DNA templates from Gram-negative, Gram-positive bacteria and Candida albicans (C). 100 ng genomic DNA from each indicated species served as template.

    Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Nucleic Acid Electrophoresis, Concentration Assay, Amplification

    7) Product Images from "Demonstration of a potent RET transcriptional inhibitor for the treatment of medullary thyroid carcinoma based on an ellipticine derivative"

    Article Title: Demonstration of a potent RET transcriptional inhibitor for the treatment of medullary thyroid carcinoma based on an ellipticine derivative

    Journal: International Journal of Oncology

    doi: 10.3892/ijo.2017.3994

    Taq DNA polymerase assay and DMS footprinting to validate the stabilization of RET G-quadruplex by NSC311153. (A) DNA polymerase stop assay at increasing concentrations of NSC311153. Lanes A, G, T and C represent the di-deoxy sequencing reactions with the same template, which serve as the marker to locate the exact stop site. Lane P represents the position of the free primer on the gel. (B) DMS footprinting on the RET-WT G-quadruplex forming sequence in the absence and presence of NSC311153 (5 equivalents) following 0.2% DMS treatment (lanes C and D, respectively). Purine and pyrimidine sequencing act as single base ladders to identify the protected and cleaved guanines after piperidine treatment (lanes AG and TC, respectively). (C) Schematic models for the parallel G-quadruplexes formed by RET-WT sequence in the absence and presence of NSC311153.
    Figure Legend Snippet: Taq DNA polymerase assay and DMS footprinting to validate the stabilization of RET G-quadruplex by NSC311153. (A) DNA polymerase stop assay at increasing concentrations of NSC311153. Lanes A, G, T and C represent the di-deoxy sequencing reactions with the same template, which serve as the marker to locate the exact stop site. Lane P represents the position of the free primer on the gel. (B) DMS footprinting on the RET-WT G-quadruplex forming sequence in the absence and presence of NSC311153 (5 equivalents) following 0.2% DMS treatment (lanes C and D, respectively). Purine and pyrimidine sequencing act as single base ladders to identify the protected and cleaved guanines after piperidine treatment (lanes AG and TC, respectively). (C) Schematic models for the parallel G-quadruplexes formed by RET-WT sequence in the absence and presence of NSC311153.

    Techniques Used: Footprinting, Sequencing, Marker, Activated Clotting Time Assay

    8) Product Images from "The novel gene Ny-1 on potato chromosome IX confers hypersensitive resistance to Potato virus Y and is an alternative to Ry genes in potato breeding for PVY resistance"

    Article Title: The novel gene Ny-1 on potato chromosome IX confers hypersensitive resistance to Potato virus Y and is an alternative to Ry genes in potato breeding for PVY resistance

    Journal: TAG. Theoretical and Applied Genetics. Theoretische Und Angewandte Genetik

    doi: 10.1007/s00122-007-0667-1

    Patterns of amplified DNA of resistant parent cv. Rywal ( lanes 1, 3, 5 and 7) and susceptible parent Accent ( lanes 2, 4, 6 and 8 ), indicating the ISSR marker UBC895 1200 ( lane 1 ), the STS marker SC895 1139 ( lane 3 ), the SCAR marker GP41 443 ( lane 5 ) and the COSII marker C2_At3g16840 after digestion with Taq I ( lanes 7 and 8 ). Arrows point to the marker products that were scored. Lanes M contain the 250-bp ( upper ) and 100-bp ( lower ) DNA ladders as molecular size markers
    Figure Legend Snippet: Patterns of amplified DNA of resistant parent cv. Rywal ( lanes 1, 3, 5 and 7) and susceptible parent Accent ( lanes 2, 4, 6 and 8 ), indicating the ISSR marker UBC895 1200 ( lane 1 ), the STS marker SC895 1139 ( lane 3 ), the SCAR marker GP41 443 ( lane 5 ) and the COSII marker C2_At3g16840 after digestion with Taq I ( lanes 7 and 8 ). Arrows point to the marker products that were scored. Lanes M contain the 250-bp ( upper ) and 100-bp ( lower ) DNA ladders as molecular size markers

    Techniques Used: Amplification, Marker

    9) Product Images from "Targeted sequencing library preparation by genomic DNA circularization"

    Article Title: Targeted sequencing library preparation by genomic DNA circularization

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-11-122

    Targeted sequencing library preparation method . (a) Overview of the assay. (b) Specific preparation steps: (1) genomic DNA is digested using Mse I restriction endonuclease. (2) Then, genomic DNA fragments are circularized using thermostable DNA ligase and Taq DNA polymerase for 5' editing. Pool of oligonucleotides targeting 5' and 3' ends of the DNA fragments and vector oligonucleotide are used for targeted DNA capture. (3) After circularization, regular Illumina sequencing library can be prepared by PCR. (4) PCR amplified library fragments are similar to regular Illumina library constructs and anneal to immobilized primers on the flow cell. (5) Additionally, circular constructs can be directly sequenced as the adapted genomic DNA circles incorporate all DNA components required for library immobilization and sequencing. (c) Molecular structures of vector oligonucleotide and capture oligonucleotides.
    Figure Legend Snippet: Targeted sequencing library preparation method . (a) Overview of the assay. (b) Specific preparation steps: (1) genomic DNA is digested using Mse I restriction endonuclease. (2) Then, genomic DNA fragments are circularized using thermostable DNA ligase and Taq DNA polymerase for 5' editing. Pool of oligonucleotides targeting 5' and 3' ends of the DNA fragments and vector oligonucleotide are used for targeted DNA capture. (3) After circularization, regular Illumina sequencing library can be prepared by PCR. (4) PCR amplified library fragments are similar to regular Illumina library constructs and anneal to immobilized primers on the flow cell. (5) Additionally, circular constructs can be directly sequenced as the adapted genomic DNA circles incorporate all DNA components required for library immobilization and sequencing. (c) Molecular structures of vector oligonucleotide and capture oligonucleotides.

    Techniques Used: Sequencing, Plasmid Preparation, Polymerase Chain Reaction, Amplification, Construct, Flow Cytometry

    10) Product Images from "Mechanical properties of DNA-like polymers"

    Article Title: Mechanical properties of DNA-like polymers

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkt808

    Characterization of DNA analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). PrimeSTAR HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).
    Figure Legend Snippet: Characterization of DNA analogs. ( A ) PCR assays analyzed by 5% native polyacrylamide gel electrophoresis. Total PCR volume 100 µl: 20 ng 418-bp DNA template (pJ1506), 0.4 mM each LJM-3222 (5'-G TA CGC AG T ) and LJM-3223 (5'-TGTGAGT AGCTCACTCAT AG ), 0.2 mM each dNTP with indicated analog triphosphate ( 1–9 ) completely replacing appropriate dNTP, and 5 U DNA polymerase (indicated with plus symbol) with associated buffer and cycle conditions. Taq DNA polymerase ( Taq ) conditions: Taq DNA polymerase buffer with 100 mg/ml BSA and 2 mM MgCl ; 98°C (3 min), 30 cycles of [94°C (30 s), 60°C (30 s), and 72°C (45 s)], 72°C (5 min). PrimeSTAR HS DNA polymerase (PS) conditions: PrimeSTAR GC buffer with 2 M betaine; 98°C (3 min), 30 cycles of [98°C (15 s), 60°C (5 s), and 72°C (45 s)], 72°C (5 min). Pwo SuperYield DNA Polymerase ( Pwo ) conditions: Pwo PCR buffer with GC-rich solution and 2 M betaine; 98°C (3 min), 30 cycles of [98°C (1 min), 60°C (2 min), and 72°C (8 min)], 72°C (5 min). Lane 1 is marker (M) DNA (100 bp DNA ladder, Invitrogen) with 400 - and 500-bp bands indicated. ( B ) Anion exchange chromatography of 98-bp DNA-like polymers (pJ1923). Following equilibration in 20 mM Tris–HCl, pH 8 (buffer A), samples were eluted over 25 min at a 1 ml/min flow rate in a linear gradient from 50 to 100% buffer B (buffer A plus 1 M NaCl). Eluent absorbance at 260 nm (milli-absorbance units) was monitored with elution time (min).

    Techniques Used: Polymerase Chain Reaction, Polyacrylamide Gel Electrophoresis, Gas Chromatography, Marker, Chromatography, Flow Cytometry

    11) Product Images from "Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization"

    Article Title: Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0184162

    A mobility shift assay for TaqS DNA polymerase (A) and NeqSSB-TaqS DNA polymerase (B) with ssDNA and dsDNA. The output products were analyzed on a 2% agarose gel with ethidium bromide in the UV light. The reaction mix contained 10 pmol Oligo (dT) 76 and/or 2.5 pmol PCR product with a length of 100 bp. In panel A: 1. Oligo (dT) 76 and 0 pmol TaqS DNA polymerase; 2. 100 bp PCR product and 0 pmol DNA polymerase; 3–9. Oligo (dT) 76 and 100 bp PCR product with 24,6; 49,2; 98,4; 196,8; 393,6; 787,2; 1574,4 pmol of TaqS DNA polymerase, respectively. In panel B: 11. Oligo (dT) 76 and 0 pmol NeqSSB-TaqS DNA polymerase. 12. 100 bp PCR product and 0 pmol NeqSSB-TaqS DNA polymerase. 13–19. Oligo (dT) 76 and 100 bp PCR product with 3,3; 6,6; 13,2; 26,4; 52,8; 105,6; 211,2 pmol Neq SSB- Taq S DNA polymerase, respectively.
    Figure Legend Snippet: A mobility shift assay for TaqS DNA polymerase (A) and NeqSSB-TaqS DNA polymerase (B) with ssDNA and dsDNA. The output products were analyzed on a 2% agarose gel with ethidium bromide in the UV light. The reaction mix contained 10 pmol Oligo (dT) 76 and/or 2.5 pmol PCR product with a length of 100 bp. In panel A: 1. Oligo (dT) 76 and 0 pmol TaqS DNA polymerase; 2. 100 bp PCR product and 0 pmol DNA polymerase; 3–9. Oligo (dT) 76 and 100 bp PCR product with 24,6; 49,2; 98,4; 196,8; 393,6; 787,2; 1574,4 pmol of TaqS DNA polymerase, respectively. In panel B: 11. Oligo (dT) 76 and 0 pmol NeqSSB-TaqS DNA polymerase. 12. 100 bp PCR product and 0 pmol NeqSSB-TaqS DNA polymerase. 13–19. Oligo (dT) 76 and 100 bp PCR product with 3,3; 6,6; 13,2; 26,4; 52,8; 105,6; 211,2 pmol Neq SSB- Taq S DNA polymerase, respectively.

    Techniques Used: Mobility Shift, Agarose Gel Electrophoresis, Polymerase Chain Reaction

    Evaluation of PCR amplification rate. Comparison of the PCR amplification rates of a fusion Neq SSB -TaqS DNA polymerase for 300 bp (A), 500 bp (B), 1000 bp (C) products and a Taq S DNA polymerase for 300 bp (D), 500 bp (E), 1000 bp (F) products. The elongation times used for the PCR amplification are indicated at the top. Lane M: the DNA molecular size marker (50–2000 bp).
    Figure Legend Snippet: Evaluation of PCR amplification rate. Comparison of the PCR amplification rates of a fusion Neq SSB -TaqS DNA polymerase for 300 bp (A), 500 bp (B), 1000 bp (C) products and a Taq S DNA polymerase for 300 bp (D), 500 bp (E), 1000 bp (F) products. The elongation times used for the PCR amplification are indicated at the top. Lane M: the DNA molecular size marker (50–2000 bp).

    Techniques Used: Polymerase Chain Reaction, Amplification, Marker

    Characterization of a fusion Neq SSB -TaqS DNA polymerase in comparison to a Taq S DNA polymerase. The effect of (A) MgCl 2 , (B) KCl, (C) (NH 4 ) 2 SO 4 , (D) pH and (E) temperature on the polymerase activity. The results for the NeqSSB-TaqS DNA polymerase are marked with black circles, whilst for the Taq S DNA polymerase with black tringles. Error bars for the TaqS DNA polymerase have the end bar whilst for the Neq - Taq S DNA polymerase does not have the end bar.
    Figure Legend Snippet: Characterization of a fusion Neq SSB -TaqS DNA polymerase in comparison to a Taq S DNA polymerase. The effect of (A) MgCl 2 , (B) KCl, (C) (NH 4 ) 2 SO 4 , (D) pH and (E) temperature on the polymerase activity. The results for the NeqSSB-TaqS DNA polymerase are marked with black circles, whilst for the Taq S DNA polymerase with black tringles. Error bars for the TaqS DNA polymerase have the end bar whilst for the Neq - Taq S DNA polymerase does not have the end bar.

    Techniques Used: Activity Assay

    12) Product Images from "Removal of mismatched bases from synthetic genes by enzymatic mismatch cleavage"

    Article Title: Removal of mismatched bases from synthetic genes by enzymatic mismatch cleavage

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gni058

    Synthesis of a functional chloramphenicol acetyltransferase gene with changed codon composition. The ratio r of ‘active clones’ to ‘analyzed clones’ as described in the text is shown for different gene synthesis methods with or without an EMC step. A significant increase of r can be observed only in the cases where EMC is combined with an exonuclease activity present in the reaction or in the later amplification reaction. Prolonged incubation with E.coli endonuclease V results in no detectable product after the amplification steps (ss, single-stranded synthesis, ds, double-stranded synthesis; VII, T4 endonuclease VII; V, E.coli endonuclease V; T, Taq DNA polymerase; and Vn, Vent DNA polymerase).
    Figure Legend Snippet: Synthesis of a functional chloramphenicol acetyltransferase gene with changed codon composition. The ratio r of ‘active clones’ to ‘analyzed clones’ as described in the text is shown for different gene synthesis methods with or without an EMC step. A significant increase of r can be observed only in the cases where EMC is combined with an exonuclease activity present in the reaction or in the later amplification reaction. Prolonged incubation with E.coli endonuclease V results in no detectable product after the amplification steps (ss, single-stranded synthesis, ds, double-stranded synthesis; VII, T4 endonuclease VII; V, E.coli endonuclease V; T, Taq DNA polymerase; and Vn, Vent DNA polymerase).

    Techniques Used: Functional Assay, Clone Assay, Activity Assay, Amplification, Incubation

    13) Product Images from "rpoB Gene Analysis as a Novel Strategy for Identification of Spirochetes from the Genera Borrelia, Treponema, and Leptospira"

    Article Title: rpoB Gene Analysis as a Novel Strategy for Identification of Spirochetes from the Genera Borrelia, Treponema, and Leptospira

    Journal:

    doi:

    Specific PCR amplification of the spirochetal rpoB gene. The PCR assay was performed by using Taq polymerase with an annealing temperature of 52°C. Lanes: 1, molecular mass markers (DNA molecular weight marker VI; Boehringer); 2, Borrelia burgdorferi ; 3, Borrelia recurrentis ; 4, Treponema pallidum ; 5, Leptospira biflexa serovar patoc; 6, Leptospira interrogans , serovar australis; 7, Leptospira interrogans , serovar icterohaemmorragiae; 8, Escherichia coli ; 9, Staphylococcus aureus ; 10, Streptococcus salivarius ; 11, Pseudomonas aeruginosa ; 12, negative control without DNA. (A) rpoB gene primers LTB 1730F and LTB 2900R. (B) rpoB gene primers LTB 1730F and LTB 3700R. (C) 16S rRNA gene primers FD1 and RP2.
    Figure Legend Snippet: Specific PCR amplification of the spirochetal rpoB gene. The PCR assay was performed by using Taq polymerase with an annealing temperature of 52°C. Lanes: 1, molecular mass markers (DNA molecular weight marker VI; Boehringer); 2, Borrelia burgdorferi ; 3, Borrelia recurrentis ; 4, Treponema pallidum ; 5, Leptospira biflexa serovar patoc; 6, Leptospira interrogans , serovar australis; 7, Leptospira interrogans , serovar icterohaemmorragiae; 8, Escherichia coli ; 9, Staphylococcus aureus ; 10, Streptococcus salivarius ; 11, Pseudomonas aeruginosa ; 12, negative control without DNA. (A) rpoB gene primers LTB 1730F and LTB 2900R. (B) rpoB gene primers LTB 1730F and LTB 3700R. (C) 16S rRNA gene primers FD1 and RP2.

    Techniques Used: Polymerase Chain Reaction, Amplification, Molecular Weight, Marker, Negative Control

    14) Product Images from "Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein"

    Article Title: Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein

    Journal: Avicenna Journal of Medical Biotechnology

    doi:

    A) Gel agarose visualization of PCR products amplified by internal primers after amplification of cDNA as template. M (DNA marker); 1–3 (interest fragment amplified in optimized Tm=58° C ); 4 (negative control, human genomic DNA); B) PCR amplification results of the PTZ57R-PR vector containing protease ORF (301 bp ). Lanes 1 and 2 (DNA marker); lanes 3–6 (amplified by Taq DNA polymerase); lanes 7–8 (amplified by pfu DNA polymerase); lane 9 (negative control).
    Figure Legend Snippet: A) Gel agarose visualization of PCR products amplified by internal primers after amplification of cDNA as template. M (DNA marker); 1–3 (interest fragment amplified in optimized Tm=58° C ); 4 (negative control, human genomic DNA); B) PCR amplification results of the PTZ57R-PR vector containing protease ORF (301 bp ). Lanes 1 and 2 (DNA marker); lanes 3–6 (amplified by Taq DNA polymerase); lanes 7–8 (amplified by pfu DNA polymerase); lane 9 (negative control).

    Techniques Used: Polymerase Chain Reaction, Amplification, Marker, Negative Control, Plasmid Preparation

    15) Product Images from "Genetic Diversity of Pasteurella dagmatis as Assessed by Analysis of the 16S rRNA and rpoB Gene Sequences"

    Article Title: Genetic Diversity of Pasteurella dagmatis as Assessed by Analysis of the 16S rRNA and rpoB Gene Sequences

    Journal: Current Microbiology

    doi: 10.1007/s00284-011-9949-6

    Agarose gel electrophoresis of a 476-bp fragment of the P . dagmatis 16S rRNA gene. Lanes 1 – 8 represent amplicons obtained from DNA of canine isolates, lanes 9 – 16 from DNA of feline isolates, and lanes 17 – 18 from DNA of the isolate from a tiger. For each isolate, intact amplicons ( lanes with odd numbers ) and Taq I-digested ones ( lanes with even numbers ) were run. M size marker (GeneRuler ™ 100 bp DNA Ladder [Fermentas])
    Figure Legend Snippet: Agarose gel electrophoresis of a 476-bp fragment of the P . dagmatis 16S rRNA gene. Lanes 1 – 8 represent amplicons obtained from DNA of canine isolates, lanes 9 – 16 from DNA of feline isolates, and lanes 17 – 18 from DNA of the isolate from a tiger. For each isolate, intact amplicons ( lanes with odd numbers ) and Taq I-digested ones ( lanes with even numbers ) were run. M size marker (GeneRuler ™ 100 bp DNA Ladder [Fermentas])

    Techniques Used: Agarose Gel Electrophoresis, Marker

    16) Product Images from "Selective repression of RET proto-oncogene in medullary thyroid carcinoma by a natural alkaloid berberine"

    Article Title: Selective repression of RET proto-oncogene in medullary thyroid carcinoma by a natural alkaloid berberine

    Journal: BMC Cancer

    doi: 10.1186/s12885-015-1610-5

    Taq DNA polymerase stop assay showing the stabilization of the RET G-quadruplex with berberine and its structural analogues. a Structures of berberine and its analogues. b Sequence of the single-stranded template DNA annealed with the 5′-[ 32 P] labelled primer used in DNA polymerase stop assay. c DNA polymerase stop assay at increasing concentrations of berberine (0, 0.75, 1.5, 15 μg/ml) and its analogues (0, 0.75, 1.5,3, 15 μg/ml). Lanes A, G, T C represent the di-deoxy sequencing reactions with the same template, which serve as the marker to identify the exact stop site. Lane P represents the position of the free primer on the gel
    Figure Legend Snippet: Taq DNA polymerase stop assay showing the stabilization of the RET G-quadruplex with berberine and its structural analogues. a Structures of berberine and its analogues. b Sequence of the single-stranded template DNA annealed with the 5′-[ 32 P] labelled primer used in DNA polymerase stop assay. c DNA polymerase stop assay at increasing concentrations of berberine (0, 0.75, 1.5, 15 μg/ml) and its analogues (0, 0.75, 1.5,3, 15 μg/ml). Lanes A, G, T C represent the di-deoxy sequencing reactions with the same template, which serve as the marker to identify the exact stop site. Lane P represents the position of the free primer on the gel

    Techniques Used: Sequencing, Marker

    17) Product Images from "Assaying chromatin structure and remodeling by restriction enzyme accessibility"

    Article Title: Assaying chromatin structure and remodeling by restriction enzyme accessibility

    Journal: Methods in molecular biology (Clifton, N.J.)

    doi: 10.1007/978-1-61779-477-3_6

    BRG1-dependent restriction endonuclease chromatin accessibility within the MMTV promoter. A) Nucleosomal organization of the MMTV promoter. When stably integrated into the host genome the MMTV promoter is organized into a phased array of six positioned nucleosomes (A-F). The hormone inducible hypersensitivity region is encompassed by nucleosome B (Nuc-B). The expanded schematic of the proximal portion of the MMTV promoter shows the location of hormone-response elements (HREs), nuclear factor 1 (NF1), octamer transcription factors (OTFs) and the TATA binding protein (TBP) and identifies cleavage sites for restriction enzymes to test for induced hypersensitivity and chromatin remodeling . B) SW-13/MMTV cells, expressing GR, were transiently transfected with empty vector (-BRG1) or BRG1 expression plasmid (+BRG1). Nuclei, from untreated (-) or dexamethasone treated (10−7 M) cells, were isolated and digested with restriction endonucleases targeting sequences within nucleosome-B (in vivo: Sst I, Mbo I, or Fok I). Purified genomic DNA was digested to completion with Hae III (In vitro). Fifteen micrograms of each sample was analyzed using linear Taq polymerase reiterative primer extension with a 32 P-labeled single-stranded specific for MMTV. Extension products were analyzed on a 6% polyacrylamide denaturing gel and exposed to PhosphorImage screen.
    Figure Legend Snippet: BRG1-dependent restriction endonuclease chromatin accessibility within the MMTV promoter. A) Nucleosomal organization of the MMTV promoter. When stably integrated into the host genome the MMTV promoter is organized into a phased array of six positioned nucleosomes (A-F). The hormone inducible hypersensitivity region is encompassed by nucleosome B (Nuc-B). The expanded schematic of the proximal portion of the MMTV promoter shows the location of hormone-response elements (HREs), nuclear factor 1 (NF1), octamer transcription factors (OTFs) and the TATA binding protein (TBP) and identifies cleavage sites for restriction enzymes to test for induced hypersensitivity and chromatin remodeling . B) SW-13/MMTV cells, expressing GR, were transiently transfected with empty vector (-BRG1) or BRG1 expression plasmid (+BRG1). Nuclei, from untreated (-) or dexamethasone treated (10−7 M) cells, were isolated and digested with restriction endonucleases targeting sequences within nucleosome-B (in vivo: Sst I, Mbo I, or Fok I). Purified genomic DNA was digested to completion with Hae III (In vitro). Fifteen micrograms of each sample was analyzed using linear Taq polymerase reiterative primer extension with a 32 P-labeled single-stranded specific for MMTV. Extension products were analyzed on a 6% polyacrylamide denaturing gel and exposed to PhosphorImage screen.

    Techniques Used: Stable Transfection, Binding Assay, Expressing, Transfection, Plasmid Preparation, Isolation, In Vivo, Purification, In Vitro, Labeling

    Schematic of the restriction enzyme hypersensitivity assay used to evaluate chromatin structure and detect SWI/SNF-mediated chromatin remodeling activity. Nuclei are isolated from naïve or hormone-treated cells with (+BRG1) or without (-BRG1) expression of a functional SWI/SNF chromatin remodeling complex. The chromatin is partially digested with various restriction endonucleases (A, B, or C) that target the predicted hypersensitive region (II). After purification, the genomic DNA is digested to competition with a second restriction enzyme which cut outside the hypersensitive region (enzyme X). The resulting DNA is purified and analyzed by reiterative primer extension using Taq polymerase and a 32 P-labeled oligonucleotide specific for the target of interest. The amplified products are resolved on a denaturing polyacrylamide gel and exposed to a PhosphorImager screen to detect the presence of bands that correspond, in length, to the predicted in vivo restriction endonuclease cleavage pattern. Re-digestion with the second restriction enzyme (in vitro digest) serves as an internal standard to ensure equal amounts of template DNA was loaded in each reaction. The prediction in this model would suggest that the SWI/SNF complex targets regions within nucleosome II where it remodeling the chromatin structure to allow access to transcription factors or, in this case, restriction endonucleases to the genomic DNA. In the absences of BRG1, SWI/SNF is unable to remodel nucleosome II where it act to block restriction enzyme access to the target DNA.
    Figure Legend Snippet: Schematic of the restriction enzyme hypersensitivity assay used to evaluate chromatin structure and detect SWI/SNF-mediated chromatin remodeling activity. Nuclei are isolated from naïve or hormone-treated cells with (+BRG1) or without (-BRG1) expression of a functional SWI/SNF chromatin remodeling complex. The chromatin is partially digested with various restriction endonucleases (A, B, or C) that target the predicted hypersensitive region (II). After purification, the genomic DNA is digested to competition with a second restriction enzyme which cut outside the hypersensitive region (enzyme X). The resulting DNA is purified and analyzed by reiterative primer extension using Taq polymerase and a 32 P-labeled oligonucleotide specific for the target of interest. The amplified products are resolved on a denaturing polyacrylamide gel and exposed to a PhosphorImager screen to detect the presence of bands that correspond, in length, to the predicted in vivo restriction endonuclease cleavage pattern. Re-digestion with the second restriction enzyme (in vitro digest) serves as an internal standard to ensure equal amounts of template DNA was loaded in each reaction. The prediction in this model would suggest that the SWI/SNF complex targets regions within nucleosome II where it remodeling the chromatin structure to allow access to transcription factors or, in this case, restriction endonucleases to the genomic DNA. In the absences of BRG1, SWI/SNF is unable to remodel nucleosome II where it act to block restriction enzyme access to the target DNA.

    Techniques Used: Activity Assay, Isolation, Expressing, Functional Assay, Purification, Labeling, Amplification, In Vivo, In Vitro, Activated Clotting Time Assay, Blocking Assay

    18) Product Images from "Selective control of primer usage in multiplex one-step reverse transcription PCR"

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-10-113

    Real-time one-step RT-PCR evaluation of cDNA priming strategies and the effect of unbalanced target concentrations . A) Real-time one-step RT-PCR evaluation of the effect of different RT primers on quantification of RNA expression in singleplex and in triplex. Reactions employed either an oligo(dT) 18 RT primer, a random decamer RT primer, or a combination of oligo(dT) 18 and random decamer RT primers for cDNA synthesis. In addition, each one-step RT-PCR protocol employed Taq DNA polymerase, M-MLV RT, 0.8 μg of human thymus total RNA, and CleanAmp™ Precision PCR primers. Reactions were performed in triplicate. B) Real-time one-step RT-PCR evaluation of triplex one-step RT-PCR amplifications using different custom prepared mixes containing three RNA standards in different ratios. The relative abundance for each mixture A through H is represented in the following format: (X:Y:Z), where the copies of the ABCA5 RNA standard is present at 10^X copies, the ABCA6 RNA standard is present at 10^Y copies, and the ABCA7 RNA standard is present at 10^Z copies. The observed copy number for each reaction, which was performed in triplicate, was obtained by extrapolation of the Cq to a standard curve for the ABCA5, ABCA6, and ABCA7 RNA standards. The resultant data for each RNA sample was normalized to ABCA7 and was plotted graphically.
    Figure Legend Snippet: Real-time one-step RT-PCR evaluation of cDNA priming strategies and the effect of unbalanced target concentrations . A) Real-time one-step RT-PCR evaluation of the effect of different RT primers on quantification of RNA expression in singleplex and in triplex. Reactions employed either an oligo(dT) 18 RT primer, a random decamer RT primer, or a combination of oligo(dT) 18 and random decamer RT primers for cDNA synthesis. In addition, each one-step RT-PCR protocol employed Taq DNA polymerase, M-MLV RT, 0.8 μg of human thymus total RNA, and CleanAmp™ Precision PCR primers. Reactions were performed in triplicate. B) Real-time one-step RT-PCR evaluation of triplex one-step RT-PCR amplifications using different custom prepared mixes containing three RNA standards in different ratios. The relative abundance for each mixture A through H is represented in the following format: (X:Y:Z), where the copies of the ABCA5 RNA standard is present at 10^X copies, the ABCA6 RNA standard is present at 10^Y copies, and the ABCA7 RNA standard is present at 10^Z copies. The observed copy number for each reaction, which was performed in triplicate, was obtained by extrapolation of the Cq to a standard curve for the ABCA5, ABCA6, and ABCA7 RNA standards. The resultant data for each RNA sample was normalized to ABCA7 and was plotted graphically.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, RNA Expression, Polymerase Chain Reaction

    One-step RT-PCR evaluation of unmodified and thermolabile CleanAmp™ Precision primers to amplify three different targets of ABCA transporters in singleplex, duplex, and triplex amplifications . For each gene of interest (ABCA5, ABCA6, and ABCA7), the PCR primers were unmodified or contained CleanAmp™ Precision modifications. Reverse transcription utilized an oligo(dT) 18 primer. Reactions contained Taq DNA polymerase, the appropriate reverse transcriptase, and 0.82 μg of human trachea total RNA. A) Reactions employed M-MLV reverse transcriptase and utilized an RT extension temperature of 42°C. B) Reactions employed SuperScript ® III reverse transcriptase (SSIII RT) and utilized an RT extension temperature of 55°C.
    Figure Legend Snippet: One-step RT-PCR evaluation of unmodified and thermolabile CleanAmp™ Precision primers to amplify three different targets of ABCA transporters in singleplex, duplex, and triplex amplifications . For each gene of interest (ABCA5, ABCA6, and ABCA7), the PCR primers were unmodified or contained CleanAmp™ Precision modifications. Reverse transcription utilized an oligo(dT) 18 primer. Reactions contained Taq DNA polymerase, the appropriate reverse transcriptase, and 0.82 μg of human trachea total RNA. A) Reactions employed M-MLV reverse transcriptase and utilized an RT extension temperature of 42°C. B) Reactions employed SuperScript ® III reverse transcriptase (SSIII RT) and utilized an RT extension temperature of 55°C.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

    Hot Start DNA polymerase evaluation in triplex one-step RT-PCR amplification of ABCA5, ABCA6 and ABCA7 targets . Reactions contained 0.82 μg of human trachea total RNA and an unmodified oligo(dT) 18 RT primer. The PCR primers were either unmodified, or contained CleanAmp™ Precision modifications. These reactions contained one of the following DNA polymerases: Taq , Platinum ® Taq , or AmpliTaq Gold ® and one of the following reverse transcriptases: M-MLV or SSIII. Reactions with M-MLV were incubated at 42°C, while reactions with SSIII were incubated at 55°C.
    Figure Legend Snippet: Hot Start DNA polymerase evaluation in triplex one-step RT-PCR amplification of ABCA5, ABCA6 and ABCA7 targets . Reactions contained 0.82 μg of human trachea total RNA and an unmodified oligo(dT) 18 RT primer. The PCR primers were either unmodified, or contained CleanAmp™ Precision modifications. These reactions contained one of the following DNA polymerases: Taq , Platinum ® Taq , or AmpliTaq Gold ® and one of the following reverse transcriptases: M-MLV or SSIII. Reactions with M-MLV were incubated at 42°C, while reactions with SSIII were incubated at 55°C.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Incubation

    Singleplex and triplex real-time one-step RT-PCR detection of ABCA5, ABCA6, and ABCA7 in three different tissues . Reactions, which were performed in triplicate, contained M-MLV reverse transcriptase, an unmodified oligo(dT) 18 primer, Taq DNA polymerase and CleanAmp™ Precision PCR primers for the ABCA5, ABCA6 and ABCA7 genes. A standard curve for ABCA5, ABCA6, and ABCA7 was determined by employing ~10 1 to ~10 8 copies of the appropriate RNA standard. Each of the three human total RNA tissue samples (brain (0.78 μg), thymus (0.8 μg), and trachea (0.82 μg)) was amplified in singleplex and triplex format for detection of ABCA5, ABCA6, and ABCA7. The number of copies of each target in a given tissue was determined by extrapolating the resultant Cq values to the standard curve and normalizing the resultant values to the micrograms of input total RNA. A) The relative number of copies per microgram and standard deviation for each target in brain, thymus, and trachea total RNA is represented in a bar graph, which displays the results for singleplex and triplex amplifications. B) The corresponding agarose gel analysis of the three tissue samples amplified in singleplex and in triplex.
    Figure Legend Snippet: Singleplex and triplex real-time one-step RT-PCR detection of ABCA5, ABCA6, and ABCA7 in three different tissues . Reactions, which were performed in triplicate, contained M-MLV reverse transcriptase, an unmodified oligo(dT) 18 primer, Taq DNA polymerase and CleanAmp™ Precision PCR primers for the ABCA5, ABCA6 and ABCA7 genes. A standard curve for ABCA5, ABCA6, and ABCA7 was determined by employing ~10 1 to ~10 8 copies of the appropriate RNA standard. Each of the three human total RNA tissue samples (brain (0.78 μg), thymus (0.8 μg), and trachea (0.82 μg)) was amplified in singleplex and triplex format for detection of ABCA5, ABCA6, and ABCA7. The number of copies of each target in a given tissue was determined by extrapolating the resultant Cq values to the standard curve and normalizing the resultant values to the micrograms of input total RNA. A) The relative number of copies per microgram and standard deviation for each target in brain, thymus, and trachea total RNA is represented in a bar graph, which displays the results for singleplex and triplex amplifications. B) The corresponding agarose gel analysis of the three tissue samples amplified in singleplex and in triplex.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Standard Deviation, Agarose Gel Electrophoresis

    Evaluation of M-MLV and SSIII reverse transcriptases in multiplex one-step RT-PCR amplification of up to five targets . The amplification of increasing number of targets was evaluated by using either M-MLV RT (42°C) or SSIII RT (55°C). Reactions contained an oligo(dT) 18 primer, 0.82 μg of human trachea total RNA, CleanAmp™ Precision primers, and Taq DNA polymerase.
    Figure Legend Snippet: Evaluation of M-MLV and SSIII reverse transcriptases in multiplex one-step RT-PCR amplification of up to five targets . The amplification of increasing number of targets was evaluated by using either M-MLV RT (42°C) or SSIII RT (55°C). Reactions contained an oligo(dT) 18 primer, 0.82 μg of human trachea total RNA, CleanAmp™ Precision primers, and Taq DNA polymerase.

    Techniques Used: Multiplex Assay, Reverse Transcription Polymerase Chain Reaction, Amplification

    19) Product Images from "Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus"

    Article Title: Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus

    Journal: Enzyme Research

    doi: 10.1155/2015/837842

    PCR reactions to amplify intermediate and long regions of DNA. Reactions were conducted as described under Section 2 . PCR reactions were allowed to proceed for 30 cycles. The same amount of primer and template was used in Tth pol III HE and Taq polymerase reactions. Primers used are shown in Table 3 . PCR product sizes are as indicated. (a) The template was pET Blue-2 plasmid (Novagen) and primers were designed to yield 1500 and 2500 bp products. (b) The template was Lambda DNA- Hind III Digest and primers were designed to yield a 4650 and 7500 bp product. (c) The template was Lambda DNA- Hind III Digest and primers were designed to yield a 12500 and 15000 bp product.
    Figure Legend Snippet: PCR reactions to amplify intermediate and long regions of DNA. Reactions were conducted as described under Section 2 . PCR reactions were allowed to proceed for 30 cycles. The same amount of primer and template was used in Tth pol III HE and Taq polymerase reactions. Primers used are shown in Table 3 . PCR product sizes are as indicated. (a) The template was pET Blue-2 plasmid (Novagen) and primers were designed to yield 1500 and 2500 bp products. (b) The template was Lambda DNA- Hind III Digest and primers were designed to yield a 4650 and 7500 bp product. (c) The template was Lambda DNA- Hind III Digest and primers were designed to yield a 12500 and 15000 bp product.

    Techniques Used: Polymerase Chain Reaction, Positron Emission Tomography, Plasmid Preparation, Lambda DNA Preparation

    PCR reactions for amplification of short regions of DNA. PCR reactions and agarose gel analysis were as described under Section 2 . PCR cycles consisted of 94°C/30 s, 55°C/1 min, and 72°C/2 min. Taq Pol indicates PCR reactions using Taq DNA polymerase (18038-018, Invitrogen) per manufacturer's instructions. Primers used are shown in Table 3 . (a) PCR reactions using primers designed to yield a 200 bp PCR product. (b) PCR reactions using primers designed to yield a 512 bp PCR product. The number of PCR cycles is indicated at bottom of the figures.
    Figure Legend Snippet: PCR reactions for amplification of short regions of DNA. PCR reactions and agarose gel analysis were as described under Section 2 . PCR cycles consisted of 94°C/30 s, 55°C/1 min, and 72°C/2 min. Taq Pol indicates PCR reactions using Taq DNA polymerase (18038-018, Invitrogen) per manufacturer's instructions. Primers used are shown in Table 3 . (a) PCR reactions using primers designed to yield a 200 bp PCR product. (b) PCR reactions using primers designed to yield a 512 bp PCR product. The number of PCR cycles is indicated at bottom of the figures.

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    20) Product Images from "Selective control of primer usage in multiplex one-step reverse transcription PCR"

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR

    Journal: BMC Molecular Biology

    doi: 10.1186/1471-2199-10-113

    Real-time one-step RT-PCR evaluation of cDNA priming strategies and the effect of unbalanced target concentrations . A) Real-time one-step RT-PCR evaluation of the effect of different RT primers on quantification of RNA expression in singleplex and in triplex. Reactions employed either an oligo(dT) 18 RT primer, a random decamer RT primer, or a combination of oligo(dT) 18 and random decamer RT primers for cDNA synthesis. In addition, each one-step RT-PCR protocol employed Taq DNA polymerase, M-MLV RT, 0.8 μg of human thymus total RNA, and CleanAmp™ Precision PCR primers. Reactions were performed in triplicate. B) Real-time one-step RT-PCR evaluation of triplex one-step RT-PCR amplifications using different custom prepared mixes containing three RNA standards in different ratios. The relative abundance for each mixture A through H is represented in the following format: (X:Y:Z), where the copies of the ABCA5 RNA standard is present at 10^X copies, the ABCA6 RNA standard is present at 10^Y copies, and the ABCA7 RNA standard is present at 10^Z copies. The observed copy number for each reaction, which was performed in triplicate, was obtained by extrapolation of the Cq to a standard curve for the ABCA5, ABCA6, and ABCA7 RNA standards. The resultant data for each RNA sample was normalized to ABCA7 and was plotted graphically.
    Figure Legend Snippet: Real-time one-step RT-PCR evaluation of cDNA priming strategies and the effect of unbalanced target concentrations . A) Real-time one-step RT-PCR evaluation of the effect of different RT primers on quantification of RNA expression in singleplex and in triplex. Reactions employed either an oligo(dT) 18 RT primer, a random decamer RT primer, or a combination of oligo(dT) 18 and random decamer RT primers for cDNA synthesis. In addition, each one-step RT-PCR protocol employed Taq DNA polymerase, M-MLV RT, 0.8 μg of human thymus total RNA, and CleanAmp™ Precision PCR primers. Reactions were performed in triplicate. B) Real-time one-step RT-PCR evaluation of triplex one-step RT-PCR amplifications using different custom prepared mixes containing three RNA standards in different ratios. The relative abundance for each mixture A through H is represented in the following format: (X:Y:Z), where the copies of the ABCA5 RNA standard is present at 10^X copies, the ABCA6 RNA standard is present at 10^Y copies, and the ABCA7 RNA standard is present at 10^Z copies. The observed copy number for each reaction, which was performed in triplicate, was obtained by extrapolation of the Cq to a standard curve for the ABCA5, ABCA6, and ABCA7 RNA standards. The resultant data for each RNA sample was normalized to ABCA7 and was plotted graphically.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, RNA Expression, Polymerase Chain Reaction

    One-step RT-PCR evaluation of unmodified and thermolabile CleanAmp™ Precision primers to amplify three different targets of ABCA transporters in singleplex, duplex, and triplex amplifications . For each gene of interest (ABCA5, ABCA6, and ABCA7), the PCR primers were unmodified or contained CleanAmp™ Precision modifications. Reverse transcription utilized an oligo(dT) 18 primer. Reactions contained Taq DNA polymerase, the appropriate reverse transcriptase, and 0.82 μg of human trachea total RNA. A) Reactions employed M-MLV reverse transcriptase and utilized an RT extension temperature of 42°C. B) Reactions employed SuperScript ® III reverse transcriptase (SSIII RT) and utilized an RT extension temperature of 55°C.
    Figure Legend Snippet: One-step RT-PCR evaluation of unmodified and thermolabile CleanAmp™ Precision primers to amplify three different targets of ABCA transporters in singleplex, duplex, and triplex amplifications . For each gene of interest (ABCA5, ABCA6, and ABCA7), the PCR primers were unmodified or contained CleanAmp™ Precision modifications. Reverse transcription utilized an oligo(dT) 18 primer. Reactions contained Taq DNA polymerase, the appropriate reverse transcriptase, and 0.82 μg of human trachea total RNA. A) Reactions employed M-MLV reverse transcriptase and utilized an RT extension temperature of 42°C. B) Reactions employed SuperScript ® III reverse transcriptase (SSIII RT) and utilized an RT extension temperature of 55°C.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction

    Hot Start DNA polymerase evaluation in triplex one-step RT-PCR amplification of ABCA5, ABCA6 and ABCA7 targets . Reactions contained 0.82 μg of human trachea total RNA and an unmodified oligo(dT) 18 RT primer. The PCR primers were either unmodified, or contained CleanAmp™ Precision modifications. These reactions contained one of the following DNA polymerases: Taq , Platinum ® Taq , or AmpliTaq Gold ® and one of the following reverse transcriptases: M-MLV or SSIII. Reactions with M-MLV were incubated at 42°C, while reactions with SSIII were incubated at 55°C.
    Figure Legend Snippet: Hot Start DNA polymerase evaluation in triplex one-step RT-PCR amplification of ABCA5, ABCA6 and ABCA7 targets . Reactions contained 0.82 μg of human trachea total RNA and an unmodified oligo(dT) 18 RT primer. The PCR primers were either unmodified, or contained CleanAmp™ Precision modifications. These reactions contained one of the following DNA polymerases: Taq , Platinum ® Taq , or AmpliTaq Gold ® and one of the following reverse transcriptases: M-MLV or SSIII. Reactions with M-MLV were incubated at 42°C, while reactions with SSIII were incubated at 55°C.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Incubation

    Singleplex and triplex real-time one-step RT-PCR detection of ABCA5, ABCA6, and ABCA7 in three different tissues . Reactions, which were performed in triplicate, contained M-MLV reverse transcriptase, an unmodified oligo(dT) 18 primer, Taq DNA polymerase and CleanAmp™ Precision PCR primers for the ABCA5, ABCA6 and ABCA7 genes. A standard curve for ABCA5, ABCA6, and ABCA7 was determined by employing ~10 1 to ~10 8 copies of the appropriate RNA standard. Each of the three human total RNA tissue samples (brain (0.78 μg), thymus (0.8 μg), and trachea (0.82 μg)) was amplified in singleplex and triplex format for detection of ABCA5, ABCA6, and ABCA7. The number of copies of each target in a given tissue was determined by extrapolating the resultant Cq values to the standard curve and normalizing the resultant values to the micrograms of input total RNA. A) The relative number of copies per microgram and standard deviation for each target in brain, thymus, and trachea total RNA is represented in a bar graph, which displays the results for singleplex and triplex amplifications. B) The corresponding agarose gel analysis of the three tissue samples amplified in singleplex and in triplex.
    Figure Legend Snippet: Singleplex and triplex real-time one-step RT-PCR detection of ABCA5, ABCA6, and ABCA7 in three different tissues . Reactions, which were performed in triplicate, contained M-MLV reverse transcriptase, an unmodified oligo(dT) 18 primer, Taq DNA polymerase and CleanAmp™ Precision PCR primers for the ABCA5, ABCA6 and ABCA7 genes. A standard curve for ABCA5, ABCA6, and ABCA7 was determined by employing ~10 1 to ~10 8 copies of the appropriate RNA standard. Each of the three human total RNA tissue samples (brain (0.78 μg), thymus (0.8 μg), and trachea (0.82 μg)) was amplified in singleplex and triplex format for detection of ABCA5, ABCA6, and ABCA7. The number of copies of each target in a given tissue was determined by extrapolating the resultant Cq values to the standard curve and normalizing the resultant values to the micrograms of input total RNA. A) The relative number of copies per microgram and standard deviation for each target in brain, thymus, and trachea total RNA is represented in a bar graph, which displays the results for singleplex and triplex amplifications. B) The corresponding agarose gel analysis of the three tissue samples amplified in singleplex and in triplex.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Standard Deviation, Agarose Gel Electrophoresis

    Evaluation of M-MLV and SSIII reverse transcriptases in multiplex one-step RT-PCR amplification of up to five targets . The amplification of increasing number of targets was evaluated by using either M-MLV RT (42°C) or SSIII RT (55°C). Reactions contained an oligo(dT) 18 primer, 0.82 μg of human trachea total RNA, CleanAmp™ Precision primers, and Taq DNA polymerase.
    Figure Legend Snippet: Evaluation of M-MLV and SSIII reverse transcriptases in multiplex one-step RT-PCR amplification of up to five targets . The amplification of increasing number of targets was evaluated by using either M-MLV RT (42°C) or SSIII RT (55°C). Reactions contained an oligo(dT) 18 primer, 0.82 μg of human trachea total RNA, CleanAmp™ Precision primers, and Taq DNA polymerase.

    Techniques Used: Multiplex Assay, Reverse Transcription Polymerase Chain Reaction, Amplification

    Related Articles

    Clone Assay:

    Article Title: Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization
    Article Snippet: The output products were analyzed using a 2% agarose gel ethidium bromide in the UV light. .. The gene encoding the Stoffel fragment of a Taq DNA polymerase was cloned into the vector pET-30 Ek/LIC to generate a pET30/TaqS plasmid which led to the expression of the enzyme as a protein with a C-terminal polyhistidine tag. .. The PCR products of the taq Stoffel and NeqSSB-like genes were mixed together with the DNA of the pET-30 Ek/LIC vector in order to obtain the pET30/NeqSSB-TaqS plasmid which encodes the enzyme as a fusion protein containing the complete NeqSSB-like sequence, a 6 amino acid linker (GGVDMI) and a sequence of the Taq Stoffel DNA polymerase with a C-terminal polyhistidine tag.

    Article Title: Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein
    Article Snippet: RT-PCR reaction was performed for achievement of 504 bp A-tailed PCR product using Taq DNA polymerase (Fermentas, Lithuania) according to following thermal cycle program: denaturation at 94°C for 5 min , 34 cycles of 94°C for 1 min , 58°C for 30 s , and 72°C for 60 s . .. The PCR products were purified using PCR Cleanup Kit (Roche, Germany).

    Article Title: Multi-pathogens sequence containing plasmids as positive controls for universal detection of potential agents of bioterrorism
    Article Snippet: Once the four single stranded DNA (ssDNA) sequences were synthesized by the manufacturer, they were assembled as a single double-stranded DNA (dsDNA) fragment to be subsequently cloned into the PGEM-T plasmid (PGEM-T Easy Vector System I kit, Promega France SARL, Charbonnieres-les-Bains, France). .. PCR reactions were carried out in a volume of 50 μl that included 10 mM Tris-HCl [pH 9.0], 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton X-100, 200 μM each dNTP, 0.4 μM of each oligonucleotide primer, 0.4 μM of the single stranded DNA, and 1.5 U of Taq DNA polymerase (Invitrogen, Cergy-Pontoise, France).

    Article Title: The novel gene Ny-1 on potato chromosome IX confers hypersensitive resistance to Potato virus Y and is an alternative to Ry genes in potato breeding for PVY resistance
    Article Snippet: Paragraph title: Plant DNA isolation, PCR, electrophoresis, DNA cloning and sequencing ... Inter-simple sequence repeat (ISSR) markers were amplified in 20 μl of 20 mM Tris–HCl pH 8.4, 50 mM KCl, 2% DMSO, 2.5 mM MgCl2, 0.2 mM of each deoxynucleotide, 0.3 μM of primer, containing 1 U Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 30 ng genomic DNA as template.

    Amplification:

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
    Article Snippet: M-MLV reverse transcriptase (25 U) (Invitrogen) and Taq DNA polymerase (2.5 U) (Invitrogen) were used in all quantitative real-time experiments. .. Serial dilutions of the RNA standards were conducted for each experiment in which copy numbers were determined for a total RNA standard or a synthetic mix of RNA standards at predetermined ratios.

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
    Article Snippet: Primer sequences for preparation of the RNA standards for ABCA5 (ABCA5-F-T7: 5'-TAATACGACTCACTATAGGGGCTGCTATTCTGACCACTCACTATA and ABCA5-R-dT: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTAACTGCCCAGACACCATGAT), ABCA6 (ABCA6-F-T7: 5'-TAATACGACTCACTATAGGCCATGAGAAATGTCCAGTTTCCT and ABCA6-R-dT: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTGCTGGGTTAAATTAGATATTGGTGTA), and ABCA7 (ABCA7-F-T7: 5'-TAATACGACTCACTATAGGTTTCTCTGGGACATGTGTAACTACTTG and ABCA7-R-dT: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTGTGATCGACCAGCCATACAG) were synthesized by TriLink BioTechnologies, Inc. PCR products for ABCA5, ABCA6 and ABCA7, which were amplified in one-step RT-PCR experiments using the appropriate primers from Table , were diluted 1:100 and were PCR amplified using the respective T7-F and dT-R primers. .. Reaction conditions were 1× PCR buffer (20 mM Tris (pH 8.4), 50 mM KCl) (Invitrogen) (2.5 mM MgCl2 ) (Invitrogen), T7-F and dT-R primers (0.5 μM), 0.2 mM dNTPs (New England BioLabs), 10 μL of diluted ABCA5, ABCA6 or ABCA7 PCR product, and 5 U Taq DNA polymerase (Invitrogen), in a 100 μL reaction volume.

    Article Title: A Ubiquitin Ligase Complex Regulates Caspase Activation During Sperm Differentiation in DrosophilaA Protein Complex Restrains a Homicidal Enzyme during Sperm Differentiation
    Article Snippet: The Mastercycler Gradient PCR machine (Eppendorf; http://www.eppendorf.com ) was programmed as follows: 50 °C for 30 min for the RT step followed by 94 °C for 2 min, and the amplification steps of 94 °C for 30 s, 60 °C for 30 s, and 68 °C for 1 min. A master-mix was prepared and aliquoted to five tubes, each of which was amplified for 17, 20, 25, 30, or 35 cycles. .. Absence of genomic DNA in RNA preparations was verified by replacing the RT/Taq mix with only Taq DNA polymerase (Invitrogen).

    Article Title: Multi-pathogens sequence containing plasmids as positive controls for universal detection of potential agents of bioterrorism
    Article Snippet: PCR amplification of each of the 4 single stranded DNA sequences by using primers consisting of the stabilization and the restriction site sequences (italics in ). .. PCR reactions were carried out in a volume of 50 μl that included 10 mM Tris-HCl [pH 9.0], 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton X-100, 200 μM each dNTP, 0.4 μM of each oligonucleotide primer, 0.4 μM of the single stranded DNA, and 1.5 U of Taq DNA polymerase (Invitrogen, Cergy-Pontoise, France).

    Article Title: The novel gene Ny-1 on potato chromosome IX confers hypersensitive resistance to Potato virus Y and is an alternative to Ry genes in potato breeding for PVY resistance
    Article Snippet: Extraction of plant genomic DNA and electrophoresis were performed as previously described (Flis et al. ). .. Inter-simple sequence repeat (ISSR) markers were amplified in 20 μl of 20 mM Tris–HCl pH 8.4, 50 mM KCl, 2% DMSO, 2.5 mM MgCl2, 0.2 mM of each deoxynucleotide, 0.3 μM of primer, containing 1 U Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 30 ng genomic DNA as template. .. The PCR parameters were: 40 cycles of 94°C for 20 s, 42°C for 30 s, 72°C for 2 min and a final extension time of 10 min at 72°C.

    Article Title: Mechanical properties of DNA-like polymers
    Article Snippet: Paragraph title: Polymerase chain reaction amplification of modified DNAs ... For analog 2 , PCR reactions (100 µl) included 20 ng plasmid template (or alternatively 20 ng of purified PCR product from a previous reaction), 0.4 mM forward and reverse primers, 100 mg/ml bovine serum albumin (BSA), Taq DNA polymerase buffer (Invitrogen), 2 mM MgCl , 0.2 mM each dNTP (with dTTP completely replaced by the analog triphosphate) and 5 U Taq DNA polymerase (Invitrogen).

    Random Hexamer Labeling:

    Article Title: Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein
    Article Snippet: Synthesis of cDNA was done under following conditions: 5 μg of isolated viral RNA was added to RT reaction mixture containing 20 units of PrimeScript ™RTase (200 U/μl ), 100 pmol of random hexamer, 4 μl of 5 x RT buffer, 20 units of Thermo Scientific RiboLock RNase inhibitor, and 10 mM of dNTPs mix (all from Fermentas, Lithuania) adjusted to the final volume of 20 μl with d.H2 O. .. RT-PCR reaction was performed for achievement of 504 bp A-tailed PCR product using Taq DNA polymerase (Fermentas, Lithuania) according to following thermal cycle program: denaturation at 94°C for 5 min , 34 cycles of 94°C for 1 min , 58°C for 30 s , and 72°C for 60 s .

    Synthesized:

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
    Article Snippet: Primer sequences for preparation of the RNA standards for ABCA5 (ABCA5-F-T7: 5'-TAATACGACTCACTATAGGGGCTGCTATTCTGACCACTCACTATA and ABCA5-R-dT: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTAACTGCCCAGACACCATGAT), ABCA6 (ABCA6-F-T7: 5'-TAATACGACTCACTATAGGCCATGAGAAATGTCCAGTTTCCT and ABCA6-R-dT: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTGCTGGGTTAAATTAGATATTGGTGTA), and ABCA7 (ABCA7-F-T7: 5'-TAATACGACTCACTATAGGTTTCTCTGGGACATGTGTAACTACTTG and ABCA7-R-dT: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTGTGATCGACCAGCCATACAG) were synthesized by TriLink BioTechnologies, Inc. PCR products for ABCA5, ABCA6 and ABCA7, which were amplified in one-step RT-PCR experiments using the appropriate primers from Table , were diluted 1:100 and were PCR amplified using the respective T7-F and dT-R primers. .. Reaction conditions were 1× PCR buffer (20 mM Tris (pH 8.4), 50 mM KCl) (Invitrogen) (2.5 mM MgCl2 ) (Invitrogen), T7-F and dT-R primers (0.5 μM), 0.2 mM dNTPs (New England BioLabs), 10 μL of diluted ABCA5, ABCA6 or ABCA7 PCR product, and 5 U Taq DNA polymerase (Invitrogen), in a 100 μL reaction volume.

    Article Title: Multi-pathogens sequence containing plasmids as positive controls for universal detection of potential agents of bioterrorism
    Article Snippet: Once the four single stranded DNA (ssDNA) sequences were synthesized by the manufacturer, they were assembled as a single double-stranded DNA (dsDNA) fragment to be subsequently cloned into the PGEM-T plasmid (PGEM-T Easy Vector System I kit, Promega France SARL, Charbonnieres-les-Bains, France). .. PCR reactions were carried out in a volume of 50 μl that included 10 mM Tris-HCl [pH 9.0], 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton X-100, 200 μM each dNTP, 0.4 μM of each oligonucleotide primer, 0.4 μM of the single stranded DNA, and 1.5 U of Taq DNA polymerase (Invitrogen, Cergy-Pontoise, France).

    Article Title: Identification of Four Entamoeba histolytica Organellar DNA Polymerases of the Family B and Cellular Localization of the Ehodp1 Gene and EhODP1 Protein
    Article Snippet: Total RNA was isolated with TRIzol (Invitrogen). cDNA was synthesized with 200 U of SuperScript II reverse transcriptase (Invitrogen) and 40 U of RNasin ribonuclease inhibitor (Promega). .. PCR assays were performed with 3 μ L of cDNA mixture, 400 μ M dNTPs, 2 mM MgCl2 , 200 nM of specific primers for each gene and 4 U of Taq DNA polymerase (Invitrogen).

    Quantitative RT-PCR:

    Article Title: Functional Characterization of the Stringent Response Regulatory Gene dksA of Vibrio cholerae and Its Role in Modulation of Virulence Phenotypes
    Article Snippet: Paragraph title: RT-PCR and qRT-PCR assays. ... To confirm absence of any contaminating DNA in prepared RNA samples, PCR assay of each sample was also done with Taq DNA polymerase (Invitrogen).

    SYBR Green Assay:

    Article Title: Functional Characterization of the Stringent Response Regulatory Gene dksA of Vibrio cholerae and Its Role in Modulation of Virulence Phenotypes
    Article Snippet: To confirm absence of any contaminating DNA in prepared RNA samples, PCR assay of each sample was also done with Taq DNA polymerase (Invitrogen). .. For qRT-PCR, cDNA was prepared from 1 μg of DNase I-treated RNA using SuperScriptIII RT (Invitrogen) essentially as described by the manufacturer.

    Quantitation Assay:

    Article Title: Functional Characterization of the Stringent Response Regulatory Gene dksA of Vibrio cholerae and Its Role in Modulation of Virulence Phenotypes
    Article Snippet: The purity check and quantitation of the prepared RNA were done spectrophotometrically ( ). .. To confirm absence of any contaminating DNA in prepared RNA samples, PCR assay of each sample was also done with Taq DNA polymerase (Invitrogen).

    Activity Assay:

    Article Title: Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization
    Article Snippet: The level of fluorescence was correlated with the polymerase activity and the number of bound nucleotides [ – ]. .. The activity was determined in relation to a commercial Taq DNA polymerase (Thermo Scientific, USA) with an activity of 1 U/μl. .. We optimized the working conditions for NeqSSB-TaqS DNA polymerases.

    Expressing:

    Article Title: Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization
    Article Snippet: The output products were analyzed using a 2% agarose gel ethidium bromide in the UV light. .. The gene encoding the Stoffel fragment of a Taq DNA polymerase was cloned into the vector pET-30 Ek/LIC to generate a pET30/TaqS plasmid which led to the expression of the enzyme as a protein with a C-terminal polyhistidine tag. .. The PCR products of the taq Stoffel and NeqSSB-like genes were mixed together with the DNA of the pET-30 Ek/LIC vector in order to obtain the pET30/NeqSSB-TaqS plasmid which encodes the enzyme as a fusion protein containing the complete NeqSSB-like sequence, a 6 amino acid linker (GGVDMI) and a sequence of the Taq Stoffel DNA polymerase with a C-terminal polyhistidine tag.

    Modification:

    Article Title: Mechanical properties of DNA-like polymers
    Article Snippet: Paragraph title: Polymerase chain reaction amplification of modified DNAs ... For analog 2 , PCR reactions (100 µl) included 20 ng plasmid template (or alternatively 20 ng of purified PCR product from a previous reaction), 0.4 mM forward and reverse primers, 100 mg/ml bovine serum albumin (BSA), Taq DNA polymerase buffer (Invitrogen), 2 mM MgCl , 0.2 mM each dNTP (with dTTP completely replaced by the analog triphosphate) and 5 U Taq DNA polymerase (Invitrogen).

    Real-time Polymerase Chain Reaction:

    Article Title: Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization
    Article Snippet: As directed in the EvaEZ Fluorometric Polymerase Activity Assay Kit Manual (Biotium, Hayward, USA), the DNA polymerase activity was assayed in an isothermal reaction at 72°C using MyGo/Pro Real-Time PCR instrument (IT-IS International Ltd., UK) in accordance with the definition of one unit of enzyme activity (“One unit of DNA polymerase activity is conventionally defined as the amount of enzyme that will incorporate 10 nmol of nucleotides during a 30-min incubation” [ ]). .. The activity was determined in relation to a commercial Taq DNA polymerase (Thermo Scientific, USA) with an activity of 1 U/μl.

    Derivative Assay:

    Article Title: An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV
    Article Snippet: In this study, we evaluated several one-step RT-PCR kits and a Taq DNA polymerase for the contamination of MLV-related genomes and found that the test kit and the Taq DNA polymerase from Invitrogen were contaminated with MLV-related genomes. .. The findings in the present study indicate that contaminating nucleic acids in the test kits can potentially produce false-positive PCR results in studies of XMRV and other MLV-related viruses.

    Gas Chromatography:

    Article Title: Mechanical properties of DNA-like polymers
    Article Snippet: For analog 2 , PCR reactions (100 µl) included 20 ng plasmid template (or alternatively 20 ng of purified PCR product from a previous reaction), 0.4 mM forward and reverse primers, 100 mg/ml bovine serum albumin (BSA), Taq DNA polymerase buffer (Invitrogen), 2 mM MgCl , 0.2 mM each dNTP (with dTTP completely replaced by the analog triphosphate) and 5 U Taq DNA polymerase (Invitrogen). .. For analogs 3 , 4 , 5 , 6 and 9 , PCR reactions (100 µl) included 20 ng template, 0.4 mM forward and reverse primers, PrimeSTAR GC buffer (Takara), 0.2 mM each dNTP (again with dTTP completely replaced with analog, except for variant 9 , which completely replaced dATP), 2 M betaine (Sigma-Aldrich) and 5 U PrimeSTAR HS DNA polymerase (Takara).

    Infection:

    Article Title: An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV
    Article Snippet: Although all research groups carefully performed their experiments to test XMRV infection by PCR and/or RT-PCR, it is still difficult to conclude that the positive results linking XMRV with CFS are not laboratory artifacts. .. In this study, we evaluated several one-step RT-PCR kits and a Taq DNA polymerase for the contamination of MLV-related genomes and found that the test kit and the Taq DNA polymerase from Invitrogen were contaminated with MLV-related genomes.

    other:

    Article Title: Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization
    Article Snippet: The processivity values determined with the use of a heparin trap were much lower than the values previously published for the Taq DNA polymerase [ , ] and were within a range of 80 nt to 160 nt.

    Article Title: Demonstration of a potent RET transcriptional inhibitor for the treatment of medullary thyroid carcinoma based on an ellipticine derivative
    Article Snippet: Taq DNA polymerase was purchased from Fermentas (Hanover, MD, USA).

    Article Title: Selective repression of RET proto-oncogene in medullary thyroid carcinoma by a natural alkaloid berberine
    Article Snippet: Taq DNA polymerase was purchased from Fermentas (Hanover, MD, USA).

    Sequencing:

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
    Article Snippet: RNA standards for ABCA5, ABCA6 and ABCA7 were made by synthesizing the forward gene-specific PCR primer with a T7 promoter sequence (T7-F) and reverse gene-specific PCR primer with a oligo(dT) sequence (dT-R) [ ]. .. Reaction conditions were 1× PCR buffer (20 mM Tris (pH 8.4), 50 mM KCl) (Invitrogen) (2.5 mM MgCl2 ) (Invitrogen), T7-F and dT-R primers (0.5 μM), 0.2 mM dNTPs (New England BioLabs), 10 μL of diluted ABCA5, ABCA6 or ABCA7 PCR product, and 5 U Taq DNA polymerase (Invitrogen), in a 100 μL reaction volume.

    Article Title: The novel gene Ny-1 on potato chromosome IX confers hypersensitive resistance to Potato virus Y and is an alternative to Ry genes in potato breeding for PVY resistance
    Article Snippet: Extraction of plant genomic DNA and electrophoresis were performed as previously described (Flis et al. ). .. Inter-simple sequence repeat (ISSR) markers were amplified in 20 μl of 20 mM Tris–HCl pH 8.4, 50 mM KCl, 2% DMSO, 2.5 mM MgCl2, 0.2 mM of each deoxynucleotide, 0.3 μM of primer, containing 1 U Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 30 ng genomic DNA as template. .. The PCR parameters were: 40 cycles of 94°C for 20 s, 42°C for 30 s, 72°C for 2 min and a final extension time of 10 min at 72°C.

    Recombinant:

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
    Article Snippet: A one-step RT-PCR protocol was used in which the components were combined in a single tube. .. Reaction conditions included 1× PCR buffer (20 mM Tris (pH 8.4), 50 mM KCl) (Invitrogen), 1.5 mM MgCl2 (Invitrogen), gene-specific PCR primers (0.5 μM) (TriLink), oligo(dT)18 primer (1 μM) (TriLink), 0.16 mM dNTPs (New England Biolabs), 0.5 μL of human trachea total RNA or other human total RNA (Stratagene or Ambion, each at ~1.6 μg/μL), 5 U RNase Inhibitor (New England Biolabs), 50 U Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Invitrogen) or SuperScript® III Reverse Transcriptase (SSIII RT) (Invitrogen), and 0.6 U of Taq DNA Polymerase, recombinant (Invitrogen) or Platinum® Taq DNA Polymerase (Invitrogen) or AmpliTaq Gold® DNA Polymerase (Applied Biosystems), in a 50 μL reaction volume. .. Thermal cycling conditions utilized a reverse transcription step at 42°C for 30 min when M-MLV RT was used and 55°C for 30 min when SSIII RT was employed; 95°C for 10 min (RT inactivation and initial denaturation step), followed by 45 PCR cycles at 95°C for 30 sec, 60°C for 1 min and final extension at 72°C for 5 min.

    DNA Extraction:

    Article Title: The novel gene Ny-1 on potato chromosome IX confers hypersensitive resistance to Potato virus Y and is an alternative to Ry genes in potato breeding for PVY resistance
    Article Snippet: Paragraph title: Plant DNA isolation, PCR, electrophoresis, DNA cloning and sequencing ... Inter-simple sequence repeat (ISSR) markers were amplified in 20 μl of 20 mM Tris–HCl pH 8.4, 50 mM KCl, 2% DMSO, 2.5 mM MgCl2, 0.2 mM of each deoxynucleotide, 0.3 μM of primer, containing 1 U Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 30 ng genomic DNA as template.

    Nucleic Acid Electrophoresis:

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
    Article Snippet: Reaction conditions were 1× PCR buffer (20 mM Tris (pH 8.4), 50 mM KCl) (Invitrogen) (2.5 mM MgCl2 ) (Invitrogen), T7-F and dT-R primers (0.5 μM), 0.2 mM dNTPs (New England BioLabs), 10 μL of diluted ABCA5, ABCA6 or ABCA7 PCR product, and 5 U Taq DNA polymerase (Invitrogen), in a 100 μL reaction volume. .. Thermal cycling conditions were 95°C for 2 min denaturation step, followed by 30 PCR cycles at 95°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, and final extension at 72°C for 5 min. PCR amplified products were isolated by QIAquick PCR purification kit (Qiagen) using the manufacturer's recommended protocol.

    Fluorescence:

    Article Title: Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization
    Article Snippet: The activity was determined in relation to a commercial Taq DNA polymerase (Thermo Scientific, USA) with an activity of 1 U/μl. .. The activity was determined in relation to a commercial Taq DNA polymerase (Thermo Scientific, USA) with an activity of 1 U/μl.

    Mutagenesis:

    Article Title: Mechanical properties of DNA-like polymers
    Article Snippet: pUC19-based plasmids containing intrinsically straight ∼200-bp sequences ( ) were subjected to site-directed mutagenesis to obtain suitable restriction sites ( Supplementary Data S2 ). .. For analog 2 , PCR reactions (100 µl) included 20 ng plasmid template (or alternatively 20 ng of purified PCR product from a previous reaction), 0.4 mM forward and reverse primers, 100 mg/ml bovine serum albumin (BSA), Taq DNA polymerase buffer (Invitrogen), 2 mM MgCl , 0.2 mM each dNTP (with dTTP completely replaced by the analog triphosphate) and 5 U Taq DNA polymerase (Invitrogen).

    Isolation:

    Article Title: Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein
    Article Snippet: Paragraph title: Viral RNA isolation and RT-PCR ... RT-PCR reaction was performed for achievement of 504 bp A-tailed PCR product using Taq DNA polymerase (Fermentas, Lithuania) according to following thermal cycle program: denaturation at 94°C for 5 min , 34 cycles of 94°C for 1 min , 58°C for 30 s , and 72°C for 60 s .

    Article Title: A Ubiquitin Ligase Complex Regulates Caspase Activation During Sperm Differentiation in DrosophilaA Protein Complex Restrains a Homicidal Enzyme during Sperm Differentiation
    Article Snippet: Paragraph title: RNA isolation and RT-PCR. ... Absence of genomic DNA in RNA preparations was verified by replacing the RT/Taq mix with only Taq DNA polymerase (Invitrogen).

    Article Title: Identification of Four Entamoeba histolytica Organellar DNA Polymerases of the Family B and Cellular Localization of the Ehodp1 Gene and EhODP1 Protein
    Article Snippet: Total RNA was isolated with TRIzol (Invitrogen). cDNA was synthesized with 200 U of SuperScript II reverse transcriptase (Invitrogen) and 40 U of RNasin ribonuclease inhibitor (Promega). .. PCR assays were performed with 3 μ L of cDNA mixture, 400 μ M dNTPs, 2 mM MgCl2 , 200 nM of specific primers for each gene and 4 U of Taq DNA polymerase (Invitrogen).

    Polymerase Chain Reaction:

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
    Article Snippet: Primer sequences for preparation of the RNA standards for ABCA5 (ABCA5-F-T7: 5'-TAATACGACTCACTATAGGGGCTGCTATTCTGACCACTCACTATA and ABCA5-R-dT: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTAACTGCCCAGACACCATGAT), ABCA6 (ABCA6-F-T7: 5'-TAATACGACTCACTATAGGCCATGAGAAATGTCCAGTTTCCT and ABCA6-R-dT: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTGCTGGGTTAAATTAGATATTGGTGTA), and ABCA7 (ABCA7-F-T7: 5'-TAATACGACTCACTATAGGTTTCTCTGGGACATGTGTAACTACTTG and ABCA7-R-dT: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTGTGATCGACCAGCCATACAG) were synthesized by TriLink BioTechnologies, Inc. PCR products for ABCA5, ABCA6 and ABCA7, which were amplified in one-step RT-PCR experiments using the appropriate primers from Table , were diluted 1:100 and were PCR amplified using the respective T7-F and dT-R primers. .. Reaction conditions were 1× PCR buffer (20 mM Tris (pH 8.4), 50 mM KCl) (Invitrogen) (2.5 mM MgCl2 ) (Invitrogen), T7-F and dT-R primers (0.5 μM), 0.2 mM dNTPs (New England BioLabs), 10 μL of diluted ABCA5, ABCA6 or ABCA7 PCR product, and 5 U Taq DNA polymerase (Invitrogen), in a 100 μL reaction volume. .. Thermal cycling conditions were 95°C for 2 min denaturation step, followed by 30 PCR cycles at 95°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, and final extension at 72°C for 5 min. PCR amplified products were isolated by QIAquick PCR purification kit (Qiagen) using the manufacturer's recommended protocol.

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
    Article Snippet: A one-step RT-PCR protocol was used in which the components were combined in a single tube. .. Reaction conditions included 1× PCR buffer (20 mM Tris (pH 8.4), 50 mM KCl) (Invitrogen), 1.5 mM MgCl2 (Invitrogen), gene-specific PCR primers (0.5 μM) (TriLink), oligo(dT)18 primer (1 μM) (TriLink), 0.16 mM dNTPs (New England Biolabs), 0.5 μL of human trachea total RNA or other human total RNA (Stratagene or Ambion, each at ~1.6 μg/μL), 5 U RNase Inhibitor (New England Biolabs), 50 U Moloney Murine Leukemia Virus Reverse Transcriptase (M-MLV RT) (Invitrogen) or SuperScript® III Reverse Transcriptase (SSIII RT) (Invitrogen), and 0.6 U of Taq DNA Polymerase, recombinant (Invitrogen) or Platinum® Taq DNA Polymerase (Invitrogen) or AmpliTaq Gold® DNA Polymerase (Applied Biosystems), in a 50 μL reaction volume. .. Thermal cycling conditions utilized a reverse transcription step at 42°C for 30 min when M-MLV RT was used and 55°C for 30 min when SSIII RT was employed; 95°C for 10 min (RT inactivation and initial denaturation step), followed by 45 PCR cycles at 95°C for 30 sec, 60°C for 1 min and final extension at 72°C for 5 min.

    Article Title: Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization
    Article Snippet: To summarize, a fusion Neq SSB-Taq S DNA polymerase consisting of the Taq Stoffel DNA polymerase and the Neq SSB-like protein of Nanoarchaeum equitans exhibits a much higher extension rate, offers higher processivity and has a higher tolerance to PCR inhibitors as compared to the Taq Stoffel DNA polymerase. .. For this reason, in many PCR applications, it may be better to use a Neq SSB-Taq S DNA polymerase instead of a Taq DNA polymerase. .. S1 Fig A DNA insert for cloning was prepared using two independent PCR reactions.

    Article Title: Assaying chromatin structure and remodeling by restriction enzyme accessibility
    Article Snippet: Liquid scintillation counter. .. PCR reaction mix: 1X PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2-4 mM MgCl2 , 0.5% Tween 20), 200 μM deoxynucleotides, 2.5 U Taq DNA polymerase (Invitrogen, Carlsbad, CA). .. PCR stop buffer: 10 mM Tris-HCl, pH 7.4, 200 mM Sodium acetate, pH 7.0, 5 mM EDTA, 0.1 μg/μl yeast tRNA.

    Article Title: Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus
    Article Snippet: Paragraph title: 2.11. PCR Reactions ... Reactions using Taq DNA polymerase (18038-018, Invitrogen) for comparison were carried out as per the manufacturer's conditions.

    Article Title: A Ubiquitin Ligase Complex Regulates Caspase Activation During Sperm Differentiation in DrosophilaA Protein Complex Restrains a Homicidal Enzyme during Sperm Differentiation
    Article Snippet: The Mastercycler Gradient PCR machine (Eppendorf; http://www.eppendorf.com ) was programmed as follows: 50 °C for 30 min for the RT step followed by 94 °C for 2 min, and the amplification steps of 94 °C for 30 s, 60 °C for 30 s, and 68 °C for 1 min. A master-mix was prepared and aliquoted to five tubes, each of which was amplified for 17, 20, 25, 30, or 35 cycles. .. Absence of genomic DNA in RNA preparations was verified by replacing the RT/Taq mix with only Taq DNA polymerase (Invitrogen).

    Article Title: Functional Characterization of the Stringent Response Regulatory Gene dksA of Vibrio cholerae and Its Role in Modulation of Virulence Phenotypes
    Article Snippet: The PCR-amplified product was checked by agarose gel electrophoresis using appropriate DNA size markers. .. To confirm absence of any contaminating DNA in prepared RNA samples, PCR assay of each sample was also done with Taq DNA polymerase (Invitrogen). .. Lack of amplification in the absence of RT confirmed that the desired PCR product was generated only from cDNAs.

    Article Title: Multi-pathogens sequence containing plasmids as positive controls for universal detection of potential agents of bioterrorism
    Article Snippet: PCR amplification of each of the 4 single stranded DNA sequences by using primers consisting of the stabilization and the restriction site sequences (italics in ). .. PCR reactions were carried out in a volume of 50 μl that included 10 mM Tris-HCl [pH 9.0], 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton X-100, 200 μM each dNTP, 0.4 μM of each oligonucleotide primer, 0.4 μM of the single stranded DNA, and 1.5 U of Taq DNA polymerase (Invitrogen, Cergy-Pontoise, France). .. The thermocycler (Biometra, Göttingen, Germany) profile was 5 min at 95°C, followed by 35 cycles of 30 sec at 95°C, 30 sec at 55°C, and 1 min at 72°C, and terminated by a final extension for 7 min at 72°C.

    Article Title: Identification of Four Entamoeba histolytica Organellar DNA Polymerases of the Family B and Cellular Localization of the Ehodp1 Gene and EhODP1 Protein
    Article Snippet: Total RNA was isolated with TRIzol (Invitrogen). cDNA was synthesized with 200 U of SuperScript II reverse transcriptase (Invitrogen) and 40 U of RNasin ribonuclease inhibitor (Promega). .. PCR assays were performed with 3 μ L of cDNA mixture, 400 μ M dNTPs, 2 mM MgCl2 , 200 nM of specific primers for each gene and 4 U of Taq DNA polymerase (Invitrogen). .. For Ehodp1 gene we used odp1 -f (forward), 5′-GAAGATCTGCCAATCCCCACAAAACGTCCCAC-3′, and odp1 -r (reverse), 5′-GGAATTCTTATTGCGGTTCGATATTTTCTAAGTT-3′ primers (Tm of 59°C), containing the Bgl II and Eco RI restriction sites at their 5′ ends, respectively.

    Article Title: An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV
    Article Snippet: Although all research groups carefully performed their experiments to test XMRV infection by PCR and/or RT-PCR, it is still difficult to conclude that the positive results linking XMRV with CFS are not laboratory artifacts. .. In this study, we evaluated several one-step RT-PCR kits and a Taq DNA polymerase for the contamination of MLV-related genomes and found that the test kit and the Taq DNA polymerase from Invitrogen were contaminated with MLV-related genomes.

    Article Title: The novel gene Ny-1 on potato chromosome IX confers hypersensitive resistance to Potato virus Y and is an alternative to Ry genes in potato breeding for PVY resistance
    Article Snippet: Paragraph title: Plant DNA isolation, PCR, electrophoresis, DNA cloning and sequencing ... Inter-simple sequence repeat (ISSR) markers were amplified in 20 μl of 20 mM Tris–HCl pH 8.4, 50 mM KCl, 2% DMSO, 2.5 mM MgCl2, 0.2 mM of each deoxynucleotide, 0.3 μM of primer, containing 1 U Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 30 ng genomic DNA as template.

    Article Title: Mechanical properties of DNA-like polymers
    Article Snippet: Polymerase chain reaction (PCR) products (∼400 bp) containing these intrinsically straight sequences flanked by Nar I sites were amplified using primers LJM-3222 (5′-G TA CGC AG T ) and LJM-3223 (5′-TGTGAGT AGCTCACTCAT AG ) (Integrated DNA Technologies). .. For analog 2 , PCR reactions (100 µl) included 20 ng plasmid template (or alternatively 20 ng of purified PCR product from a previous reaction), 0.4 mM forward and reverse primers, 100 mg/ml bovine serum albumin (BSA), Taq DNA polymerase buffer (Invitrogen), 2 mM MgCl , 0.2 mM each dNTP (with dTTP completely replaced by the analog triphosphate) and 5 U Taq DNA polymerase (Invitrogen). .. For analogs 3 , 4 , 5 , 6 and 9 , PCR reactions (100 µl) included 20 ng template, 0.4 mM forward and reverse primers, PrimeSTAR GC buffer (Takara), 0.2 mM each dNTP (again with dTTP completely replaced with analog, except for variant 9 , which completely replaced dATP), 2 M betaine (Sigma-Aldrich) and 5 U PrimeSTAR HS DNA polymerase (Takara).

    Purification:

    Article Title: Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein
    Article Snippet: RT-PCR reaction was performed for achievement of 504 bp A-tailed PCR product using Taq DNA polymerase (Fermentas, Lithuania) according to following thermal cycle program: denaturation at 94°C for 5 min , 34 cycles of 94°C for 1 min , 58°C for 30 s , and 72°C for 60 s . .. RT-PCR reaction was performed for achievement of 504 bp A-tailed PCR product using Taq DNA polymerase (Fermentas, Lithuania) according to following thermal cycle program: denaturation at 94°C for 5 min , 34 cycles of 94°C for 1 min , 58°C for 30 s , and 72°C for 60 s .

    Article Title: A Ubiquitin Ligase Complex Regulates Caspase Activation During Sperm Differentiation in DrosophilaA Protein Complex Restrains a Homicidal Enzyme during Sperm Differentiation
    Article Snippet: In cases when the genomic DNA had to be removed, the 30 μl of the RNA was incubated with 4 μl of RQ1 DNase and 3.8 μl of appropriate buffer (Promega; http://www.promega.com ) for 1.5 h at 37 °C, and subsequently purified again with the Invitrogen kit. .. Absence of genomic DNA in RNA preparations was verified by replacing the RT/Taq mix with only Taq DNA polymerase (Invitrogen).

    Article Title: Multi-pathogens sequence containing plasmids as positive controls for universal detection of potential agents of bioterrorism
    Article Snippet: PCR reactions were carried out in a volume of 50 μl that included 10 mM Tris-HCl [pH 9.0], 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton X-100, 200 μM each dNTP, 0.4 μM of each oligonucleotide primer, 0.4 μM of the single stranded DNA, and 1.5 U of Taq DNA polymerase (Invitrogen, Cergy-Pontoise, France). .. PCR products were electrophorezed in 3% TAE-agarose gel containing ethidium bromide and visualized under UV transillumination.

    Article Title: Mechanical properties of DNA-like polymers
    Article Snippet: Polymerase chain reaction (PCR) products (∼400 bp) containing these intrinsically straight sequences flanked by Nar I sites were amplified using primers LJM-3222 (5′-G TA CGC AG T ) and LJM-3223 (5′-TGTGAGT AGCTCACTCAT AG ) (Integrated DNA Technologies). .. For analog 2 , PCR reactions (100 µl) included 20 ng plasmid template (or alternatively 20 ng of purified PCR product from a previous reaction), 0.4 mM forward and reverse primers, 100 mg/ml bovine serum albumin (BSA), Taq DNA polymerase buffer (Invitrogen), 2 mM MgCl , 0.2 mM each dNTP (with dTTP completely replaced by the analog triphosphate) and 5 U Taq DNA polymerase (Invitrogen). .. For analogs 3 , 4 , 5 , 6 and 9 , PCR reactions (100 µl) included 20 ng template, 0.4 mM forward and reverse primers, PrimeSTAR GC buffer (Takara), 0.2 mM each dNTP (again with dTTP completely replaced with analog, except for variant 9 , which completely replaced dATP), 2 M betaine (Sigma-Aldrich) and 5 U PrimeSTAR HS DNA polymerase (Takara).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
    Article Snippet: Paragraph title: One-step RT-PCR (quantitative real-time) ... M-MLV reverse transcriptase (25 U) (Invitrogen) and Taq DNA polymerase (2.5 U) (Invitrogen) were used in all quantitative real-time experiments.

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
    Article Snippet: Primer sequences for preparation of the RNA standards for ABCA5 (ABCA5-F-T7: 5'-TAATACGACTCACTATAGGGGCTGCTATTCTGACCACTCACTATA and ABCA5-R-dT: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTTAACTGCCCAGACACCATGAT), ABCA6 (ABCA6-F-T7: 5'-TAATACGACTCACTATAGGCCATGAGAAATGTCCAGTTTCCT and ABCA6-R-dT: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTGCTGGGTTAAATTAGATATTGGTGTA), and ABCA7 (ABCA7-F-T7: 5'-TAATACGACTCACTATAGGTTTCTCTGGGACATGTGTAACTACTTG and ABCA7-R-dT: 5'-TTTTTTTTTTTTTTTTTTTTTTTTTTGTGATCGACCAGCCATACAG) were synthesized by TriLink BioTechnologies, Inc. PCR products for ABCA5, ABCA6 and ABCA7, which were amplified in one-step RT-PCR experiments using the appropriate primers from Table , were diluted 1:100 and were PCR amplified using the respective T7-F and dT-R primers. .. Reaction conditions were 1× PCR buffer (20 mM Tris (pH 8.4), 50 mM KCl) (Invitrogen) (2.5 mM MgCl2 ) (Invitrogen), T7-F and dT-R primers (0.5 μM), 0.2 mM dNTPs (New England BioLabs), 10 μL of diluted ABCA5, ABCA6 or ABCA7 PCR product, and 5 U Taq DNA polymerase (Invitrogen), in a 100 μL reaction volume.

    Article Title: Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein
    Article Snippet: Nested PCR was carried out using cDNA samples with external and internal primer pairs listed in . .. RT-PCR reaction was performed for achievement of 504 bp A-tailed PCR product using Taq DNA polymerase (Fermentas, Lithuania) according to following thermal cycle program: denaturation at 94°C for 5 min , 34 cycles of 94°C for 1 min , 58°C for 30 s , and 72°C for 60 s . .. A final extension cycle was run at 72°C for 10 min .

    Article Title: A Ubiquitin Ligase Complex Regulates Caspase Activation During Sperm Differentiation in DrosophilaA Protein Complex Restrains a Homicidal Enzyme during Sperm Differentiation
    Article Snippet: Paragraph title: RNA isolation and RT-PCR. ... Absence of genomic DNA in RNA preparations was verified by replacing the RT/Taq mix with only Taq DNA polymerase (Invitrogen).

    Article Title: Functional Characterization of the Stringent Response Regulatory Gene dksA of Vibrio cholerae and Its Role in Modulation of Virulence Phenotypes
    Article Snippet: Paragraph title: RT-PCR and qRT-PCR assays. ... To confirm absence of any contaminating DNA in prepared RNA samples, PCR assay of each sample was also done with Taq DNA polymerase (Invitrogen).

    Article Title: Identification of Four Entamoeba histolytica Organellar DNA Polymerases of the Family B and Cellular Localization of the Ehodp1 Gene and EhODP1 Protein
    Article Snippet: Paragraph title: 2.3. Semiquantitative RT-PCR Assays ... PCR assays were performed with 3 μ L of cDNA mixture, 400 μ M dNTPs, 2 mM MgCl2 , 200 nM of specific primers for each gene and 4 U of Taq DNA polymerase (Invitrogen).

    Article Title: An Endogenous Murine Leukemia Viral Genome Contaminant in a Commercial RT-PCR Kit is Amplified Using Standard Primers for XMRV
    Article Snippet: Xenotropic (or polytropic) MLVs are widespread, and there may be many opportunities for samples to get contaminated with such ubiquitous viruses in laboratories when conducting biological or medical research [ ]. .. In this study, we evaluated several one-step RT-PCR kits and a Taq DNA polymerase for the contamination of MLV-related genomes and found that the test kit and the Taq DNA polymerase from Invitrogen were contaminated with MLV-related genomes. .. The findings in the present study indicate that contaminating nucleic acids in the test kits can potentially produce false-positive PCR results in studies of XMRV and other MLV-related viruses.

    Construct:

    Article Title: Multi-pathogens sequence containing plasmids as positive controls for universal detection of potential agents of bioterrorism
    Article Snippet: Three plasmids were constructed such as CatA for category A agents, CatB for category B agents and CatVEF for vesicular eruptive fever (Tables and ). .. PCR reactions were carried out in a volume of 50 μl that included 10 mM Tris-HCl [pH 9.0], 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton X-100, 200 μM each dNTP, 0.4 μM of each oligonucleotide primer, 0.4 μM of the single stranded DNA, and 1.5 U of Taq DNA polymerase (Invitrogen, Cergy-Pontoise, France).

    Nested PCR:

    Article Title: Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein
    Article Snippet: Nested PCR was carried out using cDNA samples with external and internal primer pairs listed in . .. RT-PCR reaction was performed for achievement of 504 bp A-tailed PCR product using Taq DNA polymerase (Fermentas, Lithuania) according to following thermal cycle program: denaturation at 94°C for 5 min , 34 cycles of 94°C for 1 min , 58°C for 30 s , and 72°C for 60 s .

    Plasmid Preparation:

    Article Title: Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization
    Article Snippet: The output products were analyzed using a 2% agarose gel ethidium bromide in the UV light. .. The gene encoding the Stoffel fragment of a Taq DNA polymerase was cloned into the vector pET-30 Ek/LIC to generate a pET30/TaqS plasmid which led to the expression of the enzyme as a protein with a C-terminal polyhistidine tag. .. The PCR products of the taq Stoffel and NeqSSB-like genes were mixed together with the DNA of the pET-30 Ek/LIC vector in order to obtain the pET30/NeqSSB-TaqS plasmid which encodes the enzyme as a fusion protein containing the complete NeqSSB-like sequence, a 6 amino acid linker (GGVDMI) and a sequence of the Taq Stoffel DNA polymerase with a C-terminal polyhistidine tag.

    Article Title: Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus
    Article Snippet: PCR reactions (25 μ L) using pET Blue-2 plasmid (Novagen) as a template contained the optimized buffer system plus 200 μ M each dNTP, 2 μ M each primer, and 0.05 μ g plasmid. .. Reactions using Taq DNA polymerase (18038-018, Invitrogen) for comparison were carried out as per the manufacturer's conditions.

    Article Title: Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein
    Article Snippet: RT-PCR reaction was performed for achievement of 504 bp A-tailed PCR product using Taq DNA polymerase (Fermentas, Lithuania) according to following thermal cycle program: denaturation at 94°C for 5 min , 34 cycles of 94°C for 1 min , 58°C for 30 s , and 72°C for 60 s . .. The PCR products were purified using PCR Cleanup Kit (Roche, Germany).

    Article Title: Multi-pathogens sequence containing plasmids as positive controls for universal detection of potential agents of bioterrorism
    Article Snippet: Once the four single stranded DNA (ssDNA) sequences were synthesized by the manufacturer, they were assembled as a single double-stranded DNA (dsDNA) fragment to be subsequently cloned into the PGEM-T plasmid (PGEM-T Easy Vector System I kit, Promega France SARL, Charbonnieres-les-Bains, France). .. PCR reactions were carried out in a volume of 50 μl that included 10 mM Tris-HCl [pH 9.0], 1.5 mM MgCl2, 50 mM KCl, 0.1% Triton X-100, 200 μM each dNTP, 0.4 μM of each oligonucleotide primer, 0.4 μM of the single stranded DNA, and 1.5 U of Taq DNA polymerase (Invitrogen, Cergy-Pontoise, France).

    Article Title: Mechanical properties of DNA-like polymers
    Article Snippet: Polymerase chain reaction (PCR) products (∼400 bp) containing these intrinsically straight sequences flanked by Nar I sites were amplified using primers LJM-3222 (5′-G TA CGC AG T ) and LJM-3223 (5′-TGTGAGT AGCTCACTCAT AG ) (Integrated DNA Technologies). .. For analog 2 , PCR reactions (100 µl) included 20 ng plasmid template (or alternatively 20 ng of purified PCR product from a previous reaction), 0.4 mM forward and reverse primers, 100 mg/ml bovine serum albumin (BSA), Taq DNA polymerase buffer (Invitrogen), 2 mM MgCl , 0.2 mM each dNTP (with dTTP completely replaced by the analog triphosphate) and 5 U Taq DNA polymerase (Invitrogen). .. For analogs 3 , 4 , 5 , 6 and 9 , PCR reactions (100 µl) included 20 ng template, 0.4 mM forward and reverse primers, PrimeSTAR GC buffer (Takara), 0.2 mM each dNTP (again with dTTP completely replaced with analog, except for variant 9 , which completely replaced dATP), 2 M betaine (Sigma-Aldrich) and 5 U PrimeSTAR HS DNA polymerase (Takara).

    Electrophoresis:

    Article Title: Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus
    Article Snippet: Following cycling, the samples were incubated at 72°C for an additional 5 min. PCR reactions were analyzed using 0.7% agarose gel electrophoresis as described above. .. Reactions using Taq DNA polymerase (18038-018, Invitrogen) for comparison were carried out as per the manufacturer's conditions.

    Article Title: The novel gene Ny-1 on potato chromosome IX confers hypersensitive resistance to Potato virus Y and is an alternative to Ry genes in potato breeding for PVY resistance
    Article Snippet: Paragraph title: Plant DNA isolation, PCR, electrophoresis, DNA cloning and sequencing ... Inter-simple sequence repeat (ISSR) markers were amplified in 20 μl of 20 mM Tris–HCl pH 8.4, 50 mM KCl, 2% DMSO, 2.5 mM MgCl2, 0.2 mM of each deoxynucleotide, 0.3 μM of primer, containing 1 U Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 30 ng genomic DNA as template.

    RNA Extraction:

    Article Title: Cloning and Expression of Soluble Recombinant HIV-1 CRF35 Protease-HP Thioredoxin Fusion Protein
    Article Snippet: Viral RNA was isolated from HIV positive serum samples using the Viral RNA extraction Mini Kit (Qiagen, USA) according to the manufacturer’s instructions. .. RT-PCR reaction was performed for achievement of 504 bp A-tailed PCR product using Taq DNA polymerase (Fermentas, Lithuania) according to following thermal cycle program: denaturation at 94°C for 5 min , 34 cycles of 94°C for 1 min , 58°C for 30 s , and 72°C for 60 s .

    Positron Emission Tomography:

    Article Title: Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization
    Article Snippet: The output products were analyzed using a 2% agarose gel ethidium bromide in the UV light. .. The gene encoding the Stoffel fragment of a Taq DNA polymerase was cloned into the vector pET-30 Ek/LIC to generate a pET30/TaqS plasmid which led to the expression of the enzyme as a protein with a C-terminal polyhistidine tag. .. The PCR products of the taq Stoffel and NeqSSB-like genes were mixed together with the DNA of the pET-30 Ek/LIC vector in order to obtain the pET30/NeqSSB-TaqS plasmid which encodes the enzyme as a fusion protein containing the complete NeqSSB-like sequence, a 6 amino acid linker (GGVDMI) and a sequence of the Taq Stoffel DNA polymerase with a C-terminal polyhistidine tag.

    Article Title: Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus
    Article Snippet: PCR reactions (25 μ L) using pET Blue-2 plasmid (Novagen) as a template contained the optimized buffer system plus 200 μ M each dNTP, 2 μ M each primer, and 0.05 μ g plasmid. .. Reactions using Taq DNA polymerase (18038-018, Invitrogen) for comparison were carried out as per the manufacturer's conditions.

    Agarose Gel Electrophoresis:

    Article Title: Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus
    Article Snippet: Following cycling, the samples were incubated at 72°C for an additional 5 min. PCR reactions were analyzed using 0.7% agarose gel electrophoresis as described above. .. Reactions using Taq DNA polymerase (18038-018, Invitrogen) for comparison were carried out as per the manufacturer's conditions.

    Article Title: Functional Characterization of the Stringent Response Regulatory Gene dksA of Vibrio cholerae and Its Role in Modulation of Virulence Phenotypes
    Article Snippet: The PCR-amplified product was checked by agarose gel electrophoresis using appropriate DNA size markers. .. To confirm absence of any contaminating DNA in prepared RNA samples, PCR assay of each sample was also done with Taq DNA polymerase (Invitrogen).

    In Vitro:

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
    Article Snippet: Reaction conditions were 1× PCR buffer (20 mM Tris (pH 8.4), 50 mM KCl) (Invitrogen) (2.5 mM MgCl2 ) (Invitrogen), T7-F and dT-R primers (0.5 μM), 0.2 mM dNTPs (New England BioLabs), 10 μL of diluted ABCA5, ABCA6 or ABCA7 PCR product, and 5 U Taq DNA polymerase (Invitrogen), in a 100 μL reaction volume. .. Amplification was verified by gel electrophoresis and the presence of a DNA band of the correct size.

    Transgenic Assay:

    Article Title: A Ubiquitin Ligase Complex Regulates Caspase Activation During Sperm Differentiation in DrosophilaA Protein Complex Restrains a Homicidal Enzyme during Sperm Differentiation
    Article Snippet: Absence of genomic DNA in RNA preparations was verified by replacing the RT/Taq mix with only Taq DNA polymerase (Invitrogen). .. The comparative RT–PCR reactions in were performed using two pairs of primers in a same reaction mix: For cul3Testis the forward primer TCTCATGCAAGGCCGCGATC and the reverse primer CGGGTTATTGGCTGGCGGTC amplified a 2,997-bp cDNA fragment (and a 3,715-bp genomic fragment), whereas for cul3Soma , the forward primer CATTGATTGCCGCCGAGGAA and the reverse primer CGGGTTATTGGCTGGCGGTC amplified a 2,642-bp cDNA fragment (and a 4,911-bp genomic fragment).

    Incubation:

    Article Title: Fusion of Taq DNA polymerase with single-stranded DNA binding-like protein of Nanoarchaeum equitans—Expression and characterization
    Article Snippet: As directed in the EvaEZ Fluorometric Polymerase Activity Assay Kit Manual (Biotium, Hayward, USA), the DNA polymerase activity was assayed in an isothermal reaction at 72°C using MyGo/Pro Real-Time PCR instrument (IT-IS International Ltd., UK) in accordance with the definition of one unit of enzyme activity (“One unit of DNA polymerase activity is conventionally defined as the amount of enzyme that will incorporate 10 nmol of nucleotides during a 30-min incubation” [ ]). .. The activity was determined in relation to a commercial Taq DNA polymerase (Thermo Scientific, USA) with an activity of 1 U/μl.

    Article Title: Long-Range PCR Amplification of DNA by DNA Polymerase III Holoenzyme from Thermus thermophilus
    Article Snippet: Following cycling, the samples were incubated at 72°C for an additional 5 min. PCR reactions were analyzed using 0.7% agarose gel electrophoresis as described above. .. Reactions using Taq DNA polymerase (18038-018, Invitrogen) for comparison were carried out as per the manufacturer's conditions.

    Article Title: A Ubiquitin Ligase Complex Regulates Caspase Activation During Sperm Differentiation in DrosophilaA Protein Complex Restrains a Homicidal Enzyme during Sperm Differentiation
    Article Snippet: In cases when the genomic DNA had to be removed, the 30 μl of the RNA was incubated with 4 μl of RQ1 DNase and 3.8 μl of appropriate buffer (Promega; http://www.promega.com ) for 1.5 h at 37 °C, and subsequently purified again with the Invitrogen kit. .. Absence of genomic DNA in RNA preparations was verified by replacing the RT/Taq mix with only Taq DNA polymerase (Invitrogen).

    Concentration Assay:

    Article Title: Selective control of primer usage in multiplex one-step reverse transcription PCR
    Article Snippet: M-MLV reverse transcriptase (25 U) (Invitrogen) and Taq DNA polymerase (2.5 U) (Invitrogen) were used in all quantitative real-time experiments. .. M-MLV reverse transcriptase (25 U) (Invitrogen) and Taq DNA polymerase (2.5 U) (Invitrogen) were used in all quantitative real-time experiments.

    Marker:

    Article Title: The novel gene Ny-1 on potato chromosome IX confers hypersensitive resistance to Potato virus Y and is an alternative to Ry genes in potato breeding for PVY resistance
    Article Snippet: Inter-simple sequence repeat (ISSR) markers were amplified in 20 μl of 20 mM Tris–HCl pH 8.4, 50 mM KCl, 2% DMSO, 2.5 mM MgCl2, 0.2 mM of each deoxynucleotide, 0.3 μM of primer, containing 1 U Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA) and 30 ng genomic DNA as template. .. The PCR parameters were: 40 cycles of 94°C for 20 s, 42°C for 30 s, 72°C for 2 min and a final extension time of 10 min at 72°C.

    Lysis:

    Article Title: A Ubiquitin Ligase Complex Regulates Caspase Activation During Sperm Differentiation in DrosophilaA Protein Complex Restrains a Homicidal Enzyme during Sperm Differentiation
    Article Snippet: The samples were collected into 1.5-ml Eppendorf tubes that were standing on ice and containing 300 μl of the Invitrogen kit's lysis buffer and 3 μl of 2-mercaptoethanol, homogenized using a Pellet Pestle Motor (Kontes), and subsequently purified using the same kit. .. Absence of genomic DNA in RNA preparations was verified by replacing the RT/Taq mix with only Taq DNA polymerase (Invitrogen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Thermo Fisher maxma hot start taq dna polymerase
    Maxma Hot Start Taq Dna Polymerase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 97/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/maxma hot start taq dna polymerase/product/Thermo Fisher
    Average 97 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    maxma hot start taq dna polymerase - by Bioz Stars, 2019-12
    97/100 stars
      Buy from Supplier

    83
    Thermo Fisher arabidopsis leaves
    Disease phenotype of Col-0 and cwin1-1 plants in response to B. cinerea infection. (A) Lesion diameters measured 3 days after B. cinerea infection. Source leaves were drop-inoculated with a PDB solution containing 5 × 10 4 conidia ml −1 . Data represent mean (±SE) of at least 3 independent experiments. (B) Quantification of in planta growth of B. cinerea . Foliar disks were cut around the infection point, and relative genomic DNA level was quantified by qPCR using B. cinerea CUTINASE and <t>Arabidopsis</t> iASK primers. Data represent mean (±SE) of 3 independent experiments. Asterisks represent significant differences compared to Col-0 plants (Student's t -test, ** P
    Arabidopsis Leaves, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 83/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/arabidopsis leaves/product/Thermo Fisher
    Average 83 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    arabidopsis leaves - by Bioz Stars, 2019-12
    83/100 stars
      Buy from Supplier

    99
    Thermo Fisher gene exp gadd45a hs00169255 m1
    Reduction of <t>GADD45A</t> expression by GADD45A -siRNAs in decitabine-treated U2OS and MG63 cells. (A) Effects of GADD45A-siRNA on mRNA levels in U2OS and MG63. Total RNA was extracted on day 3 after the decitabine treatment was initiated. Preparation of cDNA
    Gene Exp Gadd45a Hs00169255 M1, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/gene exp gadd45a hs00169255 m1/product/Thermo Fisher
    Average 99 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    gene exp gadd45a hs00169255 m1 - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Disease phenotype of Col-0 and cwin1-1 plants in response to B. cinerea infection. (A) Lesion diameters measured 3 days after B. cinerea infection. Source leaves were drop-inoculated with a PDB solution containing 5 × 10 4 conidia ml −1 . Data represent mean (±SE) of at least 3 independent experiments. (B) Quantification of in planta growth of B. cinerea . Foliar disks were cut around the infection point, and relative genomic DNA level was quantified by qPCR using B. cinerea CUTINASE and Arabidopsis iASK primers. Data represent mean (±SE) of 3 independent experiments. Asterisks represent significant differences compared to Col-0 plants (Student's t -test, ** P

    Journal: Frontiers in Plant Science

    Article Title: Targeting the AtCWIN1 Gene to Explore the Role of Invertases in Sucrose Transport in Roots and during Botrytis cinerea Infection

    doi: 10.3389/fpls.2016.01899

    Figure Lengend Snippet: Disease phenotype of Col-0 and cwin1-1 plants in response to B. cinerea infection. (A) Lesion diameters measured 3 days after B. cinerea infection. Source leaves were drop-inoculated with a PDB solution containing 5 × 10 4 conidia ml −1 . Data represent mean (±SE) of at least 3 independent experiments. (B) Quantification of in planta growth of B. cinerea . Foliar disks were cut around the infection point, and relative genomic DNA level was quantified by qPCR using B. cinerea CUTINASE and Arabidopsis iASK primers. Data represent mean (±SE) of 3 independent experiments. Asterisks represent significant differences compared to Col-0 plants (Student's t -test, ** P

    Article Snippet: Complete coding sequence of AtSTP1 was obtained after a PCR-amplification of cDNA made from Arabidopsis leaves (Phusion Taq Polymerase, Thermo Scientific).

    Techniques: Infection, Real-time Polymerase Chain Reaction

    B. cinerea invertase activity, sugar transport and gene expression (A) Cell wall and intracellular (acidic and neutral) invertase activities in B. cinerea mycelium grown in vitro (mean +/− SE of 3 independent experiments). (B) [ 14 C]-sucrose uptake activity in B. cinerea mycelium grown in vitro (mean +/− SE of 3 independent experiments). Active sucrose uptake results from the difference between total and CCCP-insensitive uptakes. (C) Inhibition of [ 14 C]-sucrose uptake activity by sucrose, glucose:fructose (1:1 mixture) and mannitol supplied in 20-fold excess in B. cinerea mycelium grown in vitro (mean +/− SE of at least 2 independent experiments). (D) Relative expression of B. cinerea putative invertase ( Bc1g10247 and Bc1g16010 ), fructose (BcFRT1) and hexoses transporter ( Hxt1-17 ) genes in infected Arabidopsis leaves (5 × 10 4 conidia ml −1 ). Gene expression analysis was performed by RT-qPCR and results were normalized to the B. cinerea TUBA gene. Data represent mean (±SE) of 3 independent experiments.

    Journal: Frontiers in Plant Science

    Article Title: Targeting the AtCWIN1 Gene to Explore the Role of Invertases in Sucrose Transport in Roots and during Botrytis cinerea Infection

    doi: 10.3389/fpls.2016.01899

    Figure Lengend Snippet: B. cinerea invertase activity, sugar transport and gene expression (A) Cell wall and intracellular (acidic and neutral) invertase activities in B. cinerea mycelium grown in vitro (mean +/− SE of 3 independent experiments). (B) [ 14 C]-sucrose uptake activity in B. cinerea mycelium grown in vitro (mean +/− SE of 3 independent experiments). Active sucrose uptake results from the difference between total and CCCP-insensitive uptakes. (C) Inhibition of [ 14 C]-sucrose uptake activity by sucrose, glucose:fructose (1:1 mixture) and mannitol supplied in 20-fold excess in B. cinerea mycelium grown in vitro (mean +/− SE of at least 2 independent experiments). (D) Relative expression of B. cinerea putative invertase ( Bc1g10247 and Bc1g16010 ), fructose (BcFRT1) and hexoses transporter ( Hxt1-17 ) genes in infected Arabidopsis leaves (5 × 10 4 conidia ml −1 ). Gene expression analysis was performed by RT-qPCR and results were normalized to the B. cinerea TUBA gene. Data represent mean (±SE) of 3 independent experiments.

    Article Snippet: Complete coding sequence of AtSTP1 was obtained after a PCR-amplification of cDNA made from Arabidopsis leaves (Phusion Taq Polymerase, Thermo Scientific).

    Techniques: Activity Assay, Expressing, In Vitro, Inhibition, Infection, Quantitative RT-PCR

    Sucrose uptake activity and gene expression in seedling roots. (A) [ 14 C]-sucrose uptake activity in 9-day-old Col-0 and cwin1-1 seedling roots grown with 2% sucrose (mean +/− SE of 2 independent experiments). Active sucrose uptake results from the difference between total and CCCP-insensitive uptakes (B) Relative [ 14 C]-sucrose uptake rate in 9-day-old seedling roots of cwin1-1, CR-stp1, stp13-2 , OESTP1, and OESTP13 lines grown with 2% sucrose. Results are relative to the Col-0 uptake rate and represent mean (±SE) of at least 3 independent experiments. (C) Relative [ 14 C]-glucose uptake activity in 9-day-old seedling roots of Col-0 and cwin1-1 lines. Results are relative to the Col-0 uptake rate and represent mean (±SE) of 3 independent experiments. (D,E) Expression of the 14 AtSTP (D) and 9 AtSUC (E) genes in 9-day-old Arabidopsis seedling roots. Genes that were expressed below the detection level are not presented. Gene expression analysis was performed by RT-qPCR and results were normalized to the plant reference genes At4g26410 and AtACTIN2 ( At3g18780 ). Data represent mean (±SE) of 3 independent experiments. For (B) and (C) , asterisks represent significant differences compared to Col-0 plants (Student's t -test, * P

    Journal: Frontiers in Plant Science

    Article Title: Targeting the AtCWIN1 Gene to Explore the Role of Invertases in Sucrose Transport in Roots and during Botrytis cinerea Infection

    doi: 10.3389/fpls.2016.01899

    Figure Lengend Snippet: Sucrose uptake activity and gene expression in seedling roots. (A) [ 14 C]-sucrose uptake activity in 9-day-old Col-0 and cwin1-1 seedling roots grown with 2% sucrose (mean +/− SE of 2 independent experiments). Active sucrose uptake results from the difference between total and CCCP-insensitive uptakes (B) Relative [ 14 C]-sucrose uptake rate in 9-day-old seedling roots of cwin1-1, CR-stp1, stp13-2 , OESTP1, and OESTP13 lines grown with 2% sucrose. Results are relative to the Col-0 uptake rate and represent mean (±SE) of at least 3 independent experiments. (C) Relative [ 14 C]-glucose uptake activity in 9-day-old seedling roots of Col-0 and cwin1-1 lines. Results are relative to the Col-0 uptake rate and represent mean (±SE) of 3 independent experiments. (D,E) Expression of the 14 AtSTP (D) and 9 AtSUC (E) genes in 9-day-old Arabidopsis seedling roots. Genes that were expressed below the detection level are not presented. Gene expression analysis was performed by RT-qPCR and results were normalized to the plant reference genes At4g26410 and AtACTIN2 ( At3g18780 ). Data represent mean (±SE) of 3 independent experiments. For (B) and (C) , asterisks represent significant differences compared to Col-0 plants (Student's t -test, * P

    Article Snippet: Complete coding sequence of AtSTP1 was obtained after a PCR-amplification of cDNA made from Arabidopsis leaves (Phusion Taq Polymerase, Thermo Scientific).

    Techniques: Activity Assay, Expressing, Quantitative RT-PCR

    Vacuolar invertase gene expression and activity in different Arabidopsis organs. (A) Relative gene expression of AtVIN genes was performed by RT-qPCR and results were normalized to the plant reference genes At4g26410 and AtACTIN2 ( At3g18780 ). Data represent mean (±SE) of 3 independent experiments. (B) VIN activity was assayed from frozen ground tissues of 5–6 week-old soil grown plants (leaves and roots) or 9-day-old seedling roots. Data represent mean (±SE) of 2 (seedling roots) or 3 (leaves and roots) independent experiments. No significant difference was determined between Col-0 and cwin1-1 by a Student's t -test ( P

    Journal: Frontiers in Plant Science

    Article Title: Targeting the AtCWIN1 Gene to Explore the Role of Invertases in Sucrose Transport in Roots and during Botrytis cinerea Infection

    doi: 10.3389/fpls.2016.01899

    Figure Lengend Snippet: Vacuolar invertase gene expression and activity in different Arabidopsis organs. (A) Relative gene expression of AtVIN genes was performed by RT-qPCR and results were normalized to the plant reference genes At4g26410 and AtACTIN2 ( At3g18780 ). Data represent mean (±SE) of 3 independent experiments. (B) VIN activity was assayed from frozen ground tissues of 5–6 week-old soil grown plants (leaves and roots) or 9-day-old seedling roots. Data represent mean (±SE) of 2 (seedling roots) or 3 (leaves and roots) independent experiments. No significant difference was determined between Col-0 and cwin1-1 by a Student's t -test ( P

    Article Snippet: Complete coding sequence of AtSTP1 was obtained after a PCR-amplification of cDNA made from Arabidopsis leaves (Phusion Taq Polymerase, Thermo Scientific).

    Techniques: Expressing, Activity Assay, Quantitative RT-PCR

    Cell wall invertase activity and gene expression in different Arabidopsis organs. (A) CWIN activity in Col-0 and cwin1-1 was assayed from frozen ground tissues of 5–6 week-old soil-grown plants (leaves and roots) or 9-day-old seedling roots. Data represent mean (±SE) of 2 (seedling roots) or 3 (leaves and roots) independent experiments. (B,C) Relative gene expression of AtCWIN1, AtCWIN5 (B) , AtCIF1 and AtC/VIF2 (C) genes was performed by RT-qPCR and results were normalized to the plant reference genes At4g26410 and AtACTIN2 ( At3g18780 ). Data represent mean (±SE) of 3 independent experiments. AtCWIN2 and -4 are not presented because transcript levels were below the detection threshold. For (A) , asterisks represent significant differences between organs of Col-0 plants (Student's t -test, * P

    Journal: Frontiers in Plant Science

    Article Title: Targeting the AtCWIN1 Gene to Explore the Role of Invertases in Sucrose Transport in Roots and during Botrytis cinerea Infection

    doi: 10.3389/fpls.2016.01899

    Figure Lengend Snippet: Cell wall invertase activity and gene expression in different Arabidopsis organs. (A) CWIN activity in Col-0 and cwin1-1 was assayed from frozen ground tissues of 5–6 week-old soil-grown plants (leaves and roots) or 9-day-old seedling roots. Data represent mean (±SE) of 2 (seedling roots) or 3 (leaves and roots) independent experiments. (B,C) Relative gene expression of AtCWIN1, AtCWIN5 (B) , AtCIF1 and AtC/VIF2 (C) genes was performed by RT-qPCR and results were normalized to the plant reference genes At4g26410 and AtACTIN2 ( At3g18780 ). Data represent mean (±SE) of 3 independent experiments. AtCWIN2 and -4 are not presented because transcript levels were below the detection threshold. For (A) , asterisks represent significant differences between organs of Col-0 plants (Student's t -test, * P

    Article Snippet: Complete coding sequence of AtSTP1 was obtained after a PCR-amplification of cDNA made from Arabidopsis leaves (Phusion Taq Polymerase, Thermo Scientific).

    Techniques: Activity Assay, Expressing, Quantitative RT-PCR

    Simplified model representing key molecular actors involved in the competition for sugars at the  A. thaliana / B. cinerea  interface . Upon infection by  B. cinerea , unloaded sucrose is mainly cleaved into glucose and fructose. Cell wall invertases from host ( AtCWIN1 ) contribute to the accumulation of hexoses in the apoplast through transcriptional and posttranslational regulations. Host cells can assimilate free hexoses  via  the induced activity of hexose-specific transporters belonging to the Sugar Transporter Protein (STPs) family.  B. cinerea  possesses its own functional sucrolytic machinery (Bc1g10247 ?) and also a multigenic hexose uptake system (BcHXTs and BcFRT1). A secondary pathway for apoplastic sucrose retrieval involving sucrose transporter has been evidenced. Intracellular sucrolytic machinery, involving VINs and to lesser extent CINs, is efficient to provide intracellular hexoses to maintain sugar homeostasis in host cells and to fuel plant defenses. The precise regulatory role of tonoplastic, plasma membrane sucrose transporters and sugar facilitators (SWEETs) needs to be elucidated.

    Journal: Frontiers in Plant Science

    Article Title: Targeting the AtCWIN1 Gene to Explore the Role of Invertases in Sucrose Transport in Roots and during Botrytis cinerea Infection

    doi: 10.3389/fpls.2016.01899

    Figure Lengend Snippet: Simplified model representing key molecular actors involved in the competition for sugars at the A. thaliana / B. cinerea interface . Upon infection by B. cinerea , unloaded sucrose is mainly cleaved into glucose and fructose. Cell wall invertases from host ( AtCWIN1 ) contribute to the accumulation of hexoses in the apoplast through transcriptional and posttranslational regulations. Host cells can assimilate free hexoses via the induced activity of hexose-specific transporters belonging to the Sugar Transporter Protein (STPs) family. B. cinerea possesses its own functional sucrolytic machinery (Bc1g10247 ?) and also a multigenic hexose uptake system (BcHXTs and BcFRT1). A secondary pathway for apoplastic sucrose retrieval involving sucrose transporter has been evidenced. Intracellular sucrolytic machinery, involving VINs and to lesser extent CINs, is efficient to provide intracellular hexoses to maintain sugar homeostasis in host cells and to fuel plant defenses. The precise regulatory role of tonoplastic, plasma membrane sucrose transporters and sugar facilitators (SWEETs) needs to be elucidated.

    Article Snippet: Complete coding sequence of AtSTP1 was obtained after a PCR-amplification of cDNA made from Arabidopsis leaves (Phusion Taq Polymerase, Thermo Scientific).

    Techniques: Infection, Activity Assay, Functional Assay

    Reduction of GADD45A expression by GADD45A -siRNAs in decitabine-treated U2OS and MG63 cells. (A) Effects of GADD45A-siRNA on mRNA levels in U2OS and MG63. Total RNA was extracted on day 3 after the decitabine treatment was initiated. Preparation of cDNA

    Journal:

    Article Title: Decitabine-Induced Demethylation of 5? CpG Island in GADD45A Leads to Apoptosis in Osteosarcoma Cells

    doi:

    Figure Lengend Snippet: Reduction of GADD45A expression by GADD45A -siRNAs in decitabine-treated U2OS and MG63 cells. (A) Effects of GADD45A-siRNA on mRNA levels in U2OS and MG63. Total RNA was extracted on day 3 after the decitabine treatment was initiated. Preparation of cDNA

    Article Snippet: About 20 ng of the resulting cDNA was used for Taq Man real-time PCR GADD45A expression assay (Hs00169255_m1; ABI).

    Techniques: Expressing

    Repression of GADD45A expression. (A) Induction of GADD45A mRNA expression in U2OS and MG63 after decitabine treatment. Total RNA was extracted on day 3 after decitabine treatment was initiated. cDNA was then made as detailed in the Materials and Methods

    Journal:

    Article Title: Decitabine-Induced Demethylation of 5? CpG Island in GADD45A Leads to Apoptosis in Osteosarcoma Cells

    doi:

    Figure Lengend Snippet: Repression of GADD45A expression. (A) Induction of GADD45A mRNA expression in U2OS and MG63 after decitabine treatment. Total RNA was extracted on day 3 after decitabine treatment was initiated. cDNA was then made as detailed in the Materials and Methods

    Article Snippet: About 20 ng of the resulting cDNA was used for Taq Man real-time PCR GADD45A expression assay (Hs00169255_m1; ABI).

    Techniques: Expressing

    Induction of Gadd45a protein in OS xenografts by decitabine treatment. (A) Induction of Gadd45a protein levels in U2OS xenografts. Analysis of the relative levels of nuclear Gadd45a protein within xenografts derived from representative control untreated

    Journal:

    Article Title: Decitabine-Induced Demethylation of 5? CpG Island in GADD45A Leads to Apoptosis in Osteosarcoma Cells

    doi:

    Figure Lengend Snippet: Induction of Gadd45a protein in OS xenografts by decitabine treatment. (A) Induction of Gadd45a protein levels in U2OS xenografts. Analysis of the relative levels of nuclear Gadd45a protein within xenografts derived from representative control untreated

    Article Snippet: About 20 ng of the resulting cDNA was used for Taq Man real-time PCR GADD45A expression assay (Hs00169255_m1; ABI).

    Techniques: Derivative Assay

    Apoptosis induction by pCMV-GADD45A in U2OS and MG63. (A) Percentage of apoptotic nuclei as detected by Hoechst stain in U2OS and MG63. Columns are mean of three replicas, and error bars are standard deviation from the mean. (B) Induction of Gadd45a protein

    Journal:

    Article Title: Decitabine-Induced Demethylation of 5? CpG Island in GADD45A Leads to Apoptosis in Osteosarcoma Cells

    doi:

    Figure Lengend Snippet: Apoptosis induction by pCMV-GADD45A in U2OS and MG63. (A) Percentage of apoptotic nuclei as detected by Hoechst stain in U2OS and MG63. Columns are mean of three replicas, and error bars are standard deviation from the mean. (B) Induction of Gadd45a protein

    Article Snippet: About 20 ng of the resulting cDNA was used for Taq Man real-time PCR GADD45A expression assay (Hs00169255_m1; ABI).

    Techniques: Staining, Standard Deviation

    Gadd45a-siRNA treatment abolishes decitabine-induced apoptosis. (A) A representative image of apoptotic nuclei (arrows) from decitabine-treated MG63 stained with Hoechst 33342 dye. (B) One hundred nuclei were counted per slide, and three slides were prepared

    Journal:

    Article Title: Decitabine-Induced Demethylation of 5? CpG Island in GADD45A Leads to Apoptosis in Osteosarcoma Cells

    doi:

    Figure Lengend Snippet: Gadd45a-siRNA treatment abolishes decitabine-induced apoptosis. (A) A representative image of apoptotic nuclei (arrows) from decitabine-treated MG63 stained with Hoechst 33342 dye. (B) One hundred nuclei were counted per slide, and three slides were prepared

    Article Snippet: About 20 ng of the resulting cDNA was used for Taq Man real-time PCR GADD45A expression assay (Hs00169255_m1; ABI).

    Techniques: Staining

    GADD45A CpG methylation in osteosarcoma cells. (A) Schematic of GADD45A genomic locus. 5′ CpG island spanning the first three exonic regions of GADD45A is shown. An amplicon of ∼250 bp was amplified, and a cluster of eight CG dinucleotides

    Journal:

    Article Title: Decitabine-Induced Demethylation of 5? CpG Island in GADD45A Leads to Apoptosis in Osteosarcoma Cells

    doi:

    Figure Lengend Snippet: GADD45A CpG methylation in osteosarcoma cells. (A) Schematic of GADD45A genomic locus. 5′ CpG island spanning the first three exonic regions of GADD45A is shown. An amplicon of ∼250 bp was amplified, and a cluster of eight CG dinucleotides

    Article Snippet: About 20 ng of the resulting cDNA was used for Taq Man real-time PCR GADD45A expression assay (Hs00169255_m1; ABI).

    Techniques: CpG Methylation Assay, Amplification