taq dna polymerase  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
    Name:
    Hot Star taq
    Description:

    Catalog Number:
    HST3672000
    Price:
    None
    Score:
    85
    		Buy from Supplier

    Structured Review

    Qiagen taq dna polymerase
    Sequences of contaminating bacterial <t>DNA</t> in three <t>Taq</t> polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.

    https://www.bioz.com/result/taq dna polymerase/product/Qiagen
    Average 99 stars, based on 781 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2019-12
    99/100 stars

    Related Products / Commonly Used Together

    taq dna polymerase Thermo Fisher
    taq dna polymerase Promega
    mgcl2 Thermo Fisher
    taq dna polymerase New England Biolabs
    taq dna polymerase Takara
    taq dna polymerase Roche
    taq dna polymerase Qiagen
    dntp Thermo Fisher
    dntps Thermo Fisher
    pcr buffer Thermo Fisher
    mgcl2 Promega
    trizol reagent Thermo Fisher
    taq dna polymerase Millipore
    dntps Promega
    dntp Takara

    Images

    1) Product Images from "Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria"

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0007010

    Sequences of contaminating bacterial DNA in three Taq polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.
    Figure Legend Snippet: Sequences of contaminating bacterial DNA in three Taq polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.

    Techniques Used: Sequencing, Polymerase Chain Reaction

    Approximating the copy number of 16S rDNA in commercial Taq polymerases. Six DNA polymerases were used with primers for 16S rDNA on 7 serial 10-fold dilutions of E. coli genomic DNA (10 ng to 10 fg) with no added DNA in the 8 th sample. The least squares fit equation for each dilution series was used to assign a value to the signal from the 8 th sample, which contains Taq-associated DNA only. The efficiency of the reaction was determined from the slope of the linear fit plotting the base10 log of the DNA concentration vs. the threshold cycle. A slope of −3.322 indicates an average doubling rate of “2,” which is approximately 100% efficiency (2̂3.322∼10). The rDNA values assigned are for “E. coli equivalents.”
    Figure Legend Snippet: Approximating the copy number of 16S rDNA in commercial Taq polymerases. Six DNA polymerases were used with primers for 16S rDNA on 7 serial 10-fold dilutions of E. coli genomic DNA (10 ng to 10 fg) with no added DNA in the 8 th sample. The least squares fit equation for each dilution series was used to assign a value to the signal from the 8 th sample, which contains Taq-associated DNA only. The efficiency of the reaction was determined from the slope of the linear fit plotting the base10 log of the DNA concentration vs. the threshold cycle. A slope of −3.322 indicates an average doubling rate of “2,” which is approximately 100% efficiency (2̂3.322∼10). The rDNA values assigned are for “E. coli equivalents.”

    Techniques Used: Concentration Assay

    Detection of Pseudomonas fluorescens at high and low Taq polymerase concentrations. Bacterial detection with 0.5 Units (A) or 0.05 Units (B) Qiagen Taq DNA polymerase with 16S350B assay on samples containing 10 3 , 10 2 , 10 1 and zero Pseudomonas fluorescens bacteria. A composite of A and B is shown in C.
    Figure Legend Snippet: Detection of Pseudomonas fluorescens at high and low Taq polymerase concentrations. Bacterial detection with 0.5 Units (A) or 0.05 Units (B) Qiagen Taq DNA polymerase with 16S350B assay on samples containing 10 3 , 10 2 , 10 1 and zero Pseudomonas fluorescens bacteria. A composite of A and B is shown in C.

    Techniques Used:

    Detection of bacterial DNA in six Taq polymerases. Four dilutions of six DNA polymerase were tested with primers for 16S rDNA in the presence of 100 pg (∼10̂5 16S rDNA) E. coli genomic DNA (circled) or H 2 O.
    Figure Legend Snippet: Detection of bacterial DNA in six Taq polymerases. Four dilutions of six DNA polymerase were tested with primers for 16S rDNA in the presence of 100 pg (∼10̂5 16S rDNA) E. coli genomic DNA (circled) or H 2 O.

    Techniques Used:

    Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.
    Figure Legend Snippet: Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.

    Techniques Used: Labeling

    2) Product Images from "Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria"

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0007010

    Sequences of contaminating bacterial DNA in three Taq polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.
    Figure Legend Snippet: Sequences of contaminating bacterial DNA in three Taq polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.

    Techniques Used: Sequencing, Polymerase Chain Reaction

    Approximating the copy number of 16S rDNA in commercial Taq polymerases. Six DNA polymerases were used with primers for 16S rDNA on 7 serial 10-fold dilutions of E. coli genomic DNA (10 ng to 10 fg) with no added DNA in the 8 th sample. The least squares fit equation for each dilution series was used to assign a value to the signal from the 8 th sample, which contains Taq-associated DNA only. The efficiency of the reaction was determined from the slope of the linear fit plotting the base10 log of the DNA concentration vs. the threshold cycle. A slope of −3.322 indicates an average doubling rate of “2,” which is approximately 100% efficiency (2̂3.322∼10). The rDNA values assigned are for “E. coli equivalents.”
    Figure Legend Snippet: Approximating the copy number of 16S rDNA in commercial Taq polymerases. Six DNA polymerases were used with primers for 16S rDNA on 7 serial 10-fold dilutions of E. coli genomic DNA (10 ng to 10 fg) with no added DNA in the 8 th sample. The least squares fit equation for each dilution series was used to assign a value to the signal from the 8 th sample, which contains Taq-associated DNA only. The efficiency of the reaction was determined from the slope of the linear fit plotting the base10 log of the DNA concentration vs. the threshold cycle. A slope of −3.322 indicates an average doubling rate of “2,” which is approximately 100% efficiency (2̂3.322∼10). The rDNA values assigned are for “E. coli equivalents.”

    Techniques Used: Concentration Assay

    Detection of Pseudomonas fluorescens at high and low Taq polymerase concentrations. Bacterial detection with 0.5 Units (A) or 0.05 Units (B) Qiagen Taq DNA polymerase with 16S350B assay on samples containing 10 3 , 10 2 , 10 1 and zero Pseudomonas fluorescens bacteria. A composite of A and B is shown in C.
    Figure Legend Snippet: Detection of Pseudomonas fluorescens at high and low Taq polymerase concentrations. Bacterial detection with 0.5 Units (A) or 0.05 Units (B) Qiagen Taq DNA polymerase with 16S350B assay on samples containing 10 3 , 10 2 , 10 1 and zero Pseudomonas fluorescens bacteria. A composite of A and B is shown in C.

    Techniques Used:

    Detection of bacterial DNA in six Taq polymerases. Four dilutions of six DNA polymerase were tested with primers for 16S rDNA in the presence of 100 pg (∼10̂5 16S rDNA) E. coli genomic DNA (circled) or H 2 O.
    Figure Legend Snippet: Detection of bacterial DNA in six Taq polymerases. Four dilutions of six DNA polymerase were tested with primers for 16S rDNA in the presence of 100 pg (∼10̂5 16S rDNA) E. coli genomic DNA (circled) or H 2 O.

    Techniques Used:

    Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.
    Figure Legend Snippet: Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.

    Techniques Used: Labeling

    3) Product Images from "Conversion of Topoisomerase I Cleavage Complexes on the Leading Strand of Ribosomal DNA into 5?-Phosphorylated DNA Double-Strand Breaks by Replication Runoff"

    Article Title: Conversion of Topoisomerase I Cleavage Complexes on the Leading Strand of Ribosomal DNA into 5?-Phosphorylated DNA Double-Strand Breaks by Replication Runoff

    Journal:

    doi:

    Diagram of the LM-PCR protocol to detect top1-induced DNA single-strand breaks and replication-mediated DNA double-strand breaks. Top1 is shown as a shaded oval with covalent linkage to the 3′ end of a DNA single-strand break. In the assay for top1-induced DNA single-strand breaks, top1-induced DNA single-strand breaks (i.e., top1 cleavage complexes) were detected (upper left) as described previously by annealing primer 1 (P1) to denatured genomic DNA. After primer extension and in vitro phosphorylation of the 5′-OH termini with T4 polynucleotide kinase, ligation to the double-stranded linker was performed. Thereafter, rRNA gene-specific DNA fragments were amplified with Taq DNA polymerase using the linker-primer and a nested, gene-specific PCR primer. After 26 cycles of PCR, a third primer (5′ end labeled with 32 P; star) was used for two primer extension cycles before the samples were separated in 7% denaturing polyacrylamide gels. In the assay for replication-mediated DNA double-strand breaks, collision between a replication fork and a top1 cleavage complex is proposed to lead to replication runoff, with generation of a DNA double-strand break (upper right). Because of in vivo 5′-end phosphorylation of replication-mediated DNA double-strand breaks, ligation to the linker could be performed without prior T4 polynucleotide kinase reaction. The following reaction steps were the same as for the detection of top1-induced DNA single-strand breaks. Note that the single-strand break assay detects both single- and double-strand breaks.
    Figure Legend Snippet: Diagram of the LM-PCR protocol to detect top1-induced DNA single-strand breaks and replication-mediated DNA double-strand breaks. Top1 is shown as a shaded oval with covalent linkage to the 3′ end of a DNA single-strand break. In the assay for top1-induced DNA single-strand breaks, top1-induced DNA single-strand breaks (i.e., top1 cleavage complexes) were detected (upper left) as described previously by annealing primer 1 (P1) to denatured genomic DNA. After primer extension and in vitro phosphorylation of the 5′-OH termini with T4 polynucleotide kinase, ligation to the double-stranded linker was performed. Thereafter, rRNA gene-specific DNA fragments were amplified with Taq DNA polymerase using the linker-primer and a nested, gene-specific PCR primer. After 26 cycles of PCR, a third primer (5′ end labeled with 32 P; star) was used for two primer extension cycles before the samples were separated in 7% denaturing polyacrylamide gels. In the assay for replication-mediated DNA double-strand breaks, collision between a replication fork and a top1 cleavage complex is proposed to lead to replication runoff, with generation of a DNA double-strand break (upper right). Because of in vivo 5′-end phosphorylation of replication-mediated DNA double-strand breaks, ligation to the linker could be performed without prior T4 polynucleotide kinase reaction. The following reaction steps were the same as for the detection of top1-induced DNA single-strand breaks. Note that the single-strand break assay detects both single- and double-strand breaks.

    Techniques Used: Polymerase Chain Reaction, In Vitro, Ligation, Amplification, Labeling, In Vivo

    4) Product Images from "Detection of knockdown resistance (kdr) mutations in Anopheles gambiae: a comparison of two new high-throughput assays with existing methods"

    Article Title: Detection of knockdown resistance (kdr) mutations in Anopheles gambiae: a comparison of two new high-throughput assays with existing methods

    Journal: Malaria Journal

    doi: 10.1186/1475-2875-6-111

    Examples of AS-PCR products for kdr -e and kdr -w genotyping . Gels A to D show examples of AS-PCR results using four different protocols, A [29], B [11], C [12], D [20]. Gels E to G show the result of using different DNA polymerases on the AS-PCR method described by [20], E: Promega PCR master mix, F: Qiagen HotStar Taq G:Finzymes Dynazyme II Gel H is an example of results of using the protocol of [20] with the Promega PCR master mix to genotype samples using the kdr -e assay from the 96 reference plate and gel I for the kdr -w assay. The same DNA templates were used in PCRs shown in gels A to G and from left to right were 100 bp DNA Ladder (Fermentas), homozygous wildtype, homozygous wildtype, heterozygous, heterozygous, homozygous mutant, homozygous mutant.
    Figure Legend Snippet: Examples of AS-PCR products for kdr -e and kdr -w genotyping . Gels A to D show examples of AS-PCR results using four different protocols, A [29], B [11], C [12], D [20]. Gels E to G show the result of using different DNA polymerases on the AS-PCR method described by [20], E: Promega PCR master mix, F: Qiagen HotStar Taq G:Finzymes Dynazyme II Gel H is an example of results of using the protocol of [20] with the Promega PCR master mix to genotype samples using the kdr -e assay from the 96 reference plate and gel I for the kdr -w assay. The same DNA templates were used in PCRs shown in gels A to G and from left to right were 100 bp DNA Ladder (Fermentas), homozygous wildtype, homozygous wildtype, heterozygous, heterozygous, homozygous mutant, homozygous mutant.

    Techniques Used: Polymerase Chain Reaction, Mutagenesis

    Related Articles

    Clone Assay:

    Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells
    Article Snippet: For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Hot Star Taq polymerase (Qiagen) and 2 μl of converted DNA. .. Subsequently, PCR products were verified by agarose gel electrophoresis and subcloned into the pCR4-TOPO vector (Invitrogen, Groningen, Netherlands).

    Amplification:

    Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells
    Article Snippet: The reaction was incubated at 42°C for 50 minutes, and then the reverse transcriptase was inactivated at 70°C for 10 minutes. .. After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Hot Star Taq (Qiagen, Valencia, CA), 2.5 mM MgCl2 , and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer. .. Cycling conditions included an initial denaturation step at 95°C for 15 minutes, then 1 minute at each of 94°C, 66–68°C and 72°C for 45–55 cycles and a final extension of 7 minutes at 72°C.

    Article Title: Isolation and Characterization of Vibrio tubiashii Outer Membrane Proteins and Determination of a toxR Homolog
    Article Snippet: PCR analysis was carried out using a general master mix, and each reaction mixture contained 2 μl of a 3 μM concentration of the forward, 5′-end primer and 2 μl of a 3 μM concentration of the reverse, 3′-end primer (Invitrogen Corporation, Carlsbad, CA), 5 μl of 10× Tris-borate-EDTA buffer (Qiagen, Inc., Valencia, CA), 2 μl of 25 mM MgCl2 (Qiagen, Inc.), 2 μl of a 10 mM concentration of the deoxynucleoside triphosphates or 10 μl of a 2 mM concentration of the deoxynucleoside triphosphates (Invitrogen Corporation), and 0.5 μl of Hot Star Taq (Qiagen, Inc.). .. PCR analysis was carried out using a general master mix, and each reaction mixture contained 2 μl of a 3 μM concentration of the forward, 5′-end primer and 2 μl of a 3 μM concentration of the reverse, 3′-end primer (Invitrogen Corporation, Carlsbad, CA), 5 μl of 10× Tris-borate-EDTA buffer (Qiagen, Inc., Valencia, CA), 2 μl of 25 mM MgCl2 (Qiagen, Inc.), 2 μl of a 10 mM concentration of the deoxynucleoside triphosphates or 10 μl of a 2 mM concentration of the deoxynucleoside triphosphates (Invitrogen Corporation), and 0.5 μl of Hot Star Taq (Qiagen, Inc.).

    Article Title: Expression of tissue factor in pancreatic adenocarcinoma is associated with activation of coagulation
    Article Snippet: Isolated total RNA (1 μg, determined photometrically) was reverse transcribed using Superscript II reverse transcriptase (Invitrogen; Karlsruhe, Germany) and oligo-dT primers. .. The resulting cDNA was amplified in separate tubes using Hot Star Taq (Qiagen; Hilden, Germany). .. Oligonucleotides corresponded to TF nucleotides 221-244 and 1013-1036, respectively.

    Article Title: Common variants near ABCA1, AFAP1 and GMDS confer risk of primary open-angle glaucoma
    Article Snippet: PCR was performed using the Hot Star Taq Plus polymerase (Qiagen) and gene-specific primers ( ). .. PCR was performed using the Hot Star Taq Plus polymerase (Qiagen) and gene-specific primers ( ).

    Article Title: Frequent p16-Independent Inactivation of p14ARF in Human Melanoma
    Article Snippet: Amplifications were carried out in 20 μL using 100 ng DNA of genomic DNA and a mastermix consisting of purified, autoclaved water; MgCl2 buffer (Qiagen); DMSO (Sigma-Aldrich, St Louis, MO); mixed dinucleotide triphosphates (dNTPs) (Roche, Indianapolis, IN); forward and reverse primers (Applied Biosystems, Foster City, CA); and Hot Start Taq (Qiagen) according to the manufacturer's instructions. .. Polymerase chain reaction (PCR) conditions were optimized using an Eppendorf Mastercycler Gradient thermal cycler, and PCRs were performed on that machine or the GeneAmp PCR System 9700 (Applied Biosystems).

    Article Title: Interleukin-28B Polymorphisms and Response of Chronic Hepatitis C Patients from Indonesia to Pegylated Interferon/Ribavirin Treatment
    Article Snippet: To amplify the NS5B region of the HCV genome, the extracted RNA was reverse transcribed and amplified using SuperScript One-Step reverse transcription-PCR (RT-PCR) (Invitrogen, Tokyo, Japan) and a set of primers. .. PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Hot Star Taq master mix (Qiagen).

    Article Title: Occurrence, Diversity, and Host Association of Intestinal Campylobacter, Arcobacter, and Helicobacter in Reptiles
    Article Snippet: For isolates for which atpA could not be sequenced, 16S rRNA encoding DNA sequencing was used using the 16S rDNA targeting primers 27F and 1492R . .. Each PCR amplification mixture contained 2.5 µM each primer, 1x Go Taq Hot Start Green Master Mix (Promega) or Hot Star Taq Master Mix (Qiagen) and 1 ng/µl genomic DNA. .. PCRs were performed on a 2720 Thermal Cycler (Applied Biosystems) with the following conditions: 30 s at 94°C, 30 s at 53°C, and 2 min at 72°C (35 (16S rRNA) or 40 cycles (atpA )).

    Article Title: Circulating tumour cell detection: a direct comparison between the CellSearch System, the AdnaTest and CK-19/mammaglobin RT-PCR in patients with metastatic breast cancer
    Article Snippet: PCR analyses were carried out in a final volume of 50 μ l PCR mixture, containing 8 μ l of cDNA, 4 μ l primer mixture (PrimerMix BreastDetect; AdnaGen), 25 μ l of Hot Star Taq Master Mix (Qiagen) and 13 μ l of distilled water. .. PCR analyses were carried out in a final volume of 50 μ l PCR mixture, containing 8 μ l of cDNA, 4 μ l primer mixture (PrimerMix BreastDetect; AdnaGen), 25 μ l of Hot Star Taq Master Mix (Qiagen) and 13 μ l of distilled water.

    Article Title: Methylated APC and GSTP1 genes in serum DNA correlate with the presence of circulating blood tumor cells and are associated with a more aggressive and advanced breast cancer disease
    Article Snippet: Multiplex PCR analyses were carried out in a final volume of 50 μl PCR mixture, containing 8 μl of cDNA, 4 μl primer mixtures (PrimerMix BreastDetect; AdnaGen), 25 μl of Hot Star Taq Master Mix (Qiagen) and 13 μl of distilled water. .. Multiplex PCR analyses were carried out in a final volume of 50 μl PCR mixture, containing 8 μl of cDNA, 4 μl primer mixtures (PrimerMix BreastDetect; AdnaGen), 25 μl of Hot Star Taq Master Mix (Qiagen) and 13 μl of distilled water.

    Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization
    Article Snippet: Briefly, enriched CD8+ T cells were stimulated with 5 μg/mL immunodominant H-2Kd -binding 197 AMQMLKETI205 , 9 mer Gag peptide for 16 h. Following stimulation, mRNA was prepared and cDNA was synthesized as described previously (Ranasinghe and others ). .. As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Hot Star Taq Master mix (Qiagen) (cycling as 1×95°C 2 min for Taq polymerase activation, followed by 20×95°C 15 s and 60°C 4 min amplification cycle), and the preamplified cDNA samples were diluted 1:5 and 2 μL of the diluted sample was used in each qRT-PCR reaction using primers indicated in . qRT-PCR was performed as 1×50°C, 2 min, 95°C, 10 min, followed by 40 cycles of (95°C, 15s, 60°C, 1 min) using an ABI Prism™ 7700 Sequence Detection System (Perkin Elmer/PE Applied Biosystems). .. All reactions were performed in duplicate and to ensure that single products were obtained after each reaction, the melting curves of the primers were also tested by dissociation runs as described previously (Ranasinghe and others ).

    Article Title: Comparing low coverage random shotgun sequence data from Brassica oleracea and Oryza sativa genome sequence for their ability to add to the annotation of Arabidopsis thaliana
    Article Snippet: For the PCR amplification step, the negative control for each primer pair was RNA instead of the RT product as template. .. Reagents from the Qiagen Hot Start TAQ Kit were used for the PCR reactions.

    Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement
    Article Snippet: Amplification of the 105 and 133 bp product of the two-microglobulin gene and the 247-bp product of the PGK gene was used to test the quality of the extracted RNA, as previously described [ , , ]. .. Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Hot Star Taq PCR Master Mix (QIAgen, Hilden, Germany), 10 pmol of each primer TRKC1059 complementary to NTRK3 with sequence (5′-CAGTTCTCGCTTCAGCACGATG-3′) and TEL971 complementary to ETV6 with sequence (5′-ACCACATCATGGTCTCTGTCTCCC-3′) and distilled water up to 25 μl.

    Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis
    Article Snippet: Bisulfite converted DNA was eluted in 20 µL of elution buffer and was subjected to PCR amplification of the specific region by use of a primer set designed to amplify both methylated and unmethylated sequences of the UTF1 gene promoter. .. Hot start Taq DNA polymerase High fidelity (Qiagen) was used to perform the PCR reaction.

    Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France
    Article Snippet: Cybergene Group), respectively. .. The PCR amplification mixture contained 12.5 μl Hot Start Taq polymerase master mix (QIAGEN), 0.5 μl of each primer (20 μM), and 10 ng of DNA template. .. 16S rRNA gene amplification reactions were cycled in a PTC200 thermocycler (MJ Research) with a hot start step at 94°C for 15 min followed by 35 cycles of 94°C for 1 min, 52°C for 1.5 min, and 72°C for 1 min, with a final extension step at 72°C for 10 min.

    Synthesized:

    Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization
    Article Snippet: Briefly, enriched CD8+ T cells were stimulated with 5 μg/mL immunodominant H-2Kd -binding 197 AMQMLKETI205 , 9 mer Gag peptide for 16 h. Following stimulation, mRNA was prepared and cDNA was synthesized as described previously (Ranasinghe and others ). .. As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Hot Star Taq Master mix (Qiagen) (cycling as 1×95°C 2 min for Taq polymerase activation, followed by 20×95°C 15 s and 60°C 4 min amplification cycle), and the preamplified cDNA samples were diluted 1:5 and 2 μL of the diluted sample was used in each qRT-PCR reaction using primers indicated in . qRT-PCR was performed as 1×50°C, 2 min, 95°C, 10 min, followed by 40 cycles of (95°C, 15s, 60°C, 1 min) using an ABI Prism™ 7700 Sequence Detection System (Perkin Elmer/PE Applied Biosystems).

    Quantitative RT-PCR:

    Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization
    Article Snippet: Briefly, enriched CD8+ T cells were stimulated with 5 μg/mL immunodominant H-2Kd -binding 197 AMQMLKETI205 , 9 mer Gag peptide for 16 h. Following stimulation, mRNA was prepared and cDNA was synthesized as described previously (Ranasinghe and others ). .. As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Hot Star Taq Master mix (Qiagen) (cycling as 1×95°C 2 min for Taq polymerase activation, followed by 20×95°C 15 s and 60°C 4 min amplification cycle), and the preamplified cDNA samples were diluted 1:5 and 2 μL of the diluted sample was used in each qRT-PCR reaction using primers indicated in . qRT-PCR was performed as 1×50°C, 2 min, 95°C, 10 min, followed by 40 cycles of (95°C, 15s, 60°C, 1 min) using an ABI Prism™ 7700 Sequence Detection System (Perkin Elmer/PE Applied Biosystems). .. All reactions were performed in duplicate and to ensure that single products were obtained after each reaction, the melting curves of the primers were also tested by dissociation runs as described previously (Ranasinghe and others ).

    SYBR Green Assay:

    Article Title: Serum of patients with acute myocardial infarction prevents inflammation in iPSC-cardiomyocytes
    Article Snippet: RNA was extracted from hiPSC-CMs by lysis with RLT lysis buffer, followed by the application of the RNeasy MiniKit (Qiagen) according to manufacturer’s instructions. cDNA synthesis was performed with oligo (dT) primers using AMV reverse transcriptase (Roche). .. For quantitative real time PCR, hot start Taq DNA-polymerase and SYBR-Green were used, together with commercially available primers (GAPDH, #PPH00150F; TNNT2, #PPH025619A; POUF51, #PPH02394E, Qiagen). .. The mean CT value of 3 to 6 biological replicates of three different differentiations was calculated from three technical replicates.

    Microarray:

    Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus
    Article Snippet: This primer combination detects the same dscr1 isoforms as the inflammation DNA microarray and amplifies a spliced transcript of 196 bp and would amplify a genomic fragment of 554 bp if genomic traces of DNA were present. .. The PCR was performed with the Hot Star Taq kit (QIAGEN) with the following PCR conditions: 15 min at 95°C followed by 22 to 24 cycles of 30 s at 94°C, 30 s at 57°C, 20 s at 72°C, and 7-min final extension at 72°C.

    Incubation:

    Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells
    Article Snippet: After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Hot Star Taq (Qiagen, Valencia, CA), 2.5 mM MgCl2 , and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer. .. After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Hot Star Taq (Qiagen, Valencia, CA), 2.5 mM MgCl2 , and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer.

    Expressing:

    Article Title: Expression of tissue factor in pancreatic adenocarcinoma is associated with activation of coagulation
    Article Snippet: For detection of concomitant expression of TF and asTF, cells were washed with PBS. .. The resulting cDNA was amplified in separate tubes using Hot Star Taq (Qiagen; Hilden, Germany).

    Article Title: Common variants near ABCA1, AFAP1 and GMDS confer risk of primary open-angle glaucoma
    Article Snippet: Paragraph title: Expression analysis of genes at associated loci in ocular tissues and cells ... PCR was performed using the Hot Star Taq Plus polymerase (Qiagen) and gene-specific primers ( ).

    Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus
    Article Snippet: The PCR was performed with the Hot Star Taq kit (QIAGEN) with the following PCR conditions: 15 min at 95°C followed by 22 to 24 cycles of 30 s at 94°C, 30 s at 57°C, 20 s at 72°C, and 7-min final extension at 72°C. .. PCR products were separated on 1.5% agarose gels and visualized by ethidium bromide staining.

    Article Title: Interleukin-28B Polymorphisms and Response of Chronic Hepatitis C Patients from Indonesia to Pegylated Interferon/Ribavirin Treatment
    Article Snippet: PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Hot Star Taq master mix (Qiagen). .. PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Hot Star Taq master mix (Qiagen).

    Article Title: Serum of patients with acute myocardial infarction prevents inflammation in iPSC-cardiomyocytes
    Article Snippet: For quantitative real time PCR, hot start Taq DNA-polymerase and SYBR-Green were used, together with commercially available primers (GAPDH, #PPH00150F; TNNT2, #PPH025619A; POUF51, #PPH02394E, Qiagen). .. For quantitative real time PCR, hot start Taq DNA-polymerase and SYBR-Green were used, together with commercially available primers (GAPDH, #PPH00150F; TNNT2, #PPH025619A; POUF51, #PPH02394E, Qiagen).

    Modification:

    Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes
    Article Snippet: DNA methylation of the promoters p16, MLH1, Mint1, Mint2, Mint31 , and MGMT genes was determined by MSP after chemical modification of genomic DNA with sodium bisulfite as described by Herman et al. DNA modification was performed using the Methylamp DNA modification kit (Epigentek, USA) according to the manufacturer's instructions. .. PCRs were performed in a total volume of 25 µl using 0.5 U of Taq Hot Star (Qiagen) and 1 µl of bisulfite-treated DNA.

    Western Blot:

    Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus
    Article Snippet: The PCR was performed with the Hot Star Taq kit (QIAGEN) with the following PCR conditions: 15 min at 95°C followed by 22 to 24 cycles of 30 s at 94°C, 30 s at 57°C, 20 s at 72°C, and 7-min final extension at 72°C. .. PCR products were separated on 1.5% agarose gels and visualized by ethidium bromide staining.

    Real-time Polymerase Chain Reaction:

    Article Title: Interleukin-28B Polymorphisms and Response of Chronic Hepatitis C Patients from Indonesia to Pegylated Interferon/Ribavirin Treatment
    Article Snippet: PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Hot Star Taq master mix (Qiagen). .. PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Hot Star Taq master mix (Qiagen).

    Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization
    Article Snippet: Paragraph title: mRNA preparation and quantitative real-time polymerase chain reaction analysis ... As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Hot Star Taq Master mix (Qiagen) (cycling as 1×95°C 2 min for Taq polymerase activation, followed by 20×95°C 15 s and 60°C 4 min amplification cycle), and the preamplified cDNA samples were diluted 1:5 and 2 μL of the diluted sample was used in each qRT-PCR reaction using primers indicated in . qRT-PCR was performed as 1×50°C, 2 min, 95°C, 10 min, followed by 40 cycles of (95°C, 15s, 60°C, 1 min) using an ABI Prism™ 7700 Sequence Detection System (Perkin Elmer/PE Applied Biosystems).

    Article Title: Serum of patients with acute myocardial infarction prevents inflammation in iPSC-cardiomyocytes
    Article Snippet: RNA was extracted from hiPSC-CMs by lysis with RLT lysis buffer, followed by the application of the RNeasy MiniKit (Qiagen) according to manufacturer’s instructions. cDNA synthesis was performed with oligo (dT) primers using AMV reverse transcriptase (Roche). .. For quantitative real time PCR, hot start Taq DNA-polymerase and SYBR-Green were used, together with commercially available primers (GAPDH, #PPH00150F; TNNT2, #PPH025619A; POUF51, #PPH02394E, Qiagen). .. The mean CT value of 3 to 6 biological replicates of three different differentiations was calculated from three technical replicates.

    Bisulfite Sequencing:

    Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells
    Article Snippet: Bisulphite treatment of 1 μg of DNA from each sample was performed with the EZ DNA Methylation-Gold Kit™ (Zymo Research Corp, USA, Freiburg, Germany) yielding 50 μl converted DNA from each sample. .. For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Hot Star Taq polymerase (Qiagen) and 2 μl of converted DNA. .. The initial denaturing step at 94°C for 15 min. was followed by 37 cycles each consisting of a denaturing step at 95°C for 30 sec., primer annealing at 59°C for 30 sec. and a 45 sec. elongation step at 72°C.

    PSQ Assay:

    Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis
    Article Snippet: The primers were designed using PSQ assay design software (Qiagen). .. Hot start Taq DNA polymerase High fidelity (Qiagen) was used to perform the PCR reaction.

    Transfection:

    Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus
    Article Snippet: SLK cells were plated at 3 × 105 cells/well of a six-well plate and transfected with Lipofectamine 2000. .. The PCR was performed with the Hot Star Taq kit (QIAGEN) with the following PCR conditions: 15 min at 95°C followed by 22 to 24 cycles of 30 s at 94°C, 30 s at 57°C, 20 s at 72°C, and 7-min final extension at 72°C.

    Concentration Assay:

    Article Title: Isolation and Characterization of Vibrio tubiashii Outer Membrane Proteins and Determination of a toxR Homolog
    Article Snippet: DNA templates were prepared according to the procedure described by Kothary et al. ( ). .. PCR analysis was carried out using a general master mix, and each reaction mixture contained 2 μl of a 3 μM concentration of the forward, 5′-end primer and 2 μl of a 3 μM concentration of the reverse, 3′-end primer (Invitrogen Corporation, Carlsbad, CA), 5 μl of 10× Tris-borate-EDTA buffer (Qiagen, Inc., Valencia, CA), 2 μl of 25 mM MgCl2 (Qiagen, Inc.), 2 μl of a 10 mM concentration of the deoxynucleoside triphosphates or 10 μl of a 2 mM concentration of the deoxynucleoside triphosphates (Invitrogen Corporation), and 0.5 μl of Hot Star Taq (Qiagen, Inc.). .. PCR amplification of each isolate was conducted using 5 μl of the DNA template and 45 μl of a master mix containing primers, for a total volume of 50 μl.

    Magnetic Beads:

    Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement
    Article Snippet: Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Hot Star Taq PCR Master Mix (QIAgen, Hilden, Germany), 10 pmol of each primer TRKC1059 complementary to NTRK3 with sequence (5′-CAGTTCTCGCTTCAGCACGATG-3′) and TEL971 complementary to ETV6 with sequence (5′-ACCACATCATGGTCTCTGTCTCCC-3′) and distilled water up to 25 μl. .. The amplification program comprised of denaturation at 95 °C for 14 min and 45 cycles of denaturation at 95 °C for 1 min, annealing at 65 °C for 1 min and extension at 72 °C for 1 min.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells
    Article Snippet: Paragraph title: Single Cell RT-PCR ... After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Hot Star Taq (Qiagen, Valencia, CA), 2.5 mM MgCl2 , and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer.

    Article Title: Expression of tissue factor in pancreatic adenocarcinoma is associated with activation of coagulation
    Article Snippet: Paragraph title: RT-PCR ... The resulting cDNA was amplified in separate tubes using Hot Star Taq (Qiagen; Hilden, Germany).

    Article Title: Involution of the mouse mammary gland is associated with an immune cascade and an acute-phase response, involving LBP, CD14 and STAT3
    Article Snippet: Paragraph title: Reverse transcriptase polymerase chain reaction (RT–PCR) ... This cDNA (1 μl) was used in each PCR reaction with Hot-Star Taq polymerase (Qiagen).

    Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus
    Article Snippet: Paragraph title: Reverse transcription-PCR (RT-PCR). ... The PCR was performed with the Hot Star Taq kit (QIAGEN) with the following PCR conditions: 15 min at 95°C followed by 22 to 24 cycles of 30 s at 94°C, 30 s at 57°C, 20 s at 72°C, and 7-min final extension at 72°C.

    Article Title: Interleukin-28B Polymorphisms and Response of Chronic Hepatitis C Patients from Indonesia to Pegylated Interferon/Ribavirin Treatment
    Article Snippet: To amplify the NS5B region of the HCV genome, the extracted RNA was reverse transcribed and amplified using SuperScript One-Step reverse transcription-PCR (RT-PCR) (Invitrogen, Tokyo, Japan) and a set of primers. .. PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Hot Star Taq master mix (Qiagen).

    Article Title: Comparing low coverage random shotgun sequence data from Brassica oleracea and Oryza sativa genome sequence for their ability to add to the annotation of Arabidopsis thaliana
    Article Snippet: Paragraph title: RT–PCR and sequencing hypothetical genes and CCURs ... Reagents from the Qiagen Hot Start TAQ Kit were used for the PCR reactions.

    Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement
    Article Snippet: Paragraph title: Detection of the ETV6-NTRK3 fusion transcript by RT-PCR ... Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Hot Star Taq PCR Master Mix (QIAgen, Hilden, Germany), 10 pmol of each primer TRKC1059 complementary to NTRK3 with sequence (5′-CAGTTCTCGCTTCAGCACGATG-3′) and TEL971 complementary to ETV6 with sequence (5′-ACCACATCATGGTCTCTGTCTCCC-3′) and distilled water up to 25 μl.

    CpG Methylation Assay:

    Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis
    Article Snippet: Hot start Taq DNA polymerase High fidelity (Qiagen) was used to perform the PCR reaction. .. The results were analyzed by Pyro Q-CpG 1.0.9 software (Qiagen).

    DNA Sequencing:

    Article Title: Occurrence, Diversity, and Host Association of Intestinal Campylobacter, Arcobacter, and Helicobacter in Reptiles
    Article Snippet: For isolates for which atpA could not be sequenced, 16S rRNA encoding DNA sequencing was used using the 16S rDNA targeting primers 27F and 1492R . .. Each PCR amplification mixture contained 2.5 µM each primer, 1x Go Taq Hot Start Green Master Mix (Promega) or Hot Star Taq Master Mix (Qiagen) and 1 ng/µl genomic DNA.

    Sequencing:

    Article Title: Isolation and Characterization of Vibrio tubiashii Outer Membrane Proteins and Determination of a toxR Homolog
    Article Snippet: In order to confirm the presence of the OmpU-like protein expressed by the strains and to determine whether the V. tubiashii strains had homologous ompU genes, PCR analysis was performed using primer pairs (Table ) designed by Sperandio et al. ( ) and based on the sequence of ompU of V. cholerae . .. PCR analysis was carried out using a general master mix, and each reaction mixture contained 2 μl of a 3 μM concentration of the forward, 5′-end primer and 2 μl of a 3 μM concentration of the reverse, 3′-end primer (Invitrogen Corporation, Carlsbad, CA), 5 μl of 10× Tris-borate-EDTA buffer (Qiagen, Inc., Valencia, CA), 2 μl of 25 mM MgCl2 (Qiagen, Inc.), 2 μl of a 10 mM concentration of the deoxynucleoside triphosphates or 10 μl of a 2 mM concentration of the deoxynucleoside triphosphates (Invitrogen Corporation), and 0.5 μl of Hot Star Taq (Qiagen, Inc.).

    Article Title: Interleukin-28B Polymorphisms and Response of Chronic Hepatitis C Patients from Indonesia to Pegylated Interferon/Ribavirin Treatment
    Article Snippet: PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Hot Star Taq master mix (Qiagen). .. The amplified fragments were sequenced by a direct sequencing method with the BigDye Terminator v1.1 cycle sequencing kit and an ABI Prism 310 sequencer (Applied Biosystems, Foster City, CA, USA).

    Article Title: Occurrence, Diversity, and Host Association of Intestinal Campylobacter, Arcobacter, and Helicobacter in Reptiles
    Article Snippet: Paragraph title: atpA and 16S rRNA sequencing for species identification of isolates ... Each PCR amplification mixture contained 2.5 µM each primer, 1x Go Taq Hot Start Green Master Mix (Promega) or Hot Star Taq Master Mix (Qiagen) and 1 ng/µl genomic DNA.

    Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization
    Article Snippet: Briefly, enriched CD8+ T cells were stimulated with 5 μg/mL immunodominant H-2Kd -binding 197 AMQMLKETI205 , 9 mer Gag peptide for 16 h. Following stimulation, mRNA was prepared and cDNA was synthesized as described previously (Ranasinghe and others ). .. As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Hot Star Taq Master mix (Qiagen) (cycling as 1×95°C 2 min for Taq polymerase activation, followed by 20×95°C 15 s and 60°C 4 min amplification cycle), and the preamplified cDNA samples were diluted 1:5 and 2 μL of the diluted sample was used in each qRT-PCR reaction using primers indicated in . qRT-PCR was performed as 1×50°C, 2 min, 95°C, 10 min, followed by 40 cycles of (95°C, 15s, 60°C, 1 min) using an ABI Prism™ 7700 Sequence Detection System (Perkin Elmer/PE Applied Biosystems). .. All reactions were performed in duplicate and to ensure that single products were obtained after each reaction, the melting curves of the primers were also tested by dissociation runs as described previously (Ranasinghe and others ).

    Article Title: Comparing low coverage random shotgun sequence data from Brassica oleracea and Oryza sativa genome sequence for their ability to add to the annotation of Arabidopsis thaliana
    Article Snippet: Paragraph title: RT–PCR and sequencing hypothetical genes and CCURs ... Reagents from the Qiagen Hot Start TAQ Kit were used for the PCR reactions.

    Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement
    Article Snippet: Detection of 110 bp fragments of ETV6 -NTRK3 fusion transcripts was performed by RT-PCR, as follows [ ]. .. Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Hot Star Taq PCR Master Mix (QIAgen, Hilden, Germany), 10 pmol of each primer TRKC1059 complementary to NTRK3 with sequence (5′-CAGTTCTCGCTTCAGCACGATG-3′) and TEL971 complementary to ETV6 with sequence (5′-ACCACATCATGGTCTCTGTCTCCC-3′) and distilled water up to 25 μl. .. The amplification program comprised of denaturation at 95 °C for 14 min and 45 cycles of denaturation at 95 °C for 1 min, annealing at 65 °C for 1 min and extension at 72 °C for 1 min.

    Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis
    Article Snippet: The primers sequences (in 5′- -3′ orientation) are, for the first step, forward: AGGGGTTTTAGTTTTTTTAGTAGAGGTGTT -Btn and reverse: AACCCCTAACCCAATAACAAACT and for sequencing: GGGGGAGGATGTTAAG . .. Hot start Taq DNA polymerase High fidelity (Qiagen) was used to perform the PCR reaction.

    Binding Assay:

    Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization
    Article Snippet: Briefly, enriched CD8+ T cells were stimulated with 5 μg/mL immunodominant H-2Kd -binding 197 AMQMLKETI205 , 9 mer Gag peptide for 16 h. Following stimulation, mRNA was prepared and cDNA was synthesized as described previously (Ranasinghe and others ). .. As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Hot Star Taq Master mix (Qiagen) (cycling as 1×95°C 2 min for Taq polymerase activation, followed by 20×95°C 15 s and 60°C 4 min amplification cycle), and the preamplified cDNA samples were diluted 1:5 and 2 μL of the diluted sample was used in each qRT-PCR reaction using primers indicated in . qRT-PCR was performed as 1×50°C, 2 min, 95°C, 10 min, followed by 40 cycles of (95°C, 15s, 60°C, 1 min) using an ABI Prism™ 7700 Sequence Detection System (Perkin Elmer/PE Applied Biosystems).

    DNA Extraction:

    Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes
    Article Snippet: Paragraph title: DNA extraction and methylation-specific PCR (MSP) ... PCRs were performed in a total volume of 25 µl using 0.5 U of Taq Hot Star (Qiagen) and 1 µl of bisulfite-treated DNA.

    Article Title: Frequent p16-Independent Inactivation of p14ARF in Human Melanoma
    Article Snippet: Paragraph title: DNA Isolation and Polymerase Chain Reaction ... Amplifications were carried out in 20 μL using 100 ng DNA of genomic DNA and a mastermix consisting of purified, autoclaved water; MgCl2 buffer (Qiagen); DMSO (Sigma-Aldrich, St Louis, MO); mixed dinucleotide triphosphates (dNTPs) (Roche, Indianapolis, IN); forward and reverse primers (Applied Biosystems, Foster City, CA); and Hot Start Taq (Qiagen) according to the manufacturer's instructions.

    Methylation:

    Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells
    Article Snippet: Paragraph title: Methylation analysis ... For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Hot Star Taq polymerase (Qiagen) and 2 μl of converted DNA.

    Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes
    Article Snippet: Paragraph title: DNA extraction and methylation-specific PCR (MSP) ... PCRs were performed in a total volume of 25 µl using 0.5 U of Taq Hot Star (Qiagen) and 1 µl of bisulfite-treated DNA.

    Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis
    Article Snippet: Bisulfite converted DNA was eluted in 20 µL of elution buffer and was subjected to PCR amplification of the specific region by use of a primer set designed to amplify both methylated and unmethylated sequences of the UTF1 gene promoter. .. Hot start Taq DNA polymerase High fidelity (Qiagen) was used to perform the PCR reaction.

    Isolation:

    Article Title: Expression of tissue factor in pancreatic adenocarcinoma is associated with activation of coagulation
    Article Snippet: Isolated total RNA (1 μg, determined photometrically) was reverse transcribed using Superscript II reverse transcriptase (Invitrogen; Karlsruhe, Germany) and oligo-dT primers. .. The resulting cDNA was amplified in separate tubes using Hot Star Taq (Qiagen; Hilden, Germany).

    Article Title: Frequent p16-Independent Inactivation of p14ARF in Human Melanoma
    Article Snippet: Eight to ten 30-μm sections were cut from each specimen, and genomic DNA was isolated using the QIAamp DNA mini kit (Qiagen, Valencia, CA). .. Amplifications were carried out in 20 μL using 100 ng DNA of genomic DNA and a mastermix consisting of purified, autoclaved water; MgCl2 buffer (Qiagen); DMSO (Sigma-Aldrich, St Louis, MO); mixed dinucleotide triphosphates (dNTPs) (Roche, Indianapolis, IN); forward and reverse primers (Applied Biosystems, Foster City, CA); and Hot Start Taq (Qiagen) according to the manufacturer's instructions.

    Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement
    Article Snippet: RNA from all cases of MASCs was extracted using the RecoverAll Total Nucleic Acid Isolation Kit (Ambion, Austin, TX, USA). .. Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Hot Star Taq PCR Master Mix (QIAgen, Hilden, Germany), 10 pmol of each primer TRKC1059 complementary to NTRK3 with sequence (5′-CAGTTCTCGCTTCAGCACGATG-3′) and TEL971 complementary to ETV6 with sequence (5′-ACCACATCATGGTCTCTGTCTCCC-3′) and distilled water up to 25 μl.

    Negative Control:

    Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells
    Article Snippet: After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Hot Star Taq (Qiagen, Valencia, CA), 2.5 mM MgCl2 , and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer. .. Amplification products were visualised by ethidium bromide staining following separation by electrophoresis through agarose gels.

    Article Title: Comparing low coverage random shotgun sequence data from Brassica oleracea and Oryza sativa genome sequence for their ability to add to the annotation of Arabidopsis thaliana
    Article Snippet: For the PCR amplification step, the negative control for each primer pair was RNA instead of the RT product as template. .. Reagents from the Qiagen Hot Start TAQ Kit were used for the PCR reactions.

    RNA Extraction:

    Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus
    Article Snippet: At 32 h posttransfection, cells were lysed for RNA extraction according to the manufacturer's instructions (RNeasy kit; QIAGEN). cDNA was prepared as described for DNA microarray experiments. .. The PCR was performed with the Hot Star Taq kit (QIAGEN) with the following PCR conditions: 15 min at 95°C followed by 22 to 24 cycles of 30 s at 94°C, 30 s at 57°C, 20 s at 72°C, and 7-min final extension at 72°C.

    Article Title: Serum of patients with acute myocardial infarction prevents inflammation in iPSC-cardiomyocytes
    Article Snippet: Paragraph title: RNA extraction, cDNA synthesis and quantitative real-time PCR ... For quantitative real time PCR, hot start Taq DNA-polymerase and SYBR-Green were used, together with commercially available primers (GAPDH, #PPH00150F; TNNT2, #PPH025619A; POUF51, #PPH02394E, Qiagen).

    Labeling:

    Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France
    Article Snippet: Forward (8F) and reverse (1489R) primers were fluorescently labeled with tetrachlorofluorescein phosphoramidite and hexachlorofluorescein phosphoramidite (E.S.G.S. .. The PCR amplification mixture contained 12.5 μl Hot Start Taq polymerase master mix (QIAGEN), 0.5 μl of each primer (20 μM), and 10 ng of DNA template.

    Purification:

    Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes
    Article Snippet: DNA from tumor tissues was extracted from fresh-frozen specimens using a commercial kit (Master Pure DNA and RNA purification kit-Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer's instructions. .. PCRs were performed in a total volume of 25 µl using 0.5 U of Taq Hot Star (Qiagen) and 1 µl of bisulfite-treated DNA.

    Article Title: Frequent p16-Independent Inactivation of p14ARF in Human Melanoma
    Article Snippet: DNA concentrations were standardized in 1.5% agarose gels in reference to the Low DNA Mass Ladder (Invitrogen, Carlsbad, CA). .. Amplifications were carried out in 20 μL using 100 ng DNA of genomic DNA and a mastermix consisting of purified, autoclaved water; MgCl2 buffer (Qiagen); DMSO (Sigma-Aldrich, St Louis, MO); mixed dinucleotide triphosphates (dNTPs) (Roche, Indianapolis, IN); forward and reverse primers (Applied Biosystems, Foster City, CA); and Hot Start Taq (Qiagen) according to the manufacturer's instructions. .. Bovine serum albumin at a final concentration of 1 μg/μL (Sigma-Aldrich) was added to buffer excess melanin.

    Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement
    Article Snippet: Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Hot Star Taq PCR Master Mix (QIAgen, Hilden, Germany), 10 pmol of each primer TRKC1059 complementary to NTRK3 with sequence (5′-CAGTTCTCGCTTCAGCACGATG-3′) and TEL971 complementary to ETV6 with sequence (5′-ACCACATCATGGTCTCTGTCTCCC-3′) and distilled water up to 25 μl. .. The amplification program comprised of denaturation at 95 °C for 14 min and 45 cycles of denaturation at 95 °C for 1 min, annealing at 65 °C for 1 min and extension at 72 °C for 1 min.

    Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France
    Article Snippet: The PCR amplification mixture contained 12.5 μl Hot Start Taq polymerase master mix (QIAGEN), 0.5 μl of each primer (20 μM), and 10 ng of DNA template. .. The PCR amplification mixture contained 12.5 μl Hot Start Taq polymerase master mix (QIAGEN), 0.5 μl of each primer (20 μM), and 10 ng of DNA template.

    Polymerase Chain Reaction:

    Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells
    Article Snippet: The reaction was incubated at 42°C for 50 minutes, and then the reverse transcriptase was inactivated at 70°C for 10 minutes. .. After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Hot Star Taq (Qiagen, Valencia, CA), 2.5 mM MgCl2 , and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer. .. Cycling conditions included an initial denaturation step at 95°C for 15 minutes, then 1 minute at each of 94°C, 66–68°C and 72°C for 45–55 cycles and a final extension of 7 minutes at 72°C.

    Article Title: Isolation and Characterization of Vibrio tubiashii Outer Membrane Proteins and Determination of a toxR Homolog
    Article Snippet: DNA templates were prepared according to the procedure described by Kothary et al. ( ). .. PCR analysis was carried out using a general master mix, and each reaction mixture contained 2 μl of a 3 μM concentration of the forward, 5′-end primer and 2 μl of a 3 μM concentration of the reverse, 3′-end primer (Invitrogen Corporation, Carlsbad, CA), 5 μl of 10× Tris-borate-EDTA buffer (Qiagen, Inc., Valencia, CA), 2 μl of 25 mM MgCl2 (Qiagen, Inc.), 2 μl of a 10 mM concentration of the deoxynucleoside triphosphates or 10 μl of a 2 mM concentration of the deoxynucleoside triphosphates (Invitrogen Corporation), and 0.5 μl of Hot Star Taq (Qiagen, Inc.). .. PCR amplification of each isolate was conducted using 5 μl of the DNA template and 45 μl of a master mix containing primers, for a total volume of 50 μl.

    Article Title: Persistence and Complex Evolution of Fluoroquinolone-Resistant Streptococcus pneumoniae Clone
    Article Snippet: Primers amplifying the QRDR ( ) were designed for each of the 4 genes: parC primers, F-CAAAACATGTCCCTGGAGGA and R-GCAGCATCTATGACCTCAGC; parE primers, F-TCAAGTCTGCCATTACCAAGG and R-ACCCGCACCAATGGTATAAA; gyrA primers, F2-GACAAAGGAGATGAAGGCAAG and R2-GAAAATCTGGTCCAGGCAAG; gyrB primers, F-GGGAAATAGCGAAGTGGTCA and R-GTACGAATGTGGGCTCCAT. .. PCR on lysates with primers as above using Hot Star Taq (QIAGEN, Hilden, Germany) was performed as follows: 95°C for 15 min and 39 cycles of 94°C for 1 min, 56°C for 1 min, 72°C for 1 min, followed by an extension step of 72°C for 10 min, and the products were sequenced (HyLab, Rehovot, Israel). .. Sequences were analyzed by BLAST ( http://blast.ncbi.nlm.nih.gov ) against 1 of the 2 identical sequenced pneumococcal strains in the database (NC_008533 Streptococcus pneumoniae D39 and AE007317).

    Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells
    Article Snippet: Bisulphite treatment of 1 μg of DNA from each sample was performed with the EZ DNA Methylation-Gold Kit™ (Zymo Research Corp, USA, Freiburg, Germany) yielding 50 μl converted DNA from each sample. .. For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Hot Star Taq polymerase (Qiagen) and 2 μl of converted DNA. .. The initial denaturing step at 94°C for 15 min. was followed by 37 cycles each consisting of a denaturing step at 95°C for 30 sec., primer annealing at 59°C for 30 sec. and a 45 sec. elongation step at 72°C.

    Article Title: Involution of the mouse mammary gland is associated with an immune cascade and an acute-phase response, involving LBP, CD14 and STAT3
    Article Snippet: A 10 μl portion of this solution was used to produce cDNA, using SuperscriptII (Invitrogen) in accordance with the manufacturer's protocol. .. This cDNA (1 μl) was used in each PCR reaction with Hot-Star Taq polymerase (Qiagen). .. An Eppendorf Mastercycler gradient was used for the chain reaction, with 25–35 PCR cycles (30 s at 90°C, 30 s at 55–59°C, 30 s at 72°C).

    Article Title: Common variants near ABCA1, AFAP1 and GMDS confer risk of primary open-angle glaucoma
    Article Snippet: First strand cDNA was synthesised using the Superscript III reverse transcriptase (Invitrogen, Life Technologies Australia Pty Ltd., Mulgrave, Australia) and random hexamers. .. PCR was performed using the Hot Star Taq Plus polymerase (Qiagen) and gene-specific primers ( ). .. PCR was performed at the conditions specified in .

    Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes
    Article Snippet: Paragraph title: DNA extraction and methylation-specific PCR (MSP) ... PCRs were performed in a total volume of 25 µl using 0.5 U of Taq Hot Star (Qiagen) and 1 µl of bisulfite-treated DNA.

    Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus
    Article Snippet: This primer combination detects the same dscr1 isoforms as the inflammation DNA microarray and amplifies a spliced transcript of 196 bp and would amplify a genomic fragment of 554 bp if genomic traces of DNA were present. .. The PCR was performed with the Hot Star Taq kit (QIAGEN) with the following PCR conditions: 15 min at 95°C followed by 22 to 24 cycles of 30 s at 94°C, 30 s at 57°C, 20 s at 72°C, and 7-min final extension at 72°C. .. The housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was amplified with primers GAPDHfor (5′-ACCACAGTCCATGCCATCAC-3′) and GAPDHrev (5′-TCCACCACCCTGTTGGTGTA-3′) and the following PCR conditions: 15 min at 95°C followed by 22 to 24 cycles of 30 s at 94°C, 30 s at 60°C, 30 s at 72°C, and 7-min final extension at 72°C.

    Article Title: Frequent p16-Independent Inactivation of p14ARF in Human Melanoma
    Article Snippet: Paragraph title: DNA Isolation and Polymerase Chain Reaction ... Amplifications were carried out in 20 μL using 100 ng DNA of genomic DNA and a mastermix consisting of purified, autoclaved water; MgCl2 buffer (Qiagen); DMSO (Sigma-Aldrich, St Louis, MO); mixed dinucleotide triphosphates (dNTPs) (Roche, Indianapolis, IN); forward and reverse primers (Applied Biosystems, Foster City, CA); and Hot Start Taq (Qiagen) according to the manufacturer's instructions.

    Article Title: Interleukin-28B Polymorphisms and Response of Chronic Hepatitis C Patients from Indonesia to Pegylated Interferon/Ribavirin Treatment
    Article Snippet: To amplify the NS5B region of the HCV genome, the extracted RNA was reverse transcribed and amplified using SuperScript One-Step reverse transcription-PCR (RT-PCR) (Invitrogen, Tokyo, Japan) and a set of primers. .. PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Hot Star Taq master mix (Qiagen). .. The amplified fragments were sequenced by a direct sequencing method with the BigDye Terminator v1.1 cycle sequencing kit and an ABI Prism 310 sequencer (Applied Biosystems, Foster City, CA, USA).

    Article Title: Occurrence, Diversity, and Host Association of Intestinal Campylobacter, Arcobacter, and Helicobacter in Reptiles
    Article Snippet: For isolates for which atpA could not be sequenced, 16S rRNA encoding DNA sequencing was used using the 16S rDNA targeting primers 27F and 1492R . .. Each PCR amplification mixture contained 2.5 µM each primer, 1x Go Taq Hot Start Green Master Mix (Promega) or Hot Star Taq Master Mix (Qiagen) and 1 ng/µl genomic DNA. .. PCRs were performed on a 2720 Thermal Cycler (Applied Biosystems) with the following conditions: 30 s at 94°C, 30 s at 53°C, and 2 min at 72°C (35 (16S rRNA) or 40 cycles (atpA )).

    Article Title: Circulating tumour cell detection: a direct comparison between the CellSearch System, the AdnaTest and CK-19/mammaglobin RT-PCR in patients with metastatic breast cancer
    Article Snippet: The primer mixture consisted of four specific primer pairs for the amplification of three tumour markers (Muc-1 , HER2 and GA733-2 ) and one housekeeping gene (Actin ). .. PCR analyses were carried out in a final volume of 50 μ l PCR mixture, containing 8 μ l of cDNA, 4 μ l primer mixture (PrimerMix BreastDetect; AdnaGen), 25 μ l of Hot Star Taq Master Mix (Qiagen) and 13 μ l of distilled water. .. PCR analyses were performed as follows: pre-denaturation at 95°C for 15 min, followed by 35 cycles of denaturation at 94°C, annealing at 60°C for 1 min, extension at 72°C for 1 min and a final extension step at 72°C for 10 min. For negative controls, mRNA and cDNA were replaced by water in the reverse transcription and PCR experiments.

    Article Title: Methylated APC and GSTP1 genes in serum DNA correlate with the presence of circulating blood tumor cells and are associated with a more aggressive and advanced breast cancer disease
    Article Snippet: The primer mixture consisted of four specific primer pairs for the amplification of three tumour markers (Muc-1, HER2 and EPCAM) and one housekeeping gene (Actin). .. Multiplex PCR analyses were carried out in a final volume of 50 μl PCR mixture, containing 8 μl of cDNA, 4 μl primer mixtures (PrimerMix BreastDetect; AdnaGen), 25 μl of Hot Star Taq Master Mix (Qiagen) and 13 μl of distilled water. .. PCR analyses were performed as described by the manufacturer.

    Article Title: Comparing low coverage random shotgun sequence data from Brassica oleracea and Oryza sativa genome sequence for their ability to add to the annotation of Arabidopsis thaliana
    Article Snippet: Other negative controls used per 96-well plate were as follows: no primers and no Taq DNA polymerase. .. Reagents from the Qiagen Hot Start TAQ Kit were used for the PCR reactions. .. Positive controls included Actin (At5g59370), GCR1 (At1g48270), and R18.

    Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement
    Article Snippet: Detection of 110 bp fragments of ETV6 -NTRK3 fusion transcripts was performed by RT-PCR, as follows [ ]. .. Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Hot Star Taq PCR Master Mix (QIAgen, Hilden, Germany), 10 pmol of each primer TRKC1059 complementary to NTRK3 with sequence (5′-CAGTTCTCGCTTCAGCACGATG-3′) and TEL971 complementary to ETV6 with sequence (5′-ACCACATCATGGTCTCTGTCTCCC-3′) and distilled water up to 25 μl. .. The amplification program comprised of denaturation at 95 °C for 14 min and 45 cycles of denaturation at 95 °C for 1 min, annealing at 65 °C for 1 min and extension at 72 °C for 1 min.

    Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis
    Article Snippet: The primers sequences (in 5′- -3′ orientation) are, for the first step, forward: AGGGGTTTTAGTTTTTTTAGTAGAGGTGTT -Btn and reverse: AACCCCTAACCCAATAACAAACT and for sequencing: GGGGGAGGATGTTAAG . .. Hot start Taq DNA polymerase High fidelity (Qiagen) was used to perform the PCR reaction. .. The PCR product was checked by 1.5 % agarose gel electrophoresis to confirm the quality, the size of the product and rule out the formation of primer dimers.

    Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France
    Article Snippet: Cybergene Group), respectively. .. The PCR amplification mixture contained 12.5 μl Hot Start Taq polymerase master mix (QIAGEN), 0.5 μl of each primer (20 μM), and 10 ng of DNA template. .. 16S rRNA gene amplification reactions were cycled in a PTC200 thermocycler (MJ Research) with a hot start step at 94°C for 15 min followed by 35 cycles of 94°C for 1 min, 52°C for 1.5 min, and 72°C for 1 min, with a final extension step at 72°C for 10 min.

    Terminal Restriction Fragment Length Polymorphism:

    Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France
    Article Snippet: Paragraph title: T-RFLP analysis. ... The PCR amplification mixture contained 12.5 μl Hot Start Taq polymerase master mix (QIAGEN), 0.5 μl of each primer (20 μM), and 10 ng of DNA template.

    Lysis:

    Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells
    Article Snippet: After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Hot Star Taq (Qiagen, Valencia, CA), 2.5 mM MgCl2 , and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer. .. Amplification products were visualised by ethidium bromide staining following separation by electrophoresis through agarose gels.

    Article Title: Serum of patients with acute myocardial infarction prevents inflammation in iPSC-cardiomyocytes
    Article Snippet: RNA was extracted from hiPSC-CMs by lysis with RLT lysis buffer, followed by the application of the RNeasy MiniKit (Qiagen) according to manufacturer’s instructions. cDNA synthesis was performed with oligo (dT) primers using AMV reverse transcriptase (Roche). .. For quantitative real time PCR, hot start Taq DNA-polymerase and SYBR-Green were used, together with commercially available primers (GAPDH, #PPH00150F; TNNT2, #PPH025619A; POUF51, #PPH02394E, Qiagen).

    Plasmid Preparation:

    Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells
    Article Snippet: For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Hot Star Taq polymerase (Qiagen) and 2 μl of converted DNA. .. For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Hot Star Taq polymerase (Qiagen) and 2 μl of converted DNA.

    Software:

    Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis
    Article Snippet: The primers were designed using PSQ assay design software (Qiagen). .. Hot start Taq DNA polymerase High fidelity (Qiagen) was used to perform the PCR reaction.

    Electrophoresis:

    Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells
    Article Snippet: After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Hot Star Taq (Qiagen, Valencia, CA), 2.5 mM MgCl2 , and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer. .. After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Hot Star Taq (Qiagen, Valencia, CA), 2.5 mM MgCl2 , and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer.

    Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells
    Article Snippet: For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Hot Star Taq polymerase (Qiagen) and 2 μl of converted DNA. .. For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Hot Star Taq polymerase (Qiagen) and 2 μl of converted DNA.

    Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes
    Article Snippet: PCRs were performed in a total volume of 25 µl using 0.5 U of Taq Hot Star (Qiagen) and 1 µl of bisulfite-treated DNA. .. This same DNA treated in vitro with SssI methyl transferase served as the positive methylation control.

    Multiplex Assay:

    Article Title: Circulating tumour cell detection: a direct comparison between the CellSearch System, the AdnaTest and CK-19/mammaglobin RT-PCR in patients with metastatic breast cancer
    Article Snippet: For the analysis of tumour-associated mRNAs, a multiplex PCR was carried out. .. PCR analyses were carried out in a final volume of 50 μ l PCR mixture, containing 8 μ l of cDNA, 4 μ l primer mixture (PrimerMix BreastDetect; AdnaGen), 25 μ l of Hot Star Taq Master Mix (Qiagen) and 13 μ l of distilled water.

    Article Title: Methylated APC and GSTP1 genes in serum DNA correlate with the presence of circulating blood tumor cells and are associated with a more aggressive and advanced breast cancer disease
    Article Snippet: The primer mixture consisted of four specific primer pairs for the amplification of three tumour markers (Muc-1, HER2 and EPCAM) and one housekeeping gene (Actin). .. Multiplex PCR analyses were carried out in a final volume of 50 μl PCR mixture, containing 8 μl of cDNA, 4 μl primer mixtures (PrimerMix BreastDetect; AdnaGen), 25 μl of Hot Star Taq Master Mix (Qiagen) and 13 μl of distilled water. .. PCR analyses were performed as described by the manufacturer.

    Agarose Gel Electrophoresis:

    Article Title: Expression of tissue factor in pancreatic adenocarcinoma is associated with activation of coagulation
    Article Snippet: The resulting cDNA was amplified in separate tubes using Hot Star Taq (Qiagen; Hilden, Germany). .. The resulting cDNA was amplified in separate tubes using Hot Star Taq (Qiagen; Hilden, Germany).

    Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells
    Article Snippet: For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Hot Star Taq polymerase (Qiagen) and 2 μl of converted DNA. .. For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Hot Star Taq polymerase (Qiagen) and 2 μl of converted DNA.

    Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France
    Article Snippet: The PCR amplification mixture contained 12.5 μl Hot Start Taq polymerase master mix (QIAGEN), 0.5 μl of each primer (20 μM), and 10 ng of DNA template. .. 16S rRNA gene amplification reactions were cycled in a PTC200 thermocycler (MJ Research) with a hot start step at 94°C for 15 min followed by 35 cycles of 94°C for 1 min, 52°C for 1.5 min, and 72°C for 1 min, with a final extension step at 72°C for 10 min.

    In Vitro:

    Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes
    Article Snippet: PCRs were performed in a total volume of 25 µl using 0.5 U of Taq Hot Star (Qiagen) and 1 µl of bisulfite-treated DNA. .. DNA isolated from normal peripheral lymphocytes served as negative methylation control.

    DNA Methylation Assay:

    Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes
    Article Snippet: DNA methylation of the promoters p16, MLH1, Mint1, Mint2, Mint31 , and MGMT genes was determined by MSP after chemical modification of genomic DNA with sodium bisulfite as described by Herman et al. DNA modification was performed using the Methylamp DNA modification kit (Epigentek, USA) according to the manufacturer's instructions. .. PCRs were performed in a total volume of 25 µl using 0.5 U of Taq Hot Star (Qiagen) and 1 µl of bisulfite-treated DNA.

    Activation Assay:

    Article Title: Expression of tissue factor in pancreatic adenocarcinoma is associated with activation of coagulation
    Article Snippet: The resulting cDNA was amplified in separate tubes using Hot Star Taq (Qiagen; Hilden, Germany). .. TF and asTF were discriminated on a 2% agarose gel as bands of 815 and 656 bp, respectively.

    Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization
    Article Snippet: Briefly, enriched CD8+ T cells were stimulated with 5 μg/mL immunodominant H-2Kd -binding 197 AMQMLKETI205 , 9 mer Gag peptide for 16 h. Following stimulation, mRNA was prepared and cDNA was synthesized as described previously (Ranasinghe and others ). .. As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Hot Star Taq Master mix (Qiagen) (cycling as 1×95°C 2 min for Taq polymerase activation, followed by 20×95°C 15 s and 60°C 4 min amplification cycle), and the preamplified cDNA samples were diluted 1:5 and 2 μL of the diluted sample was used in each qRT-PCR reaction using primers indicated in . qRT-PCR was performed as 1×50°C, 2 min, 95°C, 10 min, followed by 40 cycles of (95°C, 15s, 60°C, 1 min) using an ABI Prism™ 7700 Sequence Detection System (Perkin Elmer/PE Applied Biosystems). .. All reactions were performed in duplicate and to ensure that single products were obtained after each reaction, the melting curves of the primers were also tested by dissociation runs as described previously (Ranasinghe and others ).

    Migration:

    Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France
    Article Snippet: The PCR amplification mixture contained 12.5 μl Hot Start Taq polymerase master mix (QIAGEN), 0.5 μl of each primer (20 μM), and 10 ng of DNA template. .. 16S rRNA gene amplification reactions were cycled in a PTC200 thermocycler (MJ Research) with a hot start step at 94°C for 15 min followed by 35 cycles of 94°C for 1 min, 52°C for 1.5 min, and 72°C for 1 min, with a final extension step at 72°C for 10 min.

    DNA Purification:

    Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France
    Article Snippet: The PCR amplification mixture contained 12.5 μl Hot Start Taq polymerase master mix (QIAGEN), 0.5 μl of each primer (20 μM), and 10 ng of DNA template. .. The amount of PCR product was determined by comparison to known concentrations by the “dots method” (Smartlader; Eurogentec) after migration on agarose gel.

    Staining:

    Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells
    Article Snippet: After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Hot Star Taq (Qiagen, Valencia, CA), 2.5 mM MgCl2 , and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer. .. After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Hot Star Taq (Qiagen, Valencia, CA), 2.5 mM MgCl2 , and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer.

    Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus
    Article Snippet: The PCR was performed with the Hot Star Taq kit (QIAGEN) with the following PCR conditions: 15 min at 95°C followed by 22 to 24 cycles of 30 s at 94°C, 30 s at 57°C, 20 s at 72°C, and 7-min final extension at 72°C. .. The PCR was performed with the Hot Star Taq kit (QIAGEN) with the following PCR conditions: 15 min at 95°C followed by 22 to 24 cycles of 30 s at 94°C, 30 s at 57°C, 20 s at 72°C, and 7-min final extension at 72°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • pcr buffer  (Qiagen)
    99
    Qiagen pcr buffer
    Expression analysis of cyclin D2 as a potential <t>Elf5</t> target gene . A . The expression pattern of cyclin D2 and Elf5 during different stages of mammary gland development. The expression profile was generated by analysis of microarray data from Stein et al[ 24 ]. B . Relative expression of cyclin D2 mRNA by real time <t>RT-PCR</t> during mouse mammary gland development . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of Ccnd2 mRNA levels by real time RT-PCR. The housekeeping gene Gapdh was used to normalize gene expression. Results are from two or more independent experiments. C . Expression of cyclin D2 protein during mouse mammary gland development . Protein extract from wild type (WT) and K14-Cre/Elf5 f/f knockout (KO) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed by western blot with antibodies against cyclin D2 and p27. Equal loading was assessed by anti-β-tubulin antibodies and the absence of Elf5 in KO was confirmed by anti-Elf5 antibodies.
    Pcr Buffer, supplied by Qiagen, used in various techniques. Bioz Stars score: 99/100, based on 781 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr buffer/product/Qiagen
    Average 99 stars, based on 781 article reviews
    Price from $9.99 to $1999.99
    pcr buffer - by Bioz Stars, 2019-12
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Expression analysis of cyclin D2 as a potential Elf5 target gene . A . The expression pattern of cyclin D2 and Elf5 during different stages of mammary gland development. The expression profile was generated by analysis of microarray data from Stein et al[ 24 ]. B . Relative expression of cyclin D2 mRNA by real time RT-PCR during mouse mammary gland development . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of Ccnd2 mRNA levels by real time RT-PCR. The housekeeping gene Gapdh was used to normalize gene expression. Results are from two or more independent experiments. C . Expression of cyclin D2 protein during mouse mammary gland development . Protein extract from wild type (WT) and K14-Cre/Elf5 f/f knockout (KO) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed by western blot with antibodies against cyclin D2 and p27. Equal loading was assessed by anti-β-tubulin antibodies and the absence of Elf5 in KO was confirmed by anti-Elf5 antibodies.

    Journal: BMC Molecular Biology

    Article Title: Genome-wide search identifies Ccnd2 as a direct transcriptional target of Elf5 in mouse mammary gland

    doi: 10.1186/1471-2199-11-68

    Figure Lengend Snippet: Expression analysis of cyclin D2 as a potential Elf5 target gene . A . The expression pattern of cyclin D2 and Elf5 during different stages of mammary gland development. The expression profile was generated by analysis of microarray data from Stein et al[ 24 ]. B . Relative expression of cyclin D2 mRNA by real time RT-PCR during mouse mammary gland development . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of Ccnd2 mRNA levels by real time RT-PCR. The housekeeping gene Gapdh was used to normalize gene expression. Results are from two or more independent experiments. C . Expression of cyclin D2 protein during mouse mammary gland development . Protein extract from wild type (WT) and K14-Cre/Elf5 f/f knockout (KO) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed by western blot with antibodies against cyclin D2 and p27. Equal loading was assessed by anti-β-tubulin antibodies and the absence of Elf5 in KO was confirmed by anti-Elf5 antibodies.

    Article Snippet: The immunoprecipitated DNA was analyzed by PCR for Elf5 occupancy and performed in a volume of 25 μl containing 1× PCR buffer (QIAGEN), 1× Q-solution (QIAGEN), 200 μM dNTPs, 2 ng/ml of each forward and reverse primers (primer sequences are listed in Table 2), 1.25 U Taq DNA polymerase (QIAGEN) and 2 μl of template.

    Techniques: Expressing, Generated, Microarray, Quantitative RT-PCR, Knock-Out, Gene Knockout, Western Blot

    Verification of putative Elf5 target DNA by independent ChIP and examination of their expression levels in Elf5 null-mouse mammary glands . A . Independent ChIP assay to demonstrate Elf5 occupancy . Mouse mammary gland at pregnancy day 17.5 were immunoprecipitated with anti-Elf5 antibodies and analyzed by PCR using specific primers that amplified genomic DNA segments located close to putative Elf5 target genes and Gapdh as negative control. As positive control of PCR, an aliquot (1%) of chromatin complex before immune isolation was used as input. Nonspecific binding was assessed using goat IgG or no antibody. B . Realtime RT-PCR analysis of Elf5 target genes in WT and Elf5-null mammary gland . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (Elf5 null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of mRNA levels of putative Elf5 target genes by real time RT-PCR. Data shown is from at least two independent experiments.

    Journal: BMC Molecular Biology

    Article Title: Genome-wide search identifies Ccnd2 as a direct transcriptional target of Elf5 in mouse mammary gland

    doi: 10.1186/1471-2199-11-68

    Figure Lengend Snippet: Verification of putative Elf5 target DNA by independent ChIP and examination of their expression levels in Elf5 null-mouse mammary glands . A . Independent ChIP assay to demonstrate Elf5 occupancy . Mouse mammary gland at pregnancy day 17.5 were immunoprecipitated with anti-Elf5 antibodies and analyzed by PCR using specific primers that amplified genomic DNA segments located close to putative Elf5 target genes and Gapdh as negative control. As positive control of PCR, an aliquot (1%) of chromatin complex before immune isolation was used as input. Nonspecific binding was assessed using goat IgG or no antibody. B . Realtime RT-PCR analysis of Elf5 target genes in WT and Elf5-null mammary gland . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (Elf5 null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of mRNA levels of putative Elf5 target genes by real time RT-PCR. Data shown is from at least two independent experiments.

    Article Snippet: The immunoprecipitated DNA was analyzed by PCR for Elf5 occupancy and performed in a volume of 25 μl containing 1× PCR buffer (QIAGEN), 1× Q-solution (QIAGEN), 200 μM dNTPs, 2 ng/ml of each forward and reverse primers (primer sequences are listed in Table 2), 1.25 U Taq DNA polymerase (QIAGEN) and 2 μl of template.

    Techniques: Chromatin Immunoprecipitation, Expressing, Immunoprecipitation, Polymerase Chain Reaction, Amplification, Negative Control, Positive Control, Isolation, Binding Assay, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR

    Binding of Elf5 to regulatory regions of the CCND2 gene . A . A schematic map of the cyclinD2 gene showing the genomic structure and the location of the Elf5-ChIPed segment in the 5' upstream region (circle) . The primer sets used for ChIP experiments are shown. B . Gelshift experiments to demonstrate binding of recombinant Elf5 to cyclinD2 regulatory regions . The Elf5-DNA complex is supershifted (*) with the addition of two different antibodies against Elf5, Ab1 (N-20) and Ab2 (generated in the laboratory). Lanes 1-7 represent data with the oligonucleotide corresponding to the cyclinD2 promoter, whereas lanes 8-12 and 13-17 correspond to two segments of the upstream region that contain Elf5-binding sites. C . In vivo occupancy of Elf5 on mouse Ccnd2 gene . ChIP was performed on mouse mammary glands using antibodies recognizing Elf5 as well as a nonspecific IgG as indicated. Input represents PCR amplification of 1% of the genomic DNA. Primer pairs P1-P2 and P3-4 correspond to the upstream and the promoter region respectively. P5-P6 corresponds to 3' region of Ccnd2 gene and serves as a negative control. Results shown are a representative of two independent experiments. D . The cyclin D2 promoter is repressed by Elf5 in reporter gene assays in mammary epithelial cells . The wildtype (black) or mutant (white) cyclinD2-Luc plasmid was co-transfected with expression plasmids encoding Elf5 or Elf3 into MCF-7 cells. Luciferase values were determined and normalized against β-galactosidase values. The corrected luciferase values for cells transfected with empty vector pCMV-HA were set at 1.

    Journal: BMC Molecular Biology

    Article Title: Genome-wide search identifies Ccnd2 as a direct transcriptional target of Elf5 in mouse mammary gland

    doi: 10.1186/1471-2199-11-68

    Figure Lengend Snippet: Binding of Elf5 to regulatory regions of the CCND2 gene . A . A schematic map of the cyclinD2 gene showing the genomic structure and the location of the Elf5-ChIPed segment in the 5' upstream region (circle) . The primer sets used for ChIP experiments are shown. B . Gelshift experiments to demonstrate binding of recombinant Elf5 to cyclinD2 regulatory regions . The Elf5-DNA complex is supershifted (*) with the addition of two different antibodies against Elf5, Ab1 (N-20) and Ab2 (generated in the laboratory). Lanes 1-7 represent data with the oligonucleotide corresponding to the cyclinD2 promoter, whereas lanes 8-12 and 13-17 correspond to two segments of the upstream region that contain Elf5-binding sites. C . In vivo occupancy of Elf5 on mouse Ccnd2 gene . ChIP was performed on mouse mammary glands using antibodies recognizing Elf5 as well as a nonspecific IgG as indicated. Input represents PCR amplification of 1% of the genomic DNA. Primer pairs P1-P2 and P3-4 correspond to the upstream and the promoter region respectively. P5-P6 corresponds to 3' region of Ccnd2 gene and serves as a negative control. Results shown are a representative of two independent experiments. D . The cyclin D2 promoter is repressed by Elf5 in reporter gene assays in mammary epithelial cells . The wildtype (black) or mutant (white) cyclinD2-Luc plasmid was co-transfected with expression plasmids encoding Elf5 or Elf3 into MCF-7 cells. Luciferase values were determined and normalized against β-galactosidase values. The corrected luciferase values for cells transfected with empty vector pCMV-HA were set at 1.

    Article Snippet: The immunoprecipitated DNA was analyzed by PCR for Elf5 occupancy and performed in a volume of 25 μl containing 1× PCR buffer (QIAGEN), 1× Q-solution (QIAGEN), 200 μM dNTPs, 2 ng/ml of each forward and reverse primers (primer sequences are listed in Table 2), 1.25 U Taq DNA polymerase (QIAGEN) and 2 μl of template.

    Techniques: Binding Assay, Chromatin Immunoprecipitation, Recombinant, Generated, In Vivo, Polymerase Chain Reaction, Amplification, Negative Control, Mutagenesis, Plasmid Preparation, Transfection, Expressing, Luciferase, Hemagglutination Assay

    Assessment of anti-Elf5 antibody for ChIP . The Elf5 antibody was tested for ChIP using the human cell line HEK293 UAS-TK-Luc, which contains a stably integrated luciferase reporter gene under the control of UAS (containing Gal4 binding sites) and the TK promoter. A . Schematic representation of the plasmids and primers utilized in the experiment . B . Expression of the Gal4 proteins assessed by anti-Gal4 and anti-Elf5 antibodies . HEK293 UAS-TK-Luc cells were transfected with plasmids that express Gal4 DNA-binding domain (Gal4 DBD) or Gal4 DBD-Elf5. C . ChIP assays performed with anti-Gal4 DBD or with anti-Elf5 antibodies . Immunoprecipitated DNA was analyzed using P1 and P2 primers. As a positive control, an aliquot (1%) of chromatin complex before immune isolation was used as input for PCR. Nonspecific binding was judged using rabbit IgG or no antibody. D . Schematic overview of the ChIP protocol used for the cloning of Elf5-putative target genes .

    Journal: BMC Molecular Biology

    Article Title: Genome-wide search identifies Ccnd2 as a direct transcriptional target of Elf5 in mouse mammary gland

    doi: 10.1186/1471-2199-11-68

    Figure Lengend Snippet: Assessment of anti-Elf5 antibody for ChIP . The Elf5 antibody was tested for ChIP using the human cell line HEK293 UAS-TK-Luc, which contains a stably integrated luciferase reporter gene under the control of UAS (containing Gal4 binding sites) and the TK promoter. A . Schematic representation of the plasmids and primers utilized in the experiment . B . Expression of the Gal4 proteins assessed by anti-Gal4 and anti-Elf5 antibodies . HEK293 UAS-TK-Luc cells were transfected with plasmids that express Gal4 DNA-binding domain (Gal4 DBD) or Gal4 DBD-Elf5. C . ChIP assays performed with anti-Gal4 DBD or with anti-Elf5 antibodies . Immunoprecipitated DNA was analyzed using P1 and P2 primers. As a positive control, an aliquot (1%) of chromatin complex before immune isolation was used as input for PCR. Nonspecific binding was judged using rabbit IgG or no antibody. D . Schematic overview of the ChIP protocol used for the cloning of Elf5-putative target genes .

    Article Snippet: The immunoprecipitated DNA was analyzed by PCR for Elf5 occupancy and performed in a volume of 25 μl containing 1× PCR buffer (QIAGEN), 1× Q-solution (QIAGEN), 200 μM dNTPs, 2 ng/ml of each forward and reverse primers (primer sequences are listed in Table 2), 1.25 U Taq DNA polymerase (QIAGEN) and 2 μl of template.

    Techniques: Chromatin Immunoprecipitation, Stable Transfection, Luciferase, Binding Assay, Expressing, Transfection, Immunoprecipitation, Positive Control, Isolation, Polymerase Chain Reaction, Clone Assay

    Sequences of contaminating bacterial DNA in three Taq polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Sequences of contaminating bacterial DNA in three Taq polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.

    Article Snippet: Qiagen Taq DNA polymerase contained a mixture of contaminants that did not give reliable sequencing data from reaction to reaction. shows the alignment of the broad host range primers for bacterial 16S rDNA used in this study.

    Techniques: Sequencing, Polymerase Chain Reaction

    Approximating the copy number of 16S rDNA in commercial Taq polymerases. Six DNA polymerases were used with primers for 16S rDNA on 7 serial 10-fold dilutions of E. coli genomic DNA (10 ng to 10 fg) with no added DNA in the 8 th sample. The least squares fit equation for each dilution series was used to assign a value to the signal from the 8 th sample, which contains Taq-associated DNA only. The efficiency of the reaction was determined from the slope of the linear fit plotting the base10 log of the DNA concentration vs. the threshold cycle. A slope of −3.322 indicates an average doubling rate of “2,” which is approximately 100% efficiency (2̂3.322∼10). The rDNA values assigned are for “E. coli equivalents.”

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Approximating the copy number of 16S rDNA in commercial Taq polymerases. Six DNA polymerases were used with primers for 16S rDNA on 7 serial 10-fold dilutions of E. coli genomic DNA (10 ng to 10 fg) with no added DNA in the 8 th sample. The least squares fit equation for each dilution series was used to assign a value to the signal from the 8 th sample, which contains Taq-associated DNA only. The efficiency of the reaction was determined from the slope of the linear fit plotting the base10 log of the DNA concentration vs. the threshold cycle. A slope of −3.322 indicates an average doubling rate of “2,” which is approximately 100% efficiency (2̂3.322∼10). The rDNA values assigned are for “E. coli equivalents.”

    Article Snippet: Qiagen Taq DNA polymerase contained a mixture of contaminants that did not give reliable sequencing data from reaction to reaction. shows the alignment of the broad host range primers for bacterial 16S rDNA used in this study.

    Techniques: Concentration Assay

    Detection of Pseudomonas fluorescens at high and low Taq polymerase concentrations. Bacterial detection with 0.5 Units (A) or 0.05 Units (B) Qiagen Taq DNA polymerase with 16S350B assay on samples containing 10 3 , 10 2 , 10 1 and zero Pseudomonas fluorescens bacteria. A composite of A and B is shown in C.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Detection of Pseudomonas fluorescens at high and low Taq polymerase concentrations. Bacterial detection with 0.5 Units (A) or 0.05 Units (B) Qiagen Taq DNA polymerase with 16S350B assay on samples containing 10 3 , 10 2 , 10 1 and zero Pseudomonas fluorescens bacteria. A composite of A and B is shown in C.

    Article Snippet: Qiagen Taq DNA polymerase contained a mixture of contaminants that did not give reliable sequencing data from reaction to reaction. shows the alignment of the broad host range primers for bacterial 16S rDNA used in this study.

    Techniques:

    Detection of bacterial DNA in six Taq polymerases. Four dilutions of six DNA polymerase were tested with primers for 16S rDNA in the presence of 100 pg (∼10̂5 16S rDNA) E. coli genomic DNA (circled) or H 2 O.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Detection of bacterial DNA in six Taq polymerases. Four dilutions of six DNA polymerase were tested with primers for 16S rDNA in the presence of 100 pg (∼10̂5 16S rDNA) E. coli genomic DNA (circled) or H 2 O.

    Article Snippet: Qiagen Taq DNA polymerase contained a mixture of contaminants that did not give reliable sequencing data from reaction to reaction. shows the alignment of the broad host range primers for bacterial 16S rDNA used in this study.

    Techniques:

    Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.

    Journal: PLoS ONE

    Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria

    doi: 10.1371/journal.pone.0007010

    Figure Lengend Snippet: Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.

    Article Snippet: Qiagen Taq DNA polymerase contained a mixture of contaminants that did not give reliable sequencing data from reaction to reaction. shows the alignment of the broad host range primers for bacterial 16S rDNA used in this study.

    Techniques: Labeling

    Amplicons generated with TbAT1 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45 to 48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo

    doi: 10.1371/journal.pntd.0003212

    Figure Lengend Snippet: Amplicons generated with TbAT1 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45 to 48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Article Snippet: A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA.

    Techniques: Generated, Polymerase Chain Reaction, Isolation, Gene Knockout

    Restriction digest profile generated with SfaNI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo

    doi: 10.1371/journal.pntd.0003212

    Figure Lengend Snippet: Restriction digest profile generated with SfaNI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Article Snippet: A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA.

    Techniques: Generated, Polymerase Chain Reaction, Isolation, Gene Knockout

    Amplicons generated with AQP2/3 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo

    doi: 10.1371/journal.pntd.0003212

    Figure Lengend Snippet: Amplicons generated with AQP2/3 -PCR on DNA of the T.b. gambiense strains as listed in Table 1 and of the two T.b. brucei control strains. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lanes 45–48 = T.b. gambiense strains isolated from Masi-Manimba, lane 49 = T.b. brucei 427 WT, lane 50 = T.b. brucei 427 AT1/P2 KO, lane 51 = negative PCR control.

    Article Snippet: A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA.

    Techniques: Generated, Polymerase Chain Reaction, Isolation, Gene Knockout

    Restriction digest profile generated with AvaI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo

    doi: 10.1371/journal.pntd.0003212

    Figure Lengend Snippet: Restriction digest profile generated with AvaI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.

    Article Snippet: A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA.

    Techniques: Generated, Polymerase Chain Reaction, Isolation, Mouse Assay

    Restriction digest profile generated with SduI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo

    doi: 10.1371/journal.pntd.0003212

    Figure Lengend Snippet: Restriction digest profile generated with SduI PCR-RFLP on DNA of the T.b. gambiense strains as listed in Table 1 , including the four strains isolated from relapsed mice. Lanes 1, 26, 27 and 52 = GeneRuler 100 bp Plus DNA Ladder (Fermentas), lanes 2 to 44 = T.b. gambiense strains isolated from Mbuji-Mayi, lane 45 = T.b. gambiense 15BT relapse 10 mg/kg BW, lane 46 = T.b. gambiense 163AT relapse 10 mg/kg BW, lane 47 = T.b. gambiense 346AT relapse 10 mg/kg BW, lane 48 = T.b. gambiense 346AT relapse 12 mg/kg BW, lane 49 = T.b. gambiense MBA, lane 50 = T.b. gambiense MM01, lane 51 = negative PCR control.

    Article Snippet: A 278-bp fragment was amplified from the predicted AQP2/3 chimeras from Mbuji-Mayi in a 20 µl reaction volume that contained 1× PCR buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.4 µM of AQP2-RFLP-F ( 5′-GAACTCATTTCCACCGCAGT-3 )′ and AQP2-RFLP-R ( 5′-AGTCCAAAGATACCTCCAAACA-3′ ) (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µl target DNA.

    Techniques: Generated, Polymerase Chain Reaction, Isolation, Mouse Assay