taq dna polymerase  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97

    Structured Review

    Qiagen taq dna polymerase
    Taq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 97/100, based on 1013 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Qiagen
    Average 97 stars, based on 1013 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-01
    97/100 stars

    Images

    Related Articles

    Electrophoresis:

    Article Title: Determination of the Loss of Function Complement C4 Exon 29 CT Insertion Using a Novel Paralog-Specific Assay in Healthy UK and Spanish Populations
    Article Snippet: PGF is a MHC homozygous cell line with two normal copies each of C4A and C4B ; therefore if the test sample was homozygous for the CT insertion in either/both C4A or C4B , the double peak pattern would be observed following capillary electrophoresis. .. The reaction volume was 25 µl, comprising 2.5 µl of 10× PCR Buffer (QIAGEN), 0.5 µM of each dATP, dCTP ,dGTP and dTTP (Promega, Cat. No. U1240), 0.625 units of Taq DNA polymerase (Qiagen, Cat.No.

    Amplification:

    Article Title: Determination of the Loss of Function Complement C4 Exon 29 CT Insertion Using a Novel Paralog-Specific Assay in Healthy UK and Spanish Populations
    Article Snippet: Specifically, for the initial PCR, the 864 bp fragment (spanning exon 26 to exon 29) was amplified using 25 ng (2.5 µl at 10 ng/µl) of genomic DNA and 2.5 µM forward primer, REDVRA_F ( CTGAGAAACTGCAGGAGACATC ) and 2.5 µM of 6-FAM labelled reverse primer, CTinsR ([6FAM] GACACGGCATTGCTCTGA ). .. The reaction volume was 25 µl, comprising 2.5 µl of 10× PCR Buffer (QIAGEN), 0.5 µM of each dATP, dCTP ,dGTP and dTTP (Promega, Cat. No. U1240), 0.625 units of Taq DNA polymerase (Qiagen, Cat.No.

    Article Title: Profiling In Situ Microbial Community Structure with an Amplification Microarray
    Article Snippet: Paragraph title: Amplification microarray analysis. ... In this case, 3 μl of purified template was added to a 50-μl total reaction volume containing 1× Qiagen PCR buffer (Qiagen Taq DNA polymerase kit, catalog no. 201205), 1 mM additional MgCl2 (over and above that provided by the PCR buffer), 0.6 mg ml−1 nonacetylated bovine serum albumin, 0.2 mM each deoxynucleoside triphosphate (catalog no. 201901; Qiagen), 5 units Qiagen Taq DNA polymerase, 7.6% deionized formamide, 10 pmol Cy3-labeled primer 338f, and 1 pmol primer 519r.

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: .. PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France). ..

    Agarose Gel Electrophoresis:

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France). .. The two amplified fragments corresponding to the two splice variants internal standards were separated by excision on a 2% agarose gel and purified with the Qiaquick gel purification kit (Qiagen, Courtaboeuf, France).

    In Vitro:

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France). .. One μg of each cDNA was then converted to cRNA by using the MEGAscript T7 in vitro transcription kit (Ambion, TX, U.S.A.) followed by a standard DNAse I treatment. cRNAs were extracted by phenol-chlorophorm, precipitated and each standard concentration quantitated by u.v. spectrophotometry.

    Microarray:

    Article Title: Profiling In Situ Microbial Community Structure with an Amplification Microarray
    Article Snippet: Paragraph title: Amplification microarray analysis. ... In this case, 3 μl of purified template was added to a 50-μl total reaction volume containing 1× Qiagen PCR buffer (Qiagen Taq DNA polymerase kit, catalog no. 201205), 1 mM additional MgCl2 (over and above that provided by the PCR buffer), 0.6 mg ml−1 nonacetylated bovine serum albumin, 0.2 mM each deoxynucleoside triphosphate (catalog no. 201901; Qiagen), 5 units Qiagen Taq DNA polymerase, 7.6% deionized formamide, 10 pmol Cy3-labeled primer 338f, and 1 pmol primer 519r.

    Sequencing:

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: In the sense primer of which sequence is Q7 : 5′- CTT AAT ACG ACT CAC TAT AGG G CA CAG GTG AAG CTG TGA GCT C-3′, the underlined part of this primer is an optimal T7 polymerase sequence ( ). .. PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France).

    Size-exclusion Chromatography:

    Article Title: Determination of the Loss of Function Complement C4 Exon 29 CT Insertion Using a Novel Paralog-Specific Assay in Healthy UK and Spanish Populations
    Article Snippet: The reaction volume was 25 µl, comprising 2.5 µl of 10× PCR Buffer (QIAGEN), 0.5 µM of each dATP, dCTP ,dGTP and dTTP (Promega, Cat. No. U1240), 0.625 units of Taq DNA polymerase (Qiagen, Cat.No. .. PCR reaction conditions were: initial denaturation step at 94°C for 3 min, followed by 25 cycles at 94°C for 30 sec, 58°C for 30 sec and 72°C for 1 min, followed by a chase phase of 56°C for 1 min and 70°C for 20 min to ensure complete addition of the terminal adenine residue.

    Quantitative RT-PCR:

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: Paragraph title: Quantitative RT–PCR analysis of the rat B1 receptor mRNA ... PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France).

    Purification:

    Article Title: Profiling In Situ Microbial Community Structure with an Amplification Microarray
    Article Snippet: .. In this case, 3 μl of purified template was added to a 50-μl total reaction volume containing 1× Qiagen PCR buffer (Qiagen Taq DNA polymerase kit, catalog no. 201205), 1 mM additional MgCl2 (over and above that provided by the PCR buffer), 0.6 mg ml−1 nonacetylated bovine serum albumin, 0.2 mM each deoxynucleoside triphosphate (catalog no. 201901; Qiagen), 5 units Qiagen Taq DNA polymerase, 7.6% deionized formamide, 10 pmol Cy3-labeled primer 338f, and 1 pmol primer 519r. .. The asymmetric ratio of forward to reverse primer accumulates predominantly single-stranded target during log-linear amplification in solution over the microarray.

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France). .. The two amplified fragments corresponding to the two splice variants internal standards were separated by excision on a 2% agarose gel and purified with the Qiaquick gel purification kit (Qiagen, Courtaboeuf, France).

    Produced:

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: It produced the 63-bases deletion in the final PCR products. .. PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France).

    Concentration Assay:

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France). .. One μg of each cDNA was then converted to cRNA by using the MEGAscript T7 in vitro transcription kit (Ambion, TX, U.S.A.) followed by a standard DNAse I treatment. cRNAs were extracted by phenol-chlorophorm, precipitated and each standard concentration quantitated by u.v. spectrophotometry.

    Polymerase Chain Reaction:

    Article Title: Determination of the Loss of Function Complement C4 Exon 29 CT Insertion Using a Novel Paralog-Specific Assay in Healthy UK and Spanish Populations
    Article Snippet: .. The reaction volume was 25 µl, comprising 2.5 µl of 10× PCR Buffer (QIAGEN), 0.5 µM of each dATP, dCTP ,dGTP and dTTP (Promega, Cat. No. U1240), 0.625 units of Taq DNA polymerase (Qiagen, Cat.No. .. PCR reaction conditions were: initial denaturation step at 94°C for 3 min, followed by 25 cycles at 94°C for 30 sec, 58°C for 30 sec and 72°C for 1 min, followed by a chase phase of 56°C for 1 min and 70°C for 20 min to ensure complete addition of the terminal adenine residue.

    Article Title: Profiling In Situ Microbial Community Structure with an Amplification Microarray
    Article Snippet: .. In this case, 3 μl of purified template was added to a 50-μl total reaction volume containing 1× Qiagen PCR buffer (Qiagen Taq DNA polymerase kit, catalog no. 201205), 1 mM additional MgCl2 (over and above that provided by the PCR buffer), 0.6 mg ml−1 nonacetylated bovine serum albumin, 0.2 mM each deoxynucleoside triphosphate (catalog no. 201901; Qiagen), 5 units Qiagen Taq DNA polymerase, 7.6% deionized formamide, 10 pmol Cy3-labeled primer 338f, and 1 pmol primer 519r. .. The asymmetric ratio of forward to reverse primer accumulates predominantly single-stranded target during log-linear amplification in solution over the microarray.

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: .. PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France). ..

    Spectrophotometry:

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France). .. One μg of each cDNA was then converted to cRNA by using the MEGAscript T7 in vitro transcription kit (Ambion, TX, U.S.A.) followed by a standard DNAse I treatment. cRNAs were extracted by phenol-chlorophorm, precipitated and each standard concentration quantitated by u.v. spectrophotometry.

    CTG Assay:

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: In the sense primer of which sequence is Q7 : 5′- CTT AAT ACG ACT CAC TAT AGG G CA CAG GTG AAG CTG TGA GCT C-3′, the underlined part of this primer is an optimal T7 polymerase sequence ( ). .. PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Determination of the Loss of Function Complement C4 Exon 29 CT Insertion Using a Novel Paralog-Specific Assay in Healthy UK and Spanish Populations
    Article Snippet: .. The reaction volume was 25 µl, comprising 2.5 µl of 10× PCR Buffer (QIAGEN), 0.5 µM of each dATP, dCTP ,dGTP and dTTP (Promega, Cat. No. U1240), 0.625 units of Taq DNA polymerase (Qiagen, Cat.No. .. PCR reaction conditions were: initial denaturation step at 94°C for 3 min, followed by 25 cycles at 94°C for 30 sec, 58°C for 30 sec and 72°C for 1 min, followed by a chase phase of 56°C for 1 min and 70°C for 20 min to ensure complete addition of the terminal adenine residue.

    Activated Clotting Time Assay:

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: In the sense primer of which sequence is Q7 : 5′- CTT AAT ACG ACT CAC TAT AGG G CA CAG GTG AAG CTG TGA GCT C-3′, the underlined part of this primer is an optimal T7 polymerase sequence ( ). .. PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France).

    Gel Purification:

    Article Title: Pharmacological and molecular evidence for kinin B1 receptor expression in urinary bladder of cyclophosphamide-treated rats
    Article Snippet: PCR amplification was performed with the Quiagen Taq DNA polymerase in a final volume of 20 μl, containing 1 μl of the RT solution, 20 pmol of primers Q7 and Q8, 1X Taq buffer (m M ): Tris-HCl [pH 8.3] 10, KCl 50 and MgCl2 1.5, 1×Q solution, 0.125 m M dNTPs, and 0.1 U of Taq DNA polymerase (Quiagen, Courtaboeuf, France). .. The two amplified fragments corresponding to the two splice variants internal standards were separated by excision on a 2% agarose gel and purified with the Qiaquick gel purification kit (Qiagen, Courtaboeuf, France).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Qiagen taq dna polymerase
    Taq Dna Polymerase, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 1013 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Qiagen
    Average 90 stars, based on 1013 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Qiagen taq dna polymerase kit
    Taq Dna Polymerase Kit, supplied by Qiagen, used in various techniques. Bioz Stars score: 90/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase kit/product/Qiagen
    Average 90 stars, based on 45 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    N/A
    For use with Investigator PCR kits for human identity and forensic testing Kit contents Qiagen Multi Taq2 DNA Polymerase 100U For use with Investigator PCR Kits for Human Identity and
      Buy from Supplier

    Image Search Results