taq dna polymerase  (Roche)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Name:
    FastStart Taq DNA Polymerase
    Description:

    Catalog Number:
    FTDPU2791696
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Roche taq dna polymerase
    The H-NS protein binds to the f9 promoter region. (A) Nucleotide sequence and features of the F9 promoter region of uropathogenic E. coli CFT073. 5′ RACE analysis identified the transcription start site as a guanine residue (labelled as +1), 251 nucleotides upstream of the start codon of the f9 major subunit (+252). The predicted ribosomal binding site (RBS), −10 and −35 promoter elements are highlighted in boldface. Six putative H-NS binding sites (positions −111, −103, +8, +14, +57 and +89) were identified with the Virtual Footprint bacterial promoter analysis tool [35] . (B) Electrophoretic band shift of the amplified 251 bp f9 promoter and <t>Taq</t> I- Ssp I digested pBR322 <t>DNA</t> in the presence of various concentrations H-NS (0 μM, 1 μM, 2 μM, 3 μM, 4 μM and 10 μM). Similar to the bla promoter positive control, the signal of the f9 promoter diminishes as its gel migration is impeded by increasing H-NS concentrations, demonstrating that H-NS binds directly to the f9 promoter sequence. Migration of bla -negative pBR322 fragments was not affected by H-NS.

    https://www.bioz.com/result/taq dna polymerase/product/Roche
    Average 97 stars, based on 838 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2019-12
    97/100 stars

    Images

    1) Product Images from "F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Gal?1-3GlcNAc-Containing Glycans"

    Article Title: F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Gal?1-3GlcNAc-Containing Glycans

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0093177

    The H-NS protein binds to the f9 promoter region. (A) Nucleotide sequence and features of the F9 promoter region of uropathogenic E. coli CFT073. 5′ RACE analysis identified the transcription start site as a guanine residue (labelled as +1), 251 nucleotides upstream of the start codon of the f9 major subunit (+252). The predicted ribosomal binding site (RBS), −10 and −35 promoter elements are highlighted in boldface. Six putative H-NS binding sites (positions −111, −103, +8, +14, +57 and +89) were identified with the Virtual Footprint bacterial promoter analysis tool [35] . (B) Electrophoretic band shift of the amplified 251 bp f9 promoter and Taq I- Ssp I digested pBR322 DNA in the presence of various concentrations H-NS (0 μM, 1 μM, 2 μM, 3 μM, 4 μM and 10 μM). Similar to the bla promoter positive control, the signal of the f9 promoter diminishes as its gel migration is impeded by increasing H-NS concentrations, demonstrating that H-NS binds directly to the f9 promoter sequence. Migration of bla -negative pBR322 fragments was not affected by H-NS.
    Figure Legend Snippet: The H-NS protein binds to the f9 promoter region. (A) Nucleotide sequence and features of the F9 promoter region of uropathogenic E. coli CFT073. 5′ RACE analysis identified the transcription start site as a guanine residue (labelled as +1), 251 nucleotides upstream of the start codon of the f9 major subunit (+252). The predicted ribosomal binding site (RBS), −10 and −35 promoter elements are highlighted in boldface. Six putative H-NS binding sites (positions −111, −103, +8, +14, +57 and +89) were identified with the Virtual Footprint bacterial promoter analysis tool [35] . (B) Electrophoretic band shift of the amplified 251 bp f9 promoter and Taq I- Ssp I digested pBR322 DNA in the presence of various concentrations H-NS (0 μM, 1 μM, 2 μM, 3 μM, 4 μM and 10 μM). Similar to the bla promoter positive control, the signal of the f9 promoter diminishes as its gel migration is impeded by increasing H-NS concentrations, demonstrating that H-NS binds directly to the f9 promoter sequence. Migration of bla -negative pBR322 fragments was not affected by H-NS.

    Techniques Used: Sequencing, Binding Assay, Electrophoretic Mobility Shift Assay, Amplification, Positive Control, Migration

    2) Product Images from "Instability of the Octarepeat Region of the Human Prion Protein Gene"

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0026635

    Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.
    Figure Legend Snippet: Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Mutagenesis, Clone Assay, Produced, Sequencing

    3) Product Images from "Optimal conditions to use Pfu exo– DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols"

    Article Title: Optimal conditions to use Pfu exo– DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols

    Journal:

    doi:

    Comparison of the efficiency of Sequenase 2.0 and Pfu exo– with different amounts of DNA at the primer extension step of LMPCR. This autoradiogram shows a representative sequence that was produced using primer set X (primers X1, X2 and X3) from the FMR1 gene promoter. Every PCR amplification step was done using 3 U of Taq . LMPCR was performed on increasing quantities of purified genomic DNA treated with standard Maxam–Gilbert guanine cleavage reaction (global SSB frequency: 1 break/400 bases); 0.8, 1.6 and 2.4 µg of DNA was used (lanes 1–4, 5–8 and 9–12, respectively). Lanes 1, 5 and 9 show LMPCR protocols done using 5.2 U of Sequenase 2.0 (S) at the primer extension step; lanes 2–4, 6–8 and 10–12 show LMPCR protocols done using 0.5 (lanes 2, 6 and 10), 1.0 (lanes 3, 7 and 11) or 1.5 U (lanes 4, 8 and 12) of Pfu exo– (P) at the primer extension step. An asterisk indicates a band in the Sequenase 2.0 track that shows an intensity markedly different compared to the rest of the bands in the track.
    Figure Legend Snippet: Comparison of the efficiency of Sequenase 2.0 and Pfu exo– with different amounts of DNA at the primer extension step of LMPCR. This autoradiogram shows a representative sequence that was produced using primer set X (primers X1, X2 and X3) from the FMR1 gene promoter. Every PCR amplification step was done using 3 U of Taq . LMPCR was performed on increasing quantities of purified genomic DNA treated with standard Maxam–Gilbert guanine cleavage reaction (global SSB frequency: 1 break/400 bases); 0.8, 1.6 and 2.4 µg of DNA was used (lanes 1–4, 5–8 and 9–12, respectively). Lanes 1, 5 and 9 show LMPCR protocols done using 5.2 U of Sequenase 2.0 (S) at the primer extension step; lanes 2–4, 6–8 and 10–12 show LMPCR protocols done using 0.5 (lanes 2, 6 and 10), 1.0 (lanes 3, 7 and 11) or 1.5 U (lanes 4, 8 and 12) of Pfu exo– (P) at the primer extension step. An asterisk indicates a band in the Sequenase 2.0 track that shows an intensity markedly different compared to the rest of the bands in the track.

    Techniques Used: Sequencing, Produced, Polymerase Chain Reaction, Amplification, Purification

    4) Product Images from "Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases"

    Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases

    Journal: Biochemistry

    doi: 10.1021/bi2014807

    Thermostability of chimeric DNA polymerases ( see Materials and Methods ). Panel A shows the stability of Taq polymerase chimeras with truncated C-terminal TopoV tails at 100°C in the presence of 1 M potassium glutamate and 1 M betaine: (○) –TaqTopoC2; (●) -TaqTopoC1Δ; (◇) –TaqTopoC2Δ; (▽) – Taq polymerase; (◆) – Stoffel Fragment. Panel B demonstrates the effect of NaCl on the thermostability at 100°C: (○) – N-TopoTaq in 0.5 M NaCl; (●) – N-TopoTaq in 0.5 M NaCl and 1 M betaine; (▽) – Taq polymerase; (◆) – Stoffel Fragment. Panel C compares inactivation of large fragment of Bst DNA polymerase and Bst C2 chimera at different temperatures. 75°C: (▽) – Bst LF; (▼) – Bst C2, 85°C: (○) – Bst LF; (●) – Bst C2, 95°C: (◇) – Bst LF; (◆) – Bst C2.
    Figure Legend Snippet: Thermostability of chimeric DNA polymerases ( see Materials and Methods ). Panel A shows the stability of Taq polymerase chimeras with truncated C-terminal TopoV tails at 100°C in the presence of 1 M potassium glutamate and 1 M betaine: (○) –TaqTopoC2; (●) -TaqTopoC1Δ; (◇) –TaqTopoC2Δ; (▽) – Taq polymerase; (◆) – Stoffel Fragment. Panel B demonstrates the effect of NaCl on the thermostability at 100°C: (○) – N-TopoTaq in 0.5 M NaCl; (●) – N-TopoTaq in 0.5 M NaCl and 1 M betaine; (▽) – Taq polymerase; (◆) – Stoffel Fragment. Panel C compares inactivation of large fragment of Bst DNA polymerase and Bst C2 chimera at different temperatures. 75°C: (▽) – Bst LF; (▼) – Bst C2, 85°C: (○) – Bst LF; (●) – Bst C2, 95°C: (◇) – Bst LF; (◆) – Bst C2.

    Techniques Used:

    5) Product Images from "Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)"

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)

    Journal:

    doi:

    Scheme of Limes pathway. One round of Limes can be divided into three different parts: (i) preparation of PCR libraries, (ii) subtractive hybridization and ligation and (iii) purification and amplification of enriched tester sequences. The enriched material can be used for additional rounds of Limes. Initial PCR libraries were prepared by digestion of the subtraction partners with Tsp RI, by subsequent ligation of PCR-competent flanking sequences (N# and A#) to their ends with the Taq DNA ligase and amplification of the ligation products. The primers (S#) for the library amplification were identical to the respective N# primer apart from the lack of a Tsp RI recognition site at their 3′-end. In preparation for the subtractive hybridization, the tester library was digested with Tsp RI again and ligated with a new 5′ flanking N-primer. The driver was digested with Sal I. After denaturation and hybridization of tester to an excess of driver, the pool of perfectly matched tester/tester homohybrids containing the tester-specific sequences was ligated with 3′-biotinylated (closed circle) oligonucleotides and purified by separation with streptavidin-coupled beads (horseshoe-shaped magnet) from driver/driver as well as tester/driver hybrids and all kinds of partial hybrids. The purified sequences were amplified with tester-specific S-primers.
    Figure Legend Snippet: Scheme of Limes pathway. One round of Limes can be divided into three different parts: (i) preparation of PCR libraries, (ii) subtractive hybridization and ligation and (iii) purification and amplification of enriched tester sequences. The enriched material can be used for additional rounds of Limes. Initial PCR libraries were prepared by digestion of the subtraction partners with Tsp RI, by subsequent ligation of PCR-competent flanking sequences (N# and A#) to their ends with the Taq DNA ligase and amplification of the ligation products. The primers (S#) for the library amplification were identical to the respective N# primer apart from the lack of a Tsp RI recognition site at their 3′-end. In preparation for the subtractive hybridization, the tester library was digested with Tsp RI again and ligated with a new 5′ flanking N-primer. The driver was digested with Sal I. After denaturation and hybridization of tester to an excess of driver, the pool of perfectly matched tester/tester homohybrids containing the tester-specific sequences was ligated with 3′-biotinylated (closed circle) oligonucleotides and purified by separation with streptavidin-coupled beads (horseshoe-shaped magnet) from driver/driver as well as tester/driver hybrids and all kinds of partial hybrids. The purified sequences were amplified with tester-specific S-primers.

    Techniques Used: Polymerase Chain Reaction, Hybridization, Ligation, Purification, Amplification

    6) Product Images from "A Novel, Killed-Virus Nasal Vaccinia Virus Vaccine"

    Article Title: A Novel, Killed-Virus Nasal Vaccinia Virus Vaccine

    Journal:

    doi: 10.1128/CVI.00440-07

    Complete virus inactivation with NE. (A) PRA of VVWR . (B) Luciferase assay of VVWR-Luc . Luciferase activity is presented in relative light units (RLU). In standardized assays, the limit of virus detection was < 10 PFU for PRA and < 4 PFU for the luciferase assay. (C) PCR analysis of lung DNA. Lanes: 1, DNA size marker; 2, primers, no DNA; 3, no Taq ; 4, 105 /Fk lung DNA; 5 to 7, 105 /Fk/NE lung DNA; 8 to 10, 105 /NE lung DNA; 11, control (VV DNA mixed with lung DNA collected from tissue harvested 4 days after vaccination). Arrows indicate amplified viral template and primers. The limit of detection of this assay was < 0.001 ng viral DNA. (D) In vivo bioluminescence imaging of mice after i.n. infection with live VVWR-Luc and with 105 PFU of NE-killed virus. Circles visible in some images indicate the regions of interest used for the photon flux analysis (Table ).
    Figure Legend Snippet: Complete virus inactivation with NE. (A) PRA of VVWR . (B) Luciferase assay of VVWR-Luc . Luciferase activity is presented in relative light units (RLU). In standardized assays, the limit of virus detection was < 10 PFU for PRA and < 4 PFU for the luciferase assay. (C) PCR analysis of lung DNA. Lanes: 1, DNA size marker; 2, primers, no DNA; 3, no Taq ; 4, 105 /Fk lung DNA; 5 to 7, 105 /Fk/NE lung DNA; 8 to 10, 105 /NE lung DNA; 11, control (VV DNA mixed with lung DNA collected from tissue harvested 4 days after vaccination). Arrows indicate amplified viral template and primers. The limit of detection of this assay was < 0.001 ng viral DNA. (D) In vivo bioluminescence imaging of mice after i.n. infection with live VVWR-Luc and with 105 PFU of NE-killed virus. Circles visible in some images indicate the regions of interest used for the photon flux analysis (Table ).

    Techniques Used: Luciferase, Activity Assay, Polymerase Chain Reaction, Marker, Amplification, In Vivo, Imaging, Mouse Assay, Infection

    7) Product Images from "Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases"

    Article Title: Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases

    Journal:

    doi: 10.1073/pnas.202127199

    Schematic representation of chimeric polymerases. ( A ) Domain organization of Taq DNA polymerase in which helices are represented by cylinders and β-strands by arrows. This structure has been modeled by using two available x-ray structures of Taq polymerase (in “open” and “closed” conformations; for details, see Text , which is published as supporting information on the PNAS web site). The polymerase and inactive 3′-5′ exonuclease domains are colored gray, and the 5′-3-exonuclease domain is colored green. Several amino-terminal and carboxyl-terminal amino acids are colored magenta and red, respectively. The only HhH motif in the 5′-3′ exonuclease domain is colored gold. DNA strands are colored cyan and orange. ( B ) Cartoon illustration of chimeric constructs. HhH repeats of Topo V are colored yellow ( H – L ), orange-yellow gradient ( E – G ), orange ( C and D ), and rainbow ( A and B ). Arrows indicate cleavage positions that result in C1–C3 domains (in case of Topo V) and the Stoffel fragment (in case of Taq polymerase).
    Figure Legend Snippet: Schematic representation of chimeric polymerases. ( A ) Domain organization of Taq DNA polymerase in which helices are represented by cylinders and β-strands by arrows. This structure has been modeled by using two available x-ray structures of Taq polymerase (in “open” and “closed” conformations; for details, see Text , which is published as supporting information on the PNAS web site). The polymerase and inactive 3′-5′ exonuclease domains are colored gray, and the 5′-3-exonuclease domain is colored green. Several amino-terminal and carboxyl-terminal amino acids are colored magenta and red, respectively. The only HhH motif in the 5′-3′ exonuclease domain is colored gold. DNA strands are colored cyan and orange. ( B ) Cartoon illustration of chimeric constructs. HhH repeats of Topo V are colored yellow ( H – L ), orange-yellow gradient ( E – G ), orange ( C and D ), and rainbow ( A and B ). Arrows indicate cleavage positions that result in C1–C3 domains (in case of Topo V) and the Stoffel fragment (in case of Taq polymerase).

    Techniques Used: Construct

    8) Product Images from "A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning"

    Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning

    Journal: Journal of Reproduction & Infertility

    doi:

    Amplification of PERF15 gene fragment. Samples of 50 μl containing standard buffer, 200μM of each dNTP, 40 pM of each primer, 100 ng genomic DNA, 1.25 unit of Taq DNA polymerase to 30 cycles of PCR amplification. Each sample was resolved on a 1% agarose gel containing ethidium bromide. Lane 1(100 bp DNA marker), Lane 2 (PCR product).
    Figure Legend Snippet: Amplification of PERF15 gene fragment. Samples of 50 μl containing standard buffer, 200μM of each dNTP, 40 pM of each primer, 100 ng genomic DNA, 1.25 unit of Taq DNA polymerase to 30 cycles of PCR amplification. Each sample was resolved on a 1% agarose gel containing ethidium bromide. Lane 1(100 bp DNA marker), Lane 2 (PCR product).

    Techniques Used: Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Marker

    9) Product Images from "Instability of the Octarepeat Region of the Human Prion Protein Gene"

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0026635

    Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.
    Figure Legend Snippet: Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.

    Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Mutagenesis, Clone Assay, Produced, Sequencing

    10) Product Images from "Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)"

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)

    Journal:

    doi:

    Scheme of Limes pathway. One round of Limes can be divided into three different parts: (i) preparation of PCR libraries, (ii) subtractive hybridization and ligation and (iii) purification and amplification of enriched tester sequences. The enriched material can be used for additional rounds of Limes. Initial PCR libraries were prepared by digestion of the subtraction partners with Tsp RI, by subsequent ligation of PCR-competent flanking sequences (N# and A#) to their ends with the Taq DNA ligase and amplification of the ligation products. The primers (S#) for the library amplification were identical to the respective N# primer apart from the lack of a Tsp RI recognition site at their 3′-end. In preparation for the subtractive hybridization, the tester library was digested with Tsp RI again and ligated with a new 5′ flanking N-primer. The driver was digested with Sal I. After denaturation and hybridization of tester to an excess of driver, the pool of perfectly matched tester/tester homohybrids containing the tester-specific sequences was ligated with 3′-biotinylated (closed circle) oligonucleotides and purified by separation with streptavidin-coupled beads (horseshoe-shaped magnet) from driver/driver as well as tester/driver hybrids and all kinds of partial hybrids. The purified sequences were amplified with tester-specific S-primers.
    Figure Legend Snippet: Scheme of Limes pathway. One round of Limes can be divided into three different parts: (i) preparation of PCR libraries, (ii) subtractive hybridization and ligation and (iii) purification and amplification of enriched tester sequences. The enriched material can be used for additional rounds of Limes. Initial PCR libraries were prepared by digestion of the subtraction partners with Tsp RI, by subsequent ligation of PCR-competent flanking sequences (N# and A#) to their ends with the Taq DNA ligase and amplification of the ligation products. The primers (S#) for the library amplification were identical to the respective N# primer apart from the lack of a Tsp RI recognition site at their 3′-end. In preparation for the subtractive hybridization, the tester library was digested with Tsp RI again and ligated with a new 5′ flanking N-primer. The driver was digested with Sal I. After denaturation and hybridization of tester to an excess of driver, the pool of perfectly matched tester/tester homohybrids containing the tester-specific sequences was ligated with 3′-biotinylated (closed circle) oligonucleotides and purified by separation with streptavidin-coupled beads (horseshoe-shaped magnet) from driver/driver as well as tester/driver hybrids and all kinds of partial hybrids. The purified sequences were amplified with tester-specific S-primers.

    Techniques Used: Polymerase Chain Reaction, Hybridization, Ligation, Purification, Amplification

    11) Product Images from "Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results"

    Article Title: Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results

    Journal: Scientific Reports

    doi: 10.1038/srep08056

    Proportion of correct reads for the three genetic systems (simple: a single allele per individual, squares ; medium: two alleles, circles ; and complex: multiple alleles, triangles ) using standard PCR conditions ( open ) and modified PCR conditions to reduce chimera formation ( gray ). The size of the shape is indicative of the number of reads (see legend). All enzymes yielded at least 50% correct reads in the simplest system, mitochondrial DNA (Test 1; open squares). Some enzymes only worked for a given set of conditions (cycling conditions/genetic system). A group of enzymes consisting of Phusion, Gold and FastStart yielded a high proportion of correct reads cosistently accross all conditions. Others, such as Roche Taq, HotStar and Biotaq, yielded a low percent of correct reads for the more complex systems (MHC class I and MHC class II). Abbreviations as defined in Table 1 .
    Figure Legend Snippet: Proportion of correct reads for the three genetic systems (simple: a single allele per individual, squares ; medium: two alleles, circles ; and complex: multiple alleles, triangles ) using standard PCR conditions ( open ) and modified PCR conditions to reduce chimera formation ( gray ). The size of the shape is indicative of the number of reads (see legend). All enzymes yielded at least 50% correct reads in the simplest system, mitochondrial DNA (Test 1; open squares). Some enzymes only worked for a given set of conditions (cycling conditions/genetic system). A group of enzymes consisting of Phusion, Gold and FastStart yielded a high proportion of correct reads cosistently accross all conditions. Others, such as Roche Taq, HotStar and Biotaq, yielded a low percent of correct reads for the more complex systems (MHC class I and MHC class II). Abbreviations as defined in Table 1 .

    Techniques Used: Polymerase Chain Reaction, Modification

    Related Articles

    Clone Assay:

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The expected PCR products were 1265 bp for PrP-Oct5 and 1409 bp for PrP-Oct11a and PrP-Oct11b, which include 232 bp upstream of the ATG initiation codon, the PrP ORF (762 bp for PrP-Oct5 and 906 bp for PrP-Oct11a/b), and 271 bp downstream of the stop codon.

    Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases
    Article Snippet: Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. .. Taq DNA polymerase was purchased from Roche Applied Science (Indianapolis, IN), the Stoffel fragment of Taq DNA polymerase was obtained from Applied BioSystems (Foster City, CA), and Pfu DNA polymerase was from Stratagene Cloning Systems (La Jolla, CA). .. The recombinant large fragment of Bst DNA polymerase (IsoTherm™ DNA polymerase) was purchased from Epicentre Technologies (Madison, WI).

    Article Title: Reconstruction and topological characterization of the sigma factor regulatory network of Mycobacterium tuberculosis
    Article Snippet: Amplification was carried out using Taq DNA polymerase (Roche Applied Science, Indianapolis, IN). .. A ∼500-bp fragment containing upstream sequences and the initial 45 bp of the predicted open read frame was amplified by PCR from the chromosomal DNA of M. tuberculosis H37 Rv for each sigma factor (primer sequences used for PCR amplification are listed in ).

    Amplification:

    Article Title: A Novel, Killed-Virus Nasal Vaccinia Virus Vaccine
    Article Snippet: To optimize virus detection and increase sensitivity, cells and lung tissue were collected from 2 to 4 days after infection, when viral replication was highest in control animals. .. PCR amplification was performed with 10 μg of total cell or lung DNA by use of 0.5 μM of each primer, 0.2 mM of each deoxynucleoside triphosphate, 2.5 mM of MgCl2 , and 0.1 U/μl of Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN). .. The PCR products were analyzed by electrophoresis on a 1% agarose gel in Tris-borate buffer for electrophoresis and with ethidium bromide for DNA staining.

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: Similarly, genomic DNAs from two subjects with PrP-129MM and different 11-repeat mutant alleles were used to clone by PCR the insertion mutant human PrP ORF templates, named PrP-Oct11a and PrP-Oct11b, respectively ( ). .. The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The PCR cycles were: 94°C for 2 min; 94°C for 30 sec, 58.5°C for 30 sec and 72°C for 90 sec for 31 cycles; 72°C for 7 min. All primers used in this study were HPLC-purified (Invitrogen, CA, USA).

    Article Title: F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Gal?1-3GlcNAc-Containing Glycans
    Article Snippet: PCR was performed using Taq DNA polymerase according to manufacturer's instructions (Roche). .. PCR was performed using Taq DNA polymerase according to manufacturer's instructions (Roche).

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: The octarepeat mutation rates in PCR products or plasmid DNAs replicated in E.coli were measured as depicted in . .. To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA). .. The PCR products were treated with the Wizard PCR clean-up kit (Promega, WI, USA), ligated to pGEM-T (for Pwo-amplified products, A-tailing was done first with Taq DNA polymerase in PCR buffer with 0.2 mM dATP) and transformed into competent DH5α cells (New England Biolabs, MA, USA) on LB-agar plates with X-gal.

    Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
    Article Snippet: Paragraph title: Polymerase chain reaction (PCR) amplification of cDNA ... The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl .

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: The beads were washed at room temperature or indicated temperature with 50 µl of any one of the following solutions: once with B & W buffer (Dynal), 1× TE (10 mM Tris–HCl pH 7.5, 0.1 mM EDTA), 1× H2 O at 55°C for 10 min, 2× H2 O, 1× 0.1 M NaOH for 7 min, 2× 0.1 M NaOH, 1× B & W buffer and, finally, 1× TE. .. Beads (10 µl) resuspended in 20 µl H2 O were amplified as described except for the following modifications: the primer was S3 (5′-ctg aat gat aac gga ccg ag-3′), 1.5 U Taq DNA polymerase (Roche) were added and 35 PCR cycles were performed. .. Enriched tester sequences were digested with Tsp RI, purified and ligated to N4 (5′-tcg tgg agc aat tta cta gtc nnc a(g/c)t gnn-3′).

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: The mixture was gradually cooled to 45°C (temperature gradient: –0.5°C/min) and incubated overnight at 45°C with 40 U Taq DNA ligase (New England Biolabs). .. For the preparation of tester PCR libraries, ligation products were purified with the PCR Purification kit (Qiagen, Hilden, Germany) and aliquots of each DNA sample were amplified in a PTC 200 MultiCycler (MJ Research, Waltham, MA) as follows: 20 ng DNA was added to 150 pmol S1 (5′-gga aca ccc tat gaa cta gtg-3′), 1× Taq polymerase buffer, 200 µM of each deoxynucleotide triphosphate (dNTPs) and 2.5 U Taq DNA polymerase (buffer and enzyme: Roche Diagnostics, Mannheim, Germany) in a final volume of 100 µl, denatured for 45 s at 92°C, annealed for 90 s at 57°C and extended for 120 s at 72°C. .. Before the first of 25 cycles, template DNA was denatured for 3 min at 94°C and after the last cycle, the reaction mixture was incubated for 15 min at 72°C.

    Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases
    Article Snippet: Taq DNA polymerase was purchased from Roche Applied Science (Indianapolis, IN), the Stoffel fragment of Taq DNA polymerase was obtained from Applied BioSystems (Foster City, CA), and Pfu DNA polymerase was from Stratagene Cloning Systems (La Jolla, CA). .. Taq DNA polymerase was purchased from Roche Applied Science (Indianapolis, IN), the Stoffel fragment of Taq DNA polymerase was obtained from Applied BioSystems (Foster City, CA), and Pfu DNA polymerase was from Stratagene Cloning Systems (La Jolla, CA).

    Article Title: Reconstruction and topological characterization of the sigma factor regulatory network of Mycobacterium tuberculosis
    Article Snippet: Sigma factor genes were amplified from genomic DNA of M. tuberculosis H37 Rv by PCR using forward and reverse primers ( ). .. Amplification was carried out using Taq DNA polymerase (Roche Applied Science, Indianapolis, IN). .. Amplified DNA was digested with appropriate restriction endonucleases and cloned in the multiple cloning site 2 of pACYCDuet-1 to create a fusion with the plasmid-borne S-tag at the C-terminal end of the recombinant product.

    Article Title: rbFOX1/MBNL1 competition for CCUG RNA repeats binding contributes to myotonic dystrophy type 1/type 2 differences
    Article Snippet: Total RNA from cells or patient muscle was isolated by TriReagent (Molecular Research Center). cDNAs were generated using the Transcriptor High Fidelity cDNA synthesis kit (Roche Diagnostics) for quantification of mRNAs. .. PCR was performed with Taq polymerase (Roche), one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using the primer described below. .. The PCR products were precipitated, analyzed by electrophoresis on a 6.5% polyacrylamide gel, stained with ethidium bromide and quantified with a Typhoon scanner.

    Article Title: Nonclinical Exon Skipping Studies with 2′-O-Methyl Phosphorothioate Antisense Oligonucleotides in mdx and mdx-utrn−/− Mice Inspired by Clinical Trial Results
    Article Snippet: For cDNA synthesis, 400 ng of RNA was used in a 20 μL reaction with random hexamer primers and transcriptor reverse transcriptase (Roche Diagnostics) for 45 min at 42°C. .. For PCR analysis, 1.5 μL of cDNA was incubated with 1.25 U taq polymerase (Roche Diagnostics), 20 pM of primers (reverse primer in exon 24, forward primer in exon 22) and one time supertaq PCR buffer (Enzyme Technologies Ltd.) and amplified for 40 cycles each consisting of an incubation for 30 s at 94°C, 30 s at 60°C, and 30 s at 72°C. .. Exon skipping levels were semiquantitatively determined as the percentages of the total (wild type and skipped) product with the Agilent 2100 Bioanalyzer.

    Positive Control:

    Article Title: A Novel, Killed-Virus Nasal Vaccinia Virus Vaccine
    Article Snippet: PCR amplification was performed with 10 μg of total cell or lung DNA by use of 0.5 μM of each primer, 0.2 mM of each deoxynucleoside triphosphate, 2.5 mM of MgCl2 , and 0.1 U/μl of Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN). .. The PCR products were analyzed by electrophoresis on a 1% agarose gel in Tris-borate buffer for electrophoresis and with ethidium bromide for DNA staining.

    Synthesized:

    Article Title: A Novel, Killed-Virus Nasal Vaccinia Virus Vaccine
    Article Snippet: Primers for conserved regions of the hemagglutinin gene of orthopoxviruses (the 5′ region from the start codon to residue 19 and the 3′ region segment proximal to the stop codon) were synthesized by Integrated DNA Technologies (Coralville, IA). .. PCR amplification was performed with 10 μg of total cell or lung DNA by use of 0.5 μM of each primer, 0.2 mM of each deoxynucleoside triphosphate, 2.5 mM of MgCl2 , and 0.1 U/μl of Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN).

    Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
    Article Snippet: Forward primer hP1 (5' ATG GTT GAG CCC TTC TTG GGA AC 3') and reverse primer hP6 (5' TCA CAC CTT TTC GTA GAT TCT GGT G 3') were synthesized (VWR, Stockholm, Sweden). .. The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl .

    Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases
    Article Snippet: Taq DNA polymerase was purchased from Roche Applied Science (Indianapolis, IN), the Stoffel fragment of Taq DNA polymerase was obtained from Applied BioSystems (Foster City, CA), and Pfu DNA polymerase was from Stratagene Cloning Systems (La Jolla, CA). .. Taq DNA polymerase was purchased from Roche Applied Science (Indianapolis, IN), the Stoffel fragment of Taq DNA polymerase was obtained from Applied BioSystems (Foster City, CA), and Pfu DNA polymerase was from Stratagene Cloning Systems (La Jolla, CA).

    Blocking Assay:

    Article Title: Primer Extension Enrichment Reaction (PEER): a new subtraction method for identification of genetic differences between biological specimens
    Article Snippet: The best results, as measured by the absence of product in the reactions to which ddNTPs were added, were achieved with Thermo Sequenase™ ( ). .. We also observed blocking by Vent (exo-) polymerase (Promega) and Taq polymerase (Roche) when the ddNTP: dNTP ratio was 10:1, but Thermo Sequenase™ remained the enzyme of choice because it gave consistent results under all experimental conditions. .. We conducted initial proof-of-concept experiments using adapters designed to be compatible with the IIS enzyme BpmI.

    Incubation:

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: The ligation products were purified (Qiagen PCR Purification kit) and incubated with 1 mg of suspended streptavidin-coupled beads (Dynal, Hamburg, Germany) as the manufacturers have recommended. .. Beads (10 µl) resuspended in 20 µl H2 O were amplified as described except for the following modifications: the primer was S3 (5′-ctg aat gat aac gga ccg ag-3′), 1.5 U Taq DNA polymerase (Roche) were added and 35 PCR cycles were performed.

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: The mixture was gradually cooled to 45°C (temperature gradient: –0.5°C/min) and incubated overnight at 45°C with 40 U Taq DNA ligase (New England Biolabs). .. For the preparation of tester PCR libraries, ligation products were purified with the PCR Purification kit (Qiagen, Hilden, Germany) and aliquots of each DNA sample were amplified in a PTC 200 MultiCycler (MJ Research, Waltham, MA) as follows: 20 ng DNA was added to 150 pmol S1 (5′-gga aca ccc tat gaa cta gtg-3′), 1× Taq polymerase buffer, 200 µM of each deoxynucleotide triphosphate (dNTPs) and 2.5 U Taq DNA polymerase (buffer and enzyme: Roche Diagnostics, Mannheim, Germany) in a final volume of 100 µl, denatured for 45 s at 92°C, annealed for 90 s at 57°C and extended for 120 s at 72°C.

    Article Title: Nonclinical Exon Skipping Studies with 2′-O-Methyl Phosphorothioate Antisense Oligonucleotides in mdx and mdx-utrn−/− Mice Inspired by Clinical Trial Results
    Article Snippet: For cDNA synthesis, 400 ng of RNA was used in a 20 μL reaction with random hexamer primers and transcriptor reverse transcriptase (Roche Diagnostics) for 45 min at 42°C. .. For PCR analysis, 1.5 μL of cDNA was incubated with 1.25 U taq polymerase (Roche Diagnostics), 20 pM of primers (reverse primer in exon 24, forward primer in exon 22) and one time supertaq PCR buffer (Enzyme Technologies Ltd.) and amplified for 40 cycles each consisting of an incubation for 30 s at 94°C, 30 s at 60°C, and 30 s at 72°C. .. Exon skipping levels were semiquantitatively determined as the percentages of the total (wild type and skipped) product with the Agilent 2100 Bioanalyzer.

    Expressing:

    Article Title: Identification and characterization of naturally occurring splice variants of SAMHD1
    Article Snippet: Paragraph title: Analysis of the expression of SAMHD1 splice variants ... cDNA pools were generated from THP-1 cells treated with 100 nM PMA for 24 h and used as template for a PCR reaction using Taq polymerase (Roche) and the following primer sets: Δ14 primers consist of a forward primer (F14) located in exon 10 (5′ GAA GTT GGA AAT CTG TAT GAC ATG TTC CAC 3′ ) and a reverse primer (R14) spanning the junction of exons 13 and 15 (5′ CTC TGG CAG AAG TTG TGA AAC ATC 3′ ).

    Article Title: Reconstruction and topological characterization of the sigma factor regulatory network of Mycobacterium tuberculosis
    Article Snippet: Paragraph title: Sigma factor expression and reporter plasmid construction ... Amplification was carried out using Taq DNA polymerase (Roche Applied Science, Indianapolis, IN).

    Countercurrent Chromatography:

    Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
    Article Snippet: Forward primer hP1 (5' ATG GTT GAG CCC TTC TTG GGA AC 3') and reverse primer hP6 (5' TCA CAC CTT TTC GTA GAT TCT GGT G 3') were synthesized (VWR, Stockholm, Sweden). .. The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl .

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: The mixture was gradually cooled to 45°C (temperature gradient: –0.5°C/min) and incubated overnight at 45°C with 40 U Taq DNA ligase (New England Biolabs). .. For the preparation of tester PCR libraries, ligation products were purified with the PCR Purification kit (Qiagen, Hilden, Germany) and aliquots of each DNA sample were amplified in a PTC 200 MultiCycler (MJ Research, Waltham, MA) as follows: 20 ng DNA was added to 150 pmol S1 (5′-gga aca ccc tat gaa cta gtg-3′), 1× Taq polymerase buffer, 200 µM of each deoxynucleotide triphosphate (dNTPs) and 2.5 U Taq DNA polymerase (buffer and enzyme: Roche Diagnostics, Mannheim, Germany) in a final volume of 100 µl, denatured for 45 s at 92°C, annealed for 90 s at 57°C and extended for 120 s at 72°C. .. Before the first of 25 cycles, template DNA was denatured for 3 min at 94°C and after the last cycle, the reaction mixture was incubated for 15 min at 72°C.

    Ligation:

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: Paragraph title: Ligation-mediated enrichment of tester-specific sequences ... Beads (10 µl) resuspended in 20 µl H2 O were amplified as described except for the following modifications: the primer was S3 (5′-ctg aat gat aac gga ccg ag-3′), 1.5 U Taq DNA polymerase (Roche) were added and 35 PCR cycles were performed.

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: The mixture was gradually cooled to 45°C (temperature gradient: –0.5°C/min) and incubated overnight at 45°C with 40 U Taq DNA ligase (New England Biolabs). .. For the preparation of tester PCR libraries, ligation products were purified with the PCR Purification kit (Qiagen, Hilden, Germany) and aliquots of each DNA sample were amplified in a PTC 200 MultiCycler (MJ Research, Waltham, MA) as follows: 20 ng DNA was added to 150 pmol S1 (5′-gga aca ccc tat gaa cta gtg-3′), 1× Taq polymerase buffer, 200 µM of each deoxynucleotide triphosphate (dNTPs) and 2.5 U Taq DNA polymerase (buffer and enzyme: Roche Diagnostics, Mannheim, Germany) in a final volume of 100 µl, denatured for 45 s at 92°C, annealed for 90 s at 57°C and extended for 120 s at 72°C. .. Before the first of 25 cycles, template DNA was denatured for 3 min at 94°C and after the last cycle, the reaction mixture was incubated for 15 min at 72°C.

    Transferring:

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA). .. Direct colony PCR screening was conducted as follows.

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: Direct colony PCR screening was conducted as follows. .. Individual white and light blue colonies were directly picked by pipette tips into 20 µl of PCR reaction mix [200 µM dNTPs (each), 1×PCR buffer containing 1.5 mM MgCl2 , 0.4 µM each of primers, and 2 units of Taq DNA polymerase] and subjected to PCR with primers HP50F ( GTGACCTGGGCCTCTGCAAG ) and HP293R ( CTTACTCGGCTTGTTCCACT ) as follows: 94°C for 2 min; 94°C for 30 sec, 66.5°C for 30 sec and 72°C for 60 sec for 17 cycles; 72°C for 7 min. .. The PCR products were separated on 2% agarose gels containing ethidium bromide.

    Infection:

    Article Title: A Novel, Killed-Virus Nasal Vaccinia Virus Vaccine
    Article Snippet: PCR amplification was performed with 10 μg of total cell or lung DNA by use of 0.5 μM of each primer, 0.2 mM of each deoxynucleoside triphosphate, 2.5 mM of MgCl2 , and 0.1 U/μl of Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN). .. PCR amplification was performed with 10 μg of total cell or lung DNA by use of 0.5 μM of each primer, 0.2 mM of each deoxynucleoside triphosphate, 2.5 mM of MgCl2 , and 0.1 U/μl of Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN).

    Generated:

    Article Title: Identification and characterization of naturally occurring splice variants of SAMHD1
    Article Snippet: Images were acquired with a Plan-Apochromat 63x/1.4 oil immersion objective (Zeiss). .. cDNA pools were generated from THP-1 cells treated with 100 nM PMA for 24 h and used as template for a PCR reaction using Taq polymerase (Roche) and the following primer sets: Δ14 primers consist of a forward primer (F14) located in exon 10 (5′ GAA GTT GGA AAT CTG TAT GAC ATG TTC CAC 3′ ) and a reverse primer (R14) spanning the junction of exons 13 and 15 (5′ CTC TGG CAG AAG TTG TGA AAC ATC 3′ ). .. Δ8-9 primers consist of a forward primer (F8/9) spanning the junction of exons 7 and 10 (5′ CTT GAA TCA CCT GTC GAA GAT TCA TTG GAA G 3′ ) and a reverse primer R8/9 in exon 15 (5′ CTG CGG CTT GGT GAA ATT TCT GTC TG 3′ ).

    Article Title: rbFOX1/MBNL1 competition for CCUG RNA repeats binding contributes to myotonic dystrophy type 1/type 2 differences
    Article Snippet: Total RNA from cells or patient muscle was isolated by TriReagent (Molecular Research Center). cDNAs were generated using the Transcriptor High Fidelity cDNA synthesis kit (Roche Diagnostics) for quantification of mRNAs. .. PCR was performed with Taq polymerase (Roche), one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using the primer described below.

    Inhibition:

    Article Title: Effects of Amplification Facilitators on Diagnostic PCR in the Presence of Blood, Feces, and Meat
    Article Snippet: A similar effect was also observed when gp32 was added to reaction mixtures of rTth containing feces or meat. .. However, the ability of gp32 to reduce the inhibition of Taq DNA polymerase by feces was not reproducible when different batches of Taq DNA polymerase and buffers were used. .. For example, in the first run of experiments, Taq DNA polymerase amplified DNA in the presence of 2% (vol/vol) feces.

    DNA Sequencing:

    Article Title: F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Gal?1-3GlcNAc-Containing Glycans
    Article Snippet: PCR was performed using Taq DNA polymerase according to manufacturer's instructions (Roche). .. PCR was performed using Taq DNA polymerase according to manufacturer's instructions (Roche).

    Sequencing:

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The expected PCR products were 1265 bp for PrP-Oct5 and 1409 bp for PrP-Oct11a and PrP-Oct11b, which include 232 bp upstream of the ATG initiation codon, the PrP ORF (762 bp for PrP-Oct5 and 906 bp for PrP-Oct11a/b), and 271 bp downstream of the stop codon.

    Article Title: F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Gal?1-3GlcNAc-Containing Glycans
    Article Snippet: PCR was performed using Taq DNA polymerase according to manufacturer's instructions (Roche). .. PCR was performed using Taq DNA polymerase according to manufacturer's instructions (Roche).

    Binding Assay:

    Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
    Article Snippet: Two pairs of primers were designed to amplify human PERF15 cDNA based on the automated computational analysis of Homo sapiens similar to testis fatty-acid binding protein 9 (Gene bank, accession number XM_378035). .. The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl .

    Cellular Antioxidant Activity Assay:

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: For the preparation of tester PCR libraries, ligation products were purified with the PCR Purification kit (Qiagen, Hilden, Germany) and aliquots of each DNA sample were amplified in a PTC 200 MultiCycler (MJ Research, Waltham, MA) as follows: 20 ng DNA was added to 150 pmol S1 (5′-gga aca ccc tat gaa cta gtg-3′), 1× Taq polymerase buffer, 200 µM of each deoxynucleotide triphosphate (dNTPs) and 2.5 U Taq DNA polymerase (buffer and enzyme: Roche Diagnostics, Mannheim, Germany) in a final volume of 100 µl, denatured for 45 s at 92°C, annealed for 90 s at 57°C and extended for 120 s at 72°C. .. Before the first of 25 cycles, template DNA was denatured for 3 min at 94°C and after the last cycle, the reaction mixture was incubated for 15 min at 72°C.

    DNA Extraction:

    Article Title: F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Gal?1-3GlcNAc-Containing Glycans
    Article Snippet: Chromosomal DNA was purified using the GenomicPrep cell and tissue DNA isolation kit (GE Healthcare Life Sciences). .. PCR was performed using Taq DNA polymerase according to manufacturer's instructions (Roche).

    Mutagenesis:

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: Paragraph title: Preparation of PCR templates (PrP-Oct5 and PrP-Oct11a) and plasmids (pOct5, pOct11b) for mutation analysis ... The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA).

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: The octarepeat mutation rates in PCR products or plasmid DNAs replicated in E.coli were measured as depicted in . .. To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA). .. The PCR products were treated with the Wizard PCR clean-up kit (Promega, WI, USA), ligated to pGEM-T (for Pwo-amplified products, A-tailing was done first with Taq DNA polymerase in PCR buffer with 0.2 mM dATP) and transformed into competent DH5α cells (New England Biolabs, MA, USA) on LB-agar plates with X-gal.

    Isolation:

    Article Title: A Novel, Killed-Virus Nasal Vaccinia Virus Vaccine
    Article Snippet: DNA was isolated from Vero cells or from lung tissue homogenates with TriReagent according to the manufacturer's protocol (MRC, Cincinnati, OH). .. PCR amplification was performed with 10 μg of total cell or lung DNA by use of 0.5 μM of each primer, 0.2 mM of each deoxynucleoside triphosphate, 2.5 mM of MgCl2 , and 0.1 U/μl of Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN).

    Article Title: F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Gal?1-3GlcNAc-Containing Glycans
    Article Snippet: Plasmid DNA was isolated using the QIAprep Spin Miniprep kit (Qiagen). .. PCR was performed using Taq DNA polymerase according to manufacturer's instructions (Roche).

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: For cDNA preparation, the cells were dissolved in Trizol and total RNA was isolated as recommended by the manufacturer (Life Technologies, Karlsruhe, Germany). .. For the preparation of tester PCR libraries, ligation products were purified with the PCR Purification kit (Qiagen, Hilden, Germany) and aliquots of each DNA sample were amplified in a PTC 200 MultiCycler (MJ Research, Waltham, MA) as follows: 20 ng DNA was added to 150 pmol S1 (5′-gga aca ccc tat gaa cta gtg-3′), 1× Taq polymerase buffer, 200 µM of each deoxynucleotide triphosphate (dNTPs) and 2.5 U Taq DNA polymerase (buffer and enzyme: Roche Diagnostics, Mannheim, Germany) in a final volume of 100 µl, denatured for 45 s at 92°C, annealed for 90 s at 57°C and extended for 120 s at 72°C.

    Article Title: rbFOX1/MBNL1 competition for CCUG RNA repeats binding contributes to myotonic dystrophy type 1/type 2 differences
    Article Snippet: Total RNA from cells or patient muscle was isolated by TriReagent (Molecular Research Center). cDNAs were generated using the Transcriptor High Fidelity cDNA synthesis kit (Roche Diagnostics) for quantification of mRNAs. .. PCR was performed with Taq polymerase (Roche), one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using the primer described below.

    Article Title: Nonclinical Exon Skipping Studies with 2′-O-Methyl Phosphorothioate Antisense Oligonucleotides in mdx and mdx-utrn−/− Mice Inspired by Clinical Trial Results
    Article Snippet: Paragraph title: RNA isolation and exon skipping analysis ... For PCR analysis, 1.5 μL of cDNA was incubated with 1.25 U taq polymerase (Roche Diagnostics), 20 pM of primers (reverse primer in exon 24, forward primer in exon 22) and one time supertaq PCR buffer (Enzyme Technologies Ltd.) and amplified for 40 cycles each consisting of an incubation for 30 s at 94°C, 30 s at 60°C, and 30 s at 72°C.

    Subcloning:

    Article Title: Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases
    Article Snippet: All plasmids for chimeric proteins were constructed by common subcloning techniques, and the DNA polymerases were expressed and purified as described in Figs. 5–14 and Tables 1 and 2, which are published as supporting information on the PNAS web site, . .. Taq DNA polymerase and its Klen Taq variant were purchased from Roche Molecular Biochemicals and from GeneCraft (Munster, Germany), respectively.

    Polymerase Chain Reaction:

    Article Title: A Novel, Killed-Virus Nasal Vaccinia Virus Vaccine
    Article Snippet: To optimize virus detection and increase sensitivity, cells and lung tissue were collected from 2 to 4 days after infection, when viral replication was highest in control animals. .. PCR amplification was performed with 10 μg of total cell or lung DNA by use of 0.5 μM of each primer, 0.2 mM of each deoxynucleoside triphosphate, 2.5 mM of MgCl2 , and 0.1 U/μl of Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN). .. The PCR products were analyzed by electrophoresis on a 1% agarose gel in Tris-borate buffer for electrophoresis and with ethidium bromide for DNA staining.

    Article Title: Identification and characterization of naturally occurring splice variants of SAMHD1
    Article Snippet: Images were acquired with a Plan-Apochromat 63x/1.4 oil immersion objective (Zeiss). .. cDNA pools were generated from THP-1 cells treated with 100 nM PMA for 24 h and used as template for a PCR reaction using Taq polymerase (Roche) and the following primer sets: Δ14 primers consist of a forward primer (F14) located in exon 10 (5′ GAA GTT GGA AAT CTG TAT GAC ATG TTC CAC 3′ ) and a reverse primer (R14) spanning the junction of exons 13 and 15 (5′ CTC TGG CAG AAG TTG TGA AAC ATC 3′ ). .. Δ8-9 primers consist of a forward primer (F8/9) spanning the junction of exons 7 and 10 (5′ CTT GAA TCA CCT GTC GAA GAT TCA TTG GAA G 3′ ) and a reverse primer R8/9 in exon 15 (5′ CTG CGG CTT GGT GAA ATT TCT GTC TG 3′ ).

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: Similarly, genomic DNAs from two subjects with PrP-129MM and different 11-repeat mutant alleles were used to clone by PCR the insertion mutant human PrP ORF templates, named PrP-Oct11a and PrP-Oct11b, respectively ( ). .. The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The PCR cycles were: 94°C for 2 min; 94°C for 30 sec, 58.5°C for 30 sec and 72°C for 90 sec for 31 cycles; 72°C for 7 min. All primers used in this study were HPLC-purified (Invitrogen, CA, USA).

    Article Title: F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Gal?1-3GlcNAc-Containing Glycans
    Article Snippet: Chromosomal DNA was purified using the GenomicPrep cell and tissue DNA isolation kit (GE Healthcare Life Sciences). .. PCR was performed using Taq DNA polymerase according to manufacturer's instructions (Roche). .. Restriction endonucleases were used according to the manufacturer's specifications (New England Biolabs).

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: The octarepeat mutation rates in PCR products or plasmid DNAs replicated in E.coli were measured as depicted in . .. To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA). .. The PCR products were treated with the Wizard PCR clean-up kit (Promega, WI, USA), ligated to pGEM-T (for Pwo-amplified products, A-tailing was done first with Taq DNA polymerase in PCR buffer with 0.2 mM dATP) and transformed into competent DH5α cells (New England Biolabs, MA, USA) on LB-agar plates with X-gal.

    Article Title: Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results
    Article Snippet: Each DNA sample was quantified using a NanoDrop ND-1000 Spectrophotometer (NanoDrop Technologies, Inc., Wilmington, DE, USA), and the concentration was adjusted to 10 or 30 ng/μl for subsequent PCR amplifications. .. A range of 13 high fidelity, regular, economy and premium Taq polymerase enzymes were selected: Biotaq® (Bioline, London, UK), FastStart® High Fidelity PCR System (Roche, Mannheim, Germany), AmpliTaq Gold® (Applied Biosystems, Warrington, UK), HotStarTaq® DNA Polymerase (Qiagen, Hilden, Gernamy), Phusion® High Fidelity DNA Polymerase (Finnzymes, Espoo, Finland), Taq DNA Polymerase (Roche, Maylan, France), i-MaxTM II DNA Polymerase (iNtRON Biotechnology, Seongnam, Korea), KAPA HiFi™ (Kapa Biosystems, Boston, USA), OneTaq ™ DNA Polymerase (New England Biolabs, Hitchin, UK), Vent® DNA Polymerase (New England Biolabs, Hitchin, UK), Deep Vent® DNA Polymerase (New England Biolabs, Hitchin, UK), Pwo® DNA Polymerase (Roche, Maylan, France) and Velocity DNA Polymerase (Bioline, London, UK) (abbreviated names in ). .. The list price of these enzymes for the amount recommended for a single 10 μl reaction (not including tax, handling or shipping) ranged from €0.01 to €0.63 (Spain, June 2013).

    Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
    Article Snippet: Forward primer hP1 (5' ATG GTT GAG CCC TTC TTG GGA AC 3') and reverse primer hP6 (5' TCA CAC CTT TTC GTA GAT TCT GGT G 3') were synthesized (VWR, Stockholm, Sweden). .. The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl . .. The mixture was amplified in a thermocycler (Eppendorf, Germany) following an initial denaturation at 94°C for 4 minutes, 40 cycles of denaturation at 94°C for 30 seconds, annealing at 63.5°C for 30 seconds, elongation at 72°C for 1 minute and a final extension at 72°C for 10 minutes.

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: Direct colony PCR screening was conducted as follows. .. Individual white and light blue colonies were directly picked by pipette tips into 20 µl of PCR reaction mix [200 µM dNTPs (each), 1×PCR buffer containing 1.5 mM MgCl2 , 0.4 µM each of primers, and 2 units of Taq DNA polymerase] and subjected to PCR with primers HP50F ( GTGACCTGGGCCTCTGCAAG ) and HP293R ( CTTACTCGGCTTGTTCCACT ) as follows: 94°C for 2 min; 94°C for 30 sec, 66.5°C for 30 sec and 72°C for 60 sec for 17 cycles; 72°C for 7 min. .. The PCR products were separated on 2% agarose gels containing ethidium bromide.

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: The beads were washed at room temperature or indicated temperature with 50 µl of any one of the following solutions: once with B & W buffer (Dynal), 1× TE (10 mM Tris–HCl pH 7.5, 0.1 mM EDTA), 1× H2 O at 55°C for 10 min, 2× H2 O, 1× 0.1 M NaOH for 7 min, 2× 0.1 M NaOH, 1× B & W buffer and, finally, 1× TE. .. Beads (10 µl) resuspended in 20 µl H2 O were amplified as described except for the following modifications: the primer was S3 (5′-ctg aat gat aac gga ccg ag-3′), 1.5 U Taq DNA polymerase (Roche) were added and 35 PCR cycles were performed. .. Enriched tester sequences were digested with Tsp RI, purified and ligated to N4 (5′-tcg tgg agc aat tta cta gtc nnc a(g/c)t gnn-3′).

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: The mixture was gradually cooled to 45°C (temperature gradient: –0.5°C/min) and incubated overnight at 45°C with 40 U Taq DNA ligase (New England Biolabs). .. For the preparation of tester PCR libraries, ligation products were purified with the PCR Purification kit (Qiagen, Hilden, Germany) and aliquots of each DNA sample were amplified in a PTC 200 MultiCycler (MJ Research, Waltham, MA) as follows: 20 ng DNA was added to 150 pmol S1 (5′-gga aca ccc tat gaa cta gtg-3′), 1× Taq polymerase buffer, 200 µM of each deoxynucleotide triphosphate (dNTPs) and 2.5 U Taq DNA polymerase (buffer and enzyme: Roche Diagnostics, Mannheim, Germany) in a final volume of 100 µl, denatured for 45 s at 92°C, annealed for 90 s at 57°C and extended for 120 s at 72°C. .. Before the first of 25 cycles, template DNA was denatured for 3 min at 94°C and after the last cycle, the reaction mixture was incubated for 15 min at 72°C.

    Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases
    Article Snippet: Taq DNA polymerase was purchased from Roche Applied Science (Indianapolis, IN), the Stoffel fragment of Taq DNA polymerase was obtained from Applied BioSystems (Foster City, CA), and Pfu DNA polymerase was from Stratagene Cloning Systems (La Jolla, CA). .. Taq DNA polymerase was purchased from Roche Applied Science (Indianapolis, IN), the Stoffel fragment of Taq DNA polymerase was obtained from Applied BioSystems (Foster City, CA), and Pfu DNA polymerase was from Stratagene Cloning Systems (La Jolla, CA).

    Article Title: Reconstruction and topological characterization of the sigma factor regulatory network of Mycobacterium tuberculosis
    Article Snippet: Sigma factor genes were amplified from genomic DNA of M. tuberculosis H37 Rv by PCR using forward and reverse primers ( ). .. Amplification was carried out using Taq DNA polymerase (Roche Applied Science, Indianapolis, IN).

    Article Title: rbFOX1/MBNL1 competition for CCUG RNA repeats binding contributes to myotonic dystrophy type 1/type 2 differences
    Article Snippet: Total RNA from cells or patient muscle was isolated by TriReagent (Molecular Research Center). cDNAs were generated using the Transcriptor High Fidelity cDNA synthesis kit (Roche Diagnostics) for quantification of mRNAs. .. PCR was performed with Taq polymerase (Roche), one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using the primer described below. .. The PCR products were precipitated, analyzed by electrophoresis on a 6.5% polyacrylamide gel, stained with ethidium bromide and quantified with a Typhoon scanner.

    Article Title: Nonclinical Exon Skipping Studies with 2′-O-Methyl Phosphorothioate Antisense Oligonucleotides in mdx and mdx-utrn−/− Mice Inspired by Clinical Trial Results
    Article Snippet: For cDNA synthesis, 400 ng of RNA was used in a 20 μL reaction with random hexamer primers and transcriptor reverse transcriptase (Roche Diagnostics) for 45 min at 42°C. .. For PCR analysis, 1.5 μL of cDNA was incubated with 1.25 U taq polymerase (Roche Diagnostics), 20 pM of primers (reverse primer in exon 24, forward primer in exon 22) and one time supertaq PCR buffer (Enzyme Technologies Ltd.) and amplified for 40 cycles each consisting of an incubation for 30 s at 94°C, 30 s at 60°C, and 30 s at 72°C. .. Exon skipping levels were semiquantitatively determined as the percentages of the total (wild type and skipped) product with the Agilent 2100 Bioanalyzer.

    Size-exclusion Chromatography:

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA). .. Direct colony PCR screening was conducted as follows.

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: Direct colony PCR screening was conducted as follows. .. Individual white and light blue colonies were directly picked by pipette tips into 20 µl of PCR reaction mix [200 µM dNTPs (each), 1×PCR buffer containing 1.5 mM MgCl2 , 0.4 µM each of primers, and 2 units of Taq DNA polymerase] and subjected to PCR with primers HP50F ( GTGACCTGGGCCTCTGCAAG ) and HP293R ( CTTACTCGGCTTGTTCCACT ) as follows: 94°C for 2 min; 94°C for 30 sec, 66.5°C for 30 sec and 72°C for 60 sec for 17 cycles; 72°C for 7 min. .. The PCR products were separated on 2% agarose gels containing ethidium bromide.

    Purification:

    Article Title: A Novel, Killed-Virus Nasal Vaccinia Virus Vaccine
    Article Snippet: PCR amplification was performed with 10 μg of total cell or lung DNA by use of 0.5 μM of each primer, 0.2 mM of each deoxynucleoside triphosphate, 2.5 mM of MgCl2 , and 0.1 U/μl of Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN). .. The PCR products were analyzed by electrophoresis on a 1% agarose gel in Tris-borate buffer for electrophoresis and with ethidium bromide for DNA staining.

    Article Title: F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Gal?1-3GlcNAc-Containing Glycans
    Article Snippet: Chromosomal DNA was purified using the GenomicPrep cell and tissue DNA isolation kit (GE Healthcare Life Sciences). .. PCR was performed using Taq DNA polymerase according to manufacturer's instructions (Roche).

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: The ligation products were purified (Qiagen PCR Purification kit) and incubated with 1 mg of suspended streptavidin-coupled beads (Dynal, Hamburg, Germany) as the manufacturers have recommended. .. Beads (10 µl) resuspended in 20 µl H2 O were amplified as described except for the following modifications: the primer was S3 (5′-ctg aat gat aac gga ccg ag-3′), 1.5 U Taq DNA polymerase (Roche) were added and 35 PCR cycles were performed.

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)
    Article Snippet: The mixture was gradually cooled to 45°C (temperature gradient: –0.5°C/min) and incubated overnight at 45°C with 40 U Taq DNA ligase (New England Biolabs). .. For the preparation of tester PCR libraries, ligation products were purified with the PCR Purification kit (Qiagen, Hilden, Germany) and aliquots of each DNA sample were amplified in a PTC 200 MultiCycler (MJ Research, Waltham, MA) as follows: 20 ng DNA was added to 150 pmol S1 (5′-gga aca ccc tat gaa cta gtg-3′), 1× Taq polymerase buffer, 200 µM of each deoxynucleotide triphosphate (dNTPs) and 2.5 U Taq DNA polymerase (buffer and enzyme: Roche Diagnostics, Mannheim, Germany) in a final volume of 100 µl, denatured for 45 s at 92°C, annealed for 90 s at 57°C and extended for 120 s at 72°C. .. Before the first of 25 cycles, template DNA was denatured for 3 min at 94°C and after the last cycle, the reaction mixture was incubated for 15 min at 72°C.

    Article Title: Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases
    Article Snippet: All plasmids for chimeric proteins were constructed by common subcloning techniques, and the DNA polymerases were expressed and purified as described in Figs. 5–14 and Tables 1 and 2, which are published as supporting information on the PNAS web site, . .. Taq DNA polymerase and its Klen Taq variant were purchased from Roche Molecular Biochemicals and from GeneCraft (Munster, Germany), respectively.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: rbFOX1/MBNL1 competition for CCUG RNA repeats binding contributes to myotonic dystrophy type 1/type 2 differences
    Article Snippet: Paragraph title: RT-PCR analyses ... PCR was performed with Taq polymerase (Roche), one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using the primer described below.

    Construct:

    Article Title: Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases
    Article Snippet: All plasmids for chimeric proteins were constructed by common subcloning techniques, and the DNA polymerases were expressed and purified as described in Figs. 5–14 and Tables 1 and 2, which are published as supporting information on the PNAS web site, . .. Taq DNA polymerase and its Klen Taq variant were purchased from Roche Molecular Biochemicals and from GeneCraft (Munster, Germany), respectively.

    IA:

    Article Title: A Novel, Killed-Virus Nasal Vaccinia Virus Vaccine
    Article Snippet: Primers for conserved regions of the hemagglutinin gene of orthopoxviruses (the 5′ region from the start codon to residue 19 and the 3′ region segment proximal to the stop codon) were synthesized by Integrated DNA Technologies (Coralville, IA). .. PCR amplification was performed with 10 μg of total cell or lung DNA by use of 0.5 μM of each primer, 0.2 mM of each deoxynucleoside triphosphate, 2.5 mM of MgCl2 , and 0.1 U/μl of Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN).

    Plasmid Preparation:

    Article Title: Identification and characterization of naturally occurring splice variants of SAMHD1
    Article Snippet: cDNA pools were generated from THP-1 cells treated with 100 nM PMA for 24 h and used as template for a PCR reaction using Taq polymerase (Roche) and the following primer sets: Δ14 primers consist of a forward primer (F14) located in exon 10 (5′ GAA GTT GGA AAT CTG TAT GAC ATG TTC CAC 3′ ) and a reverse primer (R14) spanning the junction of exons 13 and 15 (5′ CTC TGG CAG AAG TTG TGA AAC ATC 3′ ). .. Δ8-9 primers consist of a forward primer (F8/9) spanning the junction of exons 7 and 10 (5′ CTT GAA TCA CCT GTC GAA GAT TCA TTG GAA G 3′ ) and a reverse primer R8/9 in exon 15 (5′ CTG CGG CTT GGT GAA ATT TCT GTC TG 3′ ).

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The expected PCR products were 1265 bp for PrP-Oct5 and 1409 bp for PrP-Oct11a and PrP-Oct11b, which include 232 bp upstream of the ATG initiation codon, the PrP ORF (762 bp for PrP-Oct5 and 906 bp for PrP-Oct11a/b), and 271 bp downstream of the stop codon.

    Article Title: F9 Fimbriae of Uropathogenic Escherichia coli Are Expressed at Low Temperature and Recognise Gal?1-3GlcNAc-Containing Glycans
    Article Snippet: Plasmid DNA was isolated using the QIAprep Spin Miniprep kit (Qiagen). .. PCR was performed using Taq DNA polymerase according to manufacturer's instructions (Roche).

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: Paragraph title: Mutation detection in PCR products or plasmid DNAs replicated in E.coli ... To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA).

    Article Title: Reconstruction and topological characterization of the sigma factor regulatory network of Mycobacterium tuberculosis
    Article Snippet: Paragraph title: Sigma factor expression and reporter plasmid construction ... Amplification was carried out using Taq DNA polymerase (Roche Applied Science, Indianapolis, IN).

    Software:

    Article Title: A Novel, Killed-Virus Nasal Vaccinia Virus Vaccine
    Article Snippet: PCR amplification was performed with 10 μg of total cell or lung DNA by use of 0.5 μM of each primer, 0.2 mM of each deoxynucleoside triphosphate, 2.5 mM of MgCl2 , and 0.1 U/μl of Taq DNA polymerase (Roche Molecular Biochemicals, Indianapolis, IN). .. The purified VV DNA (1 ng) mixed with lung DNA served as a positive control.

    Recombinant:

    Article Title: Reconstruction and topological characterization of the sigma factor regulatory network of Mycobacterium tuberculosis
    Article Snippet: Amplification was carried out using Taq DNA polymerase (Roche Applied Science, Indianapolis, IN). .. Amplified DNA was digested with appropriate restriction endonucleases and cloned in the multiple cloning site 2 of pACYCDuet-1 to create a fusion with the plasmid-borne S-tag at the C-terminal end of the recombinant product.

    Random Hexamer Labeling:

    Article Title: Nonclinical Exon Skipping Studies with 2′-O-Methyl Phosphorothioate Antisense Oligonucleotides in mdx and mdx-utrn−/− Mice Inspired by Clinical Trial Results
    Article Snippet: For cDNA synthesis, 400 ng of RNA was used in a 20 μL reaction with random hexamer primers and transcriptor reverse transcriptase (Roche Diagnostics) for 45 min at 42°C. .. For PCR analysis, 1.5 μL of cDNA was incubated with 1.25 U taq polymerase (Roche Diagnostics), 20 pM of primers (reverse primer in exon 24, forward primer in exon 22) and one time supertaq PCR buffer (Enzyme Technologies Ltd.) and amplified for 40 cycles each consisting of an incubation for 30 s at 94°C, 30 s at 60°C, and 30 s at 72°C.

    Spectrophotometry:

    Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
    Article Snippet: The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The PCR cycles were: 94°C for 2 min; 94°C for 30 sec, 58.5°C for 30 sec and 72°C for 90 sec for 31 cycles; 72°C for 7 min. All primers used in this study were HPLC-purified (Invitrogen, CA, USA).

    CTG Assay:

    Article Title: Identification and characterization of naturally occurring splice variants of SAMHD1
    Article Snippet: Images were acquired with a Plan-Apochromat 63x/1.4 oil immersion objective (Zeiss). .. cDNA pools were generated from THP-1 cells treated with 100 nM PMA for 24 h and used as template for a PCR reaction using Taq polymerase (Roche) and the following primer sets: Δ14 primers consist of a forward primer (F14) located in exon 10 (5′ GAA GTT GGA AAT CTG TAT GAC ATG TTC CAC 3′ ) and a reverse primer (R14) spanning the junction of exons 13 and 15 (5′ CTC TGG CAG AAG TTG TGA AAC ATC 3′ ). .. Δ8-9 primers consist of a forward primer (F8/9) spanning the junction of exons 7 and 10 (5′ CTT GAA TCA CCT GTC GAA GAT TCA TTG GAA G 3′ ) and a reverse primer R8/9 in exon 15 (5′ CTG CGG CTT GGT GAA ATT TCT GTC TG 3′ ).

    Variant Assay:

    Article Title: Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases
    Article Snippet: All plasmids for chimeric proteins were constructed by common subcloning techniques, and the DNA polymerases were expressed and purified as described in Figs. 5–14 and Tables 1 and 2, which are published as supporting information on the PNAS web site, . .. Taq DNA polymerase and its Klen Taq variant were purchased from Roche Molecular Biochemicals and from GeneCraft (Munster, Germany), respectively. .. The Stoffel fragment was obtained from Applied BioSystems, and Pfu DNA polymerase was obtained from Stratagene.

    other:

    Article Title: Optimal conditions to use Pfu exo– DNA polymerase for highly efficient ligation-mediated polymerase chain reaction protocols
    Article Snippet: Taq DNA polymerase and T4 DNA ligase were purchased from Roche Molecular Biochemicals (Laval, Canada).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Roche faststart taq dna polymerase
    Reduction of PCR Inhibition by Increased Amounts of <t>Taq</t> Polymerase. qPCR with HMW and template <t>DNA</t> from FFPE tissue using different amounts of Taq polymerase. PCR-amplification of increasing amounts of genomic HMW template DNA (2.5-3,840 ng) using (A) 2 U Taq , (B) 4 U Taq and PCR-amplification of template DNA from FFPE tissue using (C) 2 U Taq , (D) 4 U Taq . Shown are the mean values (± standard deviations) from triplicate measurements.
    Faststart Taq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 300 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart taq dna polymerase/product/Roche
    Average 99 stars, based on 300 article reviews
    Price from $9.99 to $1999.99
    faststart taq dna polymerase - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    90
    Roche pcr mixture
    Circadian oscillation profile of mPer2 in wildtype and GSK3β (-/-) ; GSK3α (flox/-) MEFs . The transcriptional profile of mPer2 and GAPDH were analyzed by reverse-transcription <t>PCR</t> in the A6(wt) and c2.1(3/4 DKO) cell lines, as depicted in panels A and B , respectively. Protein samples harvested from whole-cell lysates in parallel to RNA samples harvested for transcriptional analysis at corresponding time points were analyzed by SDS-PAGE electrophoresis. Western blot analysis of these protein samples for total-GSK3 and GAPDH is depicted in Panel C for TPs 0, 4, 12, 24, 30, and 36. Panels D and E are graphical depictions of relative levels of mPer2 expression in A6 and c2.1 based on three separately harvested A6 RNA sample sets and six c2.1 RNA sample sets. Relative values derived from densitometric measurements of PCR-amplified <t>DNA</t> bands are expressed as percentage values of mPer2 at TP1.
    Pcr Mixture, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mixture/product/Roche
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    pcr mixture - by Bioz Stars, 2019-12
    90/100 stars
      Buy from Supplier

    Image Search Results


    Reduction of PCR Inhibition by Increased Amounts of Taq Polymerase. qPCR with HMW and template DNA from FFPE tissue using different amounts of Taq polymerase. PCR-amplification of increasing amounts of genomic HMW template DNA (2.5-3,840 ng) using (A) 2 U Taq , (B) 4 U Taq and PCR-amplification of template DNA from FFPE tissue using (C) 2 U Taq , (D) 4 U Taq . Shown are the mean values (± standard deviations) from triplicate measurements.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Reduction of PCR Inhibition by Increased Amounts of Taq Polymerase. qPCR with HMW and template DNA from FFPE tissue using different amounts of Taq polymerase. PCR-amplification of increasing amounts of genomic HMW template DNA (2.5-3,840 ng) using (A) 2 U Taq , (B) 4 U Taq and PCR-amplification of template DNA from FFPE tissue using (C) 2 U Taq , (D) 4 U Taq . Shown are the mean values (± standard deviations) from triplicate measurements.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Polymerase Chain Reaction, Inhibition, Real-time Polymerase Chain Reaction, Formalin-fixed Paraffin-Embedded, Amplification

    Inhibitory Effect of Template DNA from FFPE Tissues on PCR Performance. qPCR with 1 µg of genomic HMW template DNA and increasing amounts (60-1,440 ng) of spiked genomic template DNA from FFPE tissue Genomic DNA from FFPE tissue was treated beforehand with active DNase I (+) and heat-inactivated DNase I (-), respectively. qPCR was performed using a 150-bp fragment and 1 U Taq polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Inhibitory Effect of Template DNA from FFPE Tissues on PCR Performance. qPCR with 1 µg of genomic HMW template DNA and increasing amounts (60-1,440 ng) of spiked genomic template DNA from FFPE tissue Genomic DNA from FFPE tissue was treated beforehand with active DNase I (+) and heat-inactivated DNase I (-), respectively. qPCR was performed using a 150-bp fragment and 1 U Taq polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Formalin-fixed Paraffin-Embedded, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    Successful PCR Amplification of Larger Fragments by Overcoming PCR Inhibition. PCR-amplified DNA fragments of different sizes within the PITX2 gene locus using template DNA from FFPE tissue. The PCR was carried out using 1 µg (upper and middle panel) and 5 ng (lower panel) template DNA in the presence of 1 U and 4 U Taq DNA polymerase, respectively.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Successful PCR Amplification of Larger Fragments by Overcoming PCR Inhibition. PCR-amplified DNA fragments of different sizes within the PITX2 gene locus using template DNA from FFPE tissue. The PCR was carried out using 1 µg (upper and middle panel) and 5 ng (lower panel) template DNA in the presence of 1 U and 4 U Taq DNA polymerase, respectively.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Polymerase Chain Reaction, Amplification, Inhibition, Formalin-fixed Paraffin-Embedded

    Degradation of DNA from FFPE Tissues and its Effect on PCR Amplification of Amplicons with Different Sizes. Analysis of DNA integrity of genomic and bisulfite-converted DNA from unfixed and FFPE tissues by means of (A) agarose gel electrophoresis and (B) end-point PCR using PCR fragments of different sizes within the PITX2 gene locus. (C) qPCR results applying increasing amounts (2.5–3,840 ng) of genomic template DNA from unfixed and (D) from FFPE tissue. Shown are the mean values (± standard deviations) from triplicate measurements. Each PCR was performed with 1 U Taq polymerase. DNA from unfixed specimens is considered high molecular weight (HMW) DNA.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Degradation of DNA from FFPE Tissues and its Effect on PCR Amplification of Amplicons with Different Sizes. Analysis of DNA integrity of genomic and bisulfite-converted DNA from unfixed and FFPE tissues by means of (A) agarose gel electrophoresis and (B) end-point PCR using PCR fragments of different sizes within the PITX2 gene locus. (C) qPCR results applying increasing amounts (2.5–3,840 ng) of genomic template DNA from unfixed and (D) from FFPE tissue. Shown are the mean values (± standard deviations) from triplicate measurements. Each PCR was performed with 1 U Taq polymerase. DNA from unfixed specimens is considered high molecular weight (HMW) DNA.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Formalin-fixed Paraffin-Embedded, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Electrophoresis, Real-time Polymerase Chain Reaction, Molecular Weight

    Transferability of the Findings to a qPCR Targeting an Alternative Genomic Locus. qPCR applying a 200-bp PCR fragment within the ACTB gene locus. Amplification with (A) HMW DNA from unfixed tissue and (B) DNA from FFPE tissue (2.5 ng to 3,840 ng) in the presence of 1 U and 4 U Taq DNA polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Transferability of the Findings to a qPCR Targeting an Alternative Genomic Locus. qPCR applying a 200-bp PCR fragment within the ACTB gene locus. Amplification with (A) HMW DNA from unfixed tissue and (B) DNA from FFPE tissue (2.5 ng to 3,840 ng) in the presence of 1 U and 4 U Taq DNA polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Formalin-fixed Paraffin-Embedded

    PCR Inhibition by Bisulfite-Converted Template DNA from FFPE Tissues. (A) qPCR–amplification of different amounts (10–3,840 ng) of bisulfite-converted template DNA from FFPE tissue using a 129-bp PCR fragment within the ACTB gene locus. 1 U and 4 U Taq polymerase were used for qPCR. Shown are the mean values (± standard deviations) from triplicate measurements. (B) PCR amplification of the specific PCR product was confirmed by agarose gel electrophoresis using 1 U (upper panel) and 4 U (lower panel) Taq polymerase.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: PCR Inhibition by Bisulfite-Converted Template DNA from FFPE Tissues. (A) qPCR–amplification of different amounts (10–3,840 ng) of bisulfite-converted template DNA from FFPE tissue using a 129-bp PCR fragment within the ACTB gene locus. 1 U and 4 U Taq polymerase were used for qPCR. Shown are the mean values (± standard deviations) from triplicate measurements. (B) PCR amplification of the specific PCR product was confirmed by agarose gel electrophoresis using 1 U (upper panel) and 4 U (lower panel) Taq polymerase.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Polymerase Chain Reaction, Inhibition, Formalin-fixed Paraffin-Embedded, Real-time Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Electrophoresis

    PCR Inhibition by Template DNA from FFPE Tissues with Regard to PCR Conditions (dNTP Concentration and Thermal Cycling Profile). Shown are qPCR results applying a 200-bp fragment within the PITX2 gene locus using template DNA from FFPE tissue (80-1,920 ng) in the presence of 1 U Taq polymerase. (A) dNTP concentrations and (B) annealing and elongation times were varied. Shown are the mean values (± standard deviations) from triplicate measurements.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: PCR Inhibition by Template DNA from FFPE Tissues with Regard to PCR Conditions (dNTP Concentration and Thermal Cycling Profile). Shown are qPCR results applying a 200-bp fragment within the PITX2 gene locus using template DNA from FFPE tissue (80-1,920 ng) in the presence of 1 U Taq polymerase. (A) dNTP concentrations and (B) annealing and elongation times were varied. Shown are the mean values (± standard deviations) from triplicate measurements.

    Article Snippet: Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Polymerase Chain Reaction, Inhibition, Formalin-fixed Paraffin-Embedded, Concentration Assay, Real-time Polymerase Chain Reaction

    PTPN11 mutations identified in MC participants. (A) Schematic of the exonic structure of PTPN11 (above) and the corresponding protein structure of SHP2 (below). The locations of mutations that were identified in MC are indicated with black lines. Predicted protein changes are indicated for the nonsense (blue) and frameshift (red) mutations, while the cDNA designation is indicated for the splice-site mutations (green). (B) Log2 values of the number of Illumina reads obtained per 50 bp window in participant S, divided by the average number of reads obtained in other participants whose DNA was captured simultaneously using the second capture array. Shown are all 50 bp windows spanning regions of PTPN11 targeted by the array, with the corresponding exonic structure of PTPN11 shown below. The red bar indicates a region spanning exon 7, in which the average log2 value is approximately −1, suggesting a heterozygous deletion. PCR amplification and sequencing of the breakpoint, using primers on either end of the deletion, indicate that 14,629 bp of sequence have been deleted and replaced with a single CA dinucleotide.

    Journal: PLoS Genetics

    Article Title: Loss-of-Function Mutations in PTPN11 Cause Metachondromatosis, but Not Ollier Disease or Maffucci Syndrome

    doi: 10.1371/journal.pgen.1002050

    Figure Lengend Snippet: PTPN11 mutations identified in MC participants. (A) Schematic of the exonic structure of PTPN11 (above) and the corresponding protein structure of SHP2 (below). The locations of mutations that were identified in MC are indicated with black lines. Predicted protein changes are indicated for the nonsense (blue) and frameshift (red) mutations, while the cDNA designation is indicated for the splice-site mutations (green). (B) Log2 values of the number of Illumina reads obtained per 50 bp window in participant S, divided by the average number of reads obtained in other participants whose DNA was captured simultaneously using the second capture array. Shown are all 50 bp windows spanning regions of PTPN11 targeted by the array, with the corresponding exonic structure of PTPN11 shown below. The red bar indicates a region spanning exon 7, in which the average log2 value is approximately −1, suggesting a heterozygous deletion. PCR amplification and sequencing of the breakpoint, using primers on either end of the deletion, indicate that 14,629 bp of sequence have been deleted and replaced with a single CA dinucleotide.

    Article Snippet: Libraries used for hybridization to the first capture array were amplified according to two strategies: 3 µl amplified for 18 cycles in four 50 µl PCR reactions (Phusion High-Fidelity DNA polymerase, Finnzymes), or 2 µl amplified for 11 cycles in one 50 µl PCR reaction that was then purified and amplified for 17 cycles in ten 50 µl PCR reactions (FastStart Taq DNA polymerase, Roche).

    Techniques: Polymerase Chain Reaction, Amplification, Sequencing

    Loss of the wild-type PTPN11 allele in the cartilage of two exostoses. (A) Electropherograms of PCR amplified template DNA that had been extracted from whole blood, a section of an exostosis, or the cartilage core of the same exostosis. Exostoses were available from patients A-IV-5 and A-IV-8. The site of the 5 bp deletion in exon 4 of PTPN11 in both patients is indicated with a box. Note that that the heights of the peaks corresponding to the mutant sequence are markedly reduced in amplimers from the cartilage-core compared to amplimers from blood or from a section that contains cartilage, bone and fibrous tissue. This is consistent with loss-of-heterozygosity in the cartilage component of the exostoses. (B) Electropherograms of PCR amplified template DNA extracted from blood from participants A-III-9, A-III-10 and A-IV-5, as well as DNA extracted from the cartilage core of the exostosis from participant A-IV-5 shown in (A). Blood DNA electropherograms indicate that participants A-III-9 and A-IV-10 are heterozygous at a position (asterisk) in intron 11 of PTPN11 . This is the site of a known common polymorphism (rs41279092). Exostosis cartilage DNA electropherograms have a reduced adenine peak height at this position. This suggests that the wild-type PTPN11 allele inherited from the unaffected parent (A-III-9), which carries an adenine at this position, has been lost in cells that contribute to formation of the exostosis' cartilage core.

    Journal: PLoS Genetics

    Article Title: Loss-of-Function Mutations in PTPN11 Cause Metachondromatosis, but Not Ollier Disease or Maffucci Syndrome

    doi: 10.1371/journal.pgen.1002050

    Figure Lengend Snippet: Loss of the wild-type PTPN11 allele in the cartilage of two exostoses. (A) Electropherograms of PCR amplified template DNA that had been extracted from whole blood, a section of an exostosis, or the cartilage core of the same exostosis. Exostoses were available from patients A-IV-5 and A-IV-8. The site of the 5 bp deletion in exon 4 of PTPN11 in both patients is indicated with a box. Note that that the heights of the peaks corresponding to the mutant sequence are markedly reduced in amplimers from the cartilage-core compared to amplimers from blood or from a section that contains cartilage, bone and fibrous tissue. This is consistent with loss-of-heterozygosity in the cartilage component of the exostoses. (B) Electropherograms of PCR amplified template DNA extracted from blood from participants A-III-9, A-III-10 and A-IV-5, as well as DNA extracted from the cartilage core of the exostosis from participant A-IV-5 shown in (A). Blood DNA electropherograms indicate that participants A-III-9 and A-IV-10 are heterozygous at a position (asterisk) in intron 11 of PTPN11 . This is the site of a known common polymorphism (rs41279092). Exostosis cartilage DNA electropherograms have a reduced adenine peak height at this position. This suggests that the wild-type PTPN11 allele inherited from the unaffected parent (A-III-9), which carries an adenine at this position, has been lost in cells that contribute to formation of the exostosis' cartilage core.

    Article Snippet: Libraries used for hybridization to the first capture array were amplified according to two strategies: 3 µl amplified for 18 cycles in four 50 µl PCR reactions (Phusion High-Fidelity DNA polymerase, Finnzymes), or 2 µl amplified for 11 cycles in one 50 µl PCR reaction that was then purified and amplified for 17 cycles in ten 50 µl PCR reactions (FastStart Taq DNA polymerase, Roche).

    Techniques: Polymerase Chain Reaction, Amplification, Mutagenesis, Sequencing

    Generation of the notochord-specific Cre mouse line. (A) Targeting strategy used to generate the Noto cre/+ line. An internal ribosome entry site-nuclear localization signal-Cre recombinase (IRES-NLS-CRE) cassette replaced exon 2 of the Noto locus. Positively targeted ES cell clones were confirmed by Southern blot using an external 5′ probe; the wild-type allele is 15 kb and the targeted allele is 10 kb. Representative positive ‘neo-in’ clones are shown. The positions of genotyping PCR primers for wild-type and ‘neo-out’ mice are also shown. (B) Targeting of the Noto locus does not affect its temporal regulation, as demonstrated by whole mount in situ hybridization at E11.5. Noto expression is detected in both Noto cre/+ and wild-type ( Noto +/+ ) littermate control embryos, localized to the posterior node in the tail region (insert and arrows). (C) Noto expression is downregulated after E12.5, confirmed by in situ hybridization at E15.5 showing no detectable Noto expression. (D) Heterozygous inactivation of Noto does not disrupt notochord formation or IVD development. IVD formation and tissue architecture was examined in Noto cre/+ mice and wild-type ( Noto +/+ ) littermate controls using Safranin-O/Fast Green staining on paraffin embedded sections at P21. Enlarged view of the NP and inner AF tissues are shown in the right-hand box. Scale bars: 500 μm for 100× images and 50 μm for 400× images.

    Journal: Disease Models & Mechanisms

    Article Title: Tracing notochord-derived cells using a Noto-cre mouse: implications for intervertebral disc development

    doi: 10.1242/dmm.008128

    Figure Lengend Snippet: Generation of the notochord-specific Cre mouse line. (A) Targeting strategy used to generate the Noto cre/+ line. An internal ribosome entry site-nuclear localization signal-Cre recombinase (IRES-NLS-CRE) cassette replaced exon 2 of the Noto locus. Positively targeted ES cell clones were confirmed by Southern blot using an external 5′ probe; the wild-type allele is 15 kb and the targeted allele is 10 kb. Representative positive ‘neo-in’ clones are shown. The positions of genotyping PCR primers for wild-type and ‘neo-out’ mice are also shown. (B) Targeting of the Noto locus does not affect its temporal regulation, as demonstrated by whole mount in situ hybridization at E11.5. Noto expression is detected in both Noto cre/+ and wild-type ( Noto +/+ ) littermate control embryos, localized to the posterior node in the tail region (insert and arrows). (C) Noto expression is downregulated after E12.5, confirmed by in situ hybridization at E15.5 showing no detectable Noto expression. (D) Heterozygous inactivation of Noto does not disrupt notochord formation or IVD development. IVD formation and tissue architecture was examined in Noto cre/+ mice and wild-type ( Noto +/+ ) littermate controls using Safranin-O/Fast Green staining on paraffin embedded sections at P21. Enlarged view of the NP and inner AF tissues are shown in the right-hand box. Scale bars: 500 μm for 100× images and 50 μm for 400× images.

    Article Snippet: To generate the Noto-cre knock-in mouse, the Noto targeting vector was amplified using long-range PCR (Roche HiFi Taq polymerase) from a BAC clone that contained the Noto locus (RP23-417O15; library derived from female C57BL/6J tissues).

    Techniques: Clone Assay, Southern Blot, Polymerase Chain Reaction, Mouse Assay, In Situ, Hybridization, Expressing, Staining

    Circadian oscillation profile of mPer2 in wildtype and GSK3β (-/-) ; GSK3α (flox/-) MEFs . The transcriptional profile of mPer2 and GAPDH were analyzed by reverse-transcription PCR in the A6(wt) and c2.1(3/4 DKO) cell lines, as depicted in panels A and B , respectively. Protein samples harvested from whole-cell lysates in parallel to RNA samples harvested for transcriptional analysis at corresponding time points were analyzed by SDS-PAGE electrophoresis. Western blot analysis of these protein samples for total-GSK3 and GAPDH is depicted in Panel C for TPs 0, 4, 12, 24, 30, and 36. Panels D and E are graphical depictions of relative levels of mPer2 expression in A6 and c2.1 based on three separately harvested A6 RNA sample sets and six c2.1 RNA sample sets. Relative values derived from densitometric measurements of PCR-amplified DNA bands are expressed as percentage values of mPer2 at TP1.

    Journal: Journal of Circadian Rhythms

    Article Title: Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium

    doi: 10.1186/1740-3391-5-3

    Figure Lengend Snippet: Circadian oscillation profile of mPer2 in wildtype and GSK3β (-/-) ; GSK3α (flox/-) MEFs . The transcriptional profile of mPer2 and GAPDH were analyzed by reverse-transcription PCR in the A6(wt) and c2.1(3/4 DKO) cell lines, as depicted in panels A and B , respectively. Protein samples harvested from whole-cell lysates in parallel to RNA samples harvested for transcriptional analysis at corresponding time points were analyzed by SDS-PAGE electrophoresis. Western blot analysis of these protein samples for total-GSK3 and GAPDH is depicted in Panel C for TPs 0, 4, 12, 24, 30, and 36. Panels D and E are graphical depictions of relative levels of mPer2 expression in A6 and c2.1 based on three separately harvested A6 RNA sample sets and six c2.1 RNA sample sets. Relative values derived from densitometric measurements of PCR-amplified DNA bands are expressed as percentage values of mPer2 at TP1.

    Article Snippet: For all transcriptional profiles, PCR reactions for all time-points were prepared simultaneously, where 5 μl of cDNA was added to 45 μl of PCR mixture [10× reaction buffer, 0.5 unit Taq DNA polymerase (Roche), 0.2 mM dNTPs, and 50 pmol of primers].

    Techniques: Polymerase Chain Reaction, SDS Page, Electrophoresis, Western Blot, Expressing, Derivative Assay, Amplification

    Circadian oscillation profiles of clock genes in wild-type and GSK3β -/- MEFs . A , wild type and B , GSK3β -/- cells were synchronized, harvested, processed, and the gene products were amplified as described in the Materials and Methods. The resulting transcriptional profiles of murine GAPDH , m Per2 , m Cry1 , RevErbα , and Bmal1 were analyzed by reverse-transcription PCR. The subjective time points (TP) of peak expression are designated in white above the corresponding bands for each transcript examined. Panel C is a graphical depiction of m Per2 transcriptional oscillation based on relative values derived from densitometric measurements of PCR-amplified DNA bands in panels A and B expressed as percentages of the highest recorded value in each respective data set.

    Journal: Journal of Circadian Rhythms

    Article Title: Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium

    doi: 10.1186/1740-3391-5-3

    Figure Lengend Snippet: Circadian oscillation profiles of clock genes in wild-type and GSK3β -/- MEFs . A , wild type and B , GSK3β -/- cells were synchronized, harvested, processed, and the gene products were amplified as described in the Materials and Methods. The resulting transcriptional profiles of murine GAPDH , m Per2 , m Cry1 , RevErbα , and Bmal1 were analyzed by reverse-transcription PCR. The subjective time points (TP) of peak expression are designated in white above the corresponding bands for each transcript examined. Panel C is a graphical depiction of m Per2 transcriptional oscillation based on relative values derived from densitometric measurements of PCR-amplified DNA bands in panels A and B expressed as percentages of the highest recorded value in each respective data set.

    Article Snippet: For all transcriptional profiles, PCR reactions for all time-points were prepared simultaneously, where 5 μl of cDNA was added to 45 μl of PCR mixture [10× reaction buffer, 0.5 unit Taq DNA polymerase (Roche), 0.2 mM dNTPs, and 50 pmol of primers].

    Techniques: Amplification, Polymerase Chain Reaction, Expressing, Derivative Assay

    Circadian oscillation profiles of mPer2 following pharmacological or genetic GSK3 inhibition . The transcriptional profile mPer2 ( A ) was analyzed by reverse-transcription PCR in: wild-type, GSK3β -/- / GSK3α RNAi (clones A1.4 and A1.6); as well as 20 mM Lithium or 25 μM kenpaullone treatment in a wild-type background. The subjective time points of peak expression are designated in white above the corresponding bands for each transcript examined. The time intervals where these effects are most visible (TP0-4, TP24-32, and TP44-52) are isolated in white boxes. The effects of genetic ( B ) and pharmacological ( C ) interference of GSK3 activity on mPer2 transcriptional oscillation are graphically depicted based on relative values derived from densitometric measurements of PCR-amplified DNA bands in panel A expressed as percentages of the highest recorded value in each respective data set.

    Journal: Journal of Circadian Rhythms

    Article Title: Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium

    doi: 10.1186/1740-3391-5-3

    Figure Lengend Snippet: Circadian oscillation profiles of mPer2 following pharmacological or genetic GSK3 inhibition . The transcriptional profile mPer2 ( A ) was analyzed by reverse-transcription PCR in: wild-type, GSK3β -/- / GSK3α RNAi (clones A1.4 and A1.6); as well as 20 mM Lithium or 25 μM kenpaullone treatment in a wild-type background. The subjective time points of peak expression are designated in white above the corresponding bands for each transcript examined. The time intervals where these effects are most visible (TP0-4, TP24-32, and TP44-52) are isolated in white boxes. The effects of genetic ( B ) and pharmacological ( C ) interference of GSK3 activity on mPer2 transcriptional oscillation are graphically depicted based on relative values derived from densitometric measurements of PCR-amplified DNA bands in panel A expressed as percentages of the highest recorded value in each respective data set.

    Article Snippet: For all transcriptional profiles, PCR reactions for all time-points were prepared simultaneously, where 5 μl of cDNA was added to 45 μl of PCR mixture [10× reaction buffer, 0.5 unit Taq DNA polymerase (Roche), 0.2 mM dNTPs, and 50 pmol of primers].

    Techniques: Inhibition, Polymerase Chain Reaction, Expressing, Isolation, Activity Assay, Derivative Assay, Amplification