taq dna polymerase (Qiagen)
Qiagen is a verified supplier 
Qiagen manufactures this product 
99
|
Name:
Hot Star taq
Description:
Catalog Number:
HST3672000
Price:
None
Score:
85
|
Buy from Supplier |
Structured Review
Qiagen
taq dna polymerase
https://www.bioz.com/result/taq dna polymerase/product/Qiagen
Average 99 stars, based on 781 article reviews
Price from $9.99 to $1999.99
https://www.bioz.com/result/taq dna polymerase/product/Qiagen
Average 99 stars, based on 781 article reviews
Price from $9.99 to $1999.99
taq dna polymerase - by Bioz Stars,
2019-10
99/100 stars
Related Products / Commonly Used Together
Images
1) Product Images from "Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria"
Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria
Journal: PLoS ONE
doi: 10.1371/journal.pone.0007010
Figure Legend Snippet: Sequences of contaminating bacterial DNA in three Taq polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.
Techniques Used: Sequencing, Polymerase Chain Reaction
Figure Legend Snippet: Approximating the copy number of 16S rDNA in commercial Taq polymerases. Six DNA polymerases were used with primers for 16S rDNA on 7 serial 10-fold dilutions of E. coli genomic DNA (10 ng to 10 fg) with no added DNA in the 8 th sample. The least squares fit equation for each dilution series was used to assign a value to the signal from the 8 th sample, which contains Taq-associated DNA only. The efficiency of the reaction was determined from the slope of the linear fit plotting the base10 log of the DNA concentration vs. the threshold cycle. A slope of −3.322 indicates an average doubling rate of “2,” which is approximately 100% efficiency (2̂3.322∼10). The rDNA values assigned are for “E. coli equivalents.”
Techniques Used: Concentration Assay
Figure Legend Snippet: Detection of Pseudomonas fluorescens at high and low Taq polymerase concentrations. Bacterial detection with 0.5 Units (A) or 0.05 Units (B) Qiagen Taq DNA polymerase with 16S350B assay on samples containing 10 3 , 10 2 , 10 1 and zero Pseudomonas fluorescens bacteria. A composite of A and B is shown in C.
Techniques Used:
Figure Legend Snippet: Detection of bacterial DNA in six Taq polymerases. Four dilutions of six DNA polymerase were tested with primers for 16S rDNA in the presence of 100 pg (∼10̂5 16S rDNA) E. coli genomic DNA (circled) or H 2 O.
Techniques Used:
Figure Legend Snippet: Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.
Techniques Used: Labeling
2) Product Images from "Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria"
Article Title: Optimizing Taq Polymerase Concentration for Improved Signal-to-Noise in the Broad Range Detection of Low Abundance Bacteria
Journal: PLoS ONE
doi: 10.1371/journal.pone.0007010
Figure Legend Snippet: Sequences of contaminating bacterial DNA in three Taq polymerases. Sequence alignment of three contaminants from different commercial Taq polymerases showing the presence of different strains of the same Pseudomonas species. Roche FastStart, Platinum HiFi Platinum Taq polymerases contain similar strains of a Pseudomonas species with a single base difference in the region covered by the 16S350 PCR assay.
Techniques Used: Sequencing, Polymerase Chain Reaction
Figure Legend Snippet: Approximating the copy number of 16S rDNA in commercial Taq polymerases. Six DNA polymerases were used with primers for 16S rDNA on 7 serial 10-fold dilutions of E. coli genomic DNA (10 ng to 10 fg) with no added DNA in the 8 th sample. The least squares fit equation for each dilution series was used to assign a value to the signal from the 8 th sample, which contains Taq-associated DNA only. The efficiency of the reaction was determined from the slope of the linear fit plotting the base10 log of the DNA concentration vs. the threshold cycle. A slope of −3.322 indicates an average doubling rate of “2,” which is approximately 100% efficiency (2̂3.322∼10). The rDNA values assigned are for “E. coli equivalents.”
Techniques Used: Concentration Assay
Figure Legend Snippet: Detection of Pseudomonas fluorescens at high and low Taq polymerase concentrations. Bacterial detection with 0.5 Units (A) or 0.05 Units (B) Qiagen Taq DNA polymerase with 16S350B assay on samples containing 10 3 , 10 2 , 10 1 and zero Pseudomonas fluorescens bacteria. A composite of A and B is shown in C.
Techniques Used:
Figure Legend Snippet: Detection of bacterial DNA in six Taq polymerases. Four dilutions of six DNA polymerase were tested with primers for 16S rDNA in the presence of 100 pg (∼10̂5 16S rDNA) E. coli genomic DNA (circled) or H 2 O.
Techniques Used:
Figure Legend Snippet: Detection of the beta-lactamase gene in commercial Taq polymerase. Four dilutions of Amplitaq DNA polymerase were tested with primers for the beta-lactamase gene in the presence of 10 3 pUC19 plasmids (labeled 1000 pUC19 genomes) or H 2 O.
Techniques Used: Labeling
3) Product Images from "Conversion of Topoisomerase I Cleavage Complexes on the Leading Strand of Ribosomal DNA into 5?-Phosphorylated DNA Double-Strand Breaks by Replication Runoff"
Article Title: Conversion of Topoisomerase I Cleavage Complexes on the Leading Strand of Ribosomal DNA into 5?-Phosphorylated DNA Double-Strand Breaks by Replication Runoff
Journal:
doi:
Figure Legend Snippet: Diagram of the LM-PCR protocol to detect top1-induced DNA single-strand breaks and replication-mediated DNA double-strand breaks. Top1 is shown as a shaded oval with covalent linkage to the 3′ end of a DNA single-strand break. In the assay for top1-induced DNA single-strand breaks, top1-induced DNA single-strand breaks (i.e., top1 cleavage complexes) were detected (upper left) as described previously by annealing primer 1 (P1) to denatured genomic DNA. After primer extension and in vitro phosphorylation of the 5′-OH termini with T4 polynucleotide kinase, ligation to the double-stranded linker was performed. Thereafter, rRNA gene-specific DNA fragments were amplified with Taq DNA polymerase using the linker-primer and a nested, gene-specific PCR primer. After 26 cycles of PCR, a third primer (5′ end labeled with 32 P; star) was used for two primer extension cycles before the samples were separated in 7% denaturing polyacrylamide gels. In the assay for replication-mediated DNA double-strand breaks, collision between a replication fork and a top1 cleavage complex is proposed to lead to replication runoff, with generation of a DNA double-strand break (upper right). Because of in vivo 5′-end phosphorylation of replication-mediated DNA double-strand breaks, ligation to the linker could be performed without prior T4 polynucleotide kinase reaction. The following reaction steps were the same as for the detection of top1-induced DNA single-strand breaks. Note that the single-strand break assay detects both single- and double-strand breaks.
Techniques Used: Polymerase Chain Reaction, In Vitro, Ligation, Amplification, Labeling, In Vivo
4) Product Images from "Detection of knockdown resistance (kdr) mutations in Anopheles gambiae: a comparison of two new high-throughput assays with existing methods"
Article Title: Detection of knockdown resistance (kdr) mutations in Anopheles gambiae: a comparison of two new high-throughput assays with existing methods
Journal: Malaria Journal
doi: 10.1186/1475-2875-6-111
![Examples of AS-PCR products for kdr -e and kdr -w genotyping . Gels A to D show examples of AS-PCR results using four different protocols, A [29], B [11], C [12], D [20]. Gels E to G show the result of using different DNA polymerases on the AS-PCR method described by [20], E: Promega PCR master mix, F: Qiagen HotStar Taq G:Finzymes Dynazyme II Gel H is an example of results of using the protocol of [20] with the Promega PCR master mix to genotype samples using the kdr -e assay from the 96 reference plate and gel I for the kdr -w assay. The same DNA templates were used in PCRs shown in gels A to G and from left to right were 100 bp DNA Ladder (Fermentas), homozygous wildtype, homozygous wildtype, heterozygous, heterozygous, homozygous mutant, homozygous mutant.](https://storage.googleapis.com/bioz_article_images/PMC1971715/1475-2875-6-111-1.jpg "... E: Promega PCR master mix, F: Qiagen HotStar Taq G:Finzymes Dynazyme II Gel H is an example ...")
Figure Legend Snippet: Examples of AS-PCR products for kdr -e and kdr -w genotyping . Gels A to D show examples of AS-PCR results using four different protocols, A [29], B [11], C [12], D [20]. Gels E to G show the result of using different DNA polymerases on the AS-PCR method described by [20], E: Promega PCR master mix, F: Qiagen HotStar Taq G:Finzymes Dynazyme II Gel H is an example of results of using the protocol of [20] with the Promega PCR master mix to genotype samples using the kdr -e assay from the 96 reference plate and gel I for the kdr -w assay. The same DNA templates were used in PCRs shown in gels A to G and from left to right were 100 bp DNA Ladder (Fermentas), homozygous wildtype, homozygous wildtype, heterozygous, heterozygous, homozygous mutant, homozygous mutant.
Techniques Used: Polymerase Chain Reaction, Mutagenesis
Related Articles
Clone Assay:Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells Article Snippet: For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Amplification:Article Title: Common variants near ABCA1, AFAP1 and GMDS confer risk of primary open-angle glaucoma Article Snippet: PCR was performed using the Article Title: Interleukin-28B Polymorphisms and Response of Chronic Hepatitis C Patients from Indonesia to Pegylated Interferon/Ribavirin Treatment Article Snippet: To amplify the NS5B region of the HCV genome, the extracted RNA was reverse transcribed and amplified using SuperScript One-Step reverse transcription-PCR (RT-PCR) (Invitrogen, Tokyo, Japan) and a set of primers. .. PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Article Title: Occurrence, Diversity, and Host Association of Intestinal Campylobacter, Arcobacter, and Helicobacter in Reptiles Article Snippet: For isolates for which atpA could not be sequenced, 16S rRNA encoding DNA sequencing was used using the 16S rDNA targeting primers 27F and 1492R . .. Each PCR amplification mixture contained 2.5 µM each primer, 1x Go Taq Hot Start Green Master Mix (Promega) or Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells Article Snippet: The reaction was incubated at 42°C for 50 minutes, and then the reverse transcriptase was inactivated at 70°C for 10 minutes. .. After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Article Title: Isolation and Characterization of Vibrio tubiashii Outer Membrane Proteins and Determination of a toxR Homolog Article Snippet: PCR analysis was carried out using a general master mix, and each reaction mixture contained 2 μl of a 3 μM concentration of the forward, 5′-end primer and 2 μl of a 3 μM concentration of the reverse, 3′-end primer (Invitrogen Corporation, Carlsbad, CA), 5 μl of 10× Tris-borate-EDTA buffer (Qiagen, Inc., Valencia, CA), 2 μl of 25 mM MgCl2 (Qiagen, Inc.), 2 μl of a 10 mM concentration of the deoxynucleoside triphosphates or 10 μl of a 2 mM concentration of the deoxynucleoside triphosphates (Invitrogen Corporation), and 0.5 μl of Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis Article Snippet: Bisulfite converted DNA was eluted in 20 µL of elution buffer and was subjected to PCR amplification of the specific region by use of a primer set designed to amplify both methylated and unmethylated sequences of the UTF1 gene promoter. .. Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France Article Snippet: Cybergene Group), respectively. .. The PCR amplification mixture contained 12.5 μl Article Title: Comparing low coverage random shotgun sequence data from Brassica oleracea and Oryza sativa genome sequence for their ability to add to the annotation of Arabidopsis thaliana Article Snippet: For the PCR amplification step, the negative control for each primer pair was RNA instead of the RT product as template. .. Reagents from the Qiagen Article Title: Frequent p16-Independent Inactivation of p14ARF in Human Melanoma Article Snippet: Amplifications were carried out in 20 μL using 100 ng DNA of genomic DNA and a mastermix consisting of purified, autoclaved water; MgCl2 buffer (Qiagen); DMSO (Sigma-Aldrich, St Louis, MO); mixed dinucleotide triphosphates (dNTPs) (Roche, Indianapolis, IN); forward and reverse primers (Applied Biosystems, Foster City, CA); and Article Title: Circulating tumour cell detection: a direct comparison between the CellSearch System, the AdnaTest and CK-19/mammaglobin RT-PCR in patients with metastatic breast cancer Article Snippet: PCR analyses were carried out in a final volume of 50 μ l PCR mixture, containing 8 μ l of cDNA, 4 μ l primer mixture (PrimerMix BreastDetect; AdnaGen), 25 μ l of Hot Star Taq Master Mix (Qiagen) and 13 μ l of distilled water. .. PCR analyses were carried out in a final volume of 50 μ l PCR mixture, containing 8 μ l of cDNA, 4 μ l primer mixture (PrimerMix BreastDetect; AdnaGen), 25 μ l of Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement Article Snippet: Amplification of the 105 and 133 bp product of the two-microglobulin gene and the 247-bp product of the PGK gene was used to test the quality of the extracted RNA, as previously described [ , , ]. .. Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Article Title: Methylated APC and GSTP1 genes in serum DNA correlate with the presence of circulating blood tumor cells and are associated with a more aggressive and advanced breast cancer disease Article Snippet: Multiplex PCR analyses were carried out in a final volume of 50 μl PCR mixture, containing 8 μl of cDNA, 4 μl primer mixtures (PrimerMix BreastDetect; AdnaGen), 25 μl of Hot Star Taq Master Mix (Qiagen) and 13 μl of distilled water. .. Multiplex PCR analyses were carried out in a final volume of 50 μl PCR mixture, containing 8 μl of cDNA, 4 μl primer mixtures (PrimerMix BreastDetect; AdnaGen), 25 μl of Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization Article Snippet: Briefly, enriched CD8+ T cells were stimulated with 5 μg/mL immunodominant H-2Kd -binding 197 AMQMLKETI205 , 9 mer Gag peptide for 16 h. Following stimulation, mRNA was prepared and cDNA was synthesized as described previously (Ranasinghe and others ). .. As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Article Title: Expression of tissue factor in pancreatic adenocarcinoma is associated with activation of coagulation Article Snippet: Isolated total RNA (1 μg, determined photometrically) was reverse transcribed using Superscript II reverse transcriptase (Invitrogen; Karlsruhe, Germany) and oligo-dT primers. .. The resulting cDNA was amplified in separate tubes using Synthesized:Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization Article Snippet: Briefly, enriched CD8+ T cells were stimulated with 5 μg/mL immunodominant H-2Kd -binding 197 AMQMLKETI205 , 9 mer Gag peptide for 16 h. Following stimulation, mRNA was prepared and cDNA was synthesized as described previously (Ranasinghe and others ). .. As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Terminal Restriction Fragment Length Polymorphism:Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France Article Snippet: Paragraph title: T-RFLP analysis. ... The PCR amplification mixture contained 12.5 μl SYBR Green Assay:Article Title: Serum of patients with acute myocardial infarction prevents inflammation in iPSC-cardiomyocytes Article Snippet: RNA was extracted from hiPSC-CMs by lysis with RLT lysis buffer, followed by the application of the RNeasy MiniKit (Qiagen) according to manufacturer’s instructions. cDNA synthesis was performed with oligo (dT) primers using AMV reverse transcriptase (Roche). .. For quantitative real time PCR, Microarray:Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus Article Snippet: This primer combination detects the same dscr1 isoforms as the inflammation DNA microarray and amplifies a spliced transcript of 196 bp and would amplify a genomic fragment of 554 bp if genomic traces of DNA were present. .. The PCR was performed with the Incubation:Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells Article Snippet: After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Hot Star Taq (Qiagen, Valencia, CA), 2.5 mM MgCl2 , and 200 μM of each deoxynucleotide triphosphate, in the supplied PCR buffer. .. After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Expressing:Article Title: Common variants near ABCA1, AFAP1 and GMDS confer risk of primary open-angle glaucoma Article Snippet: Paragraph title: Expression analysis of genes at associated loci in ocular tissues and cells ... PCR was performed using the Article Title: Interleukin-28B Polymorphisms and Response of Chronic Hepatitis C Patients from Indonesia to Pegylated Interferon/Ribavirin Treatment Article Snippet: PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Article Title: Serum of patients with acute myocardial infarction prevents inflammation in iPSC-cardiomyocytes Article Snippet: For quantitative real time PCR, Article Title: Expression of tissue factor in pancreatic adenocarcinoma is associated with activation of coagulation Article Snippet: For detection of concomitant expression of TF and asTF, cells were washed with PBS. .. The resulting cDNA was amplified in separate tubes using Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus Article Snippet: The PCR was performed with the Modification:Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes Article Snippet: DNA methylation of the promoters p16, MLH1, Mint1, Mint2, Mint31 , and MGMT genes was determined by MSP after chemical modification of genomic DNA with sodium bisulfite as described by Herman et al. DNA modification was performed using the Methylamp DNA modification kit (Epigentek, USA) according to the manufacturer's instructions. .. PCRs were performed in a total volume of 25 µl using 0.5 U of Western Blot:Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus Article Snippet: The PCR was performed with the Real-time Polymerase Chain Reaction:Article Title: Interleukin-28B Polymorphisms and Response of Chronic Hepatitis C Patients from Indonesia to Pegylated Interferon/Ribavirin Treatment Article Snippet: PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Article Title: Serum of patients with acute myocardial infarction prevents inflammation in iPSC-cardiomyocytes Article Snippet: RNA was extracted from hiPSC-CMs by lysis with RLT lysis buffer, followed by the application of the RNeasy MiniKit (Qiagen) according to manufacturer’s instructions. cDNA synthesis was performed with oligo (dT) primers using AMV reverse transcriptase (Roche). .. For quantitative real time PCR, Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization Article Snippet: Paragraph title: mRNA preparation and quantitative real-time polymerase chain reaction analysis ... As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Bisulfite Sequencing:Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells Article Snippet: Bisulphite treatment of 1 μg of DNA from each sample was performed with the EZ DNA Methylation-Gold Kit™ (Zymo Research Corp, USA, Freiburg, Germany) yielding 50 μl converted DNA from each sample. .. For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U PSQ Assay:Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis Article Snippet: The primers were designed using PSQ assay design software (Qiagen). .. Transfection:Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus Article Snippet: SLK cells were plated at 3 × 105 cells/well of a six-well plate and transfected with Lipofectamine 2000. .. The PCR was performed with the Concentration Assay:Article Title: Isolation and Characterization of Vibrio tubiashii Outer Membrane Proteins and Determination of a toxR Homolog Article Snippet: DNA templates were prepared according to the procedure described by Kothary et al. ( ). .. PCR analysis was carried out using a general master mix, and each reaction mixture contained 2 μl of a 3 μM concentration of the forward, 5′-end primer and 2 μl of a 3 μM concentration of the reverse, 3′-end primer (Invitrogen Corporation, Carlsbad, CA), 5 μl of 10× Tris-borate-EDTA buffer (Qiagen, Inc., Valencia, CA), 2 μl of 25 mM MgCl2 (Qiagen, Inc.), 2 μl of a 10 mM concentration of the deoxynucleoside triphosphates or 10 μl of a 2 mM concentration of the deoxynucleoside triphosphates (Invitrogen Corporation), and 0.5 μl of Magnetic Beads:Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement Article Snippet: Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Reverse Transcription Polymerase Chain Reaction:Article Title: Involution of the mouse mammary gland is associated with an immune cascade and an acute-phase response, involving LBP, CD14 and STAT3 Article Snippet: Paragraph title: Reverse transcriptase polymerase chain reaction (RT–PCR) ... This cDNA (1 μl) was used in each PCR reaction with Article Title: Interleukin-28B Polymorphisms and Response of Chronic Hepatitis C Patients from Indonesia to Pegylated Interferon/Ribavirin Treatment Article Snippet: To amplify the NS5B region of the HCV genome, the extracted RNA was reverse transcribed and amplified using SuperScript One-Step reverse transcription-PCR (RT-PCR) (Invitrogen, Tokyo, Japan) and a set of primers. .. PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells Article Snippet: Paragraph title: Single Cell RT-PCR ... After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Article Title: Comparing low coverage random shotgun sequence data from Brassica oleracea and Oryza sativa genome sequence for their ability to add to the annotation of Arabidopsis thaliana Article Snippet: Paragraph title: RT–PCR and sequencing hypothetical genes and CCURs ... Reagents from the Qiagen Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement Article Snippet: Paragraph title: Detection of the ETV6-NTRK3 fusion transcript by RT-PCR ... Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Article Title: Expression of tissue factor in pancreatic adenocarcinoma is associated with activation of coagulation Article Snippet: Paragraph title: RT-PCR ... The resulting cDNA was amplified in separate tubes using Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus Article Snippet: Paragraph title: Reverse transcription-PCR (RT-PCR). ... The PCR was performed with the CpG Methylation Assay:Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis Article Snippet: DNA Sequencing:Article Title: Occurrence, Diversity, and Host Association of Intestinal Campylobacter, Arcobacter, and Helicobacter in Reptiles Article Snippet: For isolates for which atpA could not be sequenced, 16S rRNA encoding DNA sequencing was used using the 16S rDNA targeting primers 27F and 1492R . .. Each PCR amplification mixture contained 2.5 µM each primer, 1x Go Taq Hot Start Green Master Mix (Promega) or Sequencing:Article Title: Interleukin-28B Polymorphisms and Response of Chronic Hepatitis C Patients from Indonesia to Pegylated Interferon/Ribavirin Treatment Article Snippet: PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Article Title: Occurrence, Diversity, and Host Association of Intestinal Campylobacter, Arcobacter, and Helicobacter in Reptiles Article Snippet: Paragraph title: atpA and 16S rRNA sequencing for species identification of isolates ... Each PCR amplification mixture contained 2.5 µM each primer, 1x Go Taq Hot Start Green Master Mix (Promega) or Article Title: Isolation and Characterization of Vibrio tubiashii Outer Membrane Proteins and Determination of a toxR Homolog Article Snippet: In order to confirm the presence of the OmpU-like protein expressed by the strains and to determine whether the V. tubiashii strains had homologous ompU genes, PCR analysis was performed using primer pairs (Table ) designed by Sperandio et al. ( ) and based on the sequence of ompU of V. cholerae . .. PCR analysis was carried out using a general master mix, and each reaction mixture contained 2 μl of a 3 μM concentration of the forward, 5′-end primer and 2 μl of a 3 μM concentration of the reverse, 3′-end primer (Invitrogen Corporation, Carlsbad, CA), 5 μl of 10× Tris-borate-EDTA buffer (Qiagen, Inc., Valencia, CA), 2 μl of 25 mM MgCl2 (Qiagen, Inc.), 2 μl of a 10 mM concentration of the deoxynucleoside triphosphates or 10 μl of a 2 mM concentration of the deoxynucleoside triphosphates (Invitrogen Corporation), and 0.5 μl of Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis Article Snippet: The primers sequences (in 5′- -3′ orientation) are, for the first step, forward: AGGGGTTTTAGTTTTTTTAGTAGAGGTGTT -Btn and reverse: AACCCCTAACCCAATAACAAACT and for sequencing: GGGGGAGGATGTTAAG . .. Article Title: Comparing low coverage random shotgun sequence data from Brassica oleracea and Oryza sativa genome sequence for their ability to add to the annotation of Arabidopsis thaliana Article Snippet: Paragraph title: RT–PCR and sequencing hypothetical genes and CCURs ... Reagents from the Qiagen Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement Article Snippet: Detection of 110 bp fragments of ETV6 -NTRK3 fusion transcripts was performed by RT-PCR, as follows [ ]. .. Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization Article Snippet: Briefly, enriched CD8+ T cells were stimulated with 5 μg/mL immunodominant H-2Kd -binding 197 AMQMLKETI205 , 9 mer Gag peptide for 16 h. Following stimulation, mRNA was prepared and cDNA was synthesized as described previously (Ranasinghe and others ). .. As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Binding Assay:Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization Article Snippet: Briefly, enriched CD8+ T cells were stimulated with 5 μg/mL immunodominant H-2Kd -binding 197 AMQMLKETI205 , 9 mer Gag peptide for 16 h. Following stimulation, mRNA was prepared and cDNA was synthesized as described previously (Ranasinghe and others ). .. As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using DNA Extraction:Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes Article Snippet: Paragraph title: DNA extraction and methylation-specific PCR (MSP) ... PCRs were performed in a total volume of 25 µl using 0.5 U of Article Title: Frequent p16-Independent Inactivation of p14ARF in Human Melanoma Article Snippet: Paragraph title: DNA Isolation and Polymerase Chain Reaction ... Amplifications were carried out in 20 μL using 100 ng DNA of genomic DNA and a mastermix consisting of purified, autoclaved water; MgCl2 buffer (Qiagen); DMSO (Sigma-Aldrich, St Louis, MO); mixed dinucleotide triphosphates (dNTPs) (Roche, Indianapolis, IN); forward and reverse primers (Applied Biosystems, Foster City, CA); and Methylation:Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells Article Snippet: Paragraph title: Methylation analysis ... For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes Article Snippet: Paragraph title: DNA extraction and methylation-specific PCR (MSP) ... PCRs were performed in a total volume of 25 µl using 0.5 U of Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis Article Snippet: Bisulfite converted DNA was eluted in 20 µL of elution buffer and was subjected to PCR amplification of the specific region by use of a primer set designed to amplify both methylated and unmethylated sequences of the UTF1 gene promoter. .. Isolation:Article Title: Frequent p16-Independent Inactivation of p14ARF in Human Melanoma Article Snippet: Eight to ten 30-μm sections were cut from each specimen, and genomic DNA was isolated using the QIAamp DNA mini kit (Qiagen, Valencia, CA). .. Amplifications were carried out in 20 μL using 100 ng DNA of genomic DNA and a mastermix consisting of purified, autoclaved water; MgCl2 buffer (Qiagen); DMSO (Sigma-Aldrich, St Louis, MO); mixed dinucleotide triphosphates (dNTPs) (Roche, Indianapolis, IN); forward and reverse primers (Applied Biosystems, Foster City, CA); and Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement Article Snippet: RNA from all cases of MASCs was extracted using the RecoverAll Total Nucleic Acid Isolation Kit (Ambion, Austin, TX, USA). .. Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Article Title: Expression of tissue factor in pancreatic adenocarcinoma is associated with activation of coagulation Article Snippet: Isolated total RNA (1 μg, determined photometrically) was reverse transcribed using Superscript II reverse transcriptase (Invitrogen; Karlsruhe, Germany) and oligo-dT primers. .. The resulting cDNA was amplified in separate tubes using Negative Control:Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells Article Snippet: After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Article Title: Comparing low coverage random shotgun sequence data from Brassica oleracea and Oryza sativa genome sequence for their ability to add to the annotation of Arabidopsis thaliana Article Snippet: For the PCR amplification step, the negative control for each primer pair was RNA instead of the RT product as template. .. Reagents from the Qiagen RNA Extraction:Article Title: Serum of patients with acute myocardial infarction prevents inflammation in iPSC-cardiomyocytes Article Snippet: Paragraph title: RNA extraction, cDNA synthesis and quantitative real-time PCR ... For quantitative real time PCR, Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus Article Snippet: At 32 h posttransfection, cells were lysed for RNA extraction according to the manufacturer's instructions (RNeasy kit; QIAGEN). cDNA was prepared as described for DNA microarray experiments. .. The PCR was performed with the Labeling:Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France Article Snippet: Forward (8F) and reverse (1489R) primers were fluorescently labeled with tetrachlorofluorescein phosphoramidite and hexachlorofluorescein phosphoramidite (E.S.G.S. .. The PCR amplification mixture contained 12.5 μl Purification:Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes Article Snippet: DNA from tumor tissues was extracted from fresh-frozen specimens using a commercial kit (Master Pure DNA and RNA purification kit-Epicentre Biotechnologies, Madison, WI, USA) according to the manufacturer's instructions. .. PCRs were performed in a total volume of 25 µl using 0.5 U of Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France Article Snippet: The PCR amplification mixture contained 12.5 μl Article Title: Frequent p16-Independent Inactivation of p14ARF in Human Melanoma Article Snippet: DNA concentrations were standardized in 1.5% agarose gels in reference to the Low DNA Mass Ladder (Invitrogen, Carlsbad, CA). .. Amplifications were carried out in 20 μL using 100 ng DNA of genomic DNA and a mastermix consisting of purified, autoclaved water; MgCl2 buffer (Qiagen); DMSO (Sigma-Aldrich, St Louis, MO); mixed dinucleotide triphosphates (dNTPs) (Roche, Indianapolis, IN); forward and reverse primers (Applied Biosystems, Foster City, CA); and Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement Article Snippet: Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Polymerase Chain Reaction:Article Title: Common variants near ABCA1, AFAP1 and GMDS confer risk of primary open-angle glaucoma Article Snippet: First strand cDNA was synthesised using the Superscript III reverse transcriptase (Invitrogen, Life Technologies Australia Pty Ltd., Mulgrave, Australia) and random hexamers. .. PCR was performed using the Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells Article Snippet: Bisulphite treatment of 1 μg of DNA from each sample was performed with the EZ DNA Methylation-Gold Kit™ (Zymo Research Corp, USA, Freiburg, Germany) yielding 50 μl converted DNA from each sample. .. For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Article Title: Involution of the mouse mammary gland is associated with an immune cascade and an acute-phase response, involving LBP, CD14 and STAT3 Article Snippet: A 10 μl portion of this solution was used to produce cDNA, using SuperscriptII (Invitrogen) in accordance with the manufacturer's protocol. .. This cDNA (1 μl) was used in each PCR reaction with Article Title: Interleukin-28B Polymorphisms and Response of Chronic Hepatitis C Patients from Indonesia to Pegylated Interferon/Ribavirin Treatment Article Snippet: To amplify the NS5B region of the HCV genome, the extracted RNA was reverse transcribed and amplified using SuperScript One-Step reverse transcription-PCR (RT-PCR) (Invitrogen, Tokyo, Japan) and a set of primers. .. PCR amplifications using outer primers (nucleotides [nt] 7999 to 8825) and inner primers (8159 to 8630) were performed as previously described ( ) using Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes Article Snippet: Paragraph title: DNA extraction and methylation-specific PCR (MSP) ... PCRs were performed in a total volume of 25 µl using 0.5 U of Article Title: Occurrence, Diversity, and Host Association of Intestinal Campylobacter, Arcobacter, and Helicobacter in Reptiles Article Snippet: For isolates for which atpA could not be sequenced, 16S rRNA encoding DNA sequencing was used using the 16S rDNA targeting primers 27F and 1492R . .. Each PCR amplification mixture contained 2.5 µM each primer, 1x Go Taq Hot Start Green Master Mix (Promega) or Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells Article Snippet: The reaction was incubated at 42°C for 50 minutes, and then the reverse transcriptase was inactivated at 70°C for 10 minutes. .. After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Article Title: Isolation and Characterization of Vibrio tubiashii Outer Membrane Proteins and Determination of a toxR Homolog Article Snippet: DNA templates were prepared according to the procedure described by Kothary et al. ( ). .. PCR analysis was carried out using a general master mix, and each reaction mixture contained 2 μl of a 3 μM concentration of the forward, 5′-end primer and 2 μl of a 3 μM concentration of the reverse, 3′-end primer (Invitrogen Corporation, Carlsbad, CA), 5 μl of 10× Tris-borate-EDTA buffer (Qiagen, Inc., Valencia, CA), 2 μl of 25 mM MgCl2 (Qiagen, Inc.), 2 μl of a 10 mM concentration of the deoxynucleoside triphosphates or 10 μl of a 2 mM concentration of the deoxynucleoside triphosphates (Invitrogen Corporation), and 0.5 μl of Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis Article Snippet: The primers sequences (in 5′- -3′ orientation) are, for the first step, forward: AGGGGTTTTAGTTTTTTTAGTAGAGGTGTT -Btn and reverse: AACCCCTAACCCAATAACAAACT and for sequencing: GGGGGAGGATGTTAAG . .. Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France Article Snippet: Cybergene Group), respectively. .. The PCR amplification mixture contained 12.5 μl Article Title: Comparing low coverage random shotgun sequence data from Brassica oleracea and Oryza sativa genome sequence for their ability to add to the annotation of Arabidopsis thaliana Article Snippet: Other negative controls used per 96-well plate were as follows: no primers and no Taq DNA polymerase. .. Reagents from the Qiagen Article Title: Frequent p16-Independent Inactivation of p14ARF in Human Melanoma Article Snippet: Paragraph title: DNA Isolation and Polymerase Chain Reaction ... Amplifications were carried out in 20 μL using 100 ng DNA of genomic DNA and a mastermix consisting of purified, autoclaved water; MgCl2 buffer (Qiagen); DMSO (Sigma-Aldrich, St Louis, MO); mixed dinucleotide triphosphates (dNTPs) (Roche, Indianapolis, IN); forward and reverse primers (Applied Biosystems, Foster City, CA); and Article Title: Circulating tumour cell detection: a direct comparison between the CellSearch System, the AdnaTest and CK-19/mammaglobin RT-PCR in patients with metastatic breast cancer Article Snippet: The primer mixture consisted of four specific primer pairs for the amplification of three tumour markers (Muc-1 , HER2 and GA733-2 ) and one housekeeping gene (Actin ). .. PCR analyses were carried out in a final volume of 50 μ l PCR mixture, containing 8 μ l of cDNA, 4 μ l primer mixture (PrimerMix BreastDetect; AdnaGen), 25 μ l of Article Title: Mammary analogue secretory carcinoma of salivary glands: a new entity associated with ETV6 gene rearrangement Article Snippet: Detection of 110 bp fragments of ETV6 -NTRK3 fusion transcripts was performed by RT-PCR, as follows [ ]. .. Two microliters of cDNA was added to a reaction mixture containing 12.5 μl of Article Title: Methylated APC and GSTP1 genes in serum DNA correlate with the presence of circulating blood tumor cells and are associated with a more aggressive and advanced breast cancer disease Article Snippet: The primer mixture consisted of four specific primer pairs for the amplification of three tumour markers (Muc-1, HER2 and EPCAM) and one housekeeping gene (Actin). .. Multiplex PCR analyses were carried out in a final volume of 50 μl PCR mixture, containing 8 μl of cDNA, 4 μl primer mixtures (PrimerMix BreastDetect; AdnaGen), 25 μl of Article Title: Persistence and Complex Evolution of Fluoroquinolone-Resistant Streptococcus pneumoniae Clone Article Snippet: Primers amplifying the QRDR ( ) were designed for each of the 4 genes: parC primers, F-CAAAACATGTCCCTGGAGGA and R-GCAGCATCTATGACCTCAGC; parE primers, F-TCAAGTCTGCCATTACCAAGG and R-ACCCGCACCAATGGTATAAA; gyrA primers, F2-GACAAAGGAGATGAAGGCAAG and R2-GAAAATCTGGTCCAGGCAAG; gyrB primers, F-GGGAAATAGCGAAGTGGTCA and R-GTACGAATGTGGGCTCCAT. .. PCR on lysates with primers as above using Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus Article Snippet: This primer combination detects the same dscr1 isoforms as the inflammation DNA microarray and amplifies a spliced transcript of 196 bp and would amplify a genomic fragment of 554 bp if genomic traces of DNA were present. .. The PCR was performed with the Quantitative RT-PCR:Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization Article Snippet: Briefly, enriched CD8+ T cells were stimulated with 5 μg/mL immunodominant H-2Kd -binding 197 AMQMLKETI205 , 9 mer Gag peptide for 16 h. Following stimulation, mRNA was prepared and cDNA was synthesized as described previously (Ranasinghe and others ). .. As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Lysis:Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells Article Snippet: After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Article Title: Serum of patients with acute myocardial infarction prevents inflammation in iPSC-cardiomyocytes Article Snippet: RNA was extracted from hiPSC-CMs by lysis with RLT lysis buffer, followed by the application of the RNeasy MiniKit (Qiagen) according to manufacturer’s instructions. cDNA synthesis was performed with oligo (dT) primers using AMV reverse transcriptase (Roche). .. For quantitative real time PCR, Plasmid Preparation:Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells Article Snippet: For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Software:Article Title: Aberrant Promoter Methylation and Expression of UTF1 during Cervical Carcinogenesis Article Snippet: The primers were designed using PSQ assay design software (Qiagen). .. Electrophoresis:Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells Article Snippet: For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes Article Snippet: PCRs were performed in a total volume of 25 µl using 0.5 U of Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells Article Snippet: After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Multiplex Assay:Article Title: Circulating tumour cell detection: a direct comparison between the CellSearch System, the AdnaTest and CK-19/mammaglobin RT-PCR in patients with metastatic breast cancer Article Snippet: For the analysis of tumour-associated mRNAs, a multiplex PCR was carried out. .. PCR analyses were carried out in a final volume of 50 μ l PCR mixture, containing 8 μ l of cDNA, 4 μ l primer mixture (PrimerMix BreastDetect; AdnaGen), 25 μ l of Article Title: Methylated APC and GSTP1 genes in serum DNA correlate with the presence of circulating blood tumor cells and are associated with a more aggressive and advanced breast cancer disease Article Snippet: The primer mixture consisted of four specific primer pairs for the amplification of three tumour markers (Muc-1, HER2 and EPCAM) and one housekeeping gene (Actin). .. Multiplex PCR analyses were carried out in a final volume of 50 μl PCR mixture, containing 8 μl of cDNA, 4 μl primer mixtures (PrimerMix BreastDetect; AdnaGen), 25 μl of Agarose Gel Electrophoresis:Article Title: The RNA binding protein Musashi1 regulates apoptosis, gene expression and stress granule formation in urothelial carcinoma cells Article Snippet: For bisulphite sequencing, PCR of the MSI1 promoter was performed with specific primers (For: GTAGGGATTTGAGAGGGAAGA and Rev: AACAAACCATACTACCCCCTC), in a volume of 50 μl containing 150 μM deoxyribonucleotide triphosphates (dNTPs), 0.3 μM of each primer, 1× PCR buffer (Qiagen), 1.0 U Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France Article Snippet: The PCR amplification mixture contained 12.5 μl Article Title: Expression of tissue factor in pancreatic adenocarcinoma is associated with activation of coagulation Article Snippet: The resulting cDNA was amplified in separate tubes using In Vitro:Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes Article Snippet: PCRs were performed in a total volume of 25 µl using 0.5 U of DNA Methylation Assay:Article Title: Type 1 serrated polyposis represents a predominantly female disease with a high prevalence of dysplastic serrated adenomas, without germline mutation in MUTYH, APC, and PTEN genes Article Snippet: DNA methylation of the promoters p16, MLH1, Mint1, Mint2, Mint31 , and MGMT genes was determined by MSP after chemical modification of genomic DNA with sodium bisulfite as described by Herman et al. DNA modification was performed using the Methylamp DNA modification kit (Epigentek, USA) according to the manufacturer's instructions. .. PCRs were performed in a total volume of 25 µl using 0.5 U of Activation Assay:Article Title: IL-17A Expression in HIV-Specific CD8 T Cells Is Regulated by IL-4/IL-13 Following HIV-1 Prime-Boost Immunization Article Snippet: Briefly, enriched CD8+ T cells were stimulated with 5 μg/mL immunodominant H-2Kd -binding 197 AMQMLKETI205 , 9 mer Gag peptide for 16 h. Following stimulation, mRNA was prepared and cDNA was synthesized as described previously (Ranasinghe and others ). .. As mRNA copy numbers of the cytokines (IL-6, IL-17, and IL-23a) and transcription factors (TGF-β and ROR-γt) of interests were low, the samples were first preamplified with gene-specific primers ( ) using Article Title: Expression of tissue factor in pancreatic adenocarcinoma is associated with activation of coagulation Article Snippet: The resulting cDNA was amplified in separate tubes using Migration:Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France Article Snippet: The PCR amplification mixture contained 12.5 μl DNA Purification:Article Title: Diversity of Microorganisms in Fe-As-Rich Acid Mine Drainage Waters of Carnoul?s, France Article Snippet: The PCR amplification mixture contained 12.5 μl Staining:Article Title: Optimisation of the RT-PCR detection of immunomagnetically enriched carcinoma cells Article Snippet: After reverse transcription, 4 μl of cDNA was used as the template in a single round of PCR amplification with 200 nM of each gene specific primer pair (Table ), 1 U of Article Title: Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus Article Snippet: The PCR was performed with the |
![Expression analysis of cyclin D2 as a potential <t>Elf5</t> target gene . A . The expression pattern of cyclin D2 and Elf5 during different stages of mammary gland development. The expression profile was generated by analysis of microarray data from Stein et al[ 24 ]. B . Relative expression of cyclin D2 mRNA by real time <t>RT-PCR</t> during mouse mammary gland development . Total RNA from wild type (WT) and K14-Cre/Elf5 f/f (null) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed for relative expression of Ccnd2 mRNA levels by real time RT-PCR. The housekeeping gene Gapdh was used to normalize gene expression. Results are from two or more independent experiments. C . Expression of cyclin D2 protein during mouse mammary gland development . Protein extract from wild type (WT) and K14-Cre/Elf5 f/f knockout (KO) mouse mammary glands at pregnancy day 17.5 and lactation day 1 were analyzed by western blot with antibodies against cyclin D2 and p27. Equal loading was assessed by anti-β-tubulin antibodies and the absence of Elf5 in KO was confirmed by anti-Elf5 antibodies.](https://storage.googleapis.com/bioz_article_images/PMC2949602/1471-2199-11-68-5.jpg)
