Structured Review

Promega taq dna polymerase
Superimposition of the thumb domains of <t>Taq</t> <t>DNA</t> polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Taq Dna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 2455 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/taq dna polymerase/product/Promega
Average 99 stars, based on 2455 article reviews
Price from $9.99 to $1999.99
taq dna polymerase - by Bioz Stars, 2020-09
99/100 stars

Images

1) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

2) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

3) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

4) Product Images from "Quantitative target display: a method to screen yeast mutants conferring quantitative phenotypes by 'mutant DNA fingerprints'"

Article Title: Quantitative target display: a method to screen yeast mutants conferring quantitative phenotypes by 'mutant DNA fingerprints'

Journal: Nucleic Acids Research

doi:

Selective and quantitative amplification of targets. ( A ) Selective amplification of DNA flanking Tn insertions. Genomic DNA of 16 individual mutants were used to amplify DNA fragments until nearby Taq I restriction sites, and resolved on a sequencing gel. The mutants analyzed were: lane 1, SSA1 (V45B4); lane 2, YDJ1 (V6A2); lane 3, DDR48 (V6G5); lane 4, SSA2 (V18E7); lane 5, SSA3 (V41F1); lane 6, SSA4 (V5E8); lane 7, SSB1 (V23F11); lane 8, SSB2 (V32E7); lane 9, HSP35 (V18D3); lane 10, SSA4 (V3B8); lane 11, SOD2 (V4D11); lane 12, SSB2 (V47A3); lane 13, UBI4 (V36G6); lane 14, TPS2 (V2C2); lane 15, HSP104 (V8D8); lane 16, HSP104 (V22A9). Two bands each are seen for most of the mutants, consistent with specific amplification of DNA from both sides of each Tn insertion. ( B ) Quantitative amplification of targets, demonstrated by a reconstruction experiment. Ten different Tn insertion mutants were grown individually and then mixed together in equal proportions to obtain a pool of eight mutants (pool A, lane 1) and two mutants (pool B, lane 2). These two pools were then mixed at different ratios such that the abundance of the two mutants from pool B, with respect to the other mutants, was the same (lane 3) or was decreased 2-fold (lane 4), 4-fold (lane 5), 8-fold (lane 6) or 16-fold (lane 7). Genomic DNA was isolated from all the pools immediately and processed to amplify the targets. Equal volumes of PCR products were loaded, except for lane 2 where it was one-fifth of other lanes. While the intensity of the bands from eight mutants remained constant in lanes 3–7, that of two mutants (arrows) decreased in proportion to the abundance of the mutants in the pools, confirming quantitative amplification of the targets.
Figure Legend Snippet: Selective and quantitative amplification of targets. ( A ) Selective amplification of DNA flanking Tn insertions. Genomic DNA of 16 individual mutants were used to amplify DNA fragments until nearby Taq I restriction sites, and resolved on a sequencing gel. The mutants analyzed were: lane 1, SSA1 (V45B4); lane 2, YDJ1 (V6A2); lane 3, DDR48 (V6G5); lane 4, SSA2 (V18E7); lane 5, SSA3 (V41F1); lane 6, SSA4 (V5E8); lane 7, SSB1 (V23F11); lane 8, SSB2 (V32E7); lane 9, HSP35 (V18D3); lane 10, SSA4 (V3B8); lane 11, SOD2 (V4D11); lane 12, SSB2 (V47A3); lane 13, UBI4 (V36G6); lane 14, TPS2 (V2C2); lane 15, HSP104 (V8D8); lane 16, HSP104 (V22A9). Two bands each are seen for most of the mutants, consistent with specific amplification of DNA from both sides of each Tn insertion. ( B ) Quantitative amplification of targets, demonstrated by a reconstruction experiment. Ten different Tn insertion mutants were grown individually and then mixed together in equal proportions to obtain a pool of eight mutants (pool A, lane 1) and two mutants (pool B, lane 2). These two pools were then mixed at different ratios such that the abundance of the two mutants from pool B, with respect to the other mutants, was the same (lane 3) or was decreased 2-fold (lane 4), 4-fold (lane 5), 8-fold (lane 6) or 16-fold (lane 7). Genomic DNA was isolated from all the pools immediately and processed to amplify the targets. Equal volumes of PCR products were loaded, except for lane 2 where it was one-fifth of other lanes. While the intensity of the bands from eight mutants remained constant in lanes 3–7, that of two mutants (arrows) decreased in proportion to the abundance of the mutants in the pools, confirming quantitative amplification of the targets.

Techniques Used: Amplification, Sequencing, Isolation, Polymerase Chain Reaction

5) Product Images from "Quantitative target display: a method to screen yeast mutants conferring quantitative phenotypes by 'mutant DNA fingerprints'"

Article Title: Quantitative target display: a method to screen yeast mutants conferring quantitative phenotypes by 'mutant DNA fingerprints'

Journal: Nucleic Acids Research

doi:

Selective and quantitative amplification of targets. ( A ) Selective amplification of DNA flanking Tn insertions. Genomic DNA of 16 individual mutants were used to amplify DNA fragments until nearby Taq I restriction sites, and resolved on a sequencing gel. The mutants analyzed were: lane 1, SSA1 (V45B4); lane 2, YDJ1 (V6A2); lane 3, DDR48 (V6G5); lane 4, SSA2 (V18E7); lane 5, SSA3 (V41F1); lane 6, SSA4 (V5E8); lane 7, SSB1 (V23F11); lane 8, SSB2 (V32E7); lane 9, HSP35 (V18D3); lane 10, SSA4 (V3B8); lane 11, SOD2 (V4D11); lane 12, SSB2 (V47A3); lane 13, UBI4 (V36G6); lane 14, TPS2 (V2C2); lane 15, HSP104 (V8D8); lane 16, HSP104 (V22A9). Two bands each are seen for most of the mutants, consistent with specific amplification of DNA from both sides of each Tn insertion. ( B ) Quantitative amplification of targets, demonstrated by a reconstruction experiment. Ten different Tn insertion mutants were grown individually and then mixed together in equal proportions to obtain a pool of eight mutants (pool A, lane 1) and two mutants (pool B, lane 2). These two pools were then mixed at different ratios such that the abundance of the two mutants from pool B, with respect to the other mutants, was the same (lane 3) or was decreased 2-fold (lane 4), 4-fold (lane 5), 8-fold (lane 6) or 16-fold (lane 7). Genomic DNA was isolated from all the pools immediately and processed to amplify the targets. Equal volumes of PCR products were loaded, except for lane 2 where it was one-fifth of other lanes. While the intensity of the bands from eight mutants remained constant in lanes 3–7, that of two mutants (arrows) decreased in proportion to the abundance of the mutants in the pools, confirming quantitative amplification of the targets.
Figure Legend Snippet: Selective and quantitative amplification of targets. ( A ) Selective amplification of DNA flanking Tn insertions. Genomic DNA of 16 individual mutants were used to amplify DNA fragments until nearby Taq I restriction sites, and resolved on a sequencing gel. The mutants analyzed were: lane 1, SSA1 (V45B4); lane 2, YDJ1 (V6A2); lane 3, DDR48 (V6G5); lane 4, SSA2 (V18E7); lane 5, SSA3 (V41F1); lane 6, SSA4 (V5E8); lane 7, SSB1 (V23F11); lane 8, SSB2 (V32E7); lane 9, HSP35 (V18D3); lane 10, SSA4 (V3B8); lane 11, SOD2 (V4D11); lane 12, SSB2 (V47A3); lane 13, UBI4 (V36G6); lane 14, TPS2 (V2C2); lane 15, HSP104 (V8D8); lane 16, HSP104 (V22A9). Two bands each are seen for most of the mutants, consistent with specific amplification of DNA from both sides of each Tn insertion. ( B ) Quantitative amplification of targets, demonstrated by a reconstruction experiment. Ten different Tn insertion mutants were grown individually and then mixed together in equal proportions to obtain a pool of eight mutants (pool A, lane 1) and two mutants (pool B, lane 2). These two pools were then mixed at different ratios such that the abundance of the two mutants from pool B, with respect to the other mutants, was the same (lane 3) or was decreased 2-fold (lane 4), 4-fold (lane 5), 8-fold (lane 6) or 16-fold (lane 7). Genomic DNA was isolated from all the pools immediately and processed to amplify the targets. Equal volumes of PCR products were loaded, except for lane 2 where it was one-fifth of other lanes. While the intensity of the bands from eight mutants remained constant in lanes 3–7, that of two mutants (arrows) decreased in proportion to the abundance of the mutants in the pools, confirming quantitative amplification of the targets.

Techniques Used: Amplification, Sequencing, Isolation, Polymerase Chain Reaction

6) Product Images from "Nitric oxide-induced Cl− secretion in isolated rat colon is mediated by the release of thromboxane A2"

Article Title: Nitric oxide-induced Cl− secretion in isolated rat colon is mediated by the release of thromboxane A2

Journal: The Journal of Physiology

doi: 10.1113/jphysiol.2002.021287

Expression of TXA 2 receptor mRNA in colonic crypt cells Gel analysis of the RT-PCR product from isolated colonic crypts. A single band of 478 bp was detected by ethidium bromide staining (colonic crypts). No band was detected in negative control experiments of RT-PCR without reverse transcriptase (RT(-)) or Taq DNA polymerase (PCR(-)). Inset, a scheme of this PCR experiment is shown. TXA 2 R, TXA 2 receptor; sense, a sense primer; antisense, an antisense primer.
Figure Legend Snippet: Expression of TXA 2 receptor mRNA in colonic crypt cells Gel analysis of the RT-PCR product from isolated colonic crypts. A single band of 478 bp was detected by ethidium bromide staining (colonic crypts). No band was detected in negative control experiments of RT-PCR without reverse transcriptase (RT(-)) or Taq DNA polymerase (PCR(-)). Inset, a scheme of this PCR experiment is shown. TXA 2 R, TXA 2 receptor; sense, a sense primer; antisense, an antisense primer.

Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation, Staining, Negative Control, Polymerase Chain Reaction

7) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

8) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

9) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

10) Product Images from "Proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure which can be targeted by G-quadruplex-interactive agents"

Article Title: Proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure which can be targeted by G-quadruplex-interactive agents

Journal: Molecular cancer therapeutics

doi: 10.1158/1535-7163.MCT-07-2119

Taq DNA polymerase stop assay showing the stabilization of G-quadruplex structures by K + and TMPyP2, TMPyP4, and Se2SAP. (A) Sequence of the single-stranded DNA template annealed with primer used in DNA polymerase stop assay. (B) KCl-dependent pausing
Figure Legend Snippet: Taq DNA polymerase stop assay showing the stabilization of G-quadruplex structures by K + and TMPyP2, TMPyP4, and Se2SAP. (A) Sequence of the single-stranded DNA template annealed with primer used in DNA polymerase stop assay. (B) KCl-dependent pausing

Techniques Used: Sequencing

11) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

12) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

13) Product Images from "Rapid Detection of Penicillin-Resistant Streptococcus pneumoniae in Cerebrospinal Fluid by a Seminested-PCR Strategy"

Article Title: Rapid Detection of Penicillin-Resistant Streptococcus pneumoniae in Cerebrospinal Fluid by a Seminested-PCR Strategy

Journal: Journal of Clinical Microbiology

doi:

Agarose gel electrophoresis of PCR-amplified DNA fragments of the pbp2B gene from S. pneumoniae . Lane M, molecular size marker (in base pairs). Lane 1, negative control; lane 2, penicillin-susceptible S. pneumoniae . Primer combinations are as follows: R1 + P5 + P6 (lane 3), R3 + P5 + P6 (lane 4), R1 + R3 + P5 + P6 (lane 5), R2 + P5 + P6 (lane 6), R4 + P5 + P6 (lane 7), and R2 + R4 + P5 + P6 (band C is poorly visible) (lane 8). (A) A 682-bp species-specific product arising from amplification with primers P5 and P6. (B) A 328- to 334-bp products arising from amplification with primers R1 to R3 and P6. (C) A 214-bp product arising from amplification with primers R4 and P6. (D) Amplification products produced as a result of annealing between a resistance product(s) and the 682-bp product and which are subsequently extended by Taq DNA polymerase to produce a larger product (±900 to 1,000 bp).
Figure Legend Snippet: Agarose gel electrophoresis of PCR-amplified DNA fragments of the pbp2B gene from S. pneumoniae . Lane M, molecular size marker (in base pairs). Lane 1, negative control; lane 2, penicillin-susceptible S. pneumoniae . Primer combinations are as follows: R1 + P5 + P6 (lane 3), R3 + P5 + P6 (lane 4), R1 + R3 + P5 + P6 (lane 5), R2 + P5 + P6 (lane 6), R4 + P5 + P6 (lane 7), and R2 + R4 + P5 + P6 (band C is poorly visible) (lane 8). (A) A 682-bp species-specific product arising from amplification with primers P5 and P6. (B) A 328- to 334-bp products arising from amplification with primers R1 to R3 and P6. (C) A 214-bp product arising from amplification with primers R4 and P6. (D) Amplification products produced as a result of annealing between a resistance product(s) and the 682-bp product and which are subsequently extended by Taq DNA polymerase to produce a larger product (±900 to 1,000 bp).

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Amplification, Marker, Negative Control, Produced

14) Product Images from "Rapid Typing of Human Adenoviruses by a General PCR Combined with Restriction Endonuclease Analysis"

Article Title: Rapid Typing of Human Adenoviruses by a General PCR Combined with Restriction Endonuclease Analysis

Journal: Journal of Clinical Microbiology

doi: 10.1128/JCM.39.2.498-505.2001

Comparison of Taq I restriction profiles of amplified DNA of prototype strains of Ad types 21, 51, 40, and 41.
Figure Legend Snippet: Comparison of Taq I restriction profiles of amplified DNA of prototype strains of Ad types 21, 51, 40, and 41.

Techniques Used: Amplification

15) Product Images from "Proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure which can be targeted by G-quadruplex-interactive agents"

Article Title: Proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure which can be targeted by G-quadruplex-interactive agents

Journal: Molecular cancer therapeutics

doi: 10.1158/1535-7163.MCT-07-2119

Taq DNA polymerase stop assay showing the stabilization of G-quadruplex structures by K + and TMPyP2, TMPyP4, and Se2SAP. (A) Sequence of the single-stranded DNA template annealed with primer used in DNA polymerase stop assay. (B) KCl-dependent pausing
Figure Legend Snippet: Taq DNA polymerase stop assay showing the stabilization of G-quadruplex structures by K + and TMPyP2, TMPyP4, and Se2SAP. (A) Sequence of the single-stranded DNA template annealed with primer used in DNA polymerase stop assay. (B) KCl-dependent pausing

Techniques Used: Sequencing

16) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

17) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

18) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

19) Product Images from "Typing of Dengue Viruses in Clinical Specimens and Mosquitoes by Single-Tube Multiplex Reverse Transcriptase PCR"

Article Title: Typing of Dengue Viruses in Clinical Specimens and Mosquitoes by Single-Tube Multiplex Reverse Transcriptase PCR

Journal: Journal of Clinical Microbiology

doi:

Detection and typing of dengue virus by using two versions of the RT-PCR assay. (A) Reverse transcription with RAV-2 RT and amplification with Taq DNA polymerase; (B) reverse transcription and amplification with the bifunctional enzyme r Tth . (A and B) Lanes 1, dengue-2 (den-2); lanes 2, dengue-3 (den-3); lanes 3, dengue-4 (den-4); lanes 4, dengue-1 (den-1); lanes M, 100-bp ladder (lowest band shown, 100 bp); lanes 5 to 8, dengue-3 at 1,000, 100, 10, and 1 PFU, respectively. (A) Lane 9, 0 pfu; lane 10, water (negative control). (B) Lane 9, water. Expected product sizes are as follows: dengue-2, 119 bp; dengue-3, 290 bp; dengue-4, 389 bp; dengue-1, 482 bp.
Figure Legend Snippet: Detection and typing of dengue virus by using two versions of the RT-PCR assay. (A) Reverse transcription with RAV-2 RT and amplification with Taq DNA polymerase; (B) reverse transcription and amplification with the bifunctional enzyme r Tth . (A and B) Lanes 1, dengue-2 (den-2); lanes 2, dengue-3 (den-3); lanes 3, dengue-4 (den-4); lanes 4, dengue-1 (den-1); lanes M, 100-bp ladder (lowest band shown, 100 bp); lanes 5 to 8, dengue-3 at 1,000, 100, 10, and 1 PFU, respectively. (A) Lane 9, 0 pfu; lane 10, water (negative control). (B) Lane 9, water. Expected product sizes are as follows: dengue-2, 119 bp; dengue-3, 290 bp; dengue-4, 389 bp; dengue-1, 482 bp.

Techniques Used: Reverse Transcription Polymerase Chain Reaction, Amplification, Negative Control

20) Product Images from "One enzyme reverse transcription qPCR using Taq DNA polymerase"

Article Title: One enzyme reverse transcription qPCR using Taq DNA polymerase

Journal: bioRxiv

doi: 10.1101/2020.05.27.120238

Effect of DNase I treatment on Taq DNA polymerase-mediated RT-qPCR assay. Taq DNA polymerase purchased from NEB was used to operate CDC SARS-CoV-2 N1, N2, and N3 TaqMan RT-qPCR assays using SARS-CoV-2 viral genomic RNA (panels A-C) or N gene armored RNA (panels D-F) treated with DNase I. Amplification curves shown in panels A-C resulted from 6000 (black traces), 600 (red traces), 60 (blue traces), 6 (pink traces), and 0 (gray traces) copies of SARS-CoV-2 genomic RNA. Amplification curves in panels D-F resulted from 30,000 (black traces), 3,000 (red traces), 300 (blue traces), 30 (pink traces) and 0 (gray traces) copies of N gene armored RNA. Representative Ct values for RT-qPCR amplification of indicated copies of untreated and DNase I treated SARS-CoV-2 genomic RNA and N gene armored RNA are tabulated.
Figure Legend Snippet: Effect of DNase I treatment on Taq DNA polymerase-mediated RT-qPCR assay. Taq DNA polymerase purchased from NEB was used to operate CDC SARS-CoV-2 N1, N2, and N3 TaqMan RT-qPCR assays using SARS-CoV-2 viral genomic RNA (panels A-C) or N gene armored RNA (panels D-F) treated with DNase I. Amplification curves shown in panels A-C resulted from 6000 (black traces), 600 (red traces), 60 (blue traces), 6 (pink traces), and 0 (gray traces) copies of SARS-CoV-2 genomic RNA. Amplification curves in panels D-F resulted from 30,000 (black traces), 3,000 (red traces), 300 (blue traces), 30 (pink traces) and 0 (gray traces) copies of N gene armored RNA. Representative Ct values for RT-qPCR amplification of indicated copies of untreated and DNase I treated SARS-CoV-2 genomic RNA and N gene armored RNA are tabulated.

Techniques Used: Quantitative RT-PCR, Amplification

SARS-CoV-2 N1 TaqMan RT-qPCR assays performed using NEB Taq DNA polymerase and N gene armored RNA in indicated buffers. Buffer compositions are detailed in Table 2 . Amplification curves resulting from 3 × 10 5 (black traces), 3 × 10 4 (red traces), 3 × 10 3 (blue traces), 3 × 10 2 (pink traces), 30 (green traces), and 0 (gray) copies of SARS-CoV-2 N gene armored RNA are depicted.
Figure Legend Snippet: SARS-CoV-2 N1 TaqMan RT-qPCR assays performed using NEB Taq DNA polymerase and N gene armored RNA in indicated buffers. Buffer compositions are detailed in Table 2 . Amplification curves resulting from 3 × 10 5 (black traces), 3 × 10 4 (red traces), 3 × 10 3 (blue traces), 3 × 10 2 (pink traces), 30 (green traces), and 0 (gray) copies of SARS-CoV-2 N gene armored RNA are depicted.

Techniques Used: Quantitative RT-PCR, Amplification

TaqMan RT-qPCR analysis of SARS-CoV-2 viral genomic RNA and RNaseP armored RNA using Taq DNA polymerase-based one-enzyme assays. CDC SARS-CoV-2 N gene assays, N1, N2, and N3, and RNaseP assay were performed using Taq DNA polymerase from either NEB (panels A-H) or Thermo Fisher (panels I-P). Assays were performed either using the companion commercial buffer (panels A-D and panels I-L) or using Gen 6 A buffer (panels E-H and panels M-P). Amplification curves from 6000 (black traces), 600 (red traces), 60 (blue traces), 6 (pink traces), and 0 (gray traces) copies of viral genomic RNA are depicted in panels A-C, E-G, I-K, and M-O. Amplification curves from 3 × 10 5 (black traces), 3 × 10 4 (red traces), 3 × 10 3 (blue traces), 3 × 10 2 (pink traces) and 0 (gray traces) copies of armored RNaseP RNA are depicted in panes D, H, L, and P.
Figure Legend Snippet: TaqMan RT-qPCR analysis of SARS-CoV-2 viral genomic RNA and RNaseP armored RNA using Taq DNA polymerase-based one-enzyme assays. CDC SARS-CoV-2 N gene assays, N1, N2, and N3, and RNaseP assay were performed using Taq DNA polymerase from either NEB (panels A-H) or Thermo Fisher (panels I-P). Assays were performed either using the companion commercial buffer (panels A-D and panels I-L) or using Gen 6 A buffer (panels E-H and panels M-P). Amplification curves from 6000 (black traces), 600 (red traces), 60 (blue traces), 6 (pink traces), and 0 (gray traces) copies of viral genomic RNA are depicted in panels A-C, E-G, I-K, and M-O. Amplification curves from 3 × 10 5 (black traces), 3 × 10 4 (red traces), 3 × 10 3 (blue traces), 3 × 10 2 (pink traces) and 0 (gray traces) copies of armored RNaseP RNA are depicted in panes D, H, L, and P.

Techniques Used: Quantitative RT-PCR, Amplification

21) Product Images from "Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes"

Article Title: Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes

Journal: Nature Communications

doi: 10.1038/s41467-018-05733-0

Visual and modular detection of pathogen nucleic acids. a The enVision system consists of a series of enzyme–DNA nanostructures to enable target recognition, target-independent signaling, and visual detection. The nanostructures are designed to decouple recognition from signaling. The recognition nanostructure is a hybrid complex, composed of an inactivating aptamer and a Taq DNA polymerase. In the presence of complementary target DNA, the complex dissociates to activate the polymerase activity. The active polymerase proceeds to elongate a universal, self-priming signaling nanostructure, in a target-independent manner. Modified deoxynucleotides (dNTPs) are incorporated to immobilize horseradish peroxidase (HRP) onto the signaling nanostructures. Upon the addition of optical substrate, visual signals can be enzymatically enhanced, detected by the naked eye and quantified with a smartphone camera. Photograph (inset) shows an example of the actual visual readouts in the presence of none (−) and varying (+) amounts of target DNA on a smartphone application. b Schematic of the enVision microfluidic system. The platform is designed to complement the modular enVision workflow. Independent assay cassettes, preloaded with specific recognition nanostructures at the inlets, can be mounted on-demand onto a common signaling cartridge. The common cartridge houses the universal signaling nanostructures, which are immobilized on embedded membranes, for target-independent signaling and visual detection. Direction of cassette sliding is indicated by a red arrow. c Photograph of the microfluidic enVision prototype, developed for versatile assay integration and parallel processing. Scale bar indicates 1 cm
Figure Legend Snippet: Visual and modular detection of pathogen nucleic acids. a The enVision system consists of a series of enzyme–DNA nanostructures to enable target recognition, target-independent signaling, and visual detection. The nanostructures are designed to decouple recognition from signaling. The recognition nanostructure is a hybrid complex, composed of an inactivating aptamer and a Taq DNA polymerase. In the presence of complementary target DNA, the complex dissociates to activate the polymerase activity. The active polymerase proceeds to elongate a universal, self-priming signaling nanostructure, in a target-independent manner. Modified deoxynucleotides (dNTPs) are incorporated to immobilize horseradish peroxidase (HRP) onto the signaling nanostructures. Upon the addition of optical substrate, visual signals can be enzymatically enhanced, detected by the naked eye and quantified with a smartphone camera. Photograph (inset) shows an example of the actual visual readouts in the presence of none (−) and varying (+) amounts of target DNA on a smartphone application. b Schematic of the enVision microfluidic system. The platform is designed to complement the modular enVision workflow. Independent assay cassettes, preloaded with specific recognition nanostructures at the inlets, can be mounted on-demand onto a common signaling cartridge. The common cartridge houses the universal signaling nanostructures, which are immobilized on embedded membranes, for target-independent signaling and visual detection. Direction of cassette sliding is indicated by a red arrow. c Photograph of the microfluidic enVision prototype, developed for versatile assay integration and parallel processing. Scale bar indicates 1 cm

Techniques Used: Activity Assay, Modification

22) Product Images from "Quantitative target display: a method to screen yeast mutants conferring quantitative phenotypes by 'mutant DNA fingerprints'"

Article Title: Quantitative target display: a method to screen yeast mutants conferring quantitative phenotypes by 'mutant DNA fingerprints'

Journal: Nucleic Acids Research

doi:

Selective and quantitative amplification of targets. ( A ) Selective amplification of DNA flanking Tn insertions. Genomic DNA of 16 individual mutants were used to amplify DNA fragments until nearby Taq I restriction sites, and resolved on a sequencing gel. The mutants analyzed were: lane 1, SSA1 (V45B4); lane 2, YDJ1 (V6A2); lane 3, DDR48 (V6G5); lane 4, SSA2 (V18E7); lane 5, SSA3 (V41F1); lane 6, SSA4 (V5E8); lane 7, SSB1 (V23F11); lane 8, SSB2 (V32E7); lane 9, HSP35 (V18D3); lane 10, SSA4 (V3B8); lane 11, SOD2 (V4D11); lane 12, SSB2 (V47A3); lane 13, UBI4 (V36G6); lane 14, TPS2 (V2C2); lane 15, HSP104 (V8D8); lane 16, HSP104 (V22A9). Two bands each are seen for most of the mutants, consistent with specific amplification of DNA from both sides of each Tn insertion. ( B ) Quantitative amplification of targets, demonstrated by a reconstruction experiment. Ten different Tn insertion mutants were grown individually and then mixed together in equal proportions to obtain a pool of eight mutants (pool A, lane 1) and two mutants (pool B, lane 2). These two pools were then mixed at different ratios such that the abundance of the two mutants from pool B, with respect to the other mutants, was the same (lane 3) or was decreased 2-fold (lane 4), 4-fold (lane 5), 8-fold (lane 6) or 16-fold (lane 7). Genomic DNA was isolated from all the pools immediately and processed to amplify the targets. Equal volumes of PCR products were loaded, except for lane 2 where it was one-fifth of other lanes. While the intensity of the bands from eight mutants remained constant in lanes 3–7, that of two mutants (arrows) decreased in proportion to the abundance of the mutants in the pools, confirming quantitative amplification of the targets.
Figure Legend Snippet: Selective and quantitative amplification of targets. ( A ) Selective amplification of DNA flanking Tn insertions. Genomic DNA of 16 individual mutants were used to amplify DNA fragments until nearby Taq I restriction sites, and resolved on a sequencing gel. The mutants analyzed were: lane 1, SSA1 (V45B4); lane 2, YDJ1 (V6A2); lane 3, DDR48 (V6G5); lane 4, SSA2 (V18E7); lane 5, SSA3 (V41F1); lane 6, SSA4 (V5E8); lane 7, SSB1 (V23F11); lane 8, SSB2 (V32E7); lane 9, HSP35 (V18D3); lane 10, SSA4 (V3B8); lane 11, SOD2 (V4D11); lane 12, SSB2 (V47A3); lane 13, UBI4 (V36G6); lane 14, TPS2 (V2C2); lane 15, HSP104 (V8D8); lane 16, HSP104 (V22A9). Two bands each are seen for most of the mutants, consistent with specific amplification of DNA from both sides of each Tn insertion. ( B ) Quantitative amplification of targets, demonstrated by a reconstruction experiment. Ten different Tn insertion mutants were grown individually and then mixed together in equal proportions to obtain a pool of eight mutants (pool A, lane 1) and two mutants (pool B, lane 2). These two pools were then mixed at different ratios such that the abundance of the two mutants from pool B, with respect to the other mutants, was the same (lane 3) or was decreased 2-fold (lane 4), 4-fold (lane 5), 8-fold (lane 6) or 16-fold (lane 7). Genomic DNA was isolated from all the pools immediately and processed to amplify the targets. Equal volumes of PCR products were loaded, except for lane 2 where it was one-fifth of other lanes. While the intensity of the bands from eight mutants remained constant in lanes 3–7, that of two mutants (arrows) decreased in proportion to the abundance of the mutants in the pools, confirming quantitative amplification of the targets.

Techniques Used: Amplification, Sequencing, Isolation, Polymerase Chain Reaction

23) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

24) Product Images from "An ABC Transporter System of Yersinia pestis Allows Utilization of Chelated Iron by Escherichia coli SAB11"

Article Title: An ABC Transporter System of Yersinia pestis Allows Utilization of Chelated Iron by Escherichia coli SAB11

Journal: Journal of Bacteriology

doi:

PCR of DNAs derived from whole cells of Yersinia spp. or E. coli DH5α. (A) Oligonucleotide primers derived from a region of Y. enterocolitica yfuA were used to PCR amplify genomic DNAs from the indicated strains. The predicted product is indicated by the arrow. (B) Oligonucleotide primers were derived from a region of Y. pestis yfeA . The predicted amplicon is designated with an arrow. Reactions were performed with Taq DNA polymerase for 25 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 30 s.
Figure Legend Snippet: PCR of DNAs derived from whole cells of Yersinia spp. or E. coli DH5α. (A) Oligonucleotide primers derived from a region of Y. enterocolitica yfuA were used to PCR amplify genomic DNAs from the indicated strains. The predicted product is indicated by the arrow. (B) Oligonucleotide primers were derived from a region of Y. pestis yfeA . The predicted amplicon is designated with an arrow. Reactions were performed with Taq DNA polymerase for 25 cycles of 94°C for 30 s, 50°C for 30 s, and 72°C for 30 s.

Techniques Used: Polymerase Chain Reaction, Derivative Assay, Amplification

25) Product Images from "Molecular cloning of the human PDGFR-? promoter and drug targeting of the G-quadruplex-forming region to repress PDGFR-? expression"

Article Title: Molecular cloning of the human PDGFR-? promoter and drug targeting of the G-quadruplex-forming region to repress PDGFR-? expression

Journal: Biochemistry

doi: 10.1021/bi100330w

(A) Effect of NaCl and KCl on the PDGFR-β NHE Pu38-mer CD spectra. The CD signals of the NHE Pu38-mer in 100 mM NaCl, 100 mM KCl, and water are shown in black, red, and blue respectively. All CD data were obtained with a 5 μM DNA concentration at 25 °C. The sequence of the NHE Pu38-mer is shown under the CD spectra. (B) Effect of increasing concentrations of NaCl and KCl on the stability of G-quadruplex structures within the NHE Pu38-mer using the Taq polymerase stop assay. Lanes 1 and 2 represent the guanine and cytosine sequencing reactions respectively. Lane 3 is the 32 P-labeled primer without Taq polymerase. The primer extension reaction in lane 4 was performed in the buffer without KCl or NaCl. The samples in lanes 5–9 were pre-incubated with different concentrations of KCl or NaCl before the primer extension reaction. The three primer extension stop products are designated 5′-end, mid-3′, and 3′-end. The corresponding sites for the stop products are indicated on the core G-tract sequence of NHE Pu38-mer at the bottom of gel. (C) DMS footprinting of intramolecular G-quadruplex structures in the NHE. The NHE Pu38-mer (full length) was incubated in a Tris buffer without KCl (lanes 1 and 3) or in the presence of 140 mM of KCl (lanes 2 and 4) before treatment with DMS. The seven runs of two or more guanines are indicated by brackets. DMS methylation patterns are indicated by open circles (protected), half-shaded circles (partially protected), and full-shaded circles (unprotected).
Figure Legend Snippet: (A) Effect of NaCl and KCl on the PDGFR-β NHE Pu38-mer CD spectra. The CD signals of the NHE Pu38-mer in 100 mM NaCl, 100 mM KCl, and water are shown in black, red, and blue respectively. All CD data were obtained with a 5 μM DNA concentration at 25 °C. The sequence of the NHE Pu38-mer is shown under the CD spectra. (B) Effect of increasing concentrations of NaCl and KCl on the stability of G-quadruplex structures within the NHE Pu38-mer using the Taq polymerase stop assay. Lanes 1 and 2 represent the guanine and cytosine sequencing reactions respectively. Lane 3 is the 32 P-labeled primer without Taq polymerase. The primer extension reaction in lane 4 was performed in the buffer without KCl or NaCl. The samples in lanes 5–9 were pre-incubated with different concentrations of KCl or NaCl before the primer extension reaction. The three primer extension stop products are designated 5′-end, mid-3′, and 3′-end. The corresponding sites for the stop products are indicated on the core G-tract sequence of NHE Pu38-mer at the bottom of gel. (C) DMS footprinting of intramolecular G-quadruplex structures in the NHE. The NHE Pu38-mer (full length) was incubated in a Tris buffer without KCl (lanes 1 and 3) or in the presence of 140 mM of KCl (lanes 2 and 4) before treatment with DMS. The seven runs of two or more guanines are indicated by brackets. DMS methylation patterns are indicated by open circles (protected), half-shaded circles (partially protected), and full-shaded circles (unprotected).

Techniques Used: Concentration Assay, Sequencing, Labeling, Incubation, Footprinting, Methylation

26) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

27) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

28) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

29) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

30) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

31) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

32) Product Images from "One enzyme reverse transcription qPCR using Taq DNA polymerase"

Article Title: One enzyme reverse transcription qPCR using Taq DNA polymerase

Journal: bioRxiv

doi: 10.1101/2020.05.27.120238

Effect of DNase I treatment on Taq DNA polymerase-mediated RT-qPCR assay. Taq DNA polymerase purchased from NEB was used to operate CDC SARS-CoV-2 N1, N2, and N3 TaqMan RT-qPCR assays using SARS-CoV-2 viral genomic RNA (panels A-C) or N gene armored RNA (panels D-F) treated with DNase I. Amplification curves shown in panels A-C resulted from 6000 (black traces), 600 (red traces), 60 (blue traces), 6 (pink traces), and 0 (gray traces) copies of SARS-CoV-2 genomic RNA. Amplification curves in panels D-F resulted from 30,000 (black traces), 3,000 (red traces), 300 (blue traces), 30 (pink traces) and 0 (gray traces) copies of N gene armored RNA. Representative Ct values for RT-qPCR amplification of indicated copies of untreated and DNase I treated SARS-CoV-2 genomic RNA and N gene armored RNA are tabulated.
Figure Legend Snippet: Effect of DNase I treatment on Taq DNA polymerase-mediated RT-qPCR assay. Taq DNA polymerase purchased from NEB was used to operate CDC SARS-CoV-2 N1, N2, and N3 TaqMan RT-qPCR assays using SARS-CoV-2 viral genomic RNA (panels A-C) or N gene armored RNA (panels D-F) treated with DNase I. Amplification curves shown in panels A-C resulted from 6000 (black traces), 600 (red traces), 60 (blue traces), 6 (pink traces), and 0 (gray traces) copies of SARS-CoV-2 genomic RNA. Amplification curves in panels D-F resulted from 30,000 (black traces), 3,000 (red traces), 300 (blue traces), 30 (pink traces) and 0 (gray traces) copies of N gene armored RNA. Representative Ct values for RT-qPCR amplification of indicated copies of untreated and DNase I treated SARS-CoV-2 genomic RNA and N gene armored RNA are tabulated.

Techniques Used: Quantitative RT-PCR, Amplification

SARS-CoV-2 N1 TaqMan RT-qPCR assays performed using NEB Taq DNA polymerase and N gene armored RNA in indicated buffers. Buffer compositions are detailed in Table 2 . Amplification curves resulting from 3 × 10 5 (black traces), 3 × 10 4 (red traces), 3 × 10 3 (blue traces), 3 × 10 2 (pink traces), 30 (green traces), and 0 (gray) copies of SARS-CoV-2 N gene armored RNA are depicted.
Figure Legend Snippet: SARS-CoV-2 N1 TaqMan RT-qPCR assays performed using NEB Taq DNA polymerase and N gene armored RNA in indicated buffers. Buffer compositions are detailed in Table 2 . Amplification curves resulting from 3 × 10 5 (black traces), 3 × 10 4 (red traces), 3 × 10 3 (blue traces), 3 × 10 2 (pink traces), 30 (green traces), and 0 (gray) copies of SARS-CoV-2 N gene armored RNA are depicted.

Techniques Used: Quantitative RT-PCR, Amplification

TaqMan RT-qPCR analysis of SARS-CoV-2 viral genomic RNA and RNaseP armored RNA using Taq DNA polymerase-based one-enzyme assays. CDC SARS-CoV-2 N gene assays, N1, N2, and N3, and RNaseP assay were performed using Taq DNA polymerase from either NEB (panels A-H) or Thermo Fisher (panels I-P). Assays were performed either using the companion commercial buffer (panels A-D and panels I-L) or using Gen 6 A buffer (panels E-H and panels M-P). Amplification curves from 6000 (black traces), 600 (red traces), 60 (blue traces), 6 (pink traces), and 0 (gray traces) copies of viral genomic RNA are depicted in panels A-C, E-G, I-K, and M-O. Amplification curves from 3 × 10 5 (black traces), 3 × 10 4 (red traces), 3 × 10 3 (blue traces), 3 × 10 2 (pink traces) and 0 (gray traces) copies of armored RNaseP RNA are depicted in panes D, H, L, and P.
Figure Legend Snippet: TaqMan RT-qPCR analysis of SARS-CoV-2 viral genomic RNA and RNaseP armored RNA using Taq DNA polymerase-based one-enzyme assays. CDC SARS-CoV-2 N gene assays, N1, N2, and N3, and RNaseP assay were performed using Taq DNA polymerase from either NEB (panels A-H) or Thermo Fisher (panels I-P). Assays were performed either using the companion commercial buffer (panels A-D and panels I-L) or using Gen 6 A buffer (panels E-H and panels M-P). Amplification curves from 6000 (black traces), 600 (red traces), 60 (blue traces), 6 (pink traces), and 0 (gray traces) copies of viral genomic RNA are depicted in panels A-C, E-G, I-K, and M-O. Amplification curves from 3 × 10 5 (black traces), 3 × 10 4 (red traces), 3 × 10 3 (blue traces), 3 × 10 2 (pink traces) and 0 (gray traces) copies of armored RNaseP RNA are depicted in panes D, H, L, and P.

Techniques Used: Quantitative RT-PCR, Amplification

33) Product Images from "Quantitative target display: a method to screen yeast mutants conferring quantitative phenotypes by 'mutant DNA fingerprints'"

Article Title: Quantitative target display: a method to screen yeast mutants conferring quantitative phenotypes by 'mutant DNA fingerprints'

Journal: Nucleic Acids Research

doi:

Selective and quantitative amplification of targets. ( A ) Selective amplification of DNA flanking Tn insertions. Genomic DNA of 16 individual mutants were used to amplify DNA fragments until nearby Taq I restriction sites, and resolved on a sequencing gel. The mutants analyzed were: lane 1, SSA1 (V45B4); lane 2, YDJ1 (V6A2); lane 3, DDR48 (V6G5); lane 4, SSA2 (V18E7); lane 5, SSA3 (V41F1); lane 6, SSA4 (V5E8); lane 7, SSB1 (V23F11); lane 8, SSB2 (V32E7); lane 9, HSP35 (V18D3); lane 10, SSA4 (V3B8); lane 11, SOD2 (V4D11); lane 12, SSB2 (V47A3); lane 13, UBI4 (V36G6); lane 14, TPS2 (V2C2); lane 15, HSP104 (V8D8); lane 16, HSP104 (V22A9). Two bands each are seen for most of the mutants, consistent with specific amplification of DNA from both sides of each Tn insertion. ( B ) Quantitative amplification of targets, demonstrated by a reconstruction experiment. Ten different Tn insertion mutants were grown individually and then mixed together in equal proportions to obtain a pool of eight mutants (pool A, lane 1) and two mutants (pool B, lane 2). These two pools were then mixed at different ratios such that the abundance of the two mutants from pool B, with respect to the other mutants, was the same (lane 3) or was decreased 2-fold (lane 4), 4-fold (lane 5), 8-fold (lane 6) or 16-fold (lane 7). Genomic DNA was isolated from all the pools immediately and processed to amplify the targets. Equal volumes of PCR products were loaded, except for lane 2 where it was one-fifth of other lanes. While the intensity of the bands from eight mutants remained constant in lanes 3–7, that of two mutants (arrows) decreased in proportion to the abundance of the mutants in the pools, confirming quantitative amplification of the targets.
Figure Legend Snippet: Selective and quantitative amplification of targets. ( A ) Selective amplification of DNA flanking Tn insertions. Genomic DNA of 16 individual mutants were used to amplify DNA fragments until nearby Taq I restriction sites, and resolved on a sequencing gel. The mutants analyzed were: lane 1, SSA1 (V45B4); lane 2, YDJ1 (V6A2); lane 3, DDR48 (V6G5); lane 4, SSA2 (V18E7); lane 5, SSA3 (V41F1); lane 6, SSA4 (V5E8); lane 7, SSB1 (V23F11); lane 8, SSB2 (V32E7); lane 9, HSP35 (V18D3); lane 10, SSA4 (V3B8); lane 11, SOD2 (V4D11); lane 12, SSB2 (V47A3); lane 13, UBI4 (V36G6); lane 14, TPS2 (V2C2); lane 15, HSP104 (V8D8); lane 16, HSP104 (V22A9). Two bands each are seen for most of the mutants, consistent with specific amplification of DNA from both sides of each Tn insertion. ( B ) Quantitative amplification of targets, demonstrated by a reconstruction experiment. Ten different Tn insertion mutants were grown individually and then mixed together in equal proportions to obtain a pool of eight mutants (pool A, lane 1) and two mutants (pool B, lane 2). These two pools were then mixed at different ratios such that the abundance of the two mutants from pool B, with respect to the other mutants, was the same (lane 3) or was decreased 2-fold (lane 4), 4-fold (lane 5), 8-fold (lane 6) or 16-fold (lane 7). Genomic DNA was isolated from all the pools immediately and processed to amplify the targets. Equal volumes of PCR products were loaded, except for lane 2 where it was one-fifth of other lanes. While the intensity of the bands from eight mutants remained constant in lanes 3–7, that of two mutants (arrows) decreased in proportion to the abundance of the mutants in the pools, confirming quantitative amplification of the targets.

Techniques Used: Amplification, Sequencing, Isolation, Polymerase Chain Reaction

34) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

35) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

36) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

37) Product Images from "Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection"

Article Title: Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection

Journal: Food Science & Nutrition

doi: 10.1002/fsn3.69

Genomic DNA of Durazno Imilla 30CN-010 sample was amplified by Bch6 , 21BA , UGPasa , CT-203 , Chi , GP-24 , Stan1 , Chs , and Zep primers, restricted with Taq DNA polymerase, and electrophoresed through a 2% agarose gel. The primers are listed in ascending order in a range of 400–1600 bp.
Figure Legend Snippet: Genomic DNA of Durazno Imilla 30CN-010 sample was amplified by Bch6 , 21BA , UGPasa , CT-203 , Chi , GP-24 , Stan1 , Chs , and Zep primers, restricted with Taq DNA polymerase, and electrophoresed through a 2% agarose gel. The primers are listed in ascending order in a range of 400–1600 bp.

Techniques Used: Amplification, Agarose Gel Electrophoresis

38) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

39) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

40) Product Images from "Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase"

Article Title: Insertion of the T3 DNA polymerase thioredoxin binding domain enhances the processivity and fidelity of Taq DNA polymerase

Journal: Nucleic Acids Research

doi:

Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.
Figure Legend Snippet: Superimposition of the thumb domains of Taq DNA polymerase (blue) with T7 DNA polymerase (pink). The arrows indicate the site of insertion of the T3 TBD (yellow). The primary amino acid sequence of Taq DNA polymerase from residue 470–507 is indicated below (blue) with the sequence of T3 TBD in yellow and the deleted region in red.

Techniques Used: Sequencing

Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.
Figure Legend Snippet: Slippage chromatograms were obtained from PCR products amplified with either Taq DNA polymerase or Taq DNA pol/TBD. One primer was labeled with 6-FAM fluorophore and the PCR product was digested with EcoRI. The DNA was gel purified and slippage polymorphisms detected using an automated DNA sequencer (model 377; Applied Biosystems) and GENESCAN 672 software. The result is one representative of three experiments.

Techniques Used: Polymerase Chain Reaction, Amplification, Labeling, Purification, Software

Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.
Figure Legend Snippet: Streptavidin processivity assay. An immobilized single-stranded DNA molecule of 2000 nt in length was incubated in a reaction containing a primer hybridized to the 5′ end, and polymerase. Extension was initiated by the addition of dNTPs including [α- 32 P]dGTP, Mg 2+ and 0.8 mg/ml activated calf thymus DNA as described in Materials and Methods. Cleavage with restriction enzymes located 18, 96, 492, 1122 and 1898 nt, respectively, from the primer terminus only occurs if primer extension results in a double-stranded DNA substrate. Full extension with 5 U Promega Taq DNA polymerase in the absence of trap DNA allowed the percentage of primers extended to be determined.

Techniques Used: Incubation

The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.
Figure Legend Snippet: The effect of thioredoxin on processivity of the hybrid Taq DNA pol/TBD. ( A ) Extension assays were performed with a molar excess of template corresponding to a primer/template ratio of 470 for Taq DNA polymerase and Taq DNA polymerase (exo–) and 67 for Taq DNA pol/TBD and Taq DNA pol/TBD(exo–). Different ratios for the enzymes were used to ensure equal activity was loaded on the gel. (+) 100 µM thioredoxin, (–) no thioredoxin. No enzyme control shows the labeled primer alone. ( B ) Extension assay showing the effect of increasing concentrations of thioredoxin and enzyme dilution for Taq DNA pol/TBD(exo–). For each thioredoxin concentration (0.2, 2 and 20 µM), three enzyme concentrations were used (56, 28 and 5.6 pM) corresponding to a primer/template ratio of 67, 134 and 670.

Techniques Used: Activity Assay, Labeling, Concentration Assay

Related Articles

Real-time Polymerase Chain Reaction:

Article Title: Gene Expression Profiles Controlled by the Alternative Splicing Factor Nova2 in Endothelial Cells
Article Snippet: .. An aliquot of the RT reaction (1–2 μL) was then PCR-amplified (with GoTaq DNA Polymerase, Promega, Madison, WI, USA), whereas, for quantitative PCR (qPCR), cDNAs were amplified with QuantiTect SYBR Green PCR (QIAGEN) or iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) by using LightCycler 480 (Roche). ..

Amplification:

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Article Snippet: .. For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega). .. Cycling was performed in a Mastercycler gradient machine (Eppendorf) with the following parameters: 94° for 5 min, 30 cycles of 94° for 45 sec, 58° for 45 sec, 72° for 1 min 30 sec, followed by 1 cycle at 72° for 7 min and a 4° hold.

Article Title: Parallel action of AtDRB2 and RdDM in the control of transposable element expression
Article Snippet: .. 4 μl of cDNA were used in the PCR reaction (GoTaq DNA polymerase, Promega M300) in a final volume of 12.5 μl, and amplified for 37 cycles with the primers found in Additional file : Table S1. .. Mass spectrometry analysis Purified proteins were obtained as described in the immunoprecipitation segment with a starting amount of 1.5 grams of mixed floral tissues.

Article Title: A novel fluorescence and DNA combination for complex, long-term marking of mosquitoes
Article Snippet: .. Tags were amplified using 1 μl of 0.1 μM single stranded DNA ultramer (Integrated DNA Technologies, Coralville, Iowa, USA) or 1 μl of a 1:100 or 1:200 dilution of a 250ng or 500ng synthesis scale double-stranded DNA gBlock in a 50 μl PCR reaction (GoTaq Green Master Mix, Promega, Madison, WI, USA) with 400nM of primers (IDT). .. All amplifications were performed in heat-sealed random-access plates (4titude Ltd, Surrey, UK) to reduce contamination risk, and individual-use aliquots were used to add 10 μl of PCR product per 2 ml of SmartWater® spray solution (see Application method below).

Article Title: Gene Expression Profiles Controlled by the Alternative Splicing Factor Nova2 in Endothelial Cells
Article Snippet: .. An aliquot of the RT reaction (1–2 μL) was then PCR-amplified (with GoTaq DNA Polymerase, Promega, Madison, WI, USA), whereas, for quantitative PCR (qPCR), cDNAs were amplified with QuantiTect SYBR Green PCR (QIAGEN) or iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) by using LightCycler 480 (Roche). ..

Sequencing:

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Article Snippet: .. For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega). .. Cycling was performed in a Mastercycler gradient machine (Eppendorf) with the following parameters: 94° for 5 min, 30 cycles of 94° for 45 sec, 58° for 45 sec, 72° for 1 min 30 sec, followed by 1 cycle at 72° for 7 min and a 4° hold.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Comparative Genome Analysis Provides Insights into Both the Lifestyle of Acidithiobacillus ferrivorans Strain CF27 and the Chimeric Nature of the Iron-Oxidizing Acidithiobacilli Genomes
Article Snippet: .. For each RT-PCR experiment, the hybridisation (55–66°C) and elongation (68 or 72°C) temperatures, RNA concentration (from 0.1 to 20 ng), DNA polymerase (GoTaq or Tfl from Promega), and the number of cycles (30, 35, or 40) were adjusted. .. Three controls were used: one without template to detect potential contaminations, one with genomic DNA as a positive control for PCR amplification and one with RNA not treated with reverse transcriptase to check for DNA contamination during RNA preparation.

SYBR Green Assay:

Article Title: Gene Expression Profiles Controlled by the Alternative Splicing Factor Nova2 in Endothelial Cells
Article Snippet: .. An aliquot of the RT reaction (1–2 μL) was then PCR-amplified (with GoTaq DNA Polymerase, Promega, Madison, WI, USA), whereas, for quantitative PCR (qPCR), cDNAs were amplified with QuantiTect SYBR Green PCR (QIAGEN) or iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) by using LightCycler 480 (Roche). ..

Concentration Assay:

Article Title: Comparative Genome Analysis Provides Insights into Both the Lifestyle of Acidithiobacillus ferrivorans Strain CF27 and the Chimeric Nature of the Iron-Oxidizing Acidithiobacilli Genomes
Article Snippet: .. For each RT-PCR experiment, the hybridisation (55–66°C) and elongation (68 or 72°C) temperatures, RNA concentration (from 0.1 to 20 ng), DNA polymerase (GoTaq or Tfl from Promega), and the number of cycles (30, 35, or 40) were adjusted. .. Three controls were used: one without template to detect potential contaminations, one with genomic DNA as a positive control for PCR amplification and one with RNA not treated with reverse transcriptase to check for DNA contamination during RNA preparation.

Incubation:

Article Title: Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes
Article Snippet: .. The mixture was incubated at 95 °C for 5 min and slowly cooled at 0.1 °C/s until the reaction reached 25 °C, before the addition of Taq DNA polymerase (GoTaq, Promega) to form the hybrid complex. .. To characterize the assembly and activity of the recognition nanostructure in the presence of DNA targets, varying concentrations of target oligonucleotides were added to this mixture.

Polymerase Chain Reaction:

Article Title: Comparative Genomics of a Plant-Pathogenic Fungus, Pyrenophora tritici-repentis, Reveals Transduplication and the Impact of Repeat Elements on Pathogenicity and Population Divergence
Article Snippet: .. For PTRG_10433, which contained two gaps, several attempts to fill the first gap in the sequence were not successful, but the second gap was filled in by polymerase chain reaction (PCR) amplification using primers NRPSF2 (5′-AACAGCCGGAGAGAACACAT-3′) and NRPSR2 (5′-AGTCCTGCAGCTCTGACTTG-3′) in a 50-µL reaction that contained 1.25 mM MgCl2 , 0.0025 mM each dNTP, 2 mM primers, 10 ng of BFP-ToxAC genomic DNA, 0.25 µL of GoTaq of DNA polymerase, and 1X GoTaq Flexi buffer (Promega). .. Cycling was performed in a Mastercycler gradient machine (Eppendorf) with the following parameters: 94° for 5 min, 30 cycles of 94° for 45 sec, 58° for 45 sec, 72° for 1 min 30 sec, followed by 1 cycle at 72° for 7 min and a 4° hold.

Article Title: Parallel action of AtDRB2 and RdDM in the control of transposable element expression
Article Snippet: .. 4 μl of cDNA were used in the PCR reaction (GoTaq DNA polymerase, Promega M300) in a final volume of 12.5 μl, and amplified for 37 cycles with the primers found in Additional file : Table S1. .. Mass spectrometry analysis Purified proteins were obtained as described in the immunoprecipitation segment with a starting amount of 1.5 grams of mixed floral tissues.

Article Title: A novel fluorescence and DNA combination for complex, long-term marking of mosquitoes
Article Snippet: .. Tags were amplified using 1 μl of 0.1 μM single stranded DNA ultramer (Integrated DNA Technologies, Coralville, Iowa, USA) or 1 μl of a 1:100 or 1:200 dilution of a 250ng or 500ng synthesis scale double-stranded DNA gBlock in a 50 μl PCR reaction (GoTaq Green Master Mix, Promega, Madison, WI, USA) with 400nM of primers (IDT). .. All amplifications were performed in heat-sealed random-access plates (4titude Ltd, Surrey, UK) to reduce contamination risk, and individual-use aliquots were used to add 10 μl of PCR product per 2 ml of SmartWater® spray solution (see Application method below).

Article Title: Gene Expression Profiles Controlled by the Alternative Splicing Factor Nova2 in Endothelial Cells
Article Snippet: .. An aliquot of the RT reaction (1–2 μL) was then PCR-amplified (with GoTaq DNA Polymerase, Promega, Madison, WI, USA), whereas, for quantitative PCR (qPCR), cDNAs were amplified with QuantiTect SYBR Green PCR (QIAGEN) or iTaq Universal SYBR Green Supermix (Bio-Rad, Hercules, CA, USA) by using LightCycler 480 (Roche). ..

Article Title: The Broad-Spectrum Antiviral Protein ZAP Restricts Human Retrotransposition
Article Snippet: .. Subsequent PCR used GoTaq DNA polymerase (Promega). .. RT-PCR primers were: 1EGFPcass5P TGTTCTGCTGGTAGTGGTCG 2EGFPcass3P TATATCATGGCCGACAAGCAG, which span the intron of the 99-PUR-JM111-EGFP reporter cassette, and 13HSPA6for CAAAATGCAAGACAAGTGTCG 14HSPA6rev TTCTAGCTTTGGAGGGAAAG, which amplify HSPA6 (Accession No. NM_002155).

Hybridization:

Article Title: Comparative Genome Analysis Provides Insights into Both the Lifestyle of Acidithiobacillus ferrivorans Strain CF27 and the Chimeric Nature of the Iron-Oxidizing Acidithiobacilli Genomes
Article Snippet: .. For each RT-PCR experiment, the hybridisation (55–66°C) and elongation (68 or 72°C) temperatures, RNA concentration (from 0.1 to 20 ng), DNA polymerase (GoTaq or Tfl from Promega), and the number of cycles (30, 35, or 40) were adjusted. .. Three controls were used: one without template to detect potential contaminations, one with genomic DNA as a positive control for PCR amplification and one with RNA not treated with reverse transcriptase to check for DNA contamination during RNA preparation.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Promega taq i
    PCR (lanes 2 to 5) and PCR-RFLP (lanes 6 to 9, <t>Taq</t> I digestion; lanes 10 to 13, Hha I digestion) analyses of the gltA ). Lanes 1 and 14, standard 100-bp molecular ladder; lanes 2, 6, and 10, coyote isolates; lanes 3, 7, and 11, B. vinsonii subsp. berkhoffii ATCC 51672; lanes 4, 8, and 12, B. vinsonii ATCC VR152; lanes 5, 9 and 13, B. henselae (strain U-4, University of California, Davis).
    Taq I, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 27 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq i/product/Promega
    Average 92 stars, based on 27 article reviews
    Price from $9.99 to $1999.99
    taq i - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    95
    Promega taq polymerase
    PAGE gel image of the ethidium bromide stained and UV visualised 98 nt <t>PCR</t> fragment using pUC19 as template and the C5-imidazole-modified triphosphates 5c – 8c , derived from urocanic acid. The full experimental conditions are given in Materials and Methods. Lane 1, molecular weight markers; lane 2, a PCR reaction containing all four natural triphosphates, dATP, dCTP, dGTP and dTTP; lane 3, a PCR reaction containing dATP, dCTP and dGTP, which does not result in formation of any product; lane 4, a PCR reaction containing dATP, dCTP, dGTP and 6c ; lane 5, a PCR reaction containing dATP, dCTP, dGTP and 5c ; lane 6, a PCR reaction containing dATP, dCTP, dGTP and 8c ; lane 7, molecular weight markers. Triphosphates 5c and 6c (Fig. 2) are substrates for <t>Taq</t> polymerase during the PCR reaction but 8c is not.
    Taq Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 95/100, based on 2726 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerase/product/Promega
    Average 95 stars, based on 2726 article reviews
    Price from $9.99 to $1999.99
    taq polymerase - by Bioz Stars, 2020-09
    95/100 stars
      Buy from Supplier

    Image Search Results


    PCR (lanes 2 to 5) and PCR-RFLP (lanes 6 to 9, Taq I digestion; lanes 10 to 13, Hha I digestion) analyses of the gltA ). Lanes 1 and 14, standard 100-bp molecular ladder; lanes 2, 6, and 10, coyote isolates; lanes 3, 7, and 11, B. vinsonii subsp. berkhoffii ATCC 51672; lanes 4, 8, and 12, B. vinsonii ATCC VR152; lanes 5, 9 and 13, B. henselae (strain U-4, University of California, Davis).

    Journal: Journal of Clinical Microbiology

    Article Title: Coyotes (Canis latrans) as the Reservoir for a Human Pathogenic Bartonella sp.: Molecular Epidemiology of Bartonella vinsonii subsp. berkhoffii Infection in Coyotes from Central Coastal California

    doi:

    Figure Lengend Snippet: PCR (lanes 2 to 5) and PCR-RFLP (lanes 6 to 9, Taq I digestion; lanes 10 to 13, Hha I digestion) analyses of the gltA ). Lanes 1 and 14, standard 100-bp molecular ladder; lanes 2, 6, and 10, coyote isolates; lanes 3, 7, and 11, B. vinsonii subsp. berkhoffii ATCC 51672; lanes 4, 8, and 12, B. vinsonii ATCC VR152; lanes 5, 9 and 13, B. henselae (strain U-4, University of California, Davis).

    Article Snippet: The amplified product of the gltA gene obtained with the set of primers suggested by Regnery et al. ( ) was digested with Taq I (Promega, Madison, Wis.) and Hha I (new England BioLabs, Beverly, Mass.) restriction endonucleases.

    Techniques: Polymerase Chain Reaction

    PCR-RFLP analysis (lanes 2 to 11, Taq I digestion; lanes 12 to 21, Mse I digestion) of the gltA ). Lanes 1 and 22, standard 100-bp molecular ladder; lanes 2 to 9 and 12 to 19, coyote isolates; lanes 10 and 20, B. vinsonii subsp. berkhoffii ATCC 51672; lanes 11 and 21, B. henselae (strain U-4; University of California, Davis).

    Journal: Journal of Clinical Microbiology

    Article Title: Coyotes (Canis latrans) as the Reservoir for a Human Pathogenic Bartonella sp.: Molecular Epidemiology of Bartonella vinsonii subsp. berkhoffii Infection in Coyotes from Central Coastal California

    doi:

    Figure Lengend Snippet: PCR-RFLP analysis (lanes 2 to 11, Taq I digestion; lanes 12 to 21, Mse I digestion) of the gltA ). Lanes 1 and 22, standard 100-bp molecular ladder; lanes 2 to 9 and 12 to 19, coyote isolates; lanes 10 and 20, B. vinsonii subsp. berkhoffii ATCC 51672; lanes 11 and 21, B. henselae (strain U-4; University of California, Davis).

    Article Snippet: The amplified product of the gltA gene obtained with the set of primers suggested by Regnery et al. ( ) was digested with Taq I (Promega, Madison, Wis.) and Hha I (new England BioLabs, Beverly, Mass.) restriction endonucleases.

    Techniques: Polymerase Chain Reaction

    PAGE gel image of the ethidium bromide stained and UV visualised 98 nt PCR fragment using pUC19 as template and the C5-imidazole-modified triphosphates 5c – 8c , derived from urocanic acid. The full experimental conditions are given in Materials and Methods. Lane 1, molecular weight markers; lane 2, a PCR reaction containing all four natural triphosphates, dATP, dCTP, dGTP and dTTP; lane 3, a PCR reaction containing dATP, dCTP and dGTP, which does not result in formation of any product; lane 4, a PCR reaction containing dATP, dCTP, dGTP and 6c ; lane 5, a PCR reaction containing dATP, dCTP, dGTP and 5c ; lane 6, a PCR reaction containing dATP, dCTP, dGTP and 8c ; lane 7, molecular weight markers. Triphosphates 5c and 6c (Fig. 2) are substrates for Taq polymerase during the PCR reaction but 8c is not.

    Journal: Nucleic Acids Research

    Article Title: Enhancing the catalytic repertoire of nucleic acids: a systematic study of linker length and rigidity

    doi:

    Figure Lengend Snippet: PAGE gel image of the ethidium bromide stained and UV visualised 98 nt PCR fragment using pUC19 as template and the C5-imidazole-modified triphosphates 5c – 8c , derived from urocanic acid. The full experimental conditions are given in Materials and Methods. Lane 1, molecular weight markers; lane 2, a PCR reaction containing all four natural triphosphates, dATP, dCTP, dGTP and dTTP; lane 3, a PCR reaction containing dATP, dCTP and dGTP, which does not result in formation of any product; lane 4, a PCR reaction containing dATP, dCTP, dGTP and 6c ; lane 5, a PCR reaction containing dATP, dCTP, dGTP and 5c ; lane 6, a PCR reaction containing dATP, dCTP, dGTP and 8c ; lane 7, molecular weight markers. Triphosphates 5c and 6c (Fig. 2) are substrates for Taq polymerase during the PCR reaction but 8c is not.

    Article Snippet: Consequently, we have studied the incorporation of the modified triphosphates during PCR reactions mediated by Taq polymerase using template DNAs varying from 62 to 224 nt.

    Techniques: Polyacrylamide Gel Electrophoresis, Staining, Polymerase Chain Reaction, Modification, Derivative Assay, Molecular Weight

    PAGE gel image of the ethidium bromide stained and UV visualised 98 nt PCR fragment using pUC19 as template and the C5-imidazole-modified triphosphates 5b – 8b , derived from imidazole 4-acetic acid. The full experimental conditions are given in Materials and Methods. Lane 1, molecular weight markers; lane 2, a PCR reaction containing all four natural triphosphates, dATP, dCTP, dGTP and dTTP; lane 3, a PCR reaction containing dATP, dCTP and dGTP, which does not result in formation of any product; lane 4, a PCR reaction containing dATP, dCTP, dGTP and 6b ; lane 5, a PCR reaction containing dATP, dCTP, dGTP and 5b ; lane 6, a PCR reaction containing dATP, dCTP, dGTP and 8b ; lane 7, molecular weight markers. Triphosphates 5b and 6b (Fig. 2) are substrates for Taq polymerase during the PCR reaction but 8b is not.

    Journal: Nucleic Acids Research

    Article Title: Enhancing the catalytic repertoire of nucleic acids: a systematic study of linker length and rigidity

    doi:

    Figure Lengend Snippet: PAGE gel image of the ethidium bromide stained and UV visualised 98 nt PCR fragment using pUC19 as template and the C5-imidazole-modified triphosphates 5b – 8b , derived from imidazole 4-acetic acid. The full experimental conditions are given in Materials and Methods. Lane 1, molecular weight markers; lane 2, a PCR reaction containing all four natural triphosphates, dATP, dCTP, dGTP and dTTP; lane 3, a PCR reaction containing dATP, dCTP and dGTP, which does not result in formation of any product; lane 4, a PCR reaction containing dATP, dCTP, dGTP and 6b ; lane 5, a PCR reaction containing dATP, dCTP, dGTP and 5b ; lane 6, a PCR reaction containing dATP, dCTP, dGTP and 8b ; lane 7, molecular weight markers. Triphosphates 5b and 6b (Fig. 2) are substrates for Taq polymerase during the PCR reaction but 8b is not.

    Article Snippet: Consequently, we have studied the incorporation of the modified triphosphates during PCR reactions mediated by Taq polymerase using template DNAs varying from 62 to 224 nt.

    Techniques: Polyacrylamide Gel Electrophoresis, Staining, Polymerase Chain Reaction, Modification, Derivative Assay, Molecular Weight