Structured Review

Roche taq dna polymerase
Instability of octarepeats during PCR amplification by <t>Taq</t> Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp <t>DNA</t> Ladder.
Taq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taq dna polymerase/product/Roche
Average 99 stars, based on 10 article reviews
Price from $9.99 to $1999.99
taq dna polymerase - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "Instability of the Octarepeat Region of the Human Prion Protein Gene"

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

Journal: PLoS ONE

doi: 10.1371/journal.pone.0026635

Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.
Figure Legend Snippet: Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.

Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Mutagenesis, Clone Assay, Produced, Sequencing

2) Product Images from "Eprobe Mediated Real-Time PCR Monitoring and Melting Curve Analysis"

Article Title: Eprobe Mediated Real-Time PCR Monitoring and Melting Curve Analysis

Journal: PLoS ONE

doi: 10.1371/journal.pone.0070942

Use of exo+ and exo− Taq polymerase. Eprobe mediated real-time PCR experiments were performed by using an exo+ (Amplitaq) and exo− (Genotyping Master) Taq polymerase and Eprobes with different melting temperatures. Amplification curves (Random fluorescent units (RFU) plotted against PCR cycle number) using a 7 times serial dilution of the DNA template are shown on the left. The R-squared values of the PCR efficiency plots are indicated in the graphs. Differential melting curve analysis by plotting –dF/dT against temperature is shown on the right. Main peaks are indicated in the graph to show the different T M values for both Eprobes. EGFR wild-type plasmid DNA concentrations are indicated by colors: Red: 1.5×10 8 copies, Dark blue: 1.5×10 7 copies, Yellow: 1.5×10 6 copies, Green: 1.5×10 5 copies, Pink: 1.5×10 4 copies, Sky blue: 1.5×10 3 copies, Brown: 150 copies, Orange: TE negative control. A: Amplitaq and Eprobe 215-21 wt TO. B: Genotyping Mastermix and Eprobe 215-21 TO. C: Amplitaq and Eprobe 205-13 wt TO. D: Genotyping Master and Eprobe 205-13 wt TO.
Figure Legend Snippet: Use of exo+ and exo− Taq polymerase. Eprobe mediated real-time PCR experiments were performed by using an exo+ (Amplitaq) and exo− (Genotyping Master) Taq polymerase and Eprobes with different melting temperatures. Amplification curves (Random fluorescent units (RFU) plotted against PCR cycle number) using a 7 times serial dilution of the DNA template are shown on the left. The R-squared values of the PCR efficiency plots are indicated in the graphs. Differential melting curve analysis by plotting –dF/dT against temperature is shown on the right. Main peaks are indicated in the graph to show the different T M values for both Eprobes. EGFR wild-type plasmid DNA concentrations are indicated by colors: Red: 1.5×10 8 copies, Dark blue: 1.5×10 7 copies, Yellow: 1.5×10 6 copies, Green: 1.5×10 5 copies, Pink: 1.5×10 4 copies, Sky blue: 1.5×10 3 copies, Brown: 150 copies, Orange: TE negative control. A: Amplitaq and Eprobe 215-21 wt TO. B: Genotyping Mastermix and Eprobe 215-21 TO. C: Amplitaq and Eprobe 205-13 wt TO. D: Genotyping Master and Eprobe 205-13 wt TO.

Techniques Used: Real-time Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Serial Dilution, Plasmid Preparation, Negative Control

3) Product Images from "Optimal conditions to use Pfu exo– DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols"

Article Title: Optimal conditions to use Pfu exo– DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols

Journal: Nucleic Acids Research

doi:

Comparison of the efficiency of Sequenase 2.0 and Pfu exo – with different amounts of DNA at the primer extension step of LMPCR. This autoradiogram shows a representative sequence that was produced using primer set X (primers X1, X2 and X3) from the FMR1 gene promoter. Every PCR amplification step was done using 3 U of Taq . LMPCR was performed on increasing quantities of purified genomic DNA treated with standard Maxam–Gilbert guanine cleavage reaction (global SSB frequency: 1 break/400 bases); 0.8, 1.6 and 2.4 µg of DNA was used (lanes 1–4, 5–8 and 9–12, respectively). Lanes 1, 5 and 9 show LMPCR protocols done using 5.2 U of Sequenase 2.0 (S) at the primer extension step; lanes 2–4, 6–8 and 10–12 show LMPCR protocols done using 0.5 (lanes 2, 6 and 10), 1.0 (lanes 3, 7 and 11) or 1.5 U (lanes 4, 8 and 12) of Pfu exo – (P) at the primer extension step. An asterisk indicates a band in the Sequenase 2.0 track that shows an intensity markedly different compared to the rest of the bands in the track.
Figure Legend Snippet: Comparison of the efficiency of Sequenase 2.0 and Pfu exo – with different amounts of DNA at the primer extension step of LMPCR. This autoradiogram shows a representative sequence that was produced using primer set X (primers X1, X2 and X3) from the FMR1 gene promoter. Every PCR amplification step was done using 3 U of Taq . LMPCR was performed on increasing quantities of purified genomic DNA treated with standard Maxam–Gilbert guanine cleavage reaction (global SSB frequency: 1 break/400 bases); 0.8, 1.6 and 2.4 µg of DNA was used (lanes 1–4, 5–8 and 9–12, respectively). Lanes 1, 5 and 9 show LMPCR protocols done using 5.2 U of Sequenase 2.0 (S) at the primer extension step; lanes 2–4, 6–8 and 10–12 show LMPCR protocols done using 0.5 (lanes 2, 6 and 10), 1.0 (lanes 3, 7 and 11) or 1.5 U (lanes 4, 8 and 12) of Pfu exo – (P) at the primer extension step. An asterisk indicates a band in the Sequenase 2.0 track that shows an intensity markedly different compared to the rest of the bands in the track.

Techniques Used: Sequencing, Produced, Polymerase Chain Reaction, Amplification, Purification

Comparison of PCR amplification efficiency using different amounts of either Taq or Pfu exo – at the PCR amplification step. Sequenase 2.0 was used for each primer extension step and 1 µg of purified genomic DNA treated with standard Maxam–Gilbert guanine cleavage reaction (global SSB frequency: 1 break/400 bases) was used. Each of the four protocols was repeated twice. All the stripes shown are representative samples from the analyzed autoradiograms. ( A ) The short representative sequence shown was analyzed using primer set A (primers A1, A2 and A3) selected from the PGK1 gene promoter (one copy per genome). For (A) and (B), the amount of Pfu exo – varied from 0–25 U (lanes 1–15). ( B ) The short representative sequence shown was analyzed using primer set MH (primers MH1 and MH2) selected from the COX2 gene promoter (two copies per genome). ( C ) The short representative sequence shown was analyzed using primer set A (primers A1, A2 and A3) selected from the PGK1 gene promoter. For (C) and (D), the amount of Taq varied from 0–15 U (lanes 1–15). ( D ) The short representative sequence shown was analyzed using primer set MH (primers MH1 and MH2) selected from the COX2 gene promoter. ( E ) Graph showing the effects of different amounts of Pfu exo – and Taq from (A) (open square), (B) (filled square), (C) (open circle) and (D) (filled circle) on genomic DNA. The calculated value at each point represents the relative intensity of the corresponding band against the total intensity value obtained by the addition of the intensity from every band of a lane from an autoradiogram.
Figure Legend Snippet: Comparison of PCR amplification efficiency using different amounts of either Taq or Pfu exo – at the PCR amplification step. Sequenase 2.0 was used for each primer extension step and 1 µg of purified genomic DNA treated with standard Maxam–Gilbert guanine cleavage reaction (global SSB frequency: 1 break/400 bases) was used. Each of the four protocols was repeated twice. All the stripes shown are representative samples from the analyzed autoradiograms. ( A ) The short representative sequence shown was analyzed using primer set A (primers A1, A2 and A3) selected from the PGK1 gene promoter (one copy per genome). For (A) and (B), the amount of Pfu exo – varied from 0–25 U (lanes 1–15). ( B ) The short representative sequence shown was analyzed using primer set MH (primers MH1 and MH2) selected from the COX2 gene promoter (two copies per genome). ( C ) The short representative sequence shown was analyzed using primer set A (primers A1, A2 and A3) selected from the PGK1 gene promoter. For (C) and (D), the amount of Taq varied from 0–15 U (lanes 1–15). ( D ) The short representative sequence shown was analyzed using primer set MH (primers MH1 and MH2) selected from the COX2 gene promoter. ( E ) Graph showing the effects of different amounts of Pfu exo – and Taq from (A) (open square), (B) (filled square), (C) (open circle) and (D) (filled circle) on genomic DNA. The calculated value at each point represents the relative intensity of the corresponding band against the total intensity value obtained by the addition of the intensity from every band of a lane from an autoradiogram.

Techniques Used: Polymerase Chain Reaction, Amplification, Purification, Sequencing

Comparison of the effects of KCl and NaCl on band intensities at primer extension and PCR amplification steps of LMPCR. The region shown was analyzed using primer set X (primers X1, X2 and X3) selected from the FMR1 gene promoter. The starting amount of DNA was 1 µg with a SSB frequency of 1 break/400 bases. ( A ) Purified genomic DNA was treated with standard Maxam–Gilbert guanine cleavage reaction and processed by LMPCR. In lanes 1–4, Sequenase 2.0 was used with NaCl in the DNA polymerase buffer (Sequenase 2.0/NaCl) at the primer extension step with Taq /KCl (lane 1), Taq /NaCl (lane 2), Pfu exo – /KCl (lane 3) and Pfu exo – /NaCl (lane 4) at the PCR amplification step. In lanes 5–8, Sequenase 2.0/KCl was used at the primer extension step with Taq /KCl (lane 5), Taq /NaCl (lane 6), Pfu exo – /KCl (lane 7) and Pfu exo – /NaCl (lane 8) at the PCR amplification step. In lanes 9–12, Pfu exo – /NaCl was used at the primer extension step with Taq /KCl (lane 9), Taq /NaCl (lane 10), Pfu exo – /KCl (lane 11) and Pfu exo – /NaCl (lane 12) at the PCR amplification step. In lanes 13–16, Pfu exo – /KCl was used at the primer extension step with Taq /KCl (lane 13), Taq /NaCl (lane 14), Pfu exo – /KCl (lane 15) and Pfu exo – /NaCl (lane 16) at the PCR amplification step. ( B ) Purified genomic DNA was treated with standard Maxam–Gilbert pyrimidine (T+C) cleavage reaction. Lanes 1–16 are as described in (A). a, DNA polymerase at primer extension step; b, cation at primer extension step; c, DNA polymerase at PCR amplification step; d, cation at PCR amplification step.
Figure Legend Snippet: Comparison of the effects of KCl and NaCl on band intensities at primer extension and PCR amplification steps of LMPCR. The region shown was analyzed using primer set X (primers X1, X2 and X3) selected from the FMR1 gene promoter. The starting amount of DNA was 1 µg with a SSB frequency of 1 break/400 bases. ( A ) Purified genomic DNA was treated with standard Maxam–Gilbert guanine cleavage reaction and processed by LMPCR. In lanes 1–4, Sequenase 2.0 was used with NaCl in the DNA polymerase buffer (Sequenase 2.0/NaCl) at the primer extension step with Taq /KCl (lane 1), Taq /NaCl (lane 2), Pfu exo – /KCl (lane 3) and Pfu exo – /NaCl (lane 4) at the PCR amplification step. In lanes 5–8, Sequenase 2.0/KCl was used at the primer extension step with Taq /KCl (lane 5), Taq /NaCl (lane 6), Pfu exo – /KCl (lane 7) and Pfu exo – /NaCl (lane 8) at the PCR amplification step. In lanes 9–12, Pfu exo – /NaCl was used at the primer extension step with Taq /KCl (lane 9), Taq /NaCl (lane 10), Pfu exo – /KCl (lane 11) and Pfu exo – /NaCl (lane 12) at the PCR amplification step. In lanes 13–16, Pfu exo – /KCl was used at the primer extension step with Taq /KCl (lane 13), Taq /NaCl (lane 14), Pfu exo – /KCl (lane 15) and Pfu exo – /NaCl (lane 16) at the PCR amplification step. ( B ) Purified genomic DNA was treated with standard Maxam–Gilbert pyrimidine (T+C) cleavage reaction. Lanes 1–16 are as described in (A). a, DNA polymerase at primer extension step; b, cation at primer extension step; c, DNA polymerase at PCR amplification step; d, cation at PCR amplification step.

Techniques Used: Polymerase Chain Reaction, Amplification, Purification

Comparison of PCR amplification efficiency using different amounts of purified genomic DNA. Sequenase 2.0 was used at every primer extension step and purified genomic DNA treated with standard Maxam–Gilbert guanine cleavage reaction (global SSB frequency: 1 break/400 bases). Each of the four protocols was repeated twice. All the stripes shown are representative samples from the analyzed autoradiograms. The initial amount of DNA varied from 0–5 µg (lanes 1–15). ( A ) The short representative sequence shown was analyzed using primer set A (primers A1, A2 and A3) selected from the PGK1 gene promoter (one copy per genome). In (A) and (B), 3.5 U of Pfu exo – were used at the PCR amplification step. ( B ) The short representative sequence shown was analyzed using primer set MH (primers MH1 and MH2) selected from the COX2 gene promoter (two copies per genome). ( C ) The short representative sequence shown was analyzed using primer set A (primers A1, A2 and A3) selected from the PGK1 gene promoter. In (C) and (D), 3 U of Taq were used at the PCR amplification step. ( D ) The short representative sequence shown was analyzed using primer set MH (primers MH1 and MH2) selected from the COX2 gene promoter. ( E ) Graph showing the effects of different amounts of genomic DNA on the polymerization efficiency of Pfu exo – and Taq from (A) (open square), (B) (filled square), (C) (open circle) and (D) (filled circle). The calculated value at each point represents the relative intensity of the corresponding band against the total intensity value obtained by the addition of the intensity from every band of a lane from an autoradiogram.
Figure Legend Snippet: Comparison of PCR amplification efficiency using different amounts of purified genomic DNA. Sequenase 2.0 was used at every primer extension step and purified genomic DNA treated with standard Maxam–Gilbert guanine cleavage reaction (global SSB frequency: 1 break/400 bases). Each of the four protocols was repeated twice. All the stripes shown are representative samples from the analyzed autoradiograms. The initial amount of DNA varied from 0–5 µg (lanes 1–15). ( A ) The short representative sequence shown was analyzed using primer set A (primers A1, A2 and A3) selected from the PGK1 gene promoter (one copy per genome). In (A) and (B), 3.5 U of Pfu exo – were used at the PCR amplification step. ( B ) The short representative sequence shown was analyzed using primer set MH (primers MH1 and MH2) selected from the COX2 gene promoter (two copies per genome). ( C ) The short representative sequence shown was analyzed using primer set A (primers A1, A2 and A3) selected from the PGK1 gene promoter. In (C) and (D), 3 U of Taq were used at the PCR amplification step. ( D ) The short representative sequence shown was analyzed using primer set MH (primers MH1 and MH2) selected from the COX2 gene promoter. ( E ) Graph showing the effects of different amounts of genomic DNA on the polymerization efficiency of Pfu exo – and Taq from (A) (open square), (B) (filled square), (C) (open circle) and (D) (filled circle). The calculated value at each point represents the relative intensity of the corresponding band against the total intensity value obtained by the addition of the intensity from every band of a lane from an autoradiogram.

Techniques Used: Polymerase Chain Reaction, Amplification, Purification, Sequencing

4) Product Images from "Multiplex PCR for Detection and Identification of Lactococcal Bacteriophages"

Article Title: Multiplex PCR for Detection and Identification of Lactococcal Bacteriophages

Journal: Applied and Environmental Microbiology

doi:

Multiplex PCR competition assay for different combinations of phage species in the same sample. Phage Q7 represents the 936 species, Q30 represents the P335 species, and Q38 represents the c2 species. Reactions were carried out with 1.25 (A and C) and 2.50 (B and D) U of Taq DNA polymerase. Lanes (boldface, phage concentration of 10 8 PFU/ml; lightface, phage concentration of 10 7 PFU/ml): 1, 14, 15, and 28, 100-bp DNA ladder (Gibco/BRL, Burlington, Ontario, Canada); 2, 936 plus c2 ; 3, 936 plus P335 ; 4, c2 plus P335 ; 5, 936 plus c2 plus P335 ; 6, 936 plus c2; 7, 936 plus P335; 8, 936 plus P335 ; 9, c2 plus P335; 10, 936 plus P335 ; 11, c2 plus P335 ; 12, 936 plus c2 plus P335; 13, 936 plus c2 plus P335 ; 16, 936 plus c2 plus P335 ; 17, 936 plus c2 plus P335; 18, 936 plus c2 plus P335; 19, 936 plus c2 plus P335 ; 20, 936 plus c2 plus P335; 21, 936 ; 22, c2 ; 23, P335 ; 24, 10 pg of 936 DNA; 25, 10 pg of c2 DNA; 26, 10 pg of P335 DNA; 27, negative control.
Figure Legend Snippet: Multiplex PCR competition assay for different combinations of phage species in the same sample. Phage Q7 represents the 936 species, Q30 represents the P335 species, and Q38 represents the c2 species. Reactions were carried out with 1.25 (A and C) and 2.50 (B and D) U of Taq DNA polymerase. Lanes (boldface, phage concentration of 10 8 PFU/ml; lightface, phage concentration of 10 7 PFU/ml): 1, 14, 15, and 28, 100-bp DNA ladder (Gibco/BRL, Burlington, Ontario, Canada); 2, 936 plus c2 ; 3, 936 plus P335 ; 4, c2 plus P335 ; 5, 936 plus c2 plus P335 ; 6, 936 plus c2; 7, 936 plus P335; 8, 936 plus P335 ; 9, c2 plus P335; 10, 936 plus P335 ; 11, c2 plus P335 ; 12, 936 plus c2 plus P335; 13, 936 plus c2 plus P335 ; 16, 936 plus c2 plus P335 ; 17, 936 plus c2 plus P335; 18, 936 plus c2 plus P335; 19, 936 plus c2 plus P335 ; 20, 936 plus c2 plus P335; 21, 936 ; 22, c2 ; 23, P335 ; 24, 10 pg of 936 DNA; 25, 10 pg of c2 DNA; 26, 10 pg of P335 DNA; 27, negative control.

Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Competitive Binding Assay, Concentration Assay, Negative Control

5) Product Images from "Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases"

Article Title: Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.202127199

Activity of Taq DNA polymerase, the Stoffel fragment, Pfu polB, and the hybrid polymerases in salts. Initial rates of primer extension reactions for the proteins were determined as described in Materials and Methods , and the dependencies of the rates for enzymes with Taq polymerase catalytic domain on salt concentrations were plotted for NaCl ( A ), KCl ( B ), and potassium glutamate ( C . The dependencies of the rates for enzymes with Pfu polymerase catalytic domain are collected in D.
Figure Legend Snippet: Activity of Taq DNA polymerase, the Stoffel fragment, Pfu polB, and the hybrid polymerases in salts. Initial rates of primer extension reactions for the proteins were determined as described in Materials and Methods , and the dependencies of the rates for enzymes with Taq polymerase catalytic domain on salt concentrations were plotted for NaCl ( A ), KCl ( B ), and potassium glutamate ( C . The dependencies of the rates for enzymes with Pfu polymerase catalytic domain are collected in D.

Techniques Used: Activity Assay

Schematic representation of chimeric polymerases. ( A ) Domain organization of Taq DNA polymerase in which helices are represented by cylinders and β-strands by arrows. This structure has been modeled by using two available x-ray structures of Taq polymerase (in “open” and “closed” conformations; for details, see Text , which is published as supporting information on the PNAS web site). The polymerase and inactive 3′-5′ exonuclease domains are colored gray, and the 5′-3-exonuclease domain is colored green. Several amino-terminal and carboxyl-terminal amino acids are colored magenta and red, respectively. The only HhH motif in the 5′-3′ exonuclease domain is colored gold. DNA strands are colored cyan and orange. ( B ) Cartoon illustration of chimeric constructs. HhH repeats of Topo V are colored yellow ( H – L ), orange-yellow gradient ( E – G ), orange ( C and D ), and rainbow ( A and B ). Arrows indicate cleavage positions that result in C1–C3 domains (in case of Topo V) and the Stoffel fragment (in case of Taq polymerase).
Figure Legend Snippet: Schematic representation of chimeric polymerases. ( A ) Domain organization of Taq DNA polymerase in which helices are represented by cylinders and β-strands by arrows. This structure has been modeled by using two available x-ray structures of Taq polymerase (in “open” and “closed” conformations; for details, see Text , which is published as supporting information on the PNAS web site). The polymerase and inactive 3′-5′ exonuclease domains are colored gray, and the 5′-3-exonuclease domain is colored green. Several amino-terminal and carboxyl-terminal amino acids are colored magenta and red, respectively. The only HhH motif in the 5′-3′ exonuclease domain is colored gold. DNA strands are colored cyan and orange. ( B ) Cartoon illustration of chimeric constructs. HhH repeats of Topo V are colored yellow ( H – L ), orange-yellow gradient ( E – G ), orange ( C and D ), and rainbow ( A and B ). Arrows indicate cleavage positions that result in C1–C3 domains (in case of Topo V) and the Stoffel fragment (in case of Taq polymerase).

Techniques Used: Construct

Processivity of Taq DNA polymerase, the Stoffel fragment, Pfu polB, and the hybrid polymerases in salts. Processivities of enzymes in primer extension reactions were determined as described in Materials and Methods , and the dependencies of Pe for enzymes with Taq polymerase catalytic domain on salt concentrations were plotted for NaCl ( A ), KCl ( B ), and potassium glutamate ( C ). The dependencies of Pe for enzymes with Pfu polymerase catalytic domain are collected in D.
Figure Legend Snippet: Processivity of Taq DNA polymerase, the Stoffel fragment, Pfu polB, and the hybrid polymerases in salts. Processivities of enzymes in primer extension reactions were determined as described in Materials and Methods , and the dependencies of Pe for enzymes with Taq polymerase catalytic domain on salt concentrations were plotted for NaCl ( A ), KCl ( B ), and potassium glutamate ( C ). The dependencies of Pe for enzymes with Pfu polymerase catalytic domain are collected in D.

Techniques Used:

Thermostability of Taq DNA polymerase, the Stoffel fragment, Pfu polB, Taq polymerase-Topo V, and Pfu polB chimeras at 100°C in 1 M potassium glutamate and 1 M betaine.
Figure Legend Snippet: Thermostability of Taq DNA polymerase, the Stoffel fragment, Pfu polB, Taq polymerase-Topo V, and Pfu polB chimeras at 100°C in 1 M potassium glutamate and 1 M betaine.

Techniques Used:

6) Product Images from "A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning"

Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning

Journal: Journal of Reproduction & Infertility

doi:

Amplification of PERF15 gene fragment. Samples of 50 μl containing standard buffer, 200μM of each dNTP, 40 pM of each primer, 100 ng genomic DNA, 1.25 unit of Taq DNA polymerase to 30 cycles of PCR amplification. Each sample was resolved on a 1% agarose gel containing ethidium bromide. Lane 1(100 bp DNA marker), Lane 2 (PCR product).
Figure Legend Snippet: Amplification of PERF15 gene fragment. Samples of 50 μl containing standard buffer, 200μM of each dNTP, 40 pM of each primer, 100 ng genomic DNA, 1.25 unit of Taq DNA polymerase to 30 cycles of PCR amplification. Each sample was resolved on a 1% agarose gel containing ethidium bromide. Lane 1(100 bp DNA marker), Lane 2 (PCR product).

Techniques Used: Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Marker

7) Product Images from "Instability of the Octarepeat Region of the Human Prion Protein Gene"

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

Journal: PLoS ONE

doi: 10.1371/journal.pone.0026635

Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.
Figure Legend Snippet: Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.

Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Mutagenesis, Clone Assay, Produced, Sequencing

8) Product Images from "Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results"

Article Title: Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results

Journal: Scientific Reports

doi: 10.1038/srep08056

Proportion of correct reads for the three genetic systems (simple: a single allele per individual, squares ; medium: two alleles, circles ; and complex: multiple alleles, triangles ) using standard PCR conditions ( open ) and modified PCR conditions to reduce chimera formation ( gray ). The size of the shape is indicative of the number of reads (see legend). All enzymes yielded at least 50% correct reads in the simplest system, mitochondrial DNA (Test 1; open squares). Some enzymes only worked for a given set of conditions (cycling conditions/genetic system). A group of enzymes consisting of Phusion, Gold and FastStart yielded a high proportion of correct reads cosistently accross all conditions. Others, such as Roche Taq, HotStar and Biotaq, yielded a low percent of correct reads for the more complex systems (MHC class I and MHC class II). Abbreviations as defined in Table 1 .
Figure Legend Snippet: Proportion of correct reads for the three genetic systems (simple: a single allele per individual, squares ; medium: two alleles, circles ; and complex: multiple alleles, triangles ) using standard PCR conditions ( open ) and modified PCR conditions to reduce chimera formation ( gray ). The size of the shape is indicative of the number of reads (see legend). All enzymes yielded at least 50% correct reads in the simplest system, mitochondrial DNA (Test 1; open squares). Some enzymes only worked for a given set of conditions (cycling conditions/genetic system). A group of enzymes consisting of Phusion, Gold and FastStart yielded a high proportion of correct reads cosistently accross all conditions. Others, such as Roche Taq, HotStar and Biotaq, yielded a low percent of correct reads for the more complex systems (MHC class I and MHC class II). Abbreviations as defined in Table 1 .

Techniques Used: Polymerase Chain Reaction, Modification

9) Product Images from "Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases"

Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases

Journal: Biochemistry

doi: 10.1021/bi2014807

Dependencies of apparent rate of substrate binding by DNA polymerases on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2)
Figure Legend Snippet: Dependencies of apparent rate of substrate binding by DNA polymerases on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2)

Techniques Used: Binding Assay

Thermostability of chimeric DNA polymerases ( see Materials and Methods ). Panel A shows the stability of Taq polymerase chimeras with truncated C-terminal TopoV tails at 100°C in the presence of 1 M potassium glutamate and 1 M betaine: (○)
Figure Legend Snippet: Thermostability of chimeric DNA polymerases ( see Materials and Methods ). Panel A shows the stability of Taq polymerase chimeras with truncated C-terminal TopoV tails at 100°C in the presence of 1 M potassium glutamate and 1 M betaine: (○)

Techniques Used:

Dependencies of DNA polymerase processivity on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2) – Klentaq. Panel
Figure Legend Snippet: Dependencies of DNA polymerase processivity on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2) – Klentaq. Panel

Techniques Used:

. Accumulation of the inactive conformations with temperature increase and dependencies of DNA binding rate constant on temperature for Taq polymerase and its fragments ( A, B ), chimeric polymerases
Figure Legend Snippet: . Accumulation of the inactive conformations with temperature increase and dependencies of DNA binding rate constant on temperature for Taq polymerase and its fragments ( A, B ), chimeric polymerases

Techniques Used: Binding Assay

10) Product Images from "Eprobe Mediated Real-Time PCR Monitoring and Melting Curve Analysis"

Article Title: Eprobe Mediated Real-Time PCR Monitoring and Melting Curve Analysis

Journal: PLoS ONE

doi: 10.1371/journal.pone.0070942

Use of exo+ and exo− Taq polymerase. Eprobe mediated real-time PCR experiments were performed by using an exo+ (Amplitaq) and exo− (Genotyping Master) Taq polymerase and Eprobes with different melting temperatures. Amplification curves (Random fluorescent units (RFU) plotted against PCR cycle number) using a 7 times serial dilution of the DNA template are shown on the left. The R-squared values of the PCR efficiency plots are indicated in the graphs. Differential melting curve analysis by plotting –dF/dT against temperature is shown on the right. Main peaks are indicated in the graph to show the different T M values for both Eprobes. EGFR wild-type plasmid DNA concentrations are indicated by colors: Red: 1.5×10 8 copies, Dark blue: 1.5×10 7 copies, Yellow: 1.5×10 6 copies, Green: 1.5×10 5 copies, Pink: 1.5×10 4 copies, Sky blue: 1.5×10 3 copies, Brown: 150 copies, Orange: TE negative control. A: Amplitaq and Eprobe 215-21 wt TO. B: Genotyping Mastermix and Eprobe 215-21 TO. C: Amplitaq and Eprobe 205-13 wt TO. D: Genotyping Master and Eprobe 205-13 wt TO.
Figure Legend Snippet: Use of exo+ and exo− Taq polymerase. Eprobe mediated real-time PCR experiments were performed by using an exo+ (Amplitaq) and exo− (Genotyping Master) Taq polymerase and Eprobes with different melting temperatures. Amplification curves (Random fluorescent units (RFU) plotted against PCR cycle number) using a 7 times serial dilution of the DNA template are shown on the left. The R-squared values of the PCR efficiency plots are indicated in the graphs. Differential melting curve analysis by plotting –dF/dT against temperature is shown on the right. Main peaks are indicated in the graph to show the different T M values for both Eprobes. EGFR wild-type plasmid DNA concentrations are indicated by colors: Red: 1.5×10 8 copies, Dark blue: 1.5×10 7 copies, Yellow: 1.5×10 6 copies, Green: 1.5×10 5 copies, Pink: 1.5×10 4 copies, Sky blue: 1.5×10 3 copies, Brown: 150 copies, Orange: TE negative control. A: Amplitaq and Eprobe 215-21 wt TO. B: Genotyping Mastermix and Eprobe 215-21 TO. C: Amplitaq and Eprobe 205-13 wt TO. D: Genotyping Master and Eprobe 205-13 wt TO.

Techniques Used: Real-time Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Serial Dilution, Plasmid Preparation, Negative Control

11) Product Images from "Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases"

Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases

Journal: Biochemistry

doi: 10.1021/bi2014807

Dependencies of apparent rate of substrate binding by DNA polymerases on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2)
Figure Legend Snippet: Dependencies of apparent rate of substrate binding by DNA polymerases on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2)

Techniques Used: Binding Assay

Thermostability of chimeric DNA polymerases ( see Materials and Methods ). Panel A shows the stability of Taq polymerase chimeras with truncated C-terminal TopoV tails at 100°C in the presence of 1 M potassium glutamate and 1 M betaine: (○)
Figure Legend Snippet: Thermostability of chimeric DNA polymerases ( see Materials and Methods ). Panel A shows the stability of Taq polymerase chimeras with truncated C-terminal TopoV tails at 100°C in the presence of 1 M potassium glutamate and 1 M betaine: (○)

Techniques Used:

Dependencies of DNA polymerase processivity on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2) – Klentaq. Panel
Figure Legend Snippet: Dependencies of DNA polymerase processivity on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2) – Klentaq. Panel

Techniques Used:

. Accumulation of the inactive conformations with temperature increase and dependencies of DNA binding rate constant on temperature for Taq polymerase and its fragments ( A, B ), chimeric polymerases
Figure Legend Snippet: . Accumulation of the inactive conformations with temperature increase and dependencies of DNA binding rate constant on temperature for Taq polymerase and its fragments ( A, B ), chimeric polymerases

Techniques Used: Binding Assay

12) Product Images from "Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1"

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2019.02366

K2ORF5 mRNA is outcompeted by cellular RNA in binding to the yeast cap-binding protein eIF4E in vitro . Electrophoretic analysis of semiquantitative RT-PCR detecting control HGT1 mRNA (upper panel) and K2ORF5 mRNA (lower panel) in samples as follows: Lane 1, glutathione-Sepharose with the bound GST-eIF4E fusion protein in the presence of excess K. lactis IFO1267 total RNA (input); lane 2, same as in line 1 but the reaction was performed without reverse transcriptase (negative control); lane 3, supernatant from the first wash step (unbound mRNA); lanes 4, 5, and 6, supernatants after the second, third, and sixth wash steps, respectively (unbound mRNA); lane 7, mRNA remaining bound on GST-S.c-eIF4E Sepharose after the sixth wash step. M, GeneRuler 100-bp DNA Ladder Plus (Thermo Scientific). PCR was performed using cDNA, Taq DNA polymerase, and the gene-specific primers listed in Supplementary Table S1 . All washing steps were performed with 70 volumes of buffer I. The initial abundances of HGT1 and K2ORF5 mRNA in the K. lactis total RNA were comparable as determined by qRT-PCR ( Supplementary Figure S3 ).
Figure Legend Snippet: K2ORF5 mRNA is outcompeted by cellular RNA in binding to the yeast cap-binding protein eIF4E in vitro . Electrophoretic analysis of semiquantitative RT-PCR detecting control HGT1 mRNA (upper panel) and K2ORF5 mRNA (lower panel) in samples as follows: Lane 1, glutathione-Sepharose with the bound GST-eIF4E fusion protein in the presence of excess K. lactis IFO1267 total RNA (input); lane 2, same as in line 1 but the reaction was performed without reverse transcriptase (negative control); lane 3, supernatant from the first wash step (unbound mRNA); lanes 4, 5, and 6, supernatants after the second, third, and sixth wash steps, respectively (unbound mRNA); lane 7, mRNA remaining bound on GST-S.c-eIF4E Sepharose after the sixth wash step. M, GeneRuler 100-bp DNA Ladder Plus (Thermo Scientific). PCR was performed using cDNA, Taq DNA polymerase, and the gene-specific primers listed in Supplementary Table S1 . All washing steps were performed with 70 volumes of buffer I. The initial abundances of HGT1 and K2ORF5 mRNA in the K. lactis total RNA were comparable as determined by qRT-PCR ( Supplementary Figure S3 ).

Techniques Used: Binding Assay, In Vitro, Reverse Transcription Polymerase Chain Reaction, Negative Control, Polymerase Chain Reaction, Quantitative RT-PCR

13) Product Images from "F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Gal?1-3GlcNAc-Containing Glycans"

Article Title: F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Gal?1-3GlcNAc-Containing Glycans

Journal: PLoS ONE

doi: 10.1371/journal.pone.0093177

The H-NS protein binds to the f9 promoter region. (A) Nucleotide sequence and features of the F9 promoter region of uropathogenic E. coli CFT073. 5′ RACE analysis identified the transcription start site as a guanine residue (labelled as +1), 251 nucleotides upstream of the start codon of the f9 major subunit (+252). The predicted ribosomal binding site (RBS), −10 and −35 promoter elements are highlighted in boldface. Six putative H-NS binding sites (positions −111, −103, +8, +14, +57 and +89) were identified with the Virtual Footprint bacterial promoter analysis tool [35] . (B) Electrophoretic band shift of the amplified 251 bp f9 promoter and Taq I- Ssp I digested pBR322 DNA in the presence of various concentrations H-NS (0 μM, 1 μM, 2 μM, 3 μM, 4 μM and 10 μM). Similar to the bla promoter positive control, the signal of the f9 promoter diminishes as its gel migration is impeded by increasing H-NS concentrations, demonstrating that H-NS binds directly to the f9 promoter sequence. Migration of bla -negative pBR322 fragments was not affected by H-NS.
Figure Legend Snippet: The H-NS protein binds to the f9 promoter region. (A) Nucleotide sequence and features of the F9 promoter region of uropathogenic E. coli CFT073. 5′ RACE analysis identified the transcription start site as a guanine residue (labelled as +1), 251 nucleotides upstream of the start codon of the f9 major subunit (+252). The predicted ribosomal binding site (RBS), −10 and −35 promoter elements are highlighted in boldface. Six putative H-NS binding sites (positions −111, −103, +8, +14, +57 and +89) were identified with the Virtual Footprint bacterial promoter analysis tool [35] . (B) Electrophoretic band shift of the amplified 251 bp f9 promoter and Taq I- Ssp I digested pBR322 DNA in the presence of various concentrations H-NS (0 μM, 1 μM, 2 μM, 3 μM, 4 μM and 10 μM). Similar to the bla promoter positive control, the signal of the f9 promoter diminishes as its gel migration is impeded by increasing H-NS concentrations, demonstrating that H-NS binds directly to the f9 promoter sequence. Migration of bla -negative pBR322 fragments was not affected by H-NS.

Techniques Used: Sequencing, Binding Assay, Electrophoretic Mobility Shift Assay, Amplification, Positive Control, Migration

Related Articles

High Performance Liquid Chromatography:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The PCR cycles were: 94°C for 2 min; 94°C for 30 sec, 58.5°C for 30 sec and 72°C for 90 sec for 31 cycles; 72°C for 7 min. All primers used in this study were HPLC-purified (Invitrogen, CA, USA).

Countercurrent Chromatography:

Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
Article Snippet: Forward primer hP1 (5' ATG GTT GAG CCC TTC TTG GGA AC 3') and reverse primer hP6 (5' TCA CAC CTT TTC GTA GAT TCT GGT G 3') were synthesized (VWR, Stockholm, Sweden). .. The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl .

Multiplex Assay:

Article Title: Multiplex PCR for Detection and Identification of Lactococcal Bacteriophages
Article Snippet: Paragraph title: Multiplex PCR. ... PCRs were performed in 50 μl containing 125 mM deoxynucleoside triphosphate (Pharmacia Biotech, Baie d'Urfé, Québec, Canada), 5 mM concentrations of the six primers, 1.25 U of Taq DNA polymerase (Roche Diagnostic), Taq buffer (10 mM Tris-HCl, 1.5 mM magnesium chloride, 50 mM potassium chloride, pH 8.3), and 1 μl of the template.

Amplification:

Article Title: Eprobe Mediated Real-Time PCR Monitoring and Melting Curve Analysis
Article Snippet: Human KRAS specific primers for exons 12 and 13 (forward primer: 5′-TTATAAGGCCTGCTGAAAATGACTGAA-3′ , reverse primer: 5′-TGAATTAGCTGTATCGTCAAGGCACT-3′ ) were taken from and amplified a 92 bp DNA fragment. .. We selected AmpliTaq Gold PCR Master Mix (Applied Biosystems, Carlsbad, USA) as a Taq DNA polymerase with an exonuclease activity (exo+) and LightCycler 480 Genotyping Master (Roche Diagnostics, Mannheim, Germany) as a Taq DNA polymerase having an N-terminal deletion lacking an exonuclease activity (exo−).

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: .. The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The PCR cycles were: 94°C for 2 min; 94°C for 30 sec, 58.5°C for 30 sec and 72°C for 90 sec for 31 cycles; 72°C for 7 min. All primers used in this study were HPLC-purified (Invitrogen, CA, USA).

Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
Article Snippet: Paragraph title: Polymerase chain reaction (PCR) amplification of cDNA ... The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl .

Clone Assay:

Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases
Article Snippet: .. Taq DNA polymerase was purchased from Roche Applied Science (Indianapolis, IN), the Stoffel fragment of Taq DNA polymerase was obtained from Applied BioSystems (Foster City, CA), and Pfu DNA polymerase was from Stratagene Cloning Systems (La Jolla, CA). .. The recombinant large fragment of Bst DNA polymerase (IsoTherm™ DNA polymerase) was purchased from Epicentre Technologies (Madison, WI).

Binding Assay:

Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
Article Snippet: Polymerase chain reaction (PCR) amplification of cDNA Two pairs of primers were designed to amplify human PERF15 cDNA based on the automated computational analysis of Homo sapiens similar to testis fatty-acid binding protein 9 (Gene bank, accession number XM_378035). .. The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl .

Synthesized:

Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
Article Snippet: Forward primer hP1 (5' ATG GTT GAG CCC TTC TTG GGA AC 3') and reverse primer hP6 (5' TCA CAC CTT TTC GTA GAT TCT GGT G 3') were synthesized (VWR, Stockholm, Sweden). .. The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl .

Mutagenesis:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: Paragraph title: Preparation of PCR templates (PrP-Oct5 and PrP-Oct11a) and plasmids (pOct5, pOct11b) for mutation analysis ... The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA).

Transferring:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: .. Individual white and light blue colonies were directly picked by pipette tips into 20 µl of PCR reaction mix [200 µM dNTPs (each), 1×PCR buffer containing 1.5 mM MgCl2 , 0.4 µM each of primers, and 2 units of Taq DNA polymerase] and subjected to PCR with primers HP50F ( GTGACCTGGGCCTCTGCAAG ) and HP293R ( CTTACTCGGCTTGTTCCACT ) as follows: 94°C for 2 min; 94°C for 30 sec, 66.5°C for 30 sec and 72°C for 60 sec for 17 cycles; 72°C for 7 min. .. The PCR products were separated on 2% agarose gels containing ethidium bromide.

Size-exclusion Chromatography:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The PCR cycles were: 94°C for 2 min; 94°C for 30 sec, 58.5°C for 30 sec and 72°C for 90 sec for 31 cycles; 72°C for 7 min. All primers used in this study were HPLC-purified (Invitrogen, CA, USA).

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: .. Individual white and light blue colonies were directly picked by pipette tips into 20 µl of PCR reaction mix [200 µM dNTPs (each), 1×PCR buffer containing 1.5 mM MgCl2 , 0.4 µM each of primers, and 2 units of Taq DNA polymerase] and subjected to PCR with primers HP50F ( GTGACCTGGGCCTCTGCAAG ) and HP293R ( CTTACTCGGCTTGTTCCACT ) as follows: 94°C for 2 min; 94°C for 30 sec, 66.5°C for 30 sec and 72°C for 60 sec for 17 cycles; 72°C for 7 min. .. The PCR products were separated on 2% agarose gels containing ethidium bromide.

Spectrophotometry:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The A260/280 ratios of DNA samples in this study were 1.8–2.0 as assayed with a Nanovue spectrophotometer (GE Healthcare, NJ, USA).

Purification:

Article Title: Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4): an archaeal DinB-like DNA polymerase with lesion-bypass properties akin to eukaryotic pol?
Article Snippet: The thermostability of the highly purified Dpo4 enzyme was more accurately determined by heating aliquots at a variety of temperatures for 5 min. After this time, we assayed the ability of the enzyme to incorporate a single dCMP opposite template G, which is the most catalytically favorable incorporation for the enzyme (Table ). .. The thermostability of each enzyme was compared with two well-characterized enzymes, Taq polymerase (Roche Molecular) and E.coli pol I Klenow fragment (New England Biolabs), under the same assay conditions.

Real-time Polymerase Chain Reaction:

Article Title: Eprobe Mediated Real-Time PCR Monitoring and Melting Curve Analysis
Article Snippet: Paragraph title: Real-time PCR ... We selected AmpliTaq Gold PCR Master Mix (Applied Biosystems, Carlsbad, USA) as a Taq DNA polymerase with an exonuclease activity (exo+) and LightCycler 480 Genotyping Master (Roche Diagnostics, Mannheim, Germany) as a Taq DNA polymerase having an N-terminal deletion lacking an exonuclease activity (exo−).

Concentration Assay:

Article Title: Eprobe Mediated Real-Time PCR Monitoring and Melting Curve Analysis
Article Snippet: We selected AmpliTaq Gold PCR Master Mix (Applied Biosystems, Carlsbad, USA) as a Taq DNA polymerase with an exonuclease activity (exo+) and LightCycler 480 Genotyping Master (Roche Diagnostics, Mannheim, Germany) as a Taq DNA polymerase having an N-terminal deletion lacking an exonuclease activity (exo−). .. Suitable Eprobes concentrations were tested in the range of 25 nM to 500 nM, where 200 nM was the optimal concentration for standard reactions.

other:

Article Title: Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4): an archaeal DinB-like DNA polymerase with lesion-bypass properties akin to eukaryotic pol?
Article Snippet: For Dpo4, it was 10 nM; for Taq polymerase it was 0.1 U; and for E.coli pol I Klenow fragment it was 0.1 U.

Article Title: Optimal conditions to use Pfu exo– DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols
Article Snippet: Taq DNA polymerase and T4 DNA ligase were purchased from Roche Molecular Biochemicals (Laval, Canada).

Activity Assay:

Article Title: Eprobe Mediated Real-Time PCR Monitoring and Melting Curve Analysis
Article Snippet: .. We selected AmpliTaq Gold PCR Master Mix (Applied Biosystems, Carlsbad, USA) as a Taq DNA polymerase with an exonuclease activity (exo+) and LightCycler 480 Genotyping Master (Roche Diagnostics, Mannheim, Germany) as a Taq DNA polymerase having an N-terminal deletion lacking an exonuclease activity (exo−). .. Suitable Eprobes concentrations were tested in the range of 25 nM to 500 nM, where 200 nM was the optimal concentration for standard reactions.

Polymerase Chain Reaction:

Article Title: Eprobe Mediated Real-Time PCR Monitoring and Melting Curve Analysis
Article Snippet: .. We selected AmpliTaq Gold PCR Master Mix (Applied Biosystems, Carlsbad, USA) as a Taq DNA polymerase with an exonuclease activity (exo+) and LightCycler 480 Genotyping Master (Roche Diagnostics, Mannheim, Germany) as a Taq DNA polymerase having an N-terminal deletion lacking an exonuclease activity (exo−). .. Suitable Eprobes concentrations were tested in the range of 25 nM to 500 nM, where 200 nM was the optimal concentration for standard reactions.

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: .. The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The PCR cycles were: 94°C for 2 min; 94°C for 30 sec, 58.5°C for 30 sec and 72°C for 90 sec for 31 cycles; 72°C for 7 min. All primers used in this study were HPLC-purified (Invitrogen, CA, USA).

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: .. Individual white and light blue colonies were directly picked by pipette tips into 20 µl of PCR reaction mix [200 µM dNTPs (each), 1×PCR buffer containing 1.5 mM MgCl2 , 0.4 µM each of primers, and 2 units of Taq DNA polymerase] and subjected to PCR with primers HP50F ( GTGACCTGGGCCTCTGCAAG ) and HP293R ( CTTACTCGGCTTGTTCCACT ) as follows: 94°C for 2 min; 94°C for 30 sec, 66.5°C for 30 sec and 72°C for 60 sec for 17 cycles; 72°C for 7 min. .. The PCR products were separated on 2% agarose gels containing ethidium bromide.

Article Title: Multiplex PCR for Detection and Identification of Lactococcal Bacteriophages
Article Snippet: Paragraph title: Multiplex PCR. ... PCRs were performed in 50 μl containing 125 mM deoxynucleoside triphosphate (Pharmacia Biotech, Baie d'Urfé, Québec, Canada), 5 mM concentrations of the six primers, 1.25 U of Taq DNA polymerase (Roche Diagnostic), Taq buffer (10 mM Tris-HCl, 1.5 mM magnesium chloride, 50 mM potassium chloride, pH 8.3), and 1 μl of the template.

Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
Article Snippet: .. The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl . .. The mixture was amplified in a thermocycler (Eppendorf, Germany) following an initial denaturation at 94°C for 4 minutes, 40 cycles of denaturation at 94°C for 30 seconds, annealing at 63.5°C for 30 seconds, elongation at 72°C for 1 minute and a final extension at 72°C for 10 minutes.

Article Title: Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results
Article Snippet: .. Taq polymerase A range of 13 high fidelity, regular, economy and premium Taq polymerase enzymes were selected: Biotaq® (Bioline, London, UK), FastStart® High Fidelity PCR System (Roche, Mannheim, Germany), AmpliTaq Gold® (Applied Biosystems, Warrington, UK), HotStarTaq® DNA Polymerase (Qiagen, Hilden, Gernamy), Phusion® High Fidelity DNA Polymerase (Finnzymes, Espoo, Finland), Taq DNA Polymerase (Roche, Maylan, France), i-MaxTM II DNA Polymerase (iNtRON Biotechnology, Seongnam, Korea), KAPA HiFi™ (Kapa Biosystems, Boston, USA), OneTaq ™ DNA Polymerase (New England Biolabs, Hitchin, UK), Vent® DNA Polymerase (New England Biolabs, Hitchin, UK), Deep Vent® DNA Polymerase (New England Biolabs, Hitchin, UK), Pwo® DNA Polymerase (Roche, Maylan, France) and Velocity DNA Polymerase (Bioline, London, UK) (abbreviated names in ). ..

Article Title: Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4): an archaeal DinB-like DNA polymerase with lesion-bypass properties akin to eukaryotic pol?
Article Snippet: .. Given that the Dpo4 is thermostable and at high enzyme to P/T ratios can extend primers by several hundred nucleotides, we were interested in determining if the enzyme might be able to substitute for Taq polymerase in polymerase chain reactions (PCR). .. Indeed, a short linear fragment of ∼200 bp was amplified with ∼70% yield of that obtained with Taq polymerase (Fig. , upper panel).

Recombinant:

Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases
Article Snippet: Taq DNA polymerase was purchased from Roche Applied Science (Indianapolis, IN), the Stoffel fragment of Taq DNA polymerase was obtained from Applied BioSystems (Foster City, CA), and Pfu DNA polymerase was from Stratagene Cloning Systems (La Jolla, CA). .. The recombinant large fragment of Bst DNA polymerase (IsoTherm™ DNA polymerase) was purchased from Epicentre Technologies (Madison, WI).

Variant Assay:

Article Title: Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases
Article Snippet: .. Taq DNA polymerase and its Klen Taq variant were purchased from Roche Molecular Biochemicals and from GeneCraft (Munster, Germany), respectively. .. The Stoffel fragment was obtained from Applied BioSystems, and Pfu DNA polymerase was obtained from Stratagene.

Plasmid Preparation:

Article Title: Eprobe Mediated Real-Time PCR Monitoring and Melting Curve Analysis
Article Snippet: We selected AmpliTaq Gold PCR Master Mix (Applied Biosystems, Carlsbad, USA) as a Taq DNA polymerase with an exonuclease activity (exo+) and LightCycler 480 Genotyping Master (Roche Diagnostics, Mannheim, Germany) as a Taq DNA polymerase having an N-terminal deletion lacking an exonuclease activity (exo−). .. The template concentration per reaction varied from 1 ng to 1000 ng genomic DNA or from 150 to 150,000,000 copies for plasmid DNA.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • taq  (Roche)
    94
    Roche taq
    Representative autoradiograms of clonal frequency analyses of HALT-C patients with low (patient 9, panel A), intermediate (patient 6, panel B) and high (patient 16, panel C) QS diversity and complexity. <t>E2-HVR1</t> RT-PCRs were performed with <t>Taq</t> and HF-2 enzymes. PCR products were cloned as described in the Materials and Methods, and individual colonies were picked and re-amplified. Lane 1 represents the homoduplex (HD) control and represents the probe hybridized to itself. Lane 2 represents the heteroduplex profile of the heterogenous (ie not cloned) E2-HVR1 PCR product and is designated
    Taq, supplied by Roche, used in various techniques. Bioz Stars score: 94/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq/product/Roche
    Average 94 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    taq - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    99
    Roche taq dna polymerase
    Instability of octarepeats during PCR amplification by <t>Taq</t> Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp <t>DNA</t> Ladder.
    Taq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Roche
    Average 99 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    86
    Roche taq polymerases
    Sequences of contaminating bacterial <t>DNA</t> in three <t>Taq</t> polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.
    Taq Polymerases, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerases/product/Roche
    Average 86 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    taq polymerases - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    Representative autoradiograms of clonal frequency analyses of HALT-C patients with low (patient 9, panel A), intermediate (patient 6, panel B) and high (patient 16, panel C) QS diversity and complexity. E2-HVR1 RT-PCRs were performed with Taq and HF-2 enzymes. PCR products were cloned as described in the Materials and Methods, and individual colonies were picked and re-amplified. Lane 1 represents the homoduplex (HD) control and represents the probe hybridized to itself. Lane 2 represents the heteroduplex profile of the heterogenous (ie not cloned) E2-HVR1 PCR product and is designated

    Journal: Virology Journal

    Article Title: Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis

    doi: 10.1186/1743-422X-2-41

    Figure Lengend Snippet: Representative autoradiograms of clonal frequency analyses of HALT-C patients with low (patient 9, panel A), intermediate (patient 6, panel B) and high (patient 16, panel C) QS diversity and complexity. E2-HVR1 RT-PCRs were performed with Taq and HF-2 enzymes. PCR products were cloned as described in the Materials and Methods, and individual colonies were picked and re-amplified. Lane 1 represents the homoduplex (HD) control and represents the probe hybridized to itself. Lane 2 represents the heteroduplex profile of the heterogenous (ie not cloned) E2-HVR1 PCR product and is designated "H". Panels D and E are graphical summaries of HMR and Complexity in the 3 patients.

    Article Snippet: Discussion In the current investigation, we found that the sensitivity of Taq and HF-2 enzymes in amplifying the E2-HVR1 were similar to the qualitative Roche COBAS Amplicor RT-PCR assay.

    Techniques: Polymerase Chain Reaction, Clone Assay, Amplification

    Comparison of quasipecies genetic diversity (assessed by HMR, Panel A) and complexity (panel B) values processed with Taq or HF-2 polymerases, in 12 HCV/HIV co-infected samples treated (N = 7) or not treated (N = 5) with HAART. The box plots represent the means and ranges of the HMR and complexity scores for 240 HVR1 clones amplified by each polymerase, for a total of 480 clones (12 patients × 20 clones/patient × 2 enzymes). Error bars represent standard deviations. Wilcoxon Signed Ranks tests determined that all differences were not statistically significant.

    Journal: Virology Journal

    Article Title: Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis

    doi: 10.1186/1743-422X-2-41

    Figure Lengend Snippet: Comparison of quasipecies genetic diversity (assessed by HMR, Panel A) and complexity (panel B) values processed with Taq or HF-2 polymerases, in 12 HCV/HIV co-infected samples treated (N = 7) or not treated (N = 5) with HAART. The box plots represent the means and ranges of the HMR and complexity scores for 240 HVR1 clones amplified by each polymerase, for a total of 480 clones (12 patients × 20 clones/patient × 2 enzymes). Error bars represent standard deviations. Wilcoxon Signed Ranks tests determined that all differences were not statistically significant.

    Article Snippet: Discussion In the current investigation, we found that the sensitivity of Taq and HF-2 enzymes in amplifying the E2-HVR1 were similar to the qualitative Roche COBAS Amplicor RT-PCR assay.

    Techniques: Infection, Clone Assay, Amplification

    Comparison of the sensitivity of the E2-HVR1 PCR using Taq and HF-2 enzymes. RNA was extracted from duplicate serial dilutions of a WHO HCV standard and RT-PCR was performed with Taq and HF-2 enzymes. The dilutions corresponded to 50,000 (5K), 1,000 (1K), 500, 100, and 50 IU/ml, and are indicated above each lane. The position of the 176 bp E2-HVR1 is indicated with arrows. MW represents the 100 base pair DNA molecular weight marker. Below each lane is the result of testing of the same dilution of the standard with the Roche COBAS Amplicor assay. The result of this test gives a positive (+) or negative (-) result.

    Journal: Virology Journal

    Article Title: Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis

    doi: 10.1186/1743-422X-2-41

    Figure Lengend Snippet: Comparison of the sensitivity of the E2-HVR1 PCR using Taq and HF-2 enzymes. RNA was extracted from duplicate serial dilutions of a WHO HCV standard and RT-PCR was performed with Taq and HF-2 enzymes. The dilutions corresponded to 50,000 (5K), 1,000 (1K), 500, 100, and 50 IU/ml, and are indicated above each lane. The position of the 176 bp E2-HVR1 is indicated with arrows. MW represents the 100 base pair DNA molecular weight marker. Below each lane is the result of testing of the same dilution of the standard with the Roche COBAS Amplicor assay. The result of this test gives a positive (+) or negative (-) result.

    Article Snippet: Discussion In the current investigation, we found that the sensitivity of Taq and HF-2 enzymes in amplifying the E2-HVR1 were similar to the qualitative Roche COBAS Amplicor RT-PCR assay.

    Techniques: Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Molecular Weight, Marker

    Comparison of quasipecies genetic diversity (assessed by HMR, Panel A) and complexity (panel B) values in samples processed with Taq or HF-2 polymerases in HALT-C baseline specimens. The box plots represent the means and ranges of the HMR and complexity scores for 400 HVR1 clones amplified by each polymerase, for a total of 800 clones (20 patients × 20 clones/patient × 2 enzymes). Error bars represent standard deviations. Significance values above each panel were derived from Wilcoxon Signed Ranks tests.

    Journal: Virology Journal

    Article Title: Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis

    doi: 10.1186/1743-422X-2-41

    Figure Lengend Snippet: Comparison of quasipecies genetic diversity (assessed by HMR, Panel A) and complexity (panel B) values in samples processed with Taq or HF-2 polymerases in HALT-C baseline specimens. The box plots represent the means and ranges of the HMR and complexity scores for 400 HVR1 clones amplified by each polymerase, for a total of 800 clones (20 patients × 20 clones/patient × 2 enzymes). Error bars represent standard deviations. Significance values above each panel were derived from Wilcoxon Signed Ranks tests.

    Article Snippet: Discussion In the current investigation, we found that the sensitivity of Taq and HF-2 enzymes in amplifying the E2-HVR1 were similar to the qualitative Roche COBAS Amplicor RT-PCR assay.

    Techniques: Clone Assay, Amplification, Derivative Assay

    Comparison of quasipecies genetic diversity (assessed by HMR, Panel A) and complexity (panel B) scores generated with Taq or HF-2 polymerases, in 20 HALT-C samples who were HCV RNA negative (N = 6) or HCV RNA positive (N = 14) at week 20 (W20) of pegylated IFN plus ribavirin therapy. The box plots represent the means and ranges of the HMR and complexity scores for 400 HVR1 clones amplified by each polymerase, for a total of 800 clones (20 patients × 20 clones/patient × 2 enzymes). Error bars represent standard deviations. Wilcoxon Signed Ranks tests determined that the differences between enzymes and patient groups were not statistically significant.

    Journal: Virology Journal

    Article Title: Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis

    doi: 10.1186/1743-422X-2-41

    Figure Lengend Snippet: Comparison of quasipecies genetic diversity (assessed by HMR, Panel A) and complexity (panel B) scores generated with Taq or HF-2 polymerases, in 20 HALT-C samples who were HCV RNA negative (N = 6) or HCV RNA positive (N = 14) at week 20 (W20) of pegylated IFN plus ribavirin therapy. The box plots represent the means and ranges of the HMR and complexity scores for 400 HVR1 clones amplified by each polymerase, for a total of 800 clones (20 patients × 20 clones/patient × 2 enzymes). Error bars represent standard deviations. Wilcoxon Signed Ranks tests determined that the differences between enzymes and patient groups were not statistically significant.

    Article Snippet: Discussion In the current investigation, we found that the sensitivity of Taq and HF-2 enzymes in amplifying the E2-HVR1 were similar to the qualitative Roche COBAS Amplicor RT-PCR assay.

    Techniques: Generated, Clone Assay, Amplification

    Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.

    Journal: PLoS ONE

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

    doi: 10.1371/journal.pone.0026635

    Figure Lengend Snippet: Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.

    Article Snippet: The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA).

    Techniques: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Mutagenesis, Clone Assay, Produced, Sequencing

    Use of exo+ and exo− Taq polymerase. Eprobe mediated real-time PCR experiments were performed by using an exo+ (Amplitaq) and exo− (Genotyping Master) Taq polymerase and Eprobes with different melting temperatures. Amplification curves (Random fluorescent units (RFU) plotted against PCR cycle number) using a 7 times serial dilution of the DNA template are shown on the left. The R-squared values of the PCR efficiency plots are indicated in the graphs. Differential melting curve analysis by plotting –dF/dT against temperature is shown on the right. Main peaks are indicated in the graph to show the different T M values for both Eprobes. EGFR wild-type plasmid DNA concentrations are indicated by colors: Red: 1.5×10 8 copies, Dark blue: 1.5×10 7 copies, Yellow: 1.5×10 6 copies, Green: 1.5×10 5 copies, Pink: 1.5×10 4 copies, Sky blue: 1.5×10 3 copies, Brown: 150 copies, Orange: TE negative control. A: Amplitaq and Eprobe 215-21 wt TO. B: Genotyping Mastermix and Eprobe 215-21 TO. C: Amplitaq and Eprobe 205-13 wt TO. D: Genotyping Master and Eprobe 205-13 wt TO.

    Journal: PLoS ONE

    Article Title: Eprobe Mediated Real-Time PCR Monitoring and Melting Curve Analysis

    doi: 10.1371/journal.pone.0070942

    Figure Lengend Snippet: Use of exo+ and exo− Taq polymerase. Eprobe mediated real-time PCR experiments were performed by using an exo+ (Amplitaq) and exo− (Genotyping Master) Taq polymerase and Eprobes with different melting temperatures. Amplification curves (Random fluorescent units (RFU) plotted against PCR cycle number) using a 7 times serial dilution of the DNA template are shown on the left. The R-squared values of the PCR efficiency plots are indicated in the graphs. Differential melting curve analysis by plotting –dF/dT against temperature is shown on the right. Main peaks are indicated in the graph to show the different T M values for both Eprobes. EGFR wild-type plasmid DNA concentrations are indicated by colors: Red: 1.5×10 8 copies, Dark blue: 1.5×10 7 copies, Yellow: 1.5×10 6 copies, Green: 1.5×10 5 copies, Pink: 1.5×10 4 copies, Sky blue: 1.5×10 3 copies, Brown: 150 copies, Orange: TE negative control. A: Amplitaq and Eprobe 215-21 wt TO. B: Genotyping Mastermix and Eprobe 215-21 TO. C: Amplitaq and Eprobe 205-13 wt TO. D: Genotyping Master and Eprobe 205-13 wt TO.

    Article Snippet: We selected AmpliTaq Gold PCR Master Mix (Applied Biosystems, Carlsbad, USA) as a Taq DNA polymerase with an exonuclease activity (exo+) and LightCycler 480 Genotyping Master (Roche Diagnostics, Mannheim, Germany) as a Taq DNA polymerase having an N-terminal deletion lacking an exonuclease activity (exo−).

    Techniques: Real-time Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Serial Dilution, Plasmid Preparation, Negative Control

    Sequences of contaminating bacterial DNA in three Taq polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Sequences of contaminating bacterial DNA in three Taq polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.

    Article Snippet: Taq polymerases The following DNA polymerases from commercial vendors designed for qPCR were used in the experiments reported here: Amplitaq Gold (ABI, CA; Roche lot # J02913); Platinum Taq (Invitrogen, CA; cat # 10966–026; lot 1169610); Platinum HiFi Taq (Invitrogen, CA; cat# 11304–011; lot# 1267490); HotStar Taq (Qiagen, CA; Mat # 1007837; lot # 124125007); JumpStart Taq (Sigma, MO; cat # D-6558; lot # 71K9029).

    Techniques: Sequencing, Polymerase Chain Reaction

    Approximating the copy number of 16S rDNA in commercial Taq polymerases. Six DNA polymerases were used with primers for 16S rDNA on 7 serial 10-fold dilutions of E. coli genomic DNA (10 ng to 10 fg) with no added DNA in the 8 th sample. The least squares fit equation for each dilution series was used to assign a value to the signal from the 8 th sample, which contains Taq-associated DNA only. The efficiency of the reaction was determined from the slope of the linear fit plotting the base10 log of the DNA concentration vs. the threshold cycle. A slope of −3.322 indicates an average doubling rate of “2,” which is approximately 100% efficiency (2̂3.322∼10). The rDNA values assigned are for “E. coli equivalents.”

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Approximating the copy number of 16S rDNA in commercial Taq polymerases. Six DNA polymerases were used with primers for 16S rDNA on 7 serial 10-fold dilutions of E. coli genomic DNA (10 ng to 10 fg) with no added DNA in the 8 th sample. The least squares fit equation for each dilution series was used to assign a value to the signal from the 8 th sample, which contains Taq-associated DNA only. The efficiency of the reaction was determined from the slope of the linear fit plotting the base10 log of the DNA concentration vs. the threshold cycle. A slope of −3.322 indicates an average doubling rate of “2,” which is approximately 100% efficiency (2̂3.322∼10). The rDNA values assigned are for “E. coli equivalents.”

    Article Snippet: Taq polymerases The following DNA polymerases from commercial vendors designed for qPCR were used in the experiments reported here: Amplitaq Gold (ABI, CA; Roche lot # J02913); Platinum Taq (Invitrogen, CA; cat # 10966–026; lot 1169610); Platinum HiFi Taq (Invitrogen, CA; cat# 11304–011; lot# 1267490); HotStar Taq (Qiagen, CA; Mat # 1007837; lot # 124125007); JumpStart Taq (Sigma, MO; cat # D-6558; lot # 71K9029).

    Techniques: Concentration Assay

    Detection of Pseudomonas fluorescens at high and low Taq polymerase concentrations. Bacterial detection with 0.5 Units (A) or 0.05 Units (B) Qiagen Taq DNA polymerase with 16S350B assay on samples containing 10 3 , 10 2 , 10 1 and zero Pseudomonas fluorescens bacteria. A composite of A and B is shown in C.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Detection of Pseudomonas fluorescens at high and low Taq polymerase concentrations. Bacterial detection with 0.5 Units (A) or 0.05 Units (B) Qiagen Taq DNA polymerase with 16S350B assay on samples containing 10 3 , 10 2 , 10 1 and zero Pseudomonas fluorescens bacteria. A composite of A and B is shown in C.

    Article Snippet: Taq polymerases The following DNA polymerases from commercial vendors designed for qPCR were used in the experiments reported here: Amplitaq Gold (ABI, CA; Roche lot # J02913); Platinum Taq (Invitrogen, CA; cat # 10966–026; lot 1169610); Platinum HiFi Taq (Invitrogen, CA; cat# 11304–011; lot# 1267490); HotStar Taq (Qiagen, CA; Mat # 1007837; lot # 124125007); JumpStart Taq (Sigma, MO; cat # D-6558; lot # 71K9029).

    Techniques:

    Detection of bacterial DNA in six Taq polymerases. Four dilutions of six DNA polymerase were tested with primers for 16S rDNA in the presence of 100 pg (∼10̂5 16S rDNA) E. coli genomic DNA (circled) or H 2 O.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Detection of bacterial DNA in six Taq polymerases. Four dilutions of six DNA polymerase were tested with primers for 16S rDNA in the presence of 100 pg (∼10̂5 16S rDNA) E. coli genomic DNA (circled) or H 2 O.

    Article Snippet: Taq polymerases The following DNA polymerases from commercial vendors designed for qPCR were used in the experiments reported here: Amplitaq Gold (ABI, CA; Roche lot # J02913); Platinum Taq (Invitrogen, CA; cat # 10966–026; lot 1169610); Platinum HiFi Taq (Invitrogen, CA; cat# 11304–011; lot# 1267490); HotStar Taq (Qiagen, CA; Mat # 1007837; lot # 124125007); JumpStart Taq (Sigma, MO; cat # D-6558; lot # 71K9029).

    Techniques:

    Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.

    Article Snippet: Taq polymerases The following DNA polymerases from commercial vendors designed for qPCR were used in the experiments reported here: Amplitaq Gold (ABI, CA; Roche lot # J02913); Platinum Taq (Invitrogen, CA; cat # 10966–026; lot 1169610); Platinum HiFi Taq (Invitrogen, CA; cat# 11304–011; lot# 1267490); HotStar Taq (Qiagen, CA; Mat # 1007837; lot # 124125007); JumpStart Taq (Sigma, MO; cat # D-6558; lot # 71K9029).

    Techniques: Labeling