Structured Review

Roche taq dna polymerase
Dependencies of apparent rate of substrate binding by <t>DNA</t> polymerases on temperature. Panel A , (○- PTJ1, ●- PTJ2) – <t>Taq</t> polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2)
Taq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 97/100, based on 990 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taq dna polymerase/product/Roche
Average 97 stars, based on 990 article reviews
Price from $9.99 to $1999.99
taq dna polymerase - by Bioz Stars, 2020-01
97/100 stars

Images

1) Product Images from "Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases"

Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases

Journal: Biochemistry

doi: 10.1021/bi2014807

Dependencies of apparent rate of substrate binding by DNA polymerases on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2)
Figure Legend Snippet: Dependencies of apparent rate of substrate binding by DNA polymerases on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2)

Techniques Used: Binding Assay

Thermostability of chimeric DNA polymerases ( see Materials and Methods ). Panel A shows the stability of Taq polymerase chimeras with truncated C-terminal TopoV tails at 100°C in the presence of 1 M potassium glutamate and 1 M betaine: (○)
Figure Legend Snippet: Thermostability of chimeric DNA polymerases ( see Materials and Methods ). Panel A shows the stability of Taq polymerase chimeras with truncated C-terminal TopoV tails at 100°C in the presence of 1 M potassium glutamate and 1 M betaine: (○)

Techniques Used:

Dependencies of DNA polymerase processivity on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2) – Klentaq. Panel
Figure Legend Snippet: Dependencies of DNA polymerase processivity on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2) – Klentaq. Panel

Techniques Used:

. Accumulation of the inactive conformations with temperature increase and dependencies of DNA binding rate constant on temperature for Taq polymerase and its fragments ( A, B ), chimeric polymerases
Figure Legend Snippet: . Accumulation of the inactive conformations with temperature increase and dependencies of DNA binding rate constant on temperature for Taq polymerase and its fragments ( A, B ), chimeric polymerases

Techniques Used: Binding Assay

2) Product Images from "Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases"

Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases

Journal: Biochemistry

doi: 10.1021/bi2014807

Dependencies of apparent rate of substrate binding by DNA polymerases on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2)
Figure Legend Snippet: Dependencies of apparent rate of substrate binding by DNA polymerases on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2)

Techniques Used: Binding Assay

Thermostability of chimeric DNA polymerases ( see Materials and Methods ). Panel A shows the stability of Taq polymerase chimeras with truncated C-terminal TopoV tails at 100°C in the presence of 1 M potassium glutamate and 1 M betaine: (○)
Figure Legend Snippet: Thermostability of chimeric DNA polymerases ( see Materials and Methods ). Panel A shows the stability of Taq polymerase chimeras with truncated C-terminal TopoV tails at 100°C in the presence of 1 M potassium glutamate and 1 M betaine: (○)

Techniques Used:

Dependencies of DNA polymerase processivity on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2) – Klentaq. Panel
Figure Legend Snippet: Dependencies of DNA polymerase processivity on temperature. Panel A , (○- PTJ1, ●- PTJ2) – Taq polymerase; (△- PTJ1, ▲- PTJ2) – Stoffel Fragment; (◇- PTJ1, ◆- PTJ2) – Klentaq. Panel

Techniques Used:

. Accumulation of the inactive conformations with temperature increase and dependencies of DNA binding rate constant on temperature for Taq polymerase and its fragments ( A, B ), chimeric polymerases
Figure Legend Snippet: . Accumulation of the inactive conformations with temperature increase and dependencies of DNA binding rate constant on temperature for Taq polymerase and its fragments ( A, B ), chimeric polymerases

Techniques Used: Binding Assay

3) Product Images from "Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1"

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2019.02366

K2ORF5 mRNA is outcompeted by cellular RNA in binding to the yeast cap-binding protein eIF4E in vitro . Electrophoretic analysis of semiquantitative RT-PCR detecting control HGT1 mRNA (upper panel) and K2ORF5 mRNA (lower panel) in samples as follows: Lane 1, glutathione-Sepharose with the bound GST-eIF4E fusion protein in the presence of excess K. lactis IFO1267 total RNA (input); lane 2, same as in line 1 but the reaction was performed without reverse transcriptase (negative control); lane 3, supernatant from the first wash step (unbound mRNA); lanes 4, 5, and 6, supernatants after the second, third, and sixth wash steps, respectively (unbound mRNA); lane 7, mRNA remaining bound on GST-S.c-eIF4E Sepharose after the sixth wash step. M, GeneRuler 100-bp DNA Ladder Plus (Thermo Scientific). PCR was performed using cDNA, Taq DNA polymerase, and the gene-specific primers listed in Supplementary Table S1 . All washing steps were performed with 70 volumes of buffer I. The initial abundances of HGT1 and K2ORF5 mRNA in the K. lactis total RNA were comparable as determined by qRT-PCR ( Supplementary Figure S3 ).
Figure Legend Snippet: K2ORF5 mRNA is outcompeted by cellular RNA in binding to the yeast cap-binding protein eIF4E in vitro . Electrophoretic analysis of semiquantitative RT-PCR detecting control HGT1 mRNA (upper panel) and K2ORF5 mRNA (lower panel) in samples as follows: Lane 1, glutathione-Sepharose with the bound GST-eIF4E fusion protein in the presence of excess K. lactis IFO1267 total RNA (input); lane 2, same as in line 1 but the reaction was performed without reverse transcriptase (negative control); lane 3, supernatant from the first wash step (unbound mRNA); lanes 4, 5, and 6, supernatants after the second, third, and sixth wash steps, respectively (unbound mRNA); lane 7, mRNA remaining bound on GST-S.c-eIF4E Sepharose after the sixth wash step. M, GeneRuler 100-bp DNA Ladder Plus (Thermo Scientific). PCR was performed using cDNA, Taq DNA polymerase, and the gene-specific primers listed in Supplementary Table S1 . All washing steps were performed with 70 volumes of buffer I. The initial abundances of HGT1 and K2ORF5 mRNA in the K. lactis total RNA were comparable as determined by qRT-PCR ( Supplementary Figure S3 ).

Techniques Used: Binding Assay, In Vitro, Reverse Transcription Polymerase Chain Reaction, Negative Control, Polymerase Chain Reaction, Quantitative RT-PCR

4) Product Images from "Instability of the Octarepeat Region of the Human Prion Protein Gene"

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene

Journal: PLoS ONE

doi: 10.1371/journal.pone.0026635

Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.
Figure Legend Snippet: Instability of octarepeats during PCR amplification by Taq Polymerase. (A) PCR products from the PrP-Oct5 and PrP-Oct11a templates. The octarepeat regions PCR amplified by Taq polymerase from PrP-Oct5 and PrP-Oct11a with primers HP20 and HP306r were cleaned up and separated on a 2% agarose gel. (B) Mutant octarepeat clones from PCR amplification of the PrP-Oct5 template: restriction analysis with Sac II and Spe I. Six mutant clones and one wild type clone are shown. The black box marks the template-sized Oct5 band from a wild type clone. (C) Mutant octarepeat clones from PCR amplification of the PrP-Oct11a template: restriction analysis with Sac II and Spe I. Same as in (B) except that PrPOct11a was the template. Fifteen mutant clones and one wild type clone are shown. The black box marks the template-sized Oct11 band from a non-mutant clone. (D) A mutant octarepeat clone containing two octarepeat inserts from PCR amplification of PrP-Oct5. Sac II and Spe I digestion of this mutant clone produced two octarepeat inserts; one was the 5-repeat wild type Oct5 while the other was a 2-repeat deletion mutant (R1a-R4). The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct5 band from a non-mutant clone. (E) Mutant octarepeat clones containing two octarepeat inserts from PCR amplification of PrP-Oct11a. Sac II and Spe I digestion of the 10 mutant clones produced two octarepeat inserts; one was the 11-repeat parental Oct11a in all clones while the other was a mutant octarepeat sequence of varying sizes and sequences. The arrowhead points to the band whose sequence is shown above the lane. The black box marks the template-sized Oct11 band from a non-mutant clone. For all panels, the octarepeat sequence is indicated above each lane; Rep. No., number of repeats; M,100-bp DNA Ladder.

Techniques Used: Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Mutagenesis, Clone Assay, Produced, Sequencing

5) Product Images from "A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning"

Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning

Journal: Journal of Reproduction & Infertility

doi:

Amplification of PERF15 gene fragment. Samples of 50 μl containing standard buffer, 200μM of each dNTP, 40 pM of each primer, 100 ng genomic DNA, 1.25 unit of Taq DNA polymerase to 30 cycles of PCR amplification. Each sample was resolved on a 1% agarose gel containing ethidium bromide. Lane 1(100 bp DNA marker), Lane 2 (PCR product).
Figure Legend Snippet: Amplification of PERF15 gene fragment. Samples of 50 μl containing standard buffer, 200μM of each dNTP, 40 pM of each primer, 100 ng genomic DNA, 1.25 unit of Taq DNA polymerase to 30 cycles of PCR amplification. Each sample was resolved on a 1% agarose gel containing ethidium bromide. Lane 1(100 bp DNA marker), Lane 2 (PCR product).

Techniques Used: Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Marker

6) Product Images from "Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results"

Article Title: Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results

Journal: Scientific Reports

doi: 10.1038/srep08056

Proportion of correct reads for the three genetic systems (simple: a single allele per individual, squares ; medium: two alleles, circles ; and complex: multiple alleles, triangles ) using standard PCR conditions ( open ) and modified PCR conditions to reduce chimera formation ( gray ). The size of the shape is indicative of the number of reads (see legend). All enzymes yielded at least 50% correct reads in the simplest system, mitochondrial DNA (Test 1; open squares). Some enzymes only worked for a given set of conditions (cycling conditions/genetic system). A group of enzymes consisting of Phusion, Gold and FastStart yielded a high proportion of correct reads cosistently accross all conditions. Others, such as Roche Taq, HotStar and Biotaq, yielded a low percent of correct reads for the more complex systems (MHC class I and MHC class II). Abbreviations as defined in Table 1 .
Figure Legend Snippet: Proportion of correct reads for the three genetic systems (simple: a single allele per individual, squares ; medium: two alleles, circles ; and complex: multiple alleles, triangles ) using standard PCR conditions ( open ) and modified PCR conditions to reduce chimera formation ( gray ). The size of the shape is indicative of the number of reads (see legend). All enzymes yielded at least 50% correct reads in the simplest system, mitochondrial DNA (Test 1; open squares). Some enzymes only worked for a given set of conditions (cycling conditions/genetic system). A group of enzymes consisting of Phusion, Gold and FastStart yielded a high proportion of correct reads cosistently accross all conditions. Others, such as Roche Taq, HotStar and Biotaq, yielded a low percent of correct reads for the more complex systems (MHC class I and MHC class II). Abbreviations as defined in Table 1 .

Techniques Used: Polymerase Chain Reaction, Modification

7) Product Images from "Multiplex PCR for Detection and Identification of Lactococcal Bacteriophages"

Article Title: Multiplex PCR for Detection and Identification of Lactococcal Bacteriophages

Journal: Applied and Environmental Microbiology

doi:

Multiplex PCR competition assay for different combinations of phage species in the same sample. Phage Q7 represents the 936 species, Q30 represents the P335 species, and Q38 represents the c2 species. Reactions were carried out with 1.25 (A and C) and 2.50 (B and D) U of Taq DNA polymerase. Lanes (boldface, phage concentration of 10 8 PFU/ml; lightface, phage concentration of 10 7 PFU/ml): 1, 14, 15, and 28, 100-bp DNA ladder (Gibco/BRL, Burlington, Ontario, Canada); 2, 936 plus c2 ; 3, 936 plus P335 ; 4, c2 plus P335 ; 5, 936 plus c2 plus P335 ; 6, 936 plus c2; 7, 936 plus P335; 8, 936 plus P335 ; 9, c2 plus P335; 10, 936 plus P335 ; 11, c2 plus P335 ; 12, 936 plus c2 plus P335; 13, 936 plus c2 plus P335 ; 16, 936 plus c2 plus P335 ; 17, 936 plus c2 plus P335; 18, 936 plus c2 plus P335; 19, 936 plus c2 plus P335 ; 20, 936 plus c2 plus P335; 21, 936 ; 22, c2 ; 23, P335 ; 24, 10 pg of 936 DNA; 25, 10 pg of c2 DNA; 26, 10 pg of P335 DNA; 27, negative control.
Figure Legend Snippet: Multiplex PCR competition assay for different combinations of phage species in the same sample. Phage Q7 represents the 936 species, Q30 represents the P335 species, and Q38 represents the c2 species. Reactions were carried out with 1.25 (A and C) and 2.50 (B and D) U of Taq DNA polymerase. Lanes (boldface, phage concentration of 10 8 PFU/ml; lightface, phage concentration of 10 7 PFU/ml): 1, 14, 15, and 28, 100-bp DNA ladder (Gibco/BRL, Burlington, Ontario, Canada); 2, 936 plus c2 ; 3, 936 plus P335 ; 4, c2 plus P335 ; 5, 936 plus c2 plus P335 ; 6, 936 plus c2; 7, 936 plus P335; 8, 936 plus P335 ; 9, c2 plus P335; 10, 936 plus P335 ; 11, c2 plus P335 ; 12, 936 plus c2 plus P335; 13, 936 plus c2 plus P335 ; 16, 936 plus c2 plus P335 ; 17, 936 plus c2 plus P335; 18, 936 plus c2 plus P335; 19, 936 plus c2 plus P335 ; 20, 936 plus c2 plus P335; 21, 936 ; 22, c2 ; 23, P335 ; 24, 10 pg of 936 DNA; 25, 10 pg of c2 DNA; 26, 10 pg of P335 DNA; 27, negative control.

Techniques Used: Multiplex Assay, Polymerase Chain Reaction, Competitive Binding Assay, Concentration Assay, Negative Control

Related Articles

Clone Assay:

Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases
Article Snippet: .. Taq DNA polymerase was purchased from Roche Applied Science (Indianapolis, IN), the Stoffel fragment of Taq DNA polymerase was obtained from Applied BioSystems (Foster City, CA), and Pfu DNA polymerase was from Stratagene Cloning Systems (La Jolla, CA). .. The recombinant large fragment of Bst DNA polymerase (IsoTherm™ DNA polymerase) was purchased from Epicentre Technologies (Madison, WI).

Amplification:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: .. To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA). .. The PCR products were treated with the Wizard PCR clean-up kit (Promega, WI, USA), ligated to pGEM-T (for Pwo-amplified products, A-tailing was done first with Taq DNA polymerase in PCR buffer with 0.2 mM dATP) and transformed into competent DH5α cells (New England Biolabs, MA, USA) on LB-agar plates with X-gal.

Article Title: rbFOX1/MBNL1 competition for CCUG RNA repeats binding contributes to myotonic dystrophy type 1/type 2 differences
Article Snippet: .. PCR was performed with Taq polymerase (Roche), one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using the primer described below. .. The PCR products were precipitated, analyzed by electrophoresis on a 6.5% polyacrylamide gel, stained with ethidium bromide and quantified with a Typhoon scanner.

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: .. The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The PCR cycles were: 94°C for 2 min; 94°C for 30 sec, 58.5°C for 30 sec and 72°C for 90 sec for 31 cycles; 72°C for 7 min. All primers used in this study were HPLC-purified (Invitrogen, CA, USA).

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1
Article Snippet: .. Two microliters of the reverse transcriptase reaction mixture (obtained from the eIF4E-mRNA in vitro binding assay) was subjected to PCR amplification (5 min at 94°C; 35 cycles of 30 s at 94°C; 30 s at 50°C; 45 s at 72°C; and finally, 4 min at 72°C) using Taq DNA polymerase (Roche) and HGT1 and K2ORF5 gene-specific primers (listed in ). .. As a control, total RNA used for the experiment was reverse transcribed and subjected to real-time PCR amplification ( ).

Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
Article Snippet: Paragraph title: Polymerase chain reaction (PCR) amplification of cDNA ... The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl .

Synthesized:

Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
Article Snippet: Forward primer hP1 (5' ATG GTT GAG CCC TTC TTG GGA AC 3') and reverse primer hP6 (5' TCA CAC CTT TTC GTA GAT TCT GGT G 3') were synthesized (VWR, Stockholm, Sweden). .. The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl .

Quantitative RT-PCR:

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1
Article Snippet: Next, 2 μl of the reaction mixture was removed for subsequent RT-PCR and real-time quantitative PCR (qRT-PCR) analyses. .. Two microliters of the reverse transcriptase reaction mixture (obtained from the eIF4E-mRNA in vitro binding assay) was subjected to PCR amplification (5 min at 94°C; 35 cycles of 30 s at 94°C; 30 s at 50°C; 45 s at 72°C; and finally, 4 min at 72°C) using Taq DNA polymerase (Roche) and HGT1 and K2ORF5 gene-specific primers (listed in ).

Article Title: TUBG1 missense variants underlying cortical malformations disrupt neuronal locomotion and microtubule dynamics but not neurogenesis
Article Snippet: Reaction conditions were carried out for 50 cycles (10 min Initial denaturation 95 °C, 10 s at 95 °C, 15 s at 60 °C and 20 s at 72 °C), each qRT-PCR reaction was performed in triplicate and relative mRNA expression was normalized to GAPDH for Tubg1 and Tubg2 comparisons and to Actin for mouse models. .. The presence of the mutation in KI mice was verified by PCR on cDNA samples using Taq DNA Polymerase (Roche) using the same primers as those used for qPCR.

SYBR Green Assay:

Article Title: TUBG1 missense variants underlying cortical malformations disrupt neuronal locomotion and microtubule dynamics but not neurogenesis
Article Snippet: Quantitative PCR was performed in a LightCycler PCR instrument (Roche) using SYBR Green Master Mix (Roche). .. The presence of the mutation in KI mice was verified by PCR on cDNA samples using Taq DNA Polymerase (Roche) using the same primers as those used for qPCR.

Incubation:

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1
Article Snippet: The rest of the mixture was incubated for 2 h at room temperature and washed six times (approximately 70 volumes in each wash step) with buffer I. .. Two microliters of the reverse transcriptase reaction mixture (obtained from the eIF4E-mRNA in vitro binding assay) was subjected to PCR amplification (5 min at 94°C; 35 cycles of 30 s at 94°C; 30 s at 50°C; 45 s at 72°C; and finally, 4 min at 72°C) using Taq DNA polymerase (Roche) and HGT1 and K2ORF5 gene-specific primers (listed in ).

Expressing:

Article Title: Identification and characterization of naturally occurring splice variants of SAMHD1
Article Snippet: .. Analysis of the expression of SAMHD1 splice variants cDNA pools were generated from THP-1 cells treated with 100 nM PMA for 24 h and used as template for a PCR reaction using Taq polymerase (Roche) and the following primer sets: Δ14 primers consist of a forward primer (F14) located in exon 10 (5′ GAA GTT GGA AAT CTG TAT GAC ATG TTC CAC 3′ ) and a reverse primer (R14) spanning the junction of exons 13 and 15 (5′ CTC TGG CAG AAG TTG TGA AAC ATC 3′ ). .. Δ8-9 primers consist of a forward primer (F8/9) spanning the junction of exons 7 and 10 (5′ CTT GAA TCA CCT GTC GAA GAT TCA TTG GAA G 3′ ) and a reverse primer R8/9 in exon 15 (5′ CTG CGG CTT GGT GAA ATT TCT GTC TG 3′ ).

Article Title: TUBG1 missense variants underlying cortical malformations disrupt neuronal locomotion and microtubule dynamics but not neurogenesis
Article Snippet: Reaction conditions were carried out for 50 cycles (10 min Initial denaturation 95 °C, 10 s at 95 °C, 15 s at 60 °C and 20 s at 72 °C), each qRT-PCR reaction was performed in triplicate and relative mRNA expression was normalized to GAPDH for Tubg1 and Tubg2 comparisons and to Actin for mouse models. .. The presence of the mutation in KI mice was verified by PCR on cDNA samples using Taq DNA Polymerase (Roche) using the same primers as those used for qPCR.

Transformation Assay:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA). .. The PCR products were treated with the Wizard PCR clean-up kit (Promega, WI, USA), ligated to pGEM-T (for Pwo-amplified products, A-tailing was done first with Taq DNA polymerase in PCR buffer with 0.2 mM dATP) and transformed into competent DH5α cells (New England Biolabs, MA, USA) on LB-agar plates with X-gal.

High Performance Liquid Chromatography:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The PCR cycles were: 94°C for 2 min; 94°C for 30 sec, 58.5°C for 30 sec and 72°C for 90 sec for 31 cycles; 72°C for 7 min. All primers used in this study were HPLC-purified (Invitrogen, CA, USA).

Ligation:

Article Title: A conditional transposon-based insertional mutagenesis screen for hepatocellular carcinoma-associated genes in mice
Article Snippet: The ligation reaction was cleaned using MinElute 96 well plates (Qiagen) in a vacuum manifold and resuspended in 40 μl of sterile double-distilled water (DDW). .. PCR conditions for Taq polymerase (Roche FastStart High Fidelity) were used according to the manufacturer's instructions of an initial denaturing step of 94°C for 5 min; 35-cycles of denature at 94°C for 30 sec, annealing at 60°C for 30 sec and extension at 72°C for 1.5 min; followed by a final extension at 72°C for 5 min. After the secondary PCR, the reaction was purified using MinElute 96 well plates (Qiagen) in a vacuum manifold and resuspended in 30 μl of sterile TE.

Protease Inhibitor:

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1
Article Snippet: All buffers used for protein purification contained Complete (EDTA-free) Protease Inhibitor (Roche), and all buffers used for handling RNA contained RNasin Ribonuclease Inhibitor (Promega). .. Two microliters of the reverse transcriptase reaction mixture (obtained from the eIF4E-mRNA in vitro binding assay) was subjected to PCR amplification (5 min at 94°C; 35 cycles of 30 s at 94°C; 30 s at 50°C; 45 s at 72°C; and finally, 4 min at 72°C) using Taq DNA polymerase (Roche) and HGT1 and K2ORF5 gene-specific primers (listed in ).

Transferring:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA). .. Individual white and light blue colonies were directly picked by pipette tips into 20 µl of PCR reaction mix [200 µM dNTPs (each), 1×PCR buffer containing 1.5 mM MgCl2 , 0.4 µM each of primers, and 2 units of Taq DNA polymerase] and subjected to PCR with primers HP50F ( GTGACCTGGGCCTCTGCAAG ) and HP293R ( CTTACTCGGCTTGTTCCACT ) as follows: 94°C for 2 min; 94°C for 30 sec, 66.5°C for 30 sec and 72°C for 60 sec for 17 cycles; 72°C for 7 min.

Generated:

Article Title: Identification and characterization of naturally occurring splice variants of SAMHD1
Article Snippet: .. Analysis of the expression of SAMHD1 splice variants cDNA pools were generated from THP-1 cells treated with 100 nM PMA for 24 h and used as template for a PCR reaction using Taq polymerase (Roche) and the following primer sets: Δ14 primers consist of a forward primer (F14) located in exon 10 (5′ GAA GTT GGA AAT CTG TAT GAC ATG TTC CAC 3′ ) and a reverse primer (R14) spanning the junction of exons 13 and 15 (5′ CTC TGG CAG AAG TTG TGA AAC ATC 3′ ). .. Δ8-9 primers consist of a forward primer (F8/9) spanning the junction of exons 7 and 10 (5′ CTT GAA TCA CCT GTC GAA GAT TCA TTG GAA G 3′ ) and a reverse primer R8/9 in exon 15 (5′ CTG CGG CTT GGT GAA ATT TCT GTC TG 3′ ).

Article Title: rbFOX1/MBNL1 competition for CCUG RNA repeats binding contributes to myotonic dystrophy type 1/type 2 differences
Article Snippet: RT-PCR analyses Total RNA from cells or patient muscle was isolated by TriReagent (Molecular Research Center). cDNAs were generated using the Transcriptor High Fidelity cDNA synthesis kit (Roche Diagnostics) for quantification of mRNAs. .. PCR was performed with Taq polymerase (Roche), one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using the primer described below.

Inhibition:

Article Title: Effects of Amplification Facilitators on Diagnostic PCR in the Presence of Blood, Feces, and Meat
Article Snippet: .. However, the ability of gp32 to reduce the inhibition of Taq DNA polymerase by feces was not reproducible when different batches of Taq DNA polymerase and buffers were used. .. For example, in the first run of experiments, Taq DNA polymerase amplified DNA in the presence of 2% (vol/vol) feces.

Reverse Transcription Polymerase Chain Reaction:

Article Title: rbFOX1/MBNL1 competition for CCUG RNA repeats binding contributes to myotonic dystrophy type 1/type 2 differences
Article Snippet: Paragraph title: RT-PCR analyses ... PCR was performed with Taq polymerase (Roche), one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using the primer described below.

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1
Article Snippet: After the last wash step, the GST-eIF4E-glutathione-Sepharose slurry containing bound mRNA was subjected to RT-PCR and detection of specific mRNAs. .. Two microliters of the reverse transcriptase reaction mixture (obtained from the eIF4E-mRNA in vitro binding assay) was subjected to PCR amplification (5 min at 94°C; 35 cycles of 30 s at 94°C; 30 s at 50°C; 45 s at 72°C; and finally, 4 min at 72°C) using Taq DNA polymerase (Roche) and HGT1 and K2ORF5 gene-specific primers (listed in ).

Binding Assay:

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1
Article Snippet: .. Two microliters of the reverse transcriptase reaction mixture (obtained from the eIF4E-mRNA in vitro binding assay) was subjected to PCR amplification (5 min at 94°C; 35 cycles of 30 s at 94°C; 30 s at 50°C; 45 s at 72°C; and finally, 4 min at 72°C) using Taq DNA polymerase (Roche) and HGT1 and K2ORF5 gene-specific primers (listed in ). .. As a control, total RNA used for the experiment was reverse transcribed and subjected to real-time PCR amplification ( ).

Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
Article Snippet: Polymerase chain reaction (PCR) amplification of cDNA Two pairs of primers were designed to amplify human PERF15 cDNA based on the automated computational analysis of Homo sapiens similar to testis fatty-acid binding protein 9 (Gene bank, accession number XM_378035). .. The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl .

Countercurrent Chromatography:

Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
Article Snippet: Forward primer hP1 (5' ATG GTT GAG CCC TTC TTG GGA AC 3') and reverse primer hP6 (5' TCA CAC CTT TTC GTA GAT TCT GGT G 3') were synthesized (VWR, Stockholm, Sweden). .. The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl .

Real-time Polymerase Chain Reaction:

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1
Article Snippet: Next, 2 μl of the reaction mixture was removed for subsequent RT-PCR and real-time quantitative PCR (qRT-PCR) analyses. .. Two microliters of the reverse transcriptase reaction mixture (obtained from the eIF4E-mRNA in vitro binding assay) was subjected to PCR amplification (5 min at 94°C; 35 cycles of 30 s at 94°C; 30 s at 50°C; 45 s at 72°C; and finally, 4 min at 72°C) using Taq DNA polymerase (Roche) and HGT1 and K2ORF5 gene-specific primers (listed in ).

Article Title: TUBG1 missense variants underlying cortical malformations disrupt neuronal locomotion and microtubule dynamics but not neurogenesis
Article Snippet: .. The presence of the mutation in KI mice was verified by PCR on cDNA samples using Taq DNA Polymerase (Roche) using the same primers as those used for qPCR. .. PCR products were sent to GATC biotech for Sanger sequencing.

Mutagenesis:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: .. To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA). .. The PCR products were treated with the Wizard PCR clean-up kit (Promega, WI, USA), ligated to pGEM-T (for Pwo-amplified products, A-tailing was done first with Taq DNA polymerase in PCR buffer with 0.2 mM dATP) and transformed into competent DH5α cells (New England Biolabs, MA, USA) on LB-agar plates with X-gal.

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: Paragraph title: Preparation of PCR templates (PrP-Oct5 and PrP-Oct11a) and plasmids (pOct5, pOct11b) for mutation analysis ... The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA).

Article Title: TUBG1 missense variants underlying cortical malformations disrupt neuronal locomotion and microtubule dynamics but not neurogenesis
Article Snippet: .. The presence of the mutation in KI mice was verified by PCR on cDNA samples using Taq DNA Polymerase (Roche) using the same primers as those used for qPCR. .. PCR products were sent to GATC biotech for Sanger sequencing.

Isolation:

Article Title: rbFOX1/MBNL1 competition for CCUG RNA repeats binding contributes to myotonic dystrophy type 1/type 2 differences
Article Snippet: RT-PCR analyses Total RNA from cells or patient muscle was isolated by TriReagent (Molecular Research Center). cDNAs were generated using the Transcriptor High Fidelity cDNA synthesis kit (Roche Diagnostics) for quantification of mRNAs. .. PCR was performed with Taq polymerase (Roche), one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using the primer described below.

Polymerase Chain Reaction:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: .. To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA). .. The PCR products were treated with the Wizard PCR clean-up kit (Promega, WI, USA), ligated to pGEM-T (for Pwo-amplified products, A-tailing was done first with Taq DNA polymerase in PCR buffer with 0.2 mM dATP) and transformed into competent DH5α cells (New England Biolabs, MA, USA) on LB-agar plates with X-gal.

Article Title: Identification and characterization of naturally occurring splice variants of SAMHD1
Article Snippet: .. Analysis of the expression of SAMHD1 splice variants cDNA pools were generated from THP-1 cells treated with 100 nM PMA for 24 h and used as template for a PCR reaction using Taq polymerase (Roche) and the following primer sets: Δ14 primers consist of a forward primer (F14) located in exon 10 (5′ GAA GTT GGA AAT CTG TAT GAC ATG TTC CAC 3′ ) and a reverse primer (R14) spanning the junction of exons 13 and 15 (5′ CTC TGG CAG AAG TTG TGA AAC ATC 3′ ). .. Δ8-9 primers consist of a forward primer (F8/9) spanning the junction of exons 7 and 10 (5′ CTT GAA TCA CCT GTC GAA GAT TCA TTG GAA G 3′ ) and a reverse primer R8/9 in exon 15 (5′ CTG CGG CTT GGT GAA ATT TCT GTC TG 3′ ).

Article Title: rbFOX1/MBNL1 competition for CCUG RNA repeats binding contributes to myotonic dystrophy type 1/type 2 differences
Article Snippet: .. PCR was performed with Taq polymerase (Roche), one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using the primer described below. .. The PCR products were precipitated, analyzed by electrophoresis on a 6.5% polyacrylamide gel, stained with ethidium bromide and quantified with a Typhoon scanner.

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: .. The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The PCR cycles were: 94°C for 2 min; 94°C for 30 sec, 58.5°C for 30 sec and 72°C for 90 sec for 31 cycles; 72°C for 7 min. All primers used in this study were HPLC-purified (Invitrogen, CA, USA).

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1
Article Snippet: .. Two microliters of the reverse transcriptase reaction mixture (obtained from the eIF4E-mRNA in vitro binding assay) was subjected to PCR amplification (5 min at 94°C; 35 cycles of 30 s at 94°C; 30 s at 50°C; 45 s at 72°C; and finally, 4 min at 72°C) using Taq DNA polymerase (Roche) and HGT1 and K2ORF5 gene-specific primers (listed in ). .. As a control, total RNA used for the experiment was reverse transcribed and subjected to real-time PCR amplification ( ).

Article Title: A conditional transposon-based insertional mutagenesis screen for hepatocellular carcinoma-associated genes in mice
Article Snippet: .. PCR conditions for Taq polymerase (Roche FastStart High Fidelity) were used according to the manufacturer's instructions of an initial denaturing step of 94°C for 5 min; 35-cycles of denature at 94°C for 30 sec, annealing at 60°C for 30 sec and extension at 72°C for 1.5 min; followed by a final extension at 72°C for 5 min. After the secondary PCR, the reaction was purified using MinElute 96 well plates (Qiagen) in a vacuum manifold and resuspended in 30 μl of sterile TE. .. The amount of DNA in each PCR sample was quantified using the QuantIT picogreen kit (Invitrogen) and the samples were diluted to a final concentration of 2 × 105 molecules/μl for pyrosequencing.

Article Title: Multiplex PCR for Detection and Identification of Lactococcal Bacteriophages
Article Snippet: Paragraph title: Multiplex PCR. ... PCRs were performed in 50 μl containing 125 mM deoxynucleoside triphosphate (Pharmacia Biotech, Baie d'Urfé, Québec, Canada), 5 mM concentrations of the six primers, 1.25 U of Taq DNA polymerase (Roche Diagnostic), Taq buffer (10 mM Tris-HCl, 1.5 mM magnesium chloride, 50 mM potassium chloride, pH 8.3), and 1 μl of the template.

Article Title: TUBG1 missense variants underlying cortical malformations disrupt neuronal locomotion and microtubule dynamics but not neurogenesis
Article Snippet: .. The presence of the mutation in KI mice was verified by PCR on cDNA samples using Taq DNA Polymerase (Roche) using the same primers as those used for qPCR. .. PCR products were sent to GATC biotech for Sanger sequencing.

Article Title: A Novel Human Lipid Binding Protein Coding Gene: PERF15, Sequence and Cloning
Article Snippet: .. The PCR was done using the master mix containing 2.5μl of PCR buffer (10×), 2μl of 25mM MgCl2 , 1μl of 5mM dNTP, 2μl of 5μM forward primer, 2μl of 5μM reverse primer, 0.25μl of Taq DNA polymerase (Roche, Diagnostics), 25ng of cDNA and double distilled water added upto a total volume of 25μl . .. The mixture was amplified in a thermocycler (Eppendorf, Germany) following an initial denaturation at 94°C for 4 minutes, 40 cycles of denaturation at 94°C for 30 seconds, annealing at 63.5°C for 30 seconds, elongation at 72°C for 1 minute and a final extension at 72°C for 10 minutes.

Article Title: Effect of the enzyme and PCR conditions on the quality of high-throughput DNA sequencing results
Article Snippet: .. Taq polymerase A range of 13 high fidelity, regular, economy and premium Taq polymerase enzymes were selected: Biotaq® (Bioline, London, UK), FastStart® High Fidelity PCR System (Roche, Mannheim, Germany), AmpliTaq Gold® (Applied Biosystems, Warrington, UK), HotStarTaq® DNA Polymerase (Qiagen, Hilden, Gernamy), Phusion® High Fidelity DNA Polymerase (Finnzymes, Espoo, Finland), Taq DNA Polymerase (Roche, Maylan, France), i-MaxTM II DNA Polymerase (iNtRON Biotechnology, Seongnam, Korea), KAPA HiFi™ (Kapa Biosystems, Boston, USA), OneTaq ™ DNA Polymerase (New England Biolabs, Hitchin, UK), Vent® DNA Polymerase (New England Biolabs, Hitchin, UK), Deep Vent® DNA Polymerase (New England Biolabs, Hitchin, UK), Pwo® DNA Polymerase (Roche, Maylan, France) and Velocity DNA Polymerase (Bioline, London, UK) (abbreviated names in ). ..

Size-exclusion Chromatography:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA). .. Individual white and light blue colonies were directly picked by pipette tips into 20 µl of PCR reaction mix [200 µM dNTPs (each), 1×PCR buffer containing 1.5 mM MgCl2 , 0.4 µM each of primers, and 2 units of Taq DNA polymerase] and subjected to PCR with primers HP50F ( GTGACCTGGGCCTCTGCAAG ) and HP293R ( CTTACTCGGCTTGTTCCACT ) as follows: 94°C for 2 min; 94°C for 30 sec, 66.5°C for 30 sec and 72°C for 60 sec for 17 cycles; 72°C for 7 min.

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The PCR cycles were: 94°C for 2 min; 94°C for 30 sec, 58.5°C for 30 sec and 72°C for 90 sec for 31 cycles; 72°C for 7 min. All primers used in this study were HPLC-purified (Invitrogen, CA, USA).

Article Title: A conditional transposon-based insertional mutagenesis screen for hepatocellular carcinoma-associated genes in mice
Article Snippet: .. PCR conditions for Taq polymerase (Roche FastStart High Fidelity) were used according to the manufacturer's instructions of an initial denaturing step of 94°C for 5 min; 35-cycles of denature at 94°C for 30 sec, annealing at 60°C for 30 sec and extension at 72°C for 1.5 min; followed by a final extension at 72°C for 5 min. After the secondary PCR, the reaction was purified using MinElute 96 well plates (Qiagen) in a vacuum manifold and resuspended in 30 μl of sterile TE. .. The amount of DNA in each PCR sample was quantified using the QuantIT picogreen kit (Invitrogen) and the samples were diluted to a final concentration of 2 × 105 molecules/μl for pyrosequencing.

Purification:

Article Title: Sulfolobus solfataricus P2 DNA polymerase IV (Dpo4): an archaeal DinB-like DNA polymerase with lesion-bypass properties akin to eukaryotic pol?
Article Snippet: The thermostability of the highly purified Dpo4 enzyme was more accurately determined by heating aliquots at a variety of temperatures for 5 min. After this time, we assayed the ability of the enzyme to incorporate a single dCMP opposite template G, which is the most catalytically favorable incorporation for the enzyme (Table ). .. The thermostability of each enzyme was compared with two well-characterized enzymes, Taq polymerase (Roche Molecular) and E.coli pol I Klenow fragment (New England Biolabs), under the same assay conditions.

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1
Article Snippet: After the last wash step, the GST-eIF4E fusion protein bound to glutathione-Sepharose was resuspended in 200 μl of buffer I (20 mM HEPES, pH 7.5; 0.1 mM EDTA, pH 8.0; 100 mM KCl; and 1 mM β-mercaptoethanol) and mixed with 3 μg of DNase I-treated total RNA purified from K. lactis IFO1267. .. Two microliters of the reverse transcriptase reaction mixture (obtained from the eIF4E-mRNA in vitro binding assay) was subjected to PCR amplification (5 min at 94°C; 35 cycles of 30 s at 94°C; 30 s at 50°C; 45 s at 72°C; and finally, 4 min at 72°C) using Taq DNA polymerase (Roche) and HGT1 and K2ORF5 gene-specific primers (listed in ).

Article Title: A conditional transposon-based insertional mutagenesis screen for hepatocellular carcinoma-associated genes in mice
Article Snippet: .. PCR conditions for Taq polymerase (Roche FastStart High Fidelity) were used according to the manufacturer's instructions of an initial denaturing step of 94°C for 5 min; 35-cycles of denature at 94°C for 30 sec, annealing at 60°C for 30 sec and extension at 72°C for 1.5 min; followed by a final extension at 72°C for 5 min. After the secondary PCR, the reaction was purified using MinElute 96 well plates (Qiagen) in a vacuum manifold and resuspended in 30 μl of sterile TE. .. The amount of DNA in each PCR sample was quantified using the QuantIT picogreen kit (Invitrogen) and the samples were diluted to a final concentration of 2 × 105 molecules/μl for pyrosequencing.

Protein Purification:

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1
Article Snippet: All buffers used for protein purification contained Complete (EDTA-free) Protease Inhibitor (Roche), and all buffers used for handling RNA contained RNasin Ribonuclease Inhibitor (Promega). .. Two microliters of the reverse transcriptase reaction mixture (obtained from the eIF4E-mRNA in vitro binding assay) was subjected to PCR amplification (5 min at 94°C; 35 cycles of 30 s at 94°C; 30 s at 50°C; 45 s at 72°C; and finally, 4 min at 72°C) using Taq DNA polymerase (Roche) and HGT1 and K2ORF5 gene-specific primers (listed in ).

Sequencing:

Article Title: A conditional transposon-based insertional mutagenesis screen for hepatocellular carcinoma-associated genes in mice
Article Snippet: Primers were designed as such that the nested transposon primer have the Fusion A and barcode attached (Fusion A – barcode – nested primer) and the nested linker primer has the Fusion B sequence attached (linker nested – Fusion B). .. PCR conditions for Taq polymerase (Roche FastStart High Fidelity) were used according to the manufacturer's instructions of an initial denaturing step of 94°C for 5 min; 35-cycles of denature at 94°C for 30 sec, annealing at 60°C for 30 sec and extension at 72°C for 1.5 min; followed by a final extension at 72°C for 5 min. After the secondary PCR, the reaction was purified using MinElute 96 well plates (Qiagen) in a vacuum manifold and resuspended in 30 μl of sterile TE.

Article Title: TUBG1 missense variants underlying cortical malformations disrupt neuronal locomotion and microtubule dynamics but not neurogenesis
Article Snippet: The presence of the mutation in KI mice was verified by PCR on cDNA samples using Taq DNA Polymerase (Roche) using the same primers as those used for qPCR. .. PCR products were sent to GATC biotech for Sanger sequencing.

Mouse Assay:

Article Title: TUBG1 missense variants underlying cortical malformations disrupt neuronal locomotion and microtubule dynamics but not neurogenesis
Article Snippet: .. The presence of the mutation in KI mice was verified by PCR on cDNA samples using Taq DNA Polymerase (Roche) using the same primers as those used for qPCR. .. PCR products were sent to GATC biotech for Sanger sequencing.

Plasmid Preparation:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: Paragraph title: Mutation detection in PCR products or plasmid DNAs replicated in E.coli ... To measure the mutation rate in the octarepeat region during PCR amplification, the octarepeat region was amplified by PCR from PrP-Oct5 or PrP-Oct11a with primers HP20 and HP306r and either Taq polymerase (Roche, IN, USA) or Pwo polymerase (Roche, IN, USA).

Article Title: Identification and characterization of naturally occurring splice variants of SAMHD1
Article Snippet: Analysis of the expression of SAMHD1 splice variants cDNA pools were generated from THP-1 cells treated with 100 nM PMA for 24 h and used as template for a PCR reaction using Taq polymerase (Roche) and the following primer sets: Δ14 primers consist of a forward primer (F14) located in exon 10 (5′ GAA GTT GGA AAT CTG TAT GAC ATG TTC CAC 3′ ) and a reverse primer (R14) spanning the junction of exons 13 and 15 (5′ CTC TGG CAG AAG TTG TGA AAC ATC 3′ ). .. Plasmid controls consisted of 1 ng of pcDNA-SAMHD1 WT, Δ14, or Δ8-9 used as template in the PCR reaction.

Electrophoresis:

Article Title: rbFOX1/MBNL1 competition for CCUG RNA repeats binding contributes to myotonic dystrophy type 1/type 2 differences
Article Snippet: PCR was performed with Taq polymerase (Roche), one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using the primer described below. .. The PCR products were precipitated, analyzed by electrophoresis on a 6.5% polyacrylamide gel, stained with ethidium bromide and quantified with a Typhoon scanner.

Multiplex Assay:

Article Title: Multiplex PCR for Detection and Identification of Lactococcal Bacteriophages
Article Snippet: Paragraph title: Multiplex PCR. ... PCRs were performed in 50 μl containing 125 mM deoxynucleoside triphosphate (Pharmacia Biotech, Baie d'Urfé, Québec, Canada), 5 mM concentrations of the six primers, 1.25 U of Taq DNA polymerase (Roche Diagnostic), Taq buffer (10 mM Tris-HCl, 1.5 mM magnesium chloride, 50 mM potassium chloride, pH 8.3), and 1 μl of the template.

Recombinant:

Article Title: Cooperation between Catalytic and DNA-binding Domains Enhances Thermostability and Supports DNA Synthesis at Higher Temperatures by Thermostable DNA Polymerases
Article Snippet: Taq DNA polymerase was purchased from Roche Applied Science (Indianapolis, IN), the Stoffel fragment of Taq DNA polymerase was obtained from Applied BioSystems (Foster City, CA), and Pfu DNA polymerase was from Stratagene Cloning Systems (La Jolla, CA). .. The recombinant large fragment of Bst DNA polymerase (IsoTherm™ DNA polymerase) was purchased from Epicentre Technologies (Madison, WI).

In Vitro:

Article Title: Messenger RNAs of Yeast Virus-Like Elements Contain Non-templated 5′ Poly(A) Leaders, and Their Expression Is Independent of eIF4E and Pab1
Article Snippet: .. Two microliters of the reverse transcriptase reaction mixture (obtained from the eIF4E-mRNA in vitro binding assay) was subjected to PCR amplification (5 min at 94°C; 35 cycles of 30 s at 94°C; 30 s at 50°C; 45 s at 72°C; and finally, 4 min at 72°C) using Taq DNA polymerase (Roche) and HGT1 and K2ORF5 gene-specific primers (listed in ). .. As a control, total RNA used for the experiment was reverse transcribed and subjected to real-time PCR amplification ( ).

Spectrophotometry:

Article Title: Instability of the Octarepeat Region of the Human Prion Protein Gene
Article Snippet: The human PrP ORF was amplified by PCR with a Mastercycler thermal cycler (Eppendorf, NY, USA) in a 50 µl reaction containing 50 ng human genomic DNA, 200 µM dNTPs (each), 1.5 mM MgCl2 , 0.4 µM each of primers 42F ( CATAACTTAGGGTCACATTTGTCC ) and 45R ( CCAGATTAACCAA - TGGTTATTTGC ), and 5 units of Taq DNA polymerase (Roche, IN, USA). .. The A260/280 ratios of DNA samples in this study were 1.8–2.0 as assayed with a Nanovue spectrophotometer (GE Healthcare, NJ, USA).

Concentration Assay:

Article Title: A conditional transposon-based insertional mutagenesis screen for hepatocellular carcinoma-associated genes in mice
Article Snippet: PCR conditions for Taq polymerase (Roche FastStart High Fidelity) were used according to the manufacturer's instructions of an initial denaturing step of 94°C for 5 min; 35-cycles of denature at 94°C for 30 sec, annealing at 60°C for 30 sec and extension at 72°C for 1.5 min; followed by a final extension at 72°C for 5 min. After the secondary PCR, the reaction was purified using MinElute 96 well plates (Qiagen) in a vacuum manifold and resuspended in 30 μl of sterile TE. .. The amount of DNA in each PCR sample was quantified using the QuantIT picogreen kit (Invitrogen) and the samples were diluted to a final concentration of 2 × 105 molecules/μl for pyrosequencing.

CTG Assay:

Article Title: Identification and characterization of naturally occurring splice variants of SAMHD1
Article Snippet: .. Analysis of the expression of SAMHD1 splice variants cDNA pools were generated from THP-1 cells treated with 100 nM PMA for 24 h and used as template for a PCR reaction using Taq polymerase (Roche) and the following primer sets: Δ14 primers consist of a forward primer (F14) located in exon 10 (5′ GAA GTT GGA AAT CTG TAT GAC ATG TTC CAC 3′ ) and a reverse primer (R14) spanning the junction of exons 13 and 15 (5′ CTC TGG CAG AAG TTG TGA AAC ATC 3′ ). .. Δ8-9 primers consist of a forward primer (F8/9) spanning the junction of exons 7 and 10 (5′ CTT GAA TCA CCT GTC GAA GAT TCA TTG GAA G 3′ ) and a reverse primer R8/9 in exon 15 (5′ CTG CGG CTT GGT GAA ATT TCT GTC TG 3′ ).

Staining:

Article Title: rbFOX1/MBNL1 competition for CCUG RNA repeats binding contributes to myotonic dystrophy type 1/type 2 differences
Article Snippet: PCR was performed with Taq polymerase (Roche), one denaturation step at 94 °C for 2 min, 30 cycles of amplification 94 °C for 1 min, 60 °C for 1 min, 72 °C for 2 min and a final step at 72 °C for 5 min using the primer described below. .. The PCR products were precipitated, analyzed by electrophoresis on a 6.5% polyacrylamide gel, stained with ethidium bromide and quantified with a Typhoon scanner.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Roche faststart taq dna polymerase
    Reduction of PCR Inhibition by Increased Amounts of <t>Taq</t> Polymerase. qPCR with HMW and template <t>DNA</t> from FFPE tissue using different amounts of Taq polymerase. PCR-amplification of increasing amounts of genomic HMW template DNA (2.5-3,840 ng) using (A) 2 U Taq , (B) 4 U Taq and PCR-amplification of template DNA from FFPE tissue using (C) 2 U Taq , (D) 4 U Taq . Shown are the mean values (± standard deviations) from triplicate measurements.
    Faststart Taq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 466 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/faststart taq dna polymerase/product/Roche
    Average 99 stars, based on 466 article reviews
    Price from $9.99 to $1999.99
    faststart taq dna polymerase - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    82
    Roche taq polymerases
    Sequences of contaminating bacterial <t>DNA</t> in three <t>Taq</t> polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.
    Taq Polymerases, supplied by Roche, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerases/product/Roche
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    taq polymerases - by Bioz Stars, 2020-01
    82/100 stars
      Buy from Supplier

    taq  (Roche)
    95
    Roche taq
    Representative autoradiograms of clonal frequency analyses of HALT-C patients with low (patient 9, panel A), intermediate (patient 6, panel B) and high (patient 16, panel C) QS diversity and complexity. <t>E2-HVR1</t> RT-PCRs were performed with <t>Taq</t> and HF-2 enzymes. PCR products were cloned as described in the Materials and Methods, and individual colonies were picked and re-amplified. Lane 1 represents the homoduplex (HD) control and represents the probe hybridized to itself. Lane 2 represents the heteroduplex profile of the heterogenous (ie not cloned) E2-HVR1 PCR product and is designated
    Taq, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq/product/Roche
    Average 95 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    taq - by Bioz Stars, 2020-01
    95/100 stars
      Buy from Supplier

    97
    Roche taq dna polymerase
    Activity of <t>Taq</t> <t>DNA</t> polymerase, the Stoffel fragment, Pfu polB, and the hybrid polymerases in salts. Initial rates of primer extension reactions for the proteins were determined as described in Materials and Methods , and the dependencies of the rates for enzymes with Taq polymerase catalytic domain on salt concentrations were plotted for NaCl ( A ), KCl ( B ), and potassium glutamate ( C . The dependencies of the rates for enzymes with Pfu polymerase catalytic domain are collected in D.
    Taq Dna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 97/100, based on 990 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Roche
    Average 97 stars, based on 990 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-01
    97/100 stars
      Buy from Supplier

    Image Search Results


    Reduction of PCR Inhibition by Increased Amounts of Taq Polymerase. qPCR with HMW and template DNA from FFPE tissue using different amounts of Taq polymerase. PCR-amplification of increasing amounts of genomic HMW template DNA (2.5-3,840 ng) using (A) 2 U Taq , (B) 4 U Taq and PCR-amplification of template DNA from FFPE tissue using (C) 2 U Taq , (D) 4 U Taq . Shown are the mean values (± standard deviations) from triplicate measurements.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Reduction of PCR Inhibition by Increased Amounts of Taq Polymerase. qPCR with HMW and template DNA from FFPE tissue using different amounts of Taq polymerase. PCR-amplification of increasing amounts of genomic HMW template DNA (2.5-3,840 ng) using (A) 2 U Taq , (B) 4 U Taq and PCR-amplification of template DNA from FFPE tissue using (C) 2 U Taq , (D) 4 U Taq . Shown are the mean values (± standard deviations) from triplicate measurements.

    Article Snippet: Endpoint PCR and qPCR Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Polymerase Chain Reaction, Inhibition, Real-time Polymerase Chain Reaction, Formalin-fixed Paraffin-Embedded, Amplification

    Inhibitory Effect of Template DNA from FFPE Tissues on PCR Performance. qPCR with 1 µg of genomic HMW template DNA and increasing amounts (60-1,440 ng) of spiked genomic template DNA from FFPE tissue Genomic DNA from FFPE tissue was treated beforehand with active DNase I (+) and heat-inactivated DNase I (-), respectively. qPCR was performed using a 150-bp fragment and 1 U Taq polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Inhibitory Effect of Template DNA from FFPE Tissues on PCR Performance. qPCR with 1 µg of genomic HMW template DNA and increasing amounts (60-1,440 ng) of spiked genomic template DNA from FFPE tissue Genomic DNA from FFPE tissue was treated beforehand with active DNase I (+) and heat-inactivated DNase I (-), respectively. qPCR was performed using a 150-bp fragment and 1 U Taq polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Article Snippet: Endpoint PCR and qPCR Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Formalin-fixed Paraffin-Embedded, Polymerase Chain Reaction, Real-time Polymerase Chain Reaction

    Successful PCR Amplification of Larger Fragments by Overcoming PCR Inhibition. PCR-amplified DNA fragments of different sizes within the PITX2 gene locus using template DNA from FFPE tissue. The PCR was carried out using 1 µg (upper and middle panel) and 5 ng (lower panel) template DNA in the presence of 1 U and 4 U Taq DNA polymerase, respectively.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Successful PCR Amplification of Larger Fragments by Overcoming PCR Inhibition. PCR-amplified DNA fragments of different sizes within the PITX2 gene locus using template DNA from FFPE tissue. The PCR was carried out using 1 µg (upper and middle panel) and 5 ng (lower panel) template DNA in the presence of 1 U and 4 U Taq DNA polymerase, respectively.

    Article Snippet: Endpoint PCR and qPCR Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Polymerase Chain Reaction, Amplification, Inhibition, Formalin-fixed Paraffin-Embedded

    Degradation of DNA from FFPE Tissues and its Effect on PCR Amplification of Amplicons with Different Sizes. Analysis of DNA integrity of genomic and bisulfite-converted DNA from unfixed and FFPE tissues by means of (A) agarose gel electrophoresis and (B) end-point PCR using PCR fragments of different sizes within the PITX2 gene locus. (C) qPCR results applying increasing amounts (2.5–3,840 ng) of genomic template DNA from unfixed and (D) from FFPE tissue. Shown are the mean values (± standard deviations) from triplicate measurements. Each PCR was performed with 1 U Taq polymerase. DNA from unfixed specimens is considered high molecular weight (HMW) DNA.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Degradation of DNA from FFPE Tissues and its Effect on PCR Amplification of Amplicons with Different Sizes. Analysis of DNA integrity of genomic and bisulfite-converted DNA from unfixed and FFPE tissues by means of (A) agarose gel electrophoresis and (B) end-point PCR using PCR fragments of different sizes within the PITX2 gene locus. (C) qPCR results applying increasing amounts (2.5–3,840 ng) of genomic template DNA from unfixed and (D) from FFPE tissue. Shown are the mean values (± standard deviations) from triplicate measurements. Each PCR was performed with 1 U Taq polymerase. DNA from unfixed specimens is considered high molecular weight (HMW) DNA.

    Article Snippet: Endpoint PCR and qPCR Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Formalin-fixed Paraffin-Embedded, Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis, Real-time Polymerase Chain Reaction, Molecular Weight

    Transferability of the Findings to a qPCR Targeting an Alternative Genomic Locus. qPCR applying a 200-bp PCR fragment within the ACTB gene locus. Amplification with (A) HMW DNA from unfixed tissue and (B) DNA from FFPE tissue (2.5 ng to 3,840 ng) in the presence of 1 U and 4 U Taq DNA polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: Transferability of the Findings to a qPCR Targeting an Alternative Genomic Locus. qPCR applying a 200-bp PCR fragment within the ACTB gene locus. Amplification with (A) HMW DNA from unfixed tissue and (B) DNA from FFPE tissue (2.5 ng to 3,840 ng) in the presence of 1 U and 4 U Taq DNA polymerase. Shown are the mean values (± standard deviations) from triplicate measurements.

    Article Snippet: Endpoint PCR and qPCR Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Real-time Polymerase Chain Reaction, Polymerase Chain Reaction, Amplification, Formalin-fixed Paraffin-Embedded

    PCR Inhibition by Bisulfite-Converted Template DNA from FFPE Tissues. (A) qPCR–amplification of different amounts (10–3,840 ng) of bisulfite-converted template DNA from FFPE tissue using a 129-bp PCR fragment within the ACTB gene locus. 1 U and 4 U Taq polymerase were used for qPCR. Shown are the mean values (± standard deviations) from triplicate measurements. (B) PCR amplification of the specific PCR product was confirmed by agarose gel electrophoresis using 1 U (upper panel) and 4 U (lower panel) Taq polymerase.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: PCR Inhibition by Bisulfite-Converted Template DNA from FFPE Tissues. (A) qPCR–amplification of different amounts (10–3,840 ng) of bisulfite-converted template DNA from FFPE tissue using a 129-bp PCR fragment within the ACTB gene locus. 1 U and 4 U Taq polymerase were used for qPCR. Shown are the mean values (± standard deviations) from triplicate measurements. (B) PCR amplification of the specific PCR product was confirmed by agarose gel electrophoresis using 1 U (upper panel) and 4 U (lower panel) Taq polymerase.

    Article Snippet: Endpoint PCR and qPCR Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Polymerase Chain Reaction, Inhibition, Formalin-fixed Paraffin-Embedded, Real-time Polymerase Chain Reaction, Amplification, Agarose Gel Electrophoresis

    PCR Inhibition by Template DNA from FFPE Tissues with Regard to PCR Conditions (dNTP Concentration and Thermal Cycling Profile). Shown are qPCR results applying a 200-bp fragment within the PITX2 gene locus using template DNA from FFPE tissue (80-1,920 ng) in the presence of 1 U Taq polymerase. (A) dNTP concentrations and (B) annealing and elongation times were varied. Shown are the mean values (± standard deviations) from triplicate measurements.

    Journal: PLoS ONE

    Article Title: Improved PCR Performance Using Template DNA from Formalin-Fixed and Paraffin-Embedded Tissues by Overcoming PCR Inhibition

    doi: 10.1371/journal.pone.0077771

    Figure Lengend Snippet: PCR Inhibition by Template DNA from FFPE Tissues with Regard to PCR Conditions (dNTP Concentration and Thermal Cycling Profile). Shown are qPCR results applying a 200-bp fragment within the PITX2 gene locus using template DNA from FFPE tissue (80-1,920 ng) in the presence of 1 U Taq polymerase. (A) dNTP concentrations and (B) annealing and elongation times were varied. Shown are the mean values (± standard deviations) from triplicate measurements.

    Article Snippet: Endpoint PCR and qPCR Endpoint PCR was conducted in a total volume of 20 µL containing 0.4 µM each primer , 0.25 mM each dNTP, 1 U or 4 U FastStart Taq DNA polymerase (Roche, Basel, Switzerland) and 1 x FastStart Taq PCR reaction buffer with 2 mM MgCl2 .

    Techniques: Polymerase Chain Reaction, Inhibition, Formalin-fixed Paraffin-Embedded, Concentration Assay, Real-time Polymerase Chain Reaction

    Sequences of contaminating bacterial DNA in three Taq polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Sequences of contaminating bacterial DNA in three Taq polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.

    Article Snippet: Taq polymerases The following DNA polymerases from commercial vendors designed for qPCR were used in the experiments reported here: Amplitaq Gold (ABI, CA; Roche lot # J02913); Platinum Taq (Invitrogen, CA; cat # 10966–026; lot 1169610); Platinum HiFi Taq (Invitrogen, CA; cat# 11304–011; lot# 1267490); HotStar Taq (Qiagen, CA; Mat # 1007837; lot # 124125007); JumpStart Taq (Sigma, MO; cat # D-6558; lot # 71K9029).

    Techniques: Sequencing, Polymerase Chain Reaction

    Approximating the copy number of 16S rDNA in commercial Taq polymerases. Six DNA polymerases were used with primers for 16S rDNA on 7 serial 10-fold dilutions of E. coli genomic DNA (10 ng to 10 fg) with no added DNA in the 8 th sample. The least squares fit equation for each dilution series was used to assign a value to the signal from the 8 th sample, which contains Taq-associated DNA only. The efficiency of the reaction was determined from the slope of the linear fit plotting the base10 log of the DNA concentration vs. the threshold cycle. A slope of −3.322 indicates an average doubling rate of “2,” which is approximately 100% efficiency (2̂3.322∼10). The rDNA values assigned are for “E. coli equivalents.”

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Approximating the copy number of 16S rDNA in commercial Taq polymerases. Six DNA polymerases were used with primers for 16S rDNA on 7 serial 10-fold dilutions of E. coli genomic DNA (10 ng to 10 fg) with no added DNA in the 8 th sample. The least squares fit equation for each dilution series was used to assign a value to the signal from the 8 th sample, which contains Taq-associated DNA only. The efficiency of the reaction was determined from the slope of the linear fit plotting the base10 log of the DNA concentration vs. the threshold cycle. A slope of −3.322 indicates an average doubling rate of “2,” which is approximately 100% efficiency (2̂3.322∼10). The rDNA values assigned are for “E. coli equivalents.”

    Article Snippet: Taq polymerases The following DNA polymerases from commercial vendors designed for qPCR were used in the experiments reported here: Amplitaq Gold (ABI, CA; Roche lot # J02913); Platinum Taq (Invitrogen, CA; cat # 10966–026; lot 1169610); Platinum HiFi Taq (Invitrogen, CA; cat# 11304–011; lot# 1267490); HotStar Taq (Qiagen, CA; Mat # 1007837; lot # 124125007); JumpStart Taq (Sigma, MO; cat # D-6558; lot # 71K9029).

    Techniques: Concentration Assay

    Detection of Pseudomonas fluorescens at high and low Taq polymerase concentrations. Bacterial detection with 0.5 Units (A) or 0.05 Units (B) Qiagen Taq DNA polymerase with 16S350B assay on samples containing 10 3 , 10 2 , 10 1 and zero Pseudomonas fluorescens bacteria. A composite of A and B is shown in C.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Detection of Pseudomonas fluorescens at high and low Taq polymerase concentrations. Bacterial detection with 0.5 Units (A) or 0.05 Units (B) Qiagen Taq DNA polymerase with 16S350B assay on samples containing 10 3 , 10 2 , 10 1 and zero Pseudomonas fluorescens bacteria. A composite of A and B is shown in C.

    Article Snippet: Taq polymerases The following DNA polymerases from commercial vendors designed for qPCR were used in the experiments reported here: Amplitaq Gold (ABI, CA; Roche lot # J02913); Platinum Taq (Invitrogen, CA; cat # 10966–026; lot 1169610); Platinum HiFi Taq (Invitrogen, CA; cat# 11304–011; lot# 1267490); HotStar Taq (Qiagen, CA; Mat # 1007837; lot # 124125007); JumpStart Taq (Sigma, MO; cat # D-6558; lot # 71K9029).

    Techniques:

    Detection of bacterial DNA in six Taq polymerases. Four dilutions of six DNA polymerase were tested with primers for 16S rDNA in the presence of 100 pg (∼10̂5 16S rDNA) E. coli genomic DNA (circled) or H 2 O.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Detection of bacterial DNA in six Taq polymerases. Four dilutions of six DNA polymerase were tested with primers for 16S rDNA in the presence of 100 pg (∼10̂5 16S rDNA) E. coli genomic DNA (circled) or H 2 O.

    Article Snippet: Taq polymerases The following DNA polymerases from commercial vendors designed for qPCR were used in the experiments reported here: Amplitaq Gold (ABI, CA; Roche lot # J02913); Platinum Taq (Invitrogen, CA; cat # 10966–026; lot 1169610); Platinum HiFi Taq (Invitrogen, CA; cat# 11304–011; lot# 1267490); HotStar Taq (Qiagen, CA; Mat # 1007837; lot # 124125007); JumpStart Taq (Sigma, MO; cat # D-6558; lot # 71K9029).

    Techniques:

    Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.

    Article Snippet: Taq polymerases The following DNA polymerases from commercial vendors designed for qPCR were used in the experiments reported here: Amplitaq Gold (ABI, CA; Roche lot # J02913); Platinum Taq (Invitrogen, CA; cat # 10966–026; lot 1169610); Platinum HiFi Taq (Invitrogen, CA; cat# 11304–011; lot# 1267490); HotStar Taq (Qiagen, CA; Mat # 1007837; lot # 124125007); JumpStart Taq (Sigma, MO; cat # D-6558; lot # 71K9029).

    Techniques: Labeling

    Representative autoradiograms of clonal frequency analyses of HALT-C patients with low (patient 9, panel A), intermediate (patient 6, panel B) and high (patient 16, panel C) QS diversity and complexity. E2-HVR1 RT-PCRs were performed with Taq and HF-2 enzymes. PCR products were cloned as described in the Materials and Methods, and individual colonies were picked and re-amplified. Lane 1 represents the homoduplex (HD) control and represents the probe hybridized to itself. Lane 2 represents the heteroduplex profile of the heterogenous (ie not cloned) E2-HVR1 PCR product and is designated

    Journal: Virology Journal

    Article Title: Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis

    doi: 10.1186/1743-422X-2-41

    Figure Lengend Snippet: Representative autoradiograms of clonal frequency analyses of HALT-C patients with low (patient 9, panel A), intermediate (patient 6, panel B) and high (patient 16, panel C) QS diversity and complexity. E2-HVR1 RT-PCRs were performed with Taq and HF-2 enzymes. PCR products were cloned as described in the Materials and Methods, and individual colonies were picked and re-amplified. Lane 1 represents the homoduplex (HD) control and represents the probe hybridized to itself. Lane 2 represents the heteroduplex profile of the heterogenous (ie not cloned) E2-HVR1 PCR product and is designated "H". Panels D and E are graphical summaries of HMR and Complexity in the 3 patients.

    Article Snippet: Discussion In the current investigation, we found that the sensitivity of Taq and HF-2 enzymes in amplifying the E2-HVR1 were similar to the qualitative Roche COBAS Amplicor RT-PCR assay.

    Techniques: Polymerase Chain Reaction, Clone Assay, Amplification

    Comparison of quasipecies genetic diversity (assessed by HMR, Panel A) and complexity (panel B) values processed with Taq or HF-2 polymerases, in 12 HCV/HIV co-infected samples treated (N = 7) or not treated (N = 5) with HAART. The box plots represent the means and ranges of the HMR and complexity scores for 240 HVR1 clones amplified by each polymerase, for a total of 480 clones (12 patients × 20 clones/patient × 2 enzymes). Error bars represent standard deviations. Wilcoxon Signed Ranks tests determined that all differences were not statistically significant.

    Journal: Virology Journal

    Article Title: Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis

    doi: 10.1186/1743-422X-2-41

    Figure Lengend Snippet: Comparison of quasipecies genetic diversity (assessed by HMR, Panel A) and complexity (panel B) values processed with Taq or HF-2 polymerases, in 12 HCV/HIV co-infected samples treated (N = 7) or not treated (N = 5) with HAART. The box plots represent the means and ranges of the HMR and complexity scores for 240 HVR1 clones amplified by each polymerase, for a total of 480 clones (12 patients × 20 clones/patient × 2 enzymes). Error bars represent standard deviations. Wilcoxon Signed Ranks tests determined that all differences were not statistically significant.

    Article Snippet: Discussion In the current investigation, we found that the sensitivity of Taq and HF-2 enzymes in amplifying the E2-HVR1 were similar to the qualitative Roche COBAS Amplicor RT-PCR assay.

    Techniques: Infection, Clone Assay, Amplification

    Comparison of the sensitivity of the E2-HVR1 PCR using Taq and HF-2 enzymes. RNA was extracted from duplicate serial dilutions of a WHO HCV standard and RT-PCR was performed with Taq and HF-2 enzymes. The dilutions corresponded to 50,000 (5K), 1,000 (1K), 500, 100, and 50 IU/ml, and are indicated above each lane. The position of the 176 bp E2-HVR1 is indicated with arrows. MW represents the 100 base pair DNA molecular weight marker. Below each lane is the result of testing of the same dilution of the standard with the Roche COBAS Amplicor assay. The result of this test gives a positive (+) or negative (-) result.

    Journal: Virology Journal

    Article Title: Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis

    doi: 10.1186/1743-422X-2-41

    Figure Lengend Snippet: Comparison of the sensitivity of the E2-HVR1 PCR using Taq and HF-2 enzymes. RNA was extracted from duplicate serial dilutions of a WHO HCV standard and RT-PCR was performed with Taq and HF-2 enzymes. The dilutions corresponded to 50,000 (5K), 1,000 (1K), 500, 100, and 50 IU/ml, and are indicated above each lane. The position of the 176 bp E2-HVR1 is indicated with arrows. MW represents the 100 base pair DNA molecular weight marker. Below each lane is the result of testing of the same dilution of the standard with the Roche COBAS Amplicor assay. The result of this test gives a positive (+) or negative (-) result.

    Article Snippet: Discussion In the current investigation, we found that the sensitivity of Taq and HF-2 enzymes in amplifying the E2-HVR1 were similar to the qualitative Roche COBAS Amplicor RT-PCR assay.

    Techniques: Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Molecular Weight, Marker

    Comparison of quasipecies genetic diversity (assessed by HMR, Panel A) and complexity (panel B) values in samples processed with Taq or HF-2 polymerases in HALT-C baseline specimens. The box plots represent the means and ranges of the HMR and complexity scores for 400 HVR1 clones amplified by each polymerase, for a total of 800 clones (20 patients × 20 clones/patient × 2 enzymes). Error bars represent standard deviations. Significance values above each panel were derived from Wilcoxon Signed Ranks tests.

    Journal: Virology Journal

    Article Title: Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis

    doi: 10.1186/1743-422X-2-41

    Figure Lengend Snippet: Comparison of quasipecies genetic diversity (assessed by HMR, Panel A) and complexity (panel B) values in samples processed with Taq or HF-2 polymerases in HALT-C baseline specimens. The box plots represent the means and ranges of the HMR and complexity scores for 400 HVR1 clones amplified by each polymerase, for a total of 800 clones (20 patients × 20 clones/patient × 2 enzymes). Error bars represent standard deviations. Significance values above each panel were derived from Wilcoxon Signed Ranks tests.

    Article Snippet: Discussion In the current investigation, we found that the sensitivity of Taq and HF-2 enzymes in amplifying the E2-HVR1 were similar to the qualitative Roche COBAS Amplicor RT-PCR assay.

    Techniques: Clone Assay, Amplification, Derivative Assay

    Comparison of quasipecies genetic diversity (assessed by HMR, Panel A) and complexity (panel B) scores generated with Taq or HF-2 polymerases, in 20 HALT-C samples who were HCV RNA negative (N = 6) or HCV RNA positive (N = 14) at week 20 (W20) of pegylated IFN plus ribavirin therapy. The box plots represent the means and ranges of the HMR and complexity scores for 400 HVR1 clones amplified by each polymerase, for a total of 800 clones (20 patients × 20 clones/patient × 2 enzymes). Error bars represent standard deviations. Wilcoxon Signed Ranks tests determined that the differences between enzymes and patient groups were not statistically significant.

    Journal: Virology Journal

    Article Title: Comparison of amplification enzymes for Hepatitis C Virus quasispecies analysis

    doi: 10.1186/1743-422X-2-41

    Figure Lengend Snippet: Comparison of quasipecies genetic diversity (assessed by HMR, Panel A) and complexity (panel B) scores generated with Taq or HF-2 polymerases, in 20 HALT-C samples who were HCV RNA negative (N = 6) or HCV RNA positive (N = 14) at week 20 (W20) of pegylated IFN plus ribavirin therapy. The box plots represent the means and ranges of the HMR and complexity scores for 400 HVR1 clones amplified by each polymerase, for a total of 800 clones (20 patients × 20 clones/patient × 2 enzymes). Error bars represent standard deviations. Wilcoxon Signed Ranks tests determined that the differences between enzymes and patient groups were not statistically significant.

    Article Snippet: Discussion In the current investigation, we found that the sensitivity of Taq and HF-2 enzymes in amplifying the E2-HVR1 were similar to the qualitative Roche COBAS Amplicor RT-PCR assay.

    Techniques: Generated, Clone Assay, Amplification

    Activity of Taq DNA polymerase, the Stoffel fragment, Pfu polB, and the hybrid polymerases in salts. Initial rates of primer extension reactions for the proteins were determined as described in Materials and Methods , and the dependencies of the rates for enzymes with Taq polymerase catalytic domain on salt concentrations were plotted for NaCl ( A ), KCl ( B ), and potassium glutamate ( C . The dependencies of the rates for enzymes with Pfu polymerase catalytic domain are collected in D.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases

    doi: 10.1073/pnas.202127199

    Figure Lengend Snippet: Activity of Taq DNA polymerase, the Stoffel fragment, Pfu polB, and the hybrid polymerases in salts. Initial rates of primer extension reactions for the proteins were determined as described in Materials and Methods , and the dependencies of the rates for enzymes with Taq polymerase catalytic domain on salt concentrations were plotted for NaCl ( A ), KCl ( B ), and potassium glutamate ( C . The dependencies of the rates for enzymes with Pfu polymerase catalytic domain are collected in D.

    Article Snippet: Taq DNA polymerase and its Klen Taq variant were purchased from Roche Molecular Biochemicals and from GeneCraft (Munster, Germany), respectively.

    Techniques: Activity Assay

    Schematic representation of chimeric polymerases. ( A ) Domain organization of Taq DNA polymerase in which helices are represented by cylinders and β-strands by arrows. This structure has been modeled by using two available x-ray structures of Taq polymerase (in “open” and “closed” conformations; for details, see Text , which is published as supporting information on the PNAS web site). The polymerase and inactive 3′-5′ exonuclease domains are colored gray, and the 5′-3-exonuclease domain is colored green. Several amino-terminal and carboxyl-terminal amino acids are colored magenta and red, respectively. The only HhH motif in the 5′-3′ exonuclease domain is colored gold. DNA strands are colored cyan and orange. ( B ) Cartoon illustration of chimeric constructs. HhH repeats of Topo V are colored yellow ( H – L ), orange-yellow gradient ( E – G ), orange ( C and D ), and rainbow ( A and B ). Arrows indicate cleavage positions that result in C1–C3 domains (in case of Topo V) and the Stoffel fragment (in case of Taq polymerase).

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases

    doi: 10.1073/pnas.202127199

    Figure Lengend Snippet: Schematic representation of chimeric polymerases. ( A ) Domain organization of Taq DNA polymerase in which helices are represented by cylinders and β-strands by arrows. This structure has been modeled by using two available x-ray structures of Taq polymerase (in “open” and “closed” conformations; for details, see Text , which is published as supporting information on the PNAS web site). The polymerase and inactive 3′-5′ exonuclease domains are colored gray, and the 5′-3-exonuclease domain is colored green. Several amino-terminal and carboxyl-terminal amino acids are colored magenta and red, respectively. The only HhH motif in the 5′-3′ exonuclease domain is colored gold. DNA strands are colored cyan and orange. ( B ) Cartoon illustration of chimeric constructs. HhH repeats of Topo V are colored yellow ( H – L ), orange-yellow gradient ( E – G ), orange ( C and D ), and rainbow ( A and B ). Arrows indicate cleavage positions that result in C1–C3 domains (in case of Topo V) and the Stoffel fragment (in case of Taq polymerase).

    Article Snippet: Taq DNA polymerase and its Klen Taq variant were purchased from Roche Molecular Biochemicals and from GeneCraft (Munster, Germany), respectively.

    Techniques: Construct

    Processivity of Taq DNA polymerase, the Stoffel fragment, Pfu polB, and the hybrid polymerases in salts. Processivities of enzymes in primer extension reactions were determined as described in Materials and Methods , and the dependencies of Pe for enzymes with Taq polymerase catalytic domain on salt concentrations were plotted for NaCl ( A ), KCl ( B ), and potassium glutamate ( C ). The dependencies of Pe for enzymes with Pfu polymerase catalytic domain are collected in D.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases

    doi: 10.1073/pnas.202127199

    Figure Lengend Snippet: Processivity of Taq DNA polymerase, the Stoffel fragment, Pfu polB, and the hybrid polymerases in salts. Processivities of enzymes in primer extension reactions were determined as described in Materials and Methods , and the dependencies of Pe for enzymes with Taq polymerase catalytic domain on salt concentrations were plotted for NaCl ( A ), KCl ( B ), and potassium glutamate ( C ). The dependencies of Pe for enzymes with Pfu polymerase catalytic domain are collected in D.

    Article Snippet: Taq DNA polymerase and its Klen Taq variant were purchased from Roche Molecular Biochemicals and from GeneCraft (Munster, Germany), respectively.

    Techniques:

    Thermostability of Taq DNA polymerase, the Stoffel fragment, Pfu polB, Taq polymerase-Topo V, and Pfu polB chimeras at 100°C in 1 M potassium glutamate and 1 M betaine.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Helix-hairpin-helix motifs confer salt resistance and processivity on chimeric DNA polymerases

    doi: 10.1073/pnas.202127199

    Figure Lengend Snippet: Thermostability of Taq DNA polymerase, the Stoffel fragment, Pfu polB, Taq polymerase-Topo V, and Pfu polB chimeras at 100°C in 1 M potassium glutamate and 1 M betaine.

    Article Snippet: Taq DNA polymerase and its Klen Taq variant were purchased from Roche Molecular Biochemicals and from GeneCraft (Munster, Germany), respectively.

    Techniques: