taq dna polymerase  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    Name:
    Taq polymerase
    Description:

    Catalog Number:
    M3001
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Promega taq dna polymerase
    Genomic <t>DNA</t> of Durazno Imilla 30CN-010 sample was amplified by Bch6 , 21BA , UGPasa , CT-203 , Chi , GP-24 , Stan1 , Chs , and Zep primers, restricted with <t>Taq</t> DNA polymerase, and electrophoresed through a 2% agarose gel. The primers are listed in ascending order in a range of 400–1600 bp.

    https://www.bioz.com/result/taq dna polymerase/product/Promega
    Average 98 stars, based on 1819 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2019-10
    98/100 stars

    Images

    1) Product Images from "Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection"

    Article Title: Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection

    Journal: Food Science & Nutrition

    doi: 10.1002/fsn3.69

    Genomic DNA of Durazno Imilla 30CN-010 sample was amplified by Bch6 , 21BA , UGPasa , CT-203 , Chi , GP-24 , Stan1 , Chs , and Zep primers, restricted with Taq DNA polymerase, and electrophoresed through a 2% agarose gel. The primers are listed in ascending order in a range of 400–1600 bp.
    Figure Legend Snippet: Genomic DNA of Durazno Imilla 30CN-010 sample was amplified by Bch6 , 21BA , UGPasa , CT-203 , Chi , GP-24 , Stan1 , Chs , and Zep primers, restricted with Taq DNA polymerase, and electrophoresed through a 2% agarose gel. The primers are listed in ascending order in a range of 400–1600 bp.

    Techniques Used: Amplification, Agarose Gel Electrophoresis

    2) Product Images from "Proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure which can be targeted by G-quadruplex-interactive agents"

    Article Title: Proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure which can be targeted by G-quadruplex-interactive agents

    Journal:

    doi: 10.1158/1535-7163.MCT-07-2119

    Taq DNA polymerase stop assay showing the stabilization of G-quadruplex structures by K + and TMPyP2, TMPyP4, and Se2SAP. (A) Sequence of the single-stranded DNA template annealed with primer used in DNA polymerase stop assay. (B) KCl-dependent pausing
    Figure Legend Snippet: Taq DNA polymerase stop assay showing the stabilization of G-quadruplex structures by K + and TMPyP2, TMPyP4, and Se2SAP. (A) Sequence of the single-stranded DNA template annealed with primer used in DNA polymerase stop assay. (B) KCl-dependent pausing

    Techniques Used: Sequencing

    3) Product Images from "Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes"

    Article Title: Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes

    Journal: Nature Communications

    doi: 10.1038/s41467-018-05733-0

    Visual and modular detection of pathogen nucleic acids. a The enVision system consists of a series of enzyme–DNA nanostructures to enable target recognition, target-independent signaling, and visual detection. The nanostructures are designed to decouple recognition from signaling. The recognition nanostructure is a hybrid complex, composed of an inactivating aptamer and a Taq DNA polymerase. In the presence of complementary target DNA, the complex dissociates to activate the polymerase activity. The active polymerase proceeds to elongate a universal, self-priming signaling nanostructure, in a target-independent manner. Modified deoxynucleotides (dNTPs) are incorporated to immobilize horseradish peroxidase (HRP) onto the signaling nanostructures. Upon the addition of optical substrate, visual signals can be enzymatically enhanced, detected by the naked eye and quantified with a smartphone camera. Photograph (inset) shows an example of the actual visual readouts in the presence of none (−) and varying (+) amounts of target DNA on a smartphone application. b Schematic of the enVision microfluidic system. The platform is designed to complement the modular enVision workflow. Independent assay cassettes, preloaded with specific recognition nanostructures at the inlets, can be mounted on-demand onto a common signaling cartridge. The common cartridge houses the universal signaling nanostructures, which are immobilized on embedded membranes, for target-independent signaling and visual detection. Direction of cassette sliding is indicated by a red arrow. c Photograph of the microfluidic enVision prototype, developed for versatile assay integration and parallel processing. Scale bar indicates 1 cm
    Figure Legend Snippet: Visual and modular detection of pathogen nucleic acids. a The enVision system consists of a series of enzyme–DNA nanostructures to enable target recognition, target-independent signaling, and visual detection. The nanostructures are designed to decouple recognition from signaling. The recognition nanostructure is a hybrid complex, composed of an inactivating aptamer and a Taq DNA polymerase. In the presence of complementary target DNA, the complex dissociates to activate the polymerase activity. The active polymerase proceeds to elongate a universal, self-priming signaling nanostructure, in a target-independent manner. Modified deoxynucleotides (dNTPs) are incorporated to immobilize horseradish peroxidase (HRP) onto the signaling nanostructures. Upon the addition of optical substrate, visual signals can be enzymatically enhanced, detected by the naked eye and quantified with a smartphone camera. Photograph (inset) shows an example of the actual visual readouts in the presence of none (−) and varying (+) amounts of target DNA on a smartphone application. b Schematic of the enVision microfluidic system. The platform is designed to complement the modular enVision workflow. Independent assay cassettes, preloaded with specific recognition nanostructures at the inlets, can be mounted on-demand onto a common signaling cartridge. The common cartridge houses the universal signaling nanostructures, which are immobilized on embedded membranes, for target-independent signaling and visual detection. Direction of cassette sliding is indicated by a red arrow. c Photograph of the microfluidic enVision prototype, developed for versatile assay integration and parallel processing. Scale bar indicates 1 cm

    Techniques Used: Activity Assay, Modification

    4) Product Images from "Deconvoluting the Structural and Drug-Recognition Complexity of the G-Quadruplex-Forming Region Upstream of the bcl-2 P1 Promoter"

    Article Title: Deconvoluting the Structural and Drug-Recognition Complexity of the G-Quadruplex-Forming Region Upstream of the bcl-2 P1 Promoter

    Journal: Journal of the American Chemical Society

    doi: 10.1021/ja0563861

    Determination of the ability of the Pu39WT sequence to form multiple G-quadruplex structures. (A) DNA polymerase stop assay showing three K+ -dependent DNA polymerase arrests. Lane 1 shows a guanine sequencing reaction, lane 2 is a negative control containing no Taq DNA polymerase, and lanes 3–6 contain 0, 25, 50, and 100 mM KCl, respectively. Arrows point to the positions of the full-length product of DNA synthesis, the DNA polymerase arrest sites ( 1, 2 , and 3 ), and the free primer. (B) Concentration-dependent inhibition of Taq polymerase DNA synthesis by stabilization of the bcl-2 G-quadruplex structures with TMPyP4 (0.5, 1, 2.5, 5 µM) compared to TMPyP2 (0.5, 1, 2.5, 5 µM). All lanes contain 20 mM KCl. (C) Nondenaturing gel analysis of Pu39WT sequence preincubated in the absence or presence of 100 mM KCl. (D) DMS footprinting of band 1 (lane 2) and band 2 (lane 3) from (C). Lane 1 shows a purine sequencing reaction. The protected guanines from DMS are indicated with filled circles, partial protection with half-filled circles, no protection with open circles, and hypersensitive guanines with arrowheads. (E) Comparative CD spectra of three known G-quadruplex-forming sequences with the unknown bcl-2 promoter Pu39WT sequence. Line colors: green = c-myc promoter sequence (parallel G-quadruplex in 100 mM KCl); blue = thrombin binding aptamer (TBA) sequence (antiparallel G-quadruplex in 100 mM KCl); red = Tetrahymena telomeric repeat sequence (mixed parallel/antiparallel G-quadruplex in 100 NaCl); black = Tetrahymena telomeric repeat sequence (100 mM KCl); orange = bcl-2 promoter Pu39WT sequence (100 mM KCl). All CD data were obtained with a 5 µM strand concentration at 25 °C.
    Figure Legend Snippet: Determination of the ability of the Pu39WT sequence to form multiple G-quadruplex structures. (A) DNA polymerase stop assay showing three K+ -dependent DNA polymerase arrests. Lane 1 shows a guanine sequencing reaction, lane 2 is a negative control containing no Taq DNA polymerase, and lanes 3–6 contain 0, 25, 50, and 100 mM KCl, respectively. Arrows point to the positions of the full-length product of DNA synthesis, the DNA polymerase arrest sites ( 1, 2 , and 3 ), and the free primer. (B) Concentration-dependent inhibition of Taq polymerase DNA synthesis by stabilization of the bcl-2 G-quadruplex structures with TMPyP4 (0.5, 1, 2.5, 5 µM) compared to TMPyP2 (0.5, 1, 2.5, 5 µM). All lanes contain 20 mM KCl. (C) Nondenaturing gel analysis of Pu39WT sequence preincubated in the absence or presence of 100 mM KCl. (D) DMS footprinting of band 1 (lane 2) and band 2 (lane 3) from (C). Lane 1 shows a purine sequencing reaction. The protected guanines from DMS are indicated with filled circles, partial protection with half-filled circles, no protection with open circles, and hypersensitive guanines with arrowheads. (E) Comparative CD spectra of three known G-quadruplex-forming sequences with the unknown bcl-2 promoter Pu39WT sequence. Line colors: green = c-myc promoter sequence (parallel G-quadruplex in 100 mM KCl); blue = thrombin binding aptamer (TBA) sequence (antiparallel G-quadruplex in 100 mM KCl); red = Tetrahymena telomeric repeat sequence (mixed parallel/antiparallel G-quadruplex in 100 NaCl); black = Tetrahymena telomeric repeat sequence (100 mM KCl); orange = bcl-2 promoter Pu39WT sequence (100 mM KCl). All CD data were obtained with a 5 µM strand concentration at 25 °C.

    Techniques Used: Sequencing, Negative Control, DNA Synthesis, Concentration Assay, Inhibition, Footprinting, Binding Assay

    5) Product Images from "Proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure which can be targeted by G-quadruplex-interactive agents"

    Article Title: Proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure which can be targeted by G-quadruplex-interactive agents

    Journal:

    doi: 10.1158/1535-7163.MCT-07-2119

    Taq DNA polymerase stop assay showing the stabilization of G-quadruplex structures by K + and TMPyP2, TMPyP4, and Se2SAP. (A) Sequence of the single-stranded DNA template annealed with primer used in DNA polymerase stop assay. (B) KCl-dependent pausing
    Figure Legend Snippet: Taq DNA polymerase stop assay showing the stabilization of G-quadruplex structures by K + and TMPyP2, TMPyP4, and Se2SAP. (A) Sequence of the single-stranded DNA template annealed with primer used in DNA polymerase stop assay. (B) KCl-dependent pausing

    Techniques Used: Sequencing

    Related Articles

    Clone Assay:

    Article Title: Intrastrain and interstrain genetic variation within a paralogous gene family in Chlamydia pneumoniae
    Article Snippet: Paragraph title: Examination of variation within isolates through cloning of PCR products ... Both Taq polymerase (Promega, Madison, WI) and Pwo polymerase (Roche Diagnostic Corporation, Indianapolis, IN) were used in these studies.

    Article Title: Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse
    Article Snippet: The reverse Transcription System (Promega) coupled with Taq DNA Polymerase (Promega) was used for RT-PCR. .. Degenerative PCR was carried out using Taq DNA Polymerase (Promega) with 5'-GATGGGAAAC(A/G)GCACCAG(C/T)(A/C)GAC-3' and 5'-GC(G/C)AG(A/G)ATGTTCCACTGCAT(G/C)AC-3' as forward and reverse primers respectively.

    Amplification:

    Article Title: Insulin-like growth factor 1 gene (CA)n repeats and a variable number of tandem repeats of the insulin gene in Brazilian children born small for gestational age
    Article Snippet: Adenine (A) indicates the presence of the class I allele, wheras thymine (T) indicates the presence of the class III allele ( ). .. A 360 bp region containing this polymorphism was amplified using 200 ng of genomic DNA, 2.5 U of Taq DNA polymerase (Promega ®), 6.7 mM MgCl2 , 200 μM dNTP, 200 ng of the INS VNTR-specific primers sense 5 ′AGCAGGTCTGTTCCAAGG 3′ and antisense-INS VNTR 5 ′CTTGGGTGTGTAGAAGAAGC 3′ and 2.5 U of Taq DNA polymerase (Promega ®), in a final volume of 50 μL. .. The PCR conditions were: 96° C for 12 minutes; 35 cycles consisting of 94°C for 1 minute, 54°C for 1 minute and 72°C for 45 seconds; and 10 minutes at 72°C for the final extension step.

    Article Title: Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection
    Article Snippet: The DNA quality was verified by electrophoresis on 1% agarose gel and quantified using a spectrophotometer. .. Polymerase chain reaction (PCR) amplification was made using 40 ng of DNA and Master Mix (Promega), with the following concentrations: 0.2 mmol/L dNTPs, 1.5 mmol/L MgCl2 , 0.03 μ/μL Taq DNA polymerase (Promega), and 1 μmol/L for primers (forward and reverse), respectively. .. Thermal cycling conditions were found by BIOER thermocycler for 10 primers referred (Zhang et al. ) those which are on a range of 400–900 bp: bch6 , 21ba , ugp-ase , ans , ct-203 , chi , and gp-24 and the following conditions: 3 min denaturation at 95°C, 1 min annealing in the range of 48–57°C and 1 min, 30 sec extension at 72°C, and the number of cycles was between 30 and 33.

    Article Title: Identification and genomic characterization of a novel porcine parvovirus (PPV6) in china
    Article Snippet: Amplification products were then purified and a poly(C) tail was added to the 3′ end using deoxycytidine and terminal deoxynucleotidyl transferase. .. The 5′ region was then amplified with 5 units of Taq polymerase using an abridged anchor primer and Taq polymerase (5 U). .. For 3′RACE, gene specific primers p3RACE (5′-TATGGCCCATGTAAACGCATC-3′) were designed based on the available partial sequence and was used in combination with the Oligo-dT anchor primer.

    Article Title: Molecular Microbial Analysis of Lactobacillus Strains Isolated from the Gut of Calves for Potential Probiotic Use
    Article Snippet: Paragraph title: 2.3. 16S rDNA Amplification ... Each PCR tube (50 μ L) contained a reaction mix of 10 μ L 5X PCR buffer for Taq polymerase (Promega), 1.5 mM MgCl2 , 200 μ M of each deoxynucleotide triphosphate (Promega), 0.4 μ M of each primer and 2 U of Taq Polymerase (Promega) and 5 μ L of template DNA.

    Article Title: Intrastrain and interstrain genetic variation within a paralogous gene family in Chlamydia pneumoniae
    Article Snippet: The variation of the length of the polyC tract within Cpn 043, 1054 and 1055 was determined through sequence analysis of purified amplification products and through sequencing of amplification products following cloning into plasmids. .. Both Taq polymerase (Promega, Madison, WI) and Pwo polymerase (Roche Diagnostic Corporation, Indianapolis, IN) were used in these studies.

    Article Title: 7-Deaza-2`-deoxyguanosine allows PCR and sequencing reactions from CpG islands
    Article Snippet: We amplified the human p16INK4A promoter (accession number ) and HUMARA exon 1 (accession number ) according to previously published methods. .. The PCR mixtures contained 1× PCR buffer (Taq polymerase: 50mM KCl, 100mM Tris/HCl, pH 9.0, 0.1% (vol/vol) Triton-X 100, or AmpliTaq Gold polymerase: PCR Gold buffer (Applied Biosystems, Weiterstadt, Germany)), 1.5mM (p16INK4A ) or 2.0mM (HUMARA) magnesium chloride, 200μM dNTP mix (both) or deaza-mix (deaza-dGTP instead of dGTP), 10 pmol of each primer (p16INK4A WT , HUMARA ), 1 U Taq polymerase (Promega, Heidelberg, Germany) or for hot start PCR AmpliTaq Gold (Applied Biosystems) and 50 ng template (p16INK4A , SW1116; HUMARA, ARH77) in a final volume of 25 μl.

    Article Title: CALHM1 ion channel mediates purinergic neurotransmission of sweet, bitter and umami tastes
    Article Snippet: Paragraph title: Laser capture microdissection, RNA amplification, and reverse transcriptase-PCR (RT-PCR) ... A 50 μL PCR reaction was run with the following final concentrations: 450 ng of each primer (see for PCR primer sequences), 2 mM MgCl2 , 0.3 mM dNTPs, 2.5 U Taq polymerase (Promega GoFlex DNA polymerase) and 1 μL of 10 ng/μL DNA.

    Synthesized:

    Article Title: Proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure which can be targeted by G-quadruplex-interactive agents
    Article Snippet: TMPyP4, TMPyP2, and Se2SAP were synthesized in this laboratory. .. T4 polymerase kinase and Taq DNA polymerase were from Promega.

    Quantitative RT-PCR:

    Article Title: Field-deployable, quantitative, rapid identification of active Ebola virus infection in unprocessed blood †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc03281a
    Article Snippet: Instead, we spiked fresh human blood directly into reactions by obtaining it through digital venipuncture ad hoc . .. We thus assembled one-step RT-qPCR reactions with a commercially available Taq polymerase (GoTaq® G2 Flex; Promega, Inc) or the blood-tolerant OmniTaq 2 (DNA Polymerase Technology, Inc.), using the manufacturer's mastermix, respectively, and 5 U per reaction of GoScript® Moloney Murine Leukemia virus reverse transcriptase (Promega). .. Importantly, although these mastermix formulations remained proprietary, both suppliers confirmed that neither formulation featured additives to overcome PCR inhibitors.

    Electrophoresis:

    Article Title: Insulin-like growth factor 1 gene (CA)n repeats and a variable number of tandem repeats of the insulin gene in Brazilian children born small for gestational age
    Article Snippet: A 360 bp region containing this polymorphism was amplified using 200 ng of genomic DNA, 2.5 U of Taq DNA polymerase (Promega ®), 6.7 mM MgCl2 , 200 μM dNTP, 200 ng of the INS VNTR-specific primers sense 5 ′AGCAGGTCTGTTCCAAGG 3′ and antisense-INS VNTR 5 ′CTTGGGTGTGTAGAAGAAGC 3′ and 2.5 U of Taq DNA polymerase (Promega ®), in a final volume of 50 μL. .. A 360 bp region containing this polymorphism was amplified using 200 ng of genomic DNA, 2.5 U of Taq DNA polymerase (Promega ®), 6.7 mM MgCl2 , 200 μM dNTP, 200 ng of the INS VNTR-specific primers sense 5 ′AGCAGGTCTGTTCCAAGG 3′ and antisense-INS VNTR 5 ′CTTGGGTGTGTAGAAGAAGC 3′ and 2.5 U of Taq DNA polymerase (Promega ®), in a final volume of 50 μL.

    Article Title: Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection
    Article Snippet: Polymerase chain reaction (PCR) amplification was made using 40 ng of DNA and Master Mix (Promega), with the following concentrations: 0.2 mmol/L dNTPs, 1.5 mmol/L MgCl2 , 0.03 μ/μL Taq DNA polymerase (Promega), and 1 μmol/L for primers (forward and reverse), respectively. .. For primers in the range 1000–1600 bp: stan1 , chs , and zep , the conditions were 2 min denaturation at 95°C, 1 min annealing in the range 62–65°C and 1 min, 30 sec extension at 72°C, and 35 cycles.

    Article Title: Molecular Microbial Analysis of Lactobacillus Strains Isolated from the Gut of Calves for Potential Probiotic Use
    Article Snippet: Each PCR tube (50 μ L) contained a reaction mix of 10 μ L 5X PCR buffer for Taq polymerase (Promega), 1.5 mM MgCl2 , 200 μ M of each deoxynucleotide triphosphate (Promega), 0.4 μ M of each primer and 2 U of Taq Polymerase (Promega) and 5 μ L of template DNA. .. Each PCR tube (50 μ L) contained a reaction mix of 10 μ L 5X PCR buffer for Taq polymerase (Promega), 1.5 mM MgCl2 , 200 μ M of each deoxynucleotide triphosphate (Promega), 0.4 μ M of each primer and 2 U of Taq Polymerase (Promega) and 5 μ L of template DNA.

    Primer Extension Assay:

    Article Title: Proximal promoter region of the human vascular endothelial growth factor gene has a G-quadruplex structure which can be targeted by G-quadruplex-interactive agents
    Article Snippet: The template DNAs containing various G-quadruplex forming regions were annealed with primers (P28) labeled with [γ]-32 P, and the primer-annealed DNA templates were separated from excess labeled primer or remaining template DNA by electrophoresis through an 8% nondenaturing polyacrylamide gel. .. The resulting primer-annealed template DNAs were gel-purified and used in a primer extension assay by Taq DNA polymerase as described previously ( ). .. CD spectra were recorded on a Jasco-810 spectropolarimeter (Jasco, Easton, MD) using a quartz cell of 1 mm optical path length and an instrument scanning speed of 100 nm/min, with a response time of 1 s and over a wavelength range of 200–330 or 200–600 nm for the titration experiments with drugs.

    Incubation:

    Article Title: Visual and modular detection of pathogen nucleic acids with enzyme–DNA molecular complexes
    Article Snippet: To prepare the recognition nanostructure, we mixed an equal molar ratio of DNA aptamer and inverter oligonucleotide in a buffer of 50 mM NaCl, 1.5 mM MgCl2 , and 50 mM Tris–HCl buffer (pH 8.5). .. The mixture was incubated at 95 °C for 5 min and slowly cooled at 0.1 °C/s until the reaction reached 25 °C, before the addition of Taq DNA polymerase (GoTaq, Promega) to form the hybrid complex. .. To characterize the assembly and activity of the recognition nanostructure in the presence of DNA targets, varying concentrations of target oligonucleotides were added to this mixture.

    Transformation Assay:

    Article Title: Systematic Discovery of Complex Indels in Human Cancers
    Article Snippet: COLO 829 melanoma cells (CRL-1974) and the Epstein-Barr virus- transformed control B lymphoblast cells from the same individual (CRL-1980) were acquired from ATCC (Manassas, VA, USA) and cultured in RPMI-1640 medium supplemented with 10% FBS, 100 units/ml penicillin and 100 ug/ml streptomycin, at 37°C in 5% CO2 /95% air. .. PCR (50ul) was done with Taq polymerase (Promega, Madison, WI, USA.

    Library Screening:

    Article Title: Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse
    Article Snippet: Paragraph title: Genomic Library Screening and Analysis ... These three primers were used for genomic PCR with Taq DNA polymerase (Promega).

    Cell Culture:

    Article Title: Systematic Discovery of Complex Indels in Human Cancers
    Article Snippet: COLO 829 melanoma cells (CRL-1974) and the Epstein-Barr virus- transformed control B lymphoblast cells from the same individual (CRL-1980) were acquired from ATCC (Manassas, VA, USA) and cultured in RPMI-1640 medium supplemented with 10% FBS, 100 units/ml penicillin and 100 ug/ml streptomycin, at 37°C in 5% CO2 /95% air. .. PCR (50ul) was done with Taq polymerase (Promega, Madison, WI, USA.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Field-deployable, quantitative, rapid identification of active Ebola virus infection in unprocessed blood †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc03281a
    Article Snippet: Encouraged by these reports, and working in parallel to constructing the PV standards, we investigated whether the blood compatibility of PCR could be extended to RNA templates and RT-PCR using similar, well-characterized assays., However, in line with our projected application of analyzing patient blood immediately upon collection, we dispensed with anticoagulants and blood storage altogether. .. We thus assembled one-step RT-qPCR reactions with a commercially available Taq polymerase (GoTaq® G2 Flex; Promega, Inc) or the blood-tolerant OmniTaq 2 (DNA Polymerase Technology, Inc.), using the manufacturer's mastermix, respectively, and 5 U per reaction of GoScript® Moloney Murine Leukemia virus reverse transcriptase (Promega).

    Article Title: Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse
    Article Snippet: The reverse Transcription System (Promega) coupled with Taq DNA Polymerase (Promega) was used for RT-PCR. .. Degenerative PCR was carried out using Taq DNA Polymerase (Promega) with 5'-GATGGGAAAC(A/G)GCACCAG(C/T)(A/C)GAC-3' and 5'-GC(G/C)AG(A/G)ATGTTCCACTGCAT(G/C)AC-3' as forward and reverse primers respectively.

    Article Title: Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse
    Article Snippet: 5'-RACE was performed according to kit protocol (GIBCO/BRL, Rockville, MD). .. The reverse Transcription System (Promega) coupled with Taq DNA Polymerase (Promega) was used for RT-PCR. .. Degenerative PCR was carried out using Taq DNA Polymerase (Promega) with 5'-GATGGGAAAC(A/G)GCACCAG(C/T)(A/C)GAC-3' and 5'-GC(G/C)AG(A/G)ATGTTCCACTGCAT(G/C)AC-3' as forward and reverse primers respectively.

    Article Title: CALHM1 ion channel mediates purinergic neurotransmission of sweet, bitter and umami tastes
    Article Snippet: Paragraph title: Laser capture microdissection, RNA amplification, and reverse transcriptase-PCR (RT-PCR) ... A 50 μL PCR reaction was run with the following final concentrations: 450 ng of each primer (see for PCR primer sequences), 2 mM MgCl2 , 0.3 mM dNTPs, 2.5 U Taq polymerase (Promega GoFlex DNA polymerase) and 1 μL of 10 ng/μL DNA.

    other:

    Article Title: Deconvoluting the Structural and Drug-Recognition Complexity of the G-Quadruplex-Forming Region Upstream of the bcl-2 P1 Promoter
    Article Snippet: T4 kinase and Taq DNA polymerase were purchased from Promega.

    Negative Control:

    Article Title: Insulin-like growth factor 1 gene (CA)n repeats and a variable number of tandem repeats of the insulin gene in Brazilian children born small for gestational age
    Article Snippet: A 360 bp region containing this polymorphism was amplified using 200 ng of genomic DNA, 2.5 U of Taq DNA polymerase (Promega ®), 6.7 mM MgCl2 , 200 μM dNTP, 200 ng of the INS VNTR-specific primers sense 5 ′AGCAGGTCTGTTCCAAGG 3′ and antisense-INS VNTR 5 ′CTTGGGTGTGTAGAAGAAGC 3′ and 2.5 U of Taq DNA polymerase (Promega ®), in a final volume of 50 μL. .. A 360 bp region containing this polymorphism was amplified using 200 ng of genomic DNA, 2.5 U of Taq DNA polymerase (Promega ®), 6.7 mM MgCl2 , 200 μM dNTP, 200 ng of the INS VNTR-specific primers sense 5 ′AGCAGGTCTGTTCCAAGG 3′ and antisense-INS VNTR 5 ′CTTGGGTGTGTAGAAGAAGC 3′ and 2.5 U of Taq DNA polymerase (Promega ®), in a final volume of 50 μL.

    Sequencing:

    Article Title: Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse
    Article Snippet: The sequences for F1 and R1 are based on sequences from the BAC clone characterized in Figure while the sequence of F2 is from the IAP element (reference [ ]). .. These three primers were used for genomic PCR with Taq DNA polymerase (Promega).

    Article Title: Intrastrain and interstrain genetic variation within a paralogous gene family in Chlamydia pneumoniae
    Article Snippet: The variation of the length of the polyC tract within Cpn 043, 1054 and 1055 was determined through sequence analysis of purified amplification products and through sequencing of amplification products following cloning into plasmids. .. Both Taq polymerase (Promega, Madison, WI) and Pwo polymerase (Roche Diagnostic Corporation, Indianapolis, IN) were used in these studies.

    Article Title: Systematic Discovery of Complex Indels in Human Cancers
    Article Snippet: Paragraph title: Sanger Sequencing confirmation of complex indels ... PCR (50ul) was done with Taq polymerase (Promega, Madison, WI, USA.

    Recombinant:

    Article Title: Intrastrain and interstrain genetic variation within a paralogous gene family in Chlamydia pneumoniae
    Article Snippet: Both Taq polymerase (Promega, Madison, WI) and Pwo polymerase (Roche Diagnostic Corporation, Indianapolis, IN) were used in these studies. .. Both Taq polymerase (Promega, Madison, WI) and Pwo polymerase (Roche Diagnostic Corporation, Indianapolis, IN) were used in these studies.

    Molecular Weight:

    Article Title: Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection
    Article Snippet: Polymerase chain reaction (PCR) amplification was made using 40 ng of DNA and Master Mix (Promega), with the following concentrations: 0.2 mmol/L dNTPs, 1.5 mmol/L MgCl2 , 0.03 μ/μL Taq DNA polymerase (Promega), and 1 μmol/L for primers (forward and reverse), respectively. .. For primers in the range 1000–1600 bp: stan1 , chs , and zep , the conditions were 2 min denaturation at 95°C, 1 min annealing in the range 62–65°C and 1 min, 30 sec extension at 72°C, and 35 cycles.

    Mutagenesis:

    Article Title: Field-deployable, quantitative, rapid identification of active Ebola virus infection in unprocessed blood †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc03281a
    Article Snippet: We thus assembled one-step RT-qPCR reactions with a commercially available Taq polymerase (GoTaq® G2 Flex; Promega, Inc) or the blood-tolerant OmniTaq 2 (DNA Polymerase Technology, Inc.), using the manufacturer's mastermix, respectively, and 5 U per reaction of GoScript® Moloney Murine Leukemia virus reverse transcriptase (Promega). .. We thus assembled one-step RT-qPCR reactions with a commercially available Taq polymerase (GoTaq® G2 Flex; Promega, Inc) or the blood-tolerant OmniTaq 2 (DNA Polymerase Technology, Inc.), using the manufacturer's mastermix, respectively, and 5 U per reaction of GoScript® Moloney Murine Leukemia virus reverse transcriptase (Promega).

    Isolation:

    Article Title: Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse
    Article Snippet: BAC DNA was isolated by a Qiagen Plasmid Maxi Kit and sequenced using the ABI Prism 310. .. These three primers were used for genomic PCR with Taq DNA polymerase (Promega).

    Article Title: Intrastrain and interstrain genetic variation within a paralogous gene family in Chlamydia pneumoniae
    Article Snippet: Both Taq polymerase (Promega, Madison, WI) and Pwo polymerase (Roche Diagnostic Corporation, Indianapolis, IN) were used in these studies. .. Amplification products generated with Pwo polymerase were cloned using the Zeroblunt system, while products generated with Taq were cloned into pCRII (Invitrogen, Carlsbad, CA).

    Article Title: CALHM1 ion channel mediates purinergic neurotransmission of sweet, bitter and umami tastes
    Article Snippet: Taste buds from the circumvallate papilla (CVP) and surrounding lingual epithelium (LE) were isolated using a Leica laser microdissection system LMD7000 (Leica). .. A 50 μL PCR reaction was run with the following final concentrations: 450 ng of each primer (see for PCR primer sequences), 2 mM MgCl2 , 0.3 mM dNTPs, 2.5 U Taq polymerase (Promega GoFlex DNA polymerase) and 1 μL of 10 ng/μL DNA.

    Size-exclusion Chromatography:

    Article Title: Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection
    Article Snippet: Polymerase chain reaction (PCR) amplification was made using 40 ng of DNA and Master Mix (Promega), with the following concentrations: 0.2 mmol/L dNTPs, 1.5 mmol/L MgCl2 , 0.03 μ/μL Taq DNA polymerase (Promega), and 1 μmol/L for primers (forward and reverse), respectively. .. Thermal cycling conditions were found by BIOER thermocycler for 10 primers referred (Zhang et al. ) those which are on a range of 400–900 bp: bch6 , 21ba , ugp-ase , ans , ct-203 , chi , and gp-24 and the following conditions: 3 min denaturation at 95°C, 1 min annealing in the range of 48–57°C and 1 min, 30 sec extension at 72°C, and the number of cycles was between 30 and 33.

    Labeling:

    Article Title: Insulin-like growth factor 1 gene (CA)n repeats and a variable number of tandem repeats of the insulin gene in Brazilian children born small for gestational age
    Article Snippet: The forward primers were labeled with FAM, which is a fluorescent size marker, to determine the size of PCR products using an autosequencer (ABI Prism 3100 Genetic analyzer); this size determination was followed by analysis with GENESCAN Fragment Analysis software (Applied Biosystems, Foster City, CA, USA). .. A 360 bp region containing this polymorphism was amplified using 200 ng of genomic DNA, 2.5 U of Taq DNA polymerase (Promega ®), 6.7 mM MgCl2 , 200 μM dNTP, 200 ng of the INS VNTR-specific primers sense 5 ′AGCAGGTCTGTTCCAAGG 3′ and antisense-INS VNTR 5 ′CTTGGGTGTGTAGAAGAAGC 3′ and 2.5 U of Taq DNA polymerase (Promega ®), in a final volume of 50 μL.

    Purification:

    Article Title: Intrastrain and interstrain genetic variation within a paralogous gene family in Chlamydia pneumoniae
    Article Snippet: The variation of the length of the polyC tract within Cpn 043, 1054 and 1055 was determined through sequence analysis of purified amplification products and through sequencing of amplification products following cloning into plasmids. .. Both Taq polymerase (Promega, Madison, WI) and Pwo polymerase (Roche Diagnostic Corporation, Indianapolis, IN) were used in these studies.

    Article Title: Systematic Discovery of Complex Indels in Human Cancers
    Article Snippet: DNA was purified from these cells using a mammalian genomic DNA extraction kit (Sigma-Aldrich, St. Louis, MO, USA. .. PCR (50ul) was done with Taq polymerase (Promega, Madison, WI, USA.

    Article Title: CALHM1 ion channel mediates purinergic neurotransmission of sweet, bitter and umami tastes
    Article Snippet: Total RNA from taste bud and LE samples was purified using a RNAqueous-Micro Kit (Ambion). .. A 50 μL PCR reaction was run with the following final concentrations: 450 ng of each primer (see for PCR primer sequences), 2 mM MgCl2 , 0.3 mM dNTPs, 2.5 U Taq polymerase (Promega GoFlex DNA polymerase) and 1 μL of 10 ng/μL DNA.

    Polymerase Chain Reaction:

    Article Title: Field-deployable, quantitative, rapid identification of active Ebola virus infection in unprocessed blood †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc03281a
    Article Snippet: Encouraged by these reports, and working in parallel to constructing the PV standards, we investigated whether the blood compatibility of PCR could be extended to RNA templates and RT-PCR using similar, well-characterized assays., However, in line with our projected application of analyzing patient blood immediately upon collection, we dispensed with anticoagulants and blood storage altogether. .. We thus assembled one-step RT-qPCR reactions with a commercially available Taq polymerase (GoTaq® G2 Flex; Promega, Inc) or the blood-tolerant OmniTaq 2 (DNA Polymerase Technology, Inc.), using the manufacturer's mastermix, respectively, and 5 U per reaction of GoScript® Moloney Murine Leukemia virus reverse transcriptase (Promega).

    Article Title: Insulin-like growth factor 1 gene (CA)n repeats and a variable number of tandem repeats of the insulin gene in Brazilian children born small for gestational age
    Article Snippet: The INS VNTR polymorphisms were analyzed by PCR and enzymatic digestion. .. A 360 bp region containing this polymorphism was amplified using 200 ng of genomic DNA, 2.5 U of Taq DNA polymerase (Promega ®), 6.7 mM MgCl2 , 200 μM dNTP, 200 ng of the INS VNTR-specific primers sense 5 ′AGCAGGTCTGTTCCAAGG 3′ and antisense-INS VNTR 5 ′CTTGGGTGTGTAGAAGAAGC 3′ and 2.5 U of Taq DNA polymerase (Promega ®), in a final volume of 50 μL.

    Article Title: 7-Deaza-2`-deoxyguanosine allows PCR and sequencing reactions from CpG islands
    Article Snippet: The PCR mixtures contained 1× PCR buffer (Taq polymerase: 50mM KCl, 100mM Tris/HCl, pH 9.0, 0.1% (vol/vol) Triton-X 100, or AmpliTaq Gold polymerase: PCR Gold buffer (Applied Biosystems, Weiterstadt, Germany)), 1.5mM (p16INK4A ) or 2.0mM (HUMARA) magnesium chloride, 200μM dNTP mix (both) or deaza-mix (deaza-dGTP instead of dGTP), 10 pmol of each primer (p16INK4A WT , HUMARA ), 1 U Taq polymerase (Promega, Heidelberg, Germany) or for hot start PCR AmpliTaq Gold (Applied Biosystems) and 50 ng template (p16INK4A , SW1116; HUMARA, ARH77) in a final volume of 25 μl. .. The following PCR cycle profiles were used. p16INK4A : five minutes (Taq polymerase) or 12 minutes (AmpliTaq Gold) at 94°C; 35 cycles of 20 seconds at 94°C, 20 seconds at 65°C, and 20 seconds at 72°C; followed by two minutes at 72°C. .. HUMARA: five minutes (Taq polymerase) or 12 minutes (AmpliTaq Gold) at 94°C; 35 cycles of 20 seconds at 94°C, 20 seconds at 63.6°C, one minute at 65°C; followed by six minutes at 72°C on a Hybaid MBS 0.25 PCR machine (Hybaid, Heidelberg, Germany).

    Article Title: Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse
    Article Snippet: The sequences for F1 and R1 are based on sequences from the BAC clone characterized in Figure while the sequence of F2 is from the IAP element (reference [ ]). .. These three primers were used for genomic PCR with Taq DNA polymerase (Promega). .. All of the resulting PCR products were cloned into pCRII-TOPO (Invitrogen, Carlsbad, CA) and sequenced as above.

    Article Title: Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection
    Article Snippet: The DNA quality was verified by electrophoresis on 1% agarose gel and quantified using a spectrophotometer. .. Polymerase chain reaction (PCR) amplification was made using 40 ng of DNA and Master Mix (Promega), with the following concentrations: 0.2 mmol/L dNTPs, 1.5 mmol/L MgCl2 , 0.03 μ/μL Taq DNA polymerase (Promega), and 1 μmol/L for primers (forward and reverse), respectively. .. Thermal cycling conditions were found by BIOER thermocycler for 10 primers referred (Zhang et al. ) those which are on a range of 400–900 bp: bch6 , 21ba , ugp-ase , ans , ct-203 , chi , and gp-24 and the following conditions: 3 min denaturation at 95°C, 1 min annealing in the range of 48–57°C and 1 min, 30 sec extension at 72°C, and the number of cycles was between 30 and 33.

    Article Title: Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse
    Article Snippet: The reverse Transcription System (Promega) coupled with Taq DNA Polymerase (Promega) was used for RT-PCR. .. Degenerative PCR was carried out using Taq DNA Polymerase (Promega) with 5'-GATGGGAAAC(A/G)GCACCAG(C/T)(A/C)GAC-3' and 5'-GC(G/C)AG(A/G)ATGTTCCACTGCAT(G/C)AC-3' as forward and reverse primers respectively. .. The resulting PCR products were cloned into pCRII-TOPO and sequenced with an ABI Prism 310 sequencer.

    Article Title: Molecular Microbial Analysis of Lactobacillus Strains Isolated from the Gut of Calves for Potential Probiotic Use
    Article Snippet: DNA fragments of approximately 1.5 kpb were amplified using the primers 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-GGYTACCTTGTTACGACTT-3′). .. Each PCR tube (50 μ L) contained a reaction mix of 10 μ L 5X PCR buffer for Taq polymerase (Promega), 1.5 mM MgCl2 , 200 μ M of each deoxynucleotide triphosphate (Promega), 0.4 μ M of each primer and 2 U of Taq Polymerase (Promega) and 5 μ L of template DNA. .. The termocycle programme was as follows: 94°C for 5 minutes; 30 cycles of 94°C for 1 minute, 55°C for 1 minute and 72°C for 1 minute; and a final extension step at 72°C for 7 minute.

    Article Title: Intrastrain and interstrain genetic variation within a paralogous gene family in Chlamydia pneumoniae
    Article Snippet: Paragraph title: Examination of variation within isolates through cloning of PCR products ... Both Taq polymerase (Promega, Madison, WI) and Pwo polymerase (Roche Diagnostic Corporation, Indianapolis, IN) were used in these studies.

    Article Title: Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse
    Article Snippet: Paragraph title: 5' RACE and PCR reactions ... The reverse Transcription System (Promega) coupled with Taq DNA Polymerase (Promega) was used for RT-PCR.

    Article Title: Systematic Discovery of Complex Indels in Human Cancers
    Article Snippet: About 10 ngs of genomic DNA were used for amplifying the genomic region containing the complex indel. .. PCR (50ul) was done with Taq polymerase (Promega, Madison, WI, USA. .. Catalog number: M8298) following these cycling conditions: 95 °C-2 min; 35 cycles of 95 °C-30 min, 45–52 °C-30 min (Annealing temperature depends on Tm of primers used), 72 °C-1 min; 1 cycle of 72 °C-5 min. 10ul PCR products were separated on 2% agarose gel to check for the quality of the amplification.

    Article Title: 7-Deaza-2`-deoxyguanosine allows PCR and sequencing reactions from CpG islands
    Article Snippet: We amplified the human p16INK4A promoter (accession number ) and HUMARA exon 1 (accession number ) according to previously published methods. .. The PCR mixtures contained 1× PCR buffer (Taq polymerase: 50mM KCl, 100mM Tris/HCl, pH 9.0, 0.1% (vol/vol) Triton-X 100, or AmpliTaq Gold polymerase: PCR Gold buffer (Applied Biosystems, Weiterstadt, Germany)), 1.5mM (p16INK4A ) or 2.0mM (HUMARA) magnesium chloride, 200μM dNTP mix (both) or deaza-mix (deaza-dGTP instead of dGTP), 10 pmol of each primer (p16INK4A WT , HUMARA ), 1 U Taq polymerase (Promega, Heidelberg, Germany) or for hot start PCR AmpliTaq Gold (Applied Biosystems) and 50 ng template (p16INK4A , SW1116; HUMARA, ARH77) in a final volume of 25 μl. .. The following PCR cycle profiles were used. p16INK4A : five minutes (Taq polymerase) or 12 minutes (AmpliTaq Gold) at 94°C; 35 cycles of 20 seconds at 94°C, 20 seconds at 65°C, and 20 seconds at 72°C; followed by two minutes at 72°C.

    Article Title: CALHM1 ion channel mediates purinergic neurotransmission of sweet, bitter and umami tastes
    Article Snippet: One microgram of RNA was transcribed into cDNA using Invitrogen’s SuperScript III First-Strand Synthesis System for RT-PCR with random hexamers, according to the supplied protocol. .. A 50 μL PCR reaction was run with the following final concentrations: 450 ng of each primer (see for PCR primer sequences), 2 mM MgCl2 , 0.3 mM dNTPs, 2.5 U Taq polymerase (Promega GoFlex DNA polymerase) and 1 μL of 10 ng/μL DNA. .. PCR cycling conditions used for Calhm1 were: 95°C for 3 min; 35 cycles of 95°C for 30 sec, 65°C for 30 sec, and 72°C for 45 sec; 72°C for 7 min; 4°C (hold).

    Mouse Assay:

    Article Title: CALHM1 ion channel mediates purinergic neurotransmission of sweet, bitter and umami tastes
    Article Snippet: A 50 μL PCR reaction was run with the following final concentrations: 450 ng of each primer (see for PCR primer sequences), 2 mM MgCl2 , 0.3 mM dNTPs, 2.5 U Taq polymerase (Promega GoFlex DNA polymerase) and 1 μL of 10 ng/μL DNA. .. A 50 μL PCR reaction was run with the following final concentrations: 450 ng of each primer (see for PCR primer sequences), 2 mM MgCl2 , 0.3 mM dNTPs, 2.5 U Taq polymerase (Promega GoFlex DNA polymerase) and 1 μL of 10 ng/μL DNA.

    Plasmid Preparation:

    Article Title: Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse
    Article Snippet: BAC DNA was isolated by a Qiagen Plasmid Maxi Kit and sequenced using the ABI Prism 310. .. These three primers were used for genomic PCR with Taq DNA polymerase (Promega).

    Article Title: Intrastrain and interstrain genetic variation within a paralogous gene family in Chlamydia pneumoniae
    Article Snippet: Both Taq polymerase (Promega, Madison, WI) and Pwo polymerase (Roche Diagnostic Corporation, Indianapolis, IN) were used in these studies. .. Amplification products generated with Pwo polymerase were cloned using the Zeroblunt system, while products generated with Taq were cloned into pCRII (Invitrogen, Carlsbad, CA).

    Software:

    Article Title: Insulin-like growth factor 1 gene (CA)n repeats and a variable number of tandem repeats of the insulin gene in Brazilian children born small for gestational age
    Article Snippet: The forward primers were labeled with FAM, which is a fluorescent size marker, to determine the size of PCR products using an autosequencer (ABI Prism 3100 Genetic analyzer); this size determination was followed by analysis with GENESCAN Fragment Analysis software (Applied Biosystems, Foster City, CA, USA). .. A 360 bp region containing this polymorphism was amplified using 200 ng of genomic DNA, 2.5 U of Taq DNA polymerase (Promega ®), 6.7 mM MgCl2 , 200 μM dNTP, 200 ng of the INS VNTR-specific primers sense 5 ′AGCAGGTCTGTTCCAAGG 3′ and antisense-INS VNTR 5 ′CTTGGGTGTGTAGAAGAAGC 3′ and 2.5 U of Taq DNA polymerase (Promega ®), in a final volume of 50 μL.

    Hot Start PCR:

    Article Title: 7-Deaza-2`-deoxyguanosine allows PCR and sequencing reactions from CpG islands
    Article Snippet: We amplified the human p16INK4A promoter (accession number ) and HUMARA exon 1 (accession number ) according to previously published methods. .. The PCR mixtures contained 1× PCR buffer (Taq polymerase: 50mM KCl, 100mM Tris/HCl, pH 9.0, 0.1% (vol/vol) Triton-X 100, or AmpliTaq Gold polymerase: PCR Gold buffer (Applied Biosystems, Weiterstadt, Germany)), 1.5mM (p16INK4A ) or 2.0mM (HUMARA) magnesium chloride, 200μM dNTP mix (both) or deaza-mix (deaza-dGTP instead of dGTP), 10 pmol of each primer (p16INK4A WT , HUMARA ), 1 U Taq polymerase (Promega, Heidelberg, Germany) or for hot start PCR AmpliTaq Gold (Applied Biosystems) and 50 ng template (p16INK4A , SW1116; HUMARA, ARH77) in a final volume of 25 μl. .. The following PCR cycle profiles were used. p16INK4A : five minutes (Taq polymerase) or 12 minutes (AmpliTaq Gold) at 94°C; 35 cycles of 20 seconds at 94°C, 20 seconds at 65°C, and 20 seconds at 72°C; followed by two minutes at 72°C.

    Agarose Gel Electrophoresis:

    Article Title: Insulin-like growth factor 1 gene (CA)n repeats and a variable number of tandem repeats of the insulin gene in Brazilian children born small for gestational age
    Article Snippet: A 360 bp region containing this polymorphism was amplified using 200 ng of genomic DNA, 2.5 U of Taq DNA polymerase (Promega ®), 6.7 mM MgCl2 , 200 μM dNTP, 200 ng of the INS VNTR-specific primers sense 5 ′AGCAGGTCTGTTCCAAGG 3′ and antisense-INS VNTR 5 ′CTTGGGTGTGTAGAAGAAGC 3′ and 2.5 U of Taq DNA polymerase (Promega ®), in a final volume of 50 μL. .. A 360 bp region containing this polymorphism was amplified using 200 ng of genomic DNA, 2.5 U of Taq DNA polymerase (Promega ®), 6.7 mM MgCl2 , 200 μM dNTP, 200 ng of the INS VNTR-specific primers sense 5 ′AGCAGGTCTGTTCCAAGG 3′ and antisense-INS VNTR 5 ′CTTGGGTGTGTAGAAGAAGC 3′ and 2.5 U of Taq DNA polymerase (Promega ®), in a final volume of 50 μL.

    Article Title: Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection
    Article Snippet: Polymerase chain reaction (PCR) amplification was made using 40 ng of DNA and Master Mix (Promega), with the following concentrations: 0.2 mmol/L dNTPs, 1.5 mmol/L MgCl2 , 0.03 μ/μL Taq DNA polymerase (Promega), and 1 μmol/L for primers (forward and reverse), respectively. .. For primers in the range 1000–1600 bp: stan1 , chs , and zep , the conditions were 2 min denaturation at 95°C, 1 min annealing in the range 62–65°C and 1 min, 30 sec extension at 72°C, and 35 cycles.

    Article Title: Molecular Microbial Analysis of Lactobacillus Strains Isolated from the Gut of Calves for Potential Probiotic Use
    Article Snippet: Each PCR tube (50 μ L) contained a reaction mix of 10 μ L 5X PCR buffer for Taq polymerase (Promega), 1.5 mM MgCl2 , 200 μ M of each deoxynucleotide triphosphate (Promega), 0.4 μ M of each primer and 2 U of Taq Polymerase (Promega) and 5 μ L of template DNA. .. Each PCR tube (50 μ L) contained a reaction mix of 10 μ L 5X PCR buffer for Taq polymerase (Promega), 1.5 mM MgCl2 , 200 μ M of each deoxynucleotide triphosphate (Promega), 0.4 μ M of each primer and 2 U of Taq Polymerase (Promega) and 5 μ L of template DNA.

    Next-Generation Sequencing:

    Article Title: Systematic Discovery of Complex Indels in Human Cancers
    Article Snippet: About 10 ngs of genomic DNA were used for amplifying the genomic region containing the complex indel. .. PCR (50ul) was done with Taq polymerase (Promega, Madison, WI, USA.

    Laser Capture Microdissection:

    Article Title: CALHM1 ion channel mediates purinergic neurotransmission of sweet, bitter and umami tastes
    Article Snippet: Paragraph title: Laser capture microdissection, RNA amplification, and reverse transcriptase-PCR (RT-PCR) ... A 50 μL PCR reaction was run with the following final concentrations: 450 ng of each primer (see for PCR primer sequences), 2 mM MgCl2 , 0.3 mM dNTPs, 2.5 U Taq polymerase (Promega GoFlex DNA polymerase) and 1 μL of 10 ng/μL DNA.

    Concentration Assay:

    Article Title: Field-deployable, quantitative, rapid identification of active Ebola virus infection in unprocessed blood †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc03281a
    Article Snippet: We thus assembled one-step RT-qPCR reactions with a commercially available Taq polymerase (GoTaq® G2 Flex; Promega, Inc) or the blood-tolerant OmniTaq 2 (DNA Polymerase Technology, Inc.), using the manufacturer's mastermix, respectively, and 5 U per reaction of GoScript® Moloney Murine Leukemia virus reverse transcriptase (Promega). .. To our surprise, our results indicated that RT-PCR successfully proceeded in the presence of blood with no obvious differences between the hot-start, wild type Taq polymerase ( ) and the blood-adapted OmniTaq mutant ( ).

    BAC Assay:

    Article Title: Rhythmic expression of Nocturnin mRNA in multiple tissues of the mouse
    Article Snippet: The sequences for F1 and R1 are based on sequences from the BAC clone characterized in Figure while the sequence of F2 is from the IAP element (reference [ ]). .. These three primers were used for genomic PCR with Taq DNA polymerase (Promega).

    Marker:

    Article Title: Insulin-like growth factor 1 gene (CA)n repeats and a variable number of tandem repeats of the insulin gene in Brazilian children born small for gestational age
    Article Snippet: The forward primers were labeled with FAM, which is a fluorescent size marker, to determine the size of PCR products using an autosequencer (ABI Prism 3100 Genetic analyzer); this size determination was followed by analysis with GENESCAN Fragment Analysis software (Applied Biosystems, Foster City, CA, USA). .. A 360 bp region containing this polymorphism was amplified using 200 ng of genomic DNA, 2.5 U of Taq DNA polymerase (Promega ®), 6.7 mM MgCl2 , 200 μM dNTP, 200 ng of the INS VNTR-specific primers sense 5 ′AGCAGGTCTGTTCCAAGG 3′ and antisense-INS VNTR 5 ′CTTGGGTGTGTAGAAGAAGC 3′ and 2.5 U of Taq DNA polymerase (Promega ®), in a final volume of 50 μL.

    Article Title: Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection
    Article Snippet: Polymerase chain reaction (PCR) amplification was made using 40 ng of DNA and Master Mix (Promega), with the following concentrations: 0.2 mmol/L dNTPs, 1.5 mmol/L MgCl2 , 0.03 μ/μL Taq DNA polymerase (Promega), and 1 μmol/L for primers (forward and reverse), respectively. .. For primers in the range 1000–1600 bp: stan1 , chs , and zep , the conditions were 2 min denaturation at 95°C, 1 min annealing in the range 62–65°C and 1 min, 30 sec extension at 72°C, and 35 cycles.

    Staining:

    Article Title: Relating genes in the biosynthesis of the polyphenol composition of Andean colored potato collection
    Article Snippet: Polymerase chain reaction (PCR) amplification was made using 40 ng of DNA and Master Mix (Promega), with the following concentrations: 0.2 mmol/L dNTPs, 1.5 mmol/L MgCl2 , 0.03 μ/μL Taq DNA polymerase (Promega), and 1 μmol/L for primers (forward and reverse), respectively. .. For primers in the range 1000–1600 bp: stan1 , chs , and zep , the conditions were 2 min denaturation at 95°C, 1 min annealing in the range 62–65°C and 1 min, 30 sec extension at 72°C, and 35 cycles.

    Article Title: Molecular Microbial Analysis of Lactobacillus Strains Isolated from the Gut of Calves for Potential Probiotic Use
    Article Snippet: Each PCR tube (50 μ L) contained a reaction mix of 10 μ L 5X PCR buffer for Taq polymerase (Promega), 1.5 mM MgCl2 , 200 μ M of each deoxynucleotide triphosphate (Promega), 0.4 μ M of each primer and 2 U of Taq Polymerase (Promega) and 5 μ L of template DNA. .. Each PCR tube (50 μ L) contained a reaction mix of 10 μ L 5X PCR buffer for Taq polymerase (Promega), 1.5 mM MgCl2 , 200 μ M of each deoxynucleotide triphosphate (Promega), 0.4 μ M of each primer and 2 U of Taq Polymerase (Promega) and 5 μ L of template DNA.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78
    Promega taq polymerase
    Overcoming the dose-dependent inhibitory effect of blood on qRT-PCR. Increasing amounts of fresh, unprocessed human blood introduced into qRT-PCR reactions (0.0–5.0% v/v final blood concentration) result in comparable dose-dependent inhibition of FAM-labelled Taqman® probe-based RT-PCR fluorogenicity (amplification plateau) whether the <t>Promega</t> hot-start wild type <t>Taq</t> polymerase (a) or the blood-optimised OmniTaq 2 polymerase (b) is used in conjunction with an MMuLV reverse transcriptase to detect 4 × 10 8 copies of MS2 coliphage RNA. Reaction progression is reported for each of two technical replicates in relative fluorescence units (RFU) normalised to no template control (–ve c) against PCR cycle value. Far red/infrared fluorescent dyes (c) and dye–quencher combinations (d) were screened by spectrophotometry under 620 nm laser diode simulation for utility in blood-containing reactions. The impact of blood on dye fluorogenicity is expressed as the change (Δ F N ) in background-subtracted fluorescence emission (RFU) in the presence and absence of human blood (mean of two technical replicates). DDB: deep dark blue; VRH: Viridian Red High; VRL: Viridian Red Low; IWB: Iowa Black; BHQ: Black Hole Quencher.
    Taq Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerase/product/Promega
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    taq polymerase - by Bioz Stars, 2019-10
    78/100 stars
      Buy from Supplier

    99
    Promega pcr master mix
    Validation of multiplex <t>PCR</t> using individual and combined oligonucleotide primer sets and <t>DNA</t> extracts from mixed bacterial culture. Multiplex PCR was performed on DNA extracts from mixed bacterial cultures. DNA template was extracted using the modified DNAzol ® . (1) Non-pathogenic E. coli strain K-12 18s primers were used (171 bp); (2) MAP UCF4 IS900 AV1/AV2 primers were used (298 bp); (3) K. pneumoniae 23s primers were used (493 bp); (4) Mycobacterium avium complex (MAC) IS1311 primers were used (534 bp); (5) a cocktail of the 4 primer sets mentioned above were used. M: DNA molecular weight marker
    Pcr Master Mix, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 320 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr master mix/product/Promega
    Average 99 stars, based on 320 article reviews
    Price from $9.99 to $1999.99
    pcr master mix - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    99
    Promega pcr mix
    Amplification of bovine leukemia virus (BLV) genome regions in human breast tissue specimens. Nested liquid-phase <t>PCR,</t> using primers from 5 BLV genome regions, was used to amplify products from <t>DNA</t> extracted from breast tissues of 6 human donors. PCR products for each tissue were loaded into 1 well and separated by agarose gel (3.5%) electrophoresis on the basis of size differences: long terminal repeat, 290 bp; group-specific antigen, 272 bp; envelope, 230 bp; trans-activating gene of the X region, 206 bp; polymerase, 157 bp. The section below the white line shows the glyceraldehyde 3-phosphate dehydrogenase amplification of each sample as an indicator of DNA quality. Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA); lane 2, fetal lamb kidney cell line, positive control; lane 3, no-template-DNA negative control (water substituted for DNA template); lane 4, human sample 143; lane 5, human sample 236; lane 6, human sample 010; lane 7, human sample 20874; lane 8, human sample 23803; lane 9, human sample 0253.
    Pcr Mix, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr mix/product/Promega
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    pcr mix - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results


    Overcoming the dose-dependent inhibitory effect of blood on qRT-PCR. Increasing amounts of fresh, unprocessed human blood introduced into qRT-PCR reactions (0.0–5.0% v/v final blood concentration) result in comparable dose-dependent inhibition of FAM-labelled Taqman® probe-based RT-PCR fluorogenicity (amplification plateau) whether the Promega hot-start wild type Taq polymerase (a) or the blood-optimised OmniTaq 2 polymerase (b) is used in conjunction with an MMuLV reverse transcriptase to detect 4 × 10 8 copies of MS2 coliphage RNA. Reaction progression is reported for each of two technical replicates in relative fluorescence units (RFU) normalised to no template control (–ve c) against PCR cycle value. Far red/infrared fluorescent dyes (c) and dye–quencher combinations (d) were screened by spectrophotometry under 620 nm laser diode simulation for utility in blood-containing reactions. The impact of blood on dye fluorogenicity is expressed as the change (Δ F N ) in background-subtracted fluorescence emission (RFU) in the presence and absence of human blood (mean of two technical replicates). DDB: deep dark blue; VRH: Viridian Red High; VRL: Viridian Red Low; IWB: Iowa Black; BHQ: Black Hole Quencher.

    Journal: Chemical Science

    Article Title: Field-deployable, quantitative, rapid identification of active Ebola virus infection in unprocessed blood †Electronic supplementary information (ESI) available. See DOI: 10.1039/c7sc03281a

    doi: 10.1039/c7sc03281a

    Figure Lengend Snippet: Overcoming the dose-dependent inhibitory effect of blood on qRT-PCR. Increasing amounts of fresh, unprocessed human blood introduced into qRT-PCR reactions (0.0–5.0% v/v final blood concentration) result in comparable dose-dependent inhibition of FAM-labelled Taqman® probe-based RT-PCR fluorogenicity (amplification plateau) whether the Promega hot-start wild type Taq polymerase (a) or the blood-optimised OmniTaq 2 polymerase (b) is used in conjunction with an MMuLV reverse transcriptase to detect 4 × 10 8 copies of MS2 coliphage RNA. Reaction progression is reported for each of two technical replicates in relative fluorescence units (RFU) normalised to no template control (–ve c) against PCR cycle value. Far red/infrared fluorescent dyes (c) and dye–quencher combinations (d) were screened by spectrophotometry under 620 nm laser diode simulation for utility in blood-containing reactions. The impact of blood on dye fluorogenicity is expressed as the change (Δ F N ) in background-subtracted fluorescence emission (RFU) in the presence and absence of human blood (mean of two technical replicates). DDB: deep dark blue; VRH: Viridian Red High; VRL: Viridian Red Low; IWB: Iowa Black; BHQ: Black Hole Quencher.

    Article Snippet: We thus assembled one-step RT-qPCR reactions with a commercially available Taq polymerase (GoTaq® G2 Flex; Promega, Inc) or the blood-tolerant OmniTaq 2 (DNA Polymerase Technology, Inc.), using the manufacturer's mastermix, respectively, and 5 U per reaction of GoScript® Moloney Murine Leukemia virus reverse transcriptase (Promega).

    Techniques: Quantitative RT-PCR, Concentration Assay, Inhibition, Reverse Transcription Polymerase Chain Reaction, Amplification, Fluorescence, Polymerase Chain Reaction, Spectrophotometry

    Validation of multiplex PCR using individual and combined oligonucleotide primer sets and DNA extracts from mixed bacterial culture. Multiplex PCR was performed on DNA extracts from mixed bacterial cultures. DNA template was extracted using the modified DNAzol ® . (1) Non-pathogenic E. coli strain K-12 18s primers were used (171 bp); (2) MAP UCF4 IS900 AV1/AV2 primers were used (298 bp); (3) K. pneumoniae 23s primers were used (493 bp); (4) Mycobacterium avium complex (MAC) IS1311 primers were used (534 bp); (5) a cocktail of the 4 primer sets mentioned above were used. M: DNA molecular weight marker

    Journal: Gut Pathogens

    Article Title: Development of multiplex PCR and multi-color fluorescent in situ hybridization (m-FISH) coupled protocol for detection and imaging of multi-pathogens involved in inflammatory bowel disease

    doi: 10.1186/s13099-018-0278-1

    Figure Lengend Snippet: Validation of multiplex PCR using individual and combined oligonucleotide primer sets and DNA extracts from mixed bacterial culture. Multiplex PCR was performed on DNA extracts from mixed bacterial cultures. DNA template was extracted using the modified DNAzol ® . (1) Non-pathogenic E. coli strain K-12 18s primers were used (171 bp); (2) MAP UCF4 IS900 AV1/AV2 primers were used (298 bp); (3) K. pneumoniae 23s primers were used (493 bp); (4) Mycobacterium avium complex (MAC) IS1311 primers were used (534 bp); (5) a cocktail of the 4 primer sets mentioned above were used. M: DNA molecular weight marker

    Article Snippet: Briefly, 10 μL of DNA containing 17 ng/μL of bacterial DNA or 50 ng/μL tissue DNA were added into a 200 μL-microcentrifuge tube containing 25 μL of PCR Master Mix (2× solution containing Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers, Promega©), 5 μL of betaine (Sigma-Aldrich©), and 1 μL of each oligonucleotide primer (10 μM forward and 10 μM reverse primer for each bacterial species (MAP, MAC, non-pathogenic E. coli strain K-12, AIEC strain LF82, and K. pneumoniae ).

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Modification, Molecular Weight, Marker

    Validation of multiplex PCR using individual and combined oligonucleotide primer sets and DNA extracts from IBD tissue. Multiplex PCR was performed on DNA extracts from intestinal tissue samples. DNA template was extracted using the modified DNAzol ® . RS1: ulcerative colitis (UC) patient; RS2: Crohn’s disease (CD) patient; (1) Non-pathogenic E. coli strain K-12 18s primers were used (171 bp); (2) MAP UCF4 IS900 AV1/AV2 primers were used (298 bp); (3) AIEC strain LF82 g ipA primers were used (357 bp); (4) K. pneumoniae 23s primers were used (493 bp); (5) Mycobacterium avium complex (MAC) IS1311 primers were used (534 bp); (6) a cocktail of the 5 primer sets mentioned above were used. M: DNA molecular weight marker

    Journal: Gut Pathogens

    Article Title: Development of multiplex PCR and multi-color fluorescent in situ hybridization (m-FISH) coupled protocol for detection and imaging of multi-pathogens involved in inflammatory bowel disease

    doi: 10.1186/s13099-018-0278-1

    Figure Lengend Snippet: Validation of multiplex PCR using individual and combined oligonucleotide primer sets and DNA extracts from IBD tissue. Multiplex PCR was performed on DNA extracts from intestinal tissue samples. DNA template was extracted using the modified DNAzol ® . RS1: ulcerative colitis (UC) patient; RS2: Crohn’s disease (CD) patient; (1) Non-pathogenic E. coli strain K-12 18s primers were used (171 bp); (2) MAP UCF4 IS900 AV1/AV2 primers were used (298 bp); (3) AIEC strain LF82 g ipA primers were used (357 bp); (4) K. pneumoniae 23s primers were used (493 bp); (5) Mycobacterium avium complex (MAC) IS1311 primers were used (534 bp); (6) a cocktail of the 5 primer sets mentioned above were used. M: DNA molecular weight marker

    Article Snippet: Briefly, 10 μL of DNA containing 17 ng/μL of bacterial DNA or 50 ng/μL tissue DNA were added into a 200 μL-microcentrifuge tube containing 25 μL of PCR Master Mix (2× solution containing Taq DNA polymerase, dNTPs, MgCl2 and reaction buffers, Promega©), 5 μL of betaine (Sigma-Aldrich©), and 1 μL of each oligonucleotide primer (10 μM forward and 10 μM reverse primer for each bacterial species (MAP, MAC, non-pathogenic E. coli strain K-12, AIEC strain LF82, and K. pneumoniae ).

    Techniques: Multiplex Assay, Polymerase Chain Reaction, Modification, Indirect Immunoperoxidase Assay, Molecular Weight, Marker

    PCR-DGGE profiles representing the succession in the bacterial community structure, as well as the monitoring during the time course experiment of M. xanthus on decayed calcarenite. DNA was directly extracted from non-treated ( D ) and treated ( TD ) stone slabs, as well as from aliquots taken from the culture medium of treated samples during the time course experiment, and subsequently amplified with the 16S rRNA primers pair 341f/907r. The description for lane numbers and for b are as indicated for Fig. 1

    Journal: Microbial Ecology

    Article Title: Bacterial Community Dynamics During the Application of a Myxococcus xanthus-Inoculated Culture Medium Used for Consolidation of Ornamental Limestone

    doi: 10.1007/s00248-010-9661-2

    Figure Lengend Snippet: PCR-DGGE profiles representing the succession in the bacterial community structure, as well as the monitoring during the time course experiment of M. xanthus on decayed calcarenite. DNA was directly extracted from non-treated ( D ) and treated ( TD ) stone slabs, as well as from aliquots taken from the culture medium of treated samples during the time course experiment, and subsequently amplified with the 16S rRNA primers pair 341f/907r. The description for lane numbers and for b are as indicated for Fig. 1

    Article Snippet: For PCR analysis, 2× PCR Master Mix (Promega; 50 U ml−1 of Taq DNA polymerase supplied in a proprietary reaction buffer (pH 8.5), 400 µM dATP, 400 µM dGTP, 400 µM dCTP, 400 µM dTTP, 3 mM MgCl2) was diluted as recommended by the manufacturers, and 12.5 pmol of each primer was added.

    Techniques: Polymerase Chain Reaction, Denaturing Gradient Gel Electrophoresis, Amplification

    PCR-DGGE profiles representing the succession in the bacterial community structure, as well as the monitoring during the time course experiment of M. xanthus on quarry calcarenite. DNA was directly extracted from non-treated ( Q ) and treated ( TQ ) stone slabs, as well as from aliquots taken from the culture medium of treated samples during the time course experiment, and subsequently amplified with the 16S rRNA primers pair 341f/907r. Numbers of lanes indicate sampling days. Lane M , marker of M. xanthus . DGGE-bands identified from the 16S rDNA clone libraries are numbered and are indicated by arrowheads . These bands are described in the b . Closest relative, as determined by comparative sequence analysis, level of identity with this relative, clone designation, and accession number for each band are summarized in b

    Journal: Microbial Ecology

    Article Title: Bacterial Community Dynamics During the Application of a Myxococcus xanthus-Inoculated Culture Medium Used for Consolidation of Ornamental Limestone

    doi: 10.1007/s00248-010-9661-2

    Figure Lengend Snippet: PCR-DGGE profiles representing the succession in the bacterial community structure, as well as the monitoring during the time course experiment of M. xanthus on quarry calcarenite. DNA was directly extracted from non-treated ( Q ) and treated ( TQ ) stone slabs, as well as from aliquots taken from the culture medium of treated samples during the time course experiment, and subsequently amplified with the 16S rRNA primers pair 341f/907r. Numbers of lanes indicate sampling days. Lane M , marker of M. xanthus . DGGE-bands identified from the 16S rDNA clone libraries are numbered and are indicated by arrowheads . These bands are described in the b . Closest relative, as determined by comparative sequence analysis, level of identity with this relative, clone designation, and accession number for each band are summarized in b

    Article Snippet: For PCR analysis, 2× PCR Master Mix (Promega; 50 U ml−1 of Taq DNA polymerase supplied in a proprietary reaction buffer (pH 8.5), 400 µM dATP, 400 µM dGTP, 400 µM dCTP, 400 µM dTTP, 3 mM MgCl2) was diluted as recommended by the manufacturers, and 12.5 pmol of each primer was added.

    Techniques: Polymerase Chain Reaction, Denaturing Gradient Gel Electrophoresis, Amplification, Sampling, Marker, Sequencing

    Amplification of bovine leukemia virus (BLV) genome regions in human breast tissue specimens. Nested liquid-phase PCR, using primers from 5 BLV genome regions, was used to amplify products from DNA extracted from breast tissues of 6 human donors. PCR products for each tissue were loaded into 1 well and separated by agarose gel (3.5%) electrophoresis on the basis of size differences: long terminal repeat, 290 bp; group-specific antigen, 272 bp; envelope, 230 bp; trans-activating gene of the X region, 206 bp; polymerase, 157 bp. The section below the white line shows the glyceraldehyde 3-phosphate dehydrogenase amplification of each sample as an indicator of DNA quality. Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA); lane 2, fetal lamb kidney cell line, positive control; lane 3, no-template-DNA negative control (water substituted for DNA template); lane 4, human sample 143; lane 5, human sample 236; lane 6, human sample 010; lane 7, human sample 20874; lane 8, human sample 23803; lane 9, human sample 0253.

    Journal: Emerging Infectious Diseases

    Article Title: Bovine Leukemia Virus DNA in Human Breast Tissue

    doi: 10.3201/eid2005.131298

    Figure Lengend Snippet: Amplification of bovine leukemia virus (BLV) genome regions in human breast tissue specimens. Nested liquid-phase PCR, using primers from 5 BLV genome regions, was used to amplify products from DNA extracted from breast tissues of 6 human donors. PCR products for each tissue were loaded into 1 well and separated by agarose gel (3.5%) electrophoresis on the basis of size differences: long terminal repeat, 290 bp; group-specific antigen, 272 bp; envelope, 230 bp; trans-activating gene of the X region, 206 bp; polymerase, 157 bp. The section below the white line shows the glyceraldehyde 3-phosphate dehydrogenase amplification of each sample as an indicator of DNA quality. Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA); lane 2, fetal lamb kidney cell line, positive control; lane 3, no-template-DNA negative control (water substituted for DNA template); lane 4, human sample 143; lane 5, human sample 236; lane 6, human sample 010; lane 7, human sample 20874; lane 8, human sample 23803; lane 9, human sample 0253.

    Article Snippet: For nested L-PCR, extracted DNA (0.85 µg) was added to 50 μL of PCR mix (2.0 mmol/L MgCl2 , 0.2 mmol/L dNTPs, 0.025 U/µL Taq polymerase [all from Promega, Madison, WI, USA], and 0.2 μmol/L outer primers for each BLV gene [ ]) in Hot Start Micro 50 tubes (MolecularBio Products, San Diego, CA, USA).

    Techniques: Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Electrophoresis, Molecular Weight, Marker, Positive Control, Negative Control

    Test results showing lack of cross - reactivity of bovine leukemia virus (BLV)–specific primers with representatives of all mammalian and avian retrovirus subfamilies and human exogenous and endogenous viruses previously identified in human breast tissue. Nested liquid-phase PCR used primers from 5 BLV genome regions with template DNA from the viruses in lanes 4–10 and 12–21. PCR products for each virus, loaded into 1 well, were separated by agarose gel (1.5%) electrophoresis on the basis of size differences. Amplicons were generated only for known BLV-positive cell lines (FLK and Bat 2 Cl 6 ). Samples in lanes 13–21 were run simultaneously in the same gel in wells below samples in lanes 4–12. The section below the white line shows glyceraldehyde 3-phosphate dehydrogenase (GAPDH) amplification of each sample to indicate DNA quality. Human GAPDH primers were used for human, rhesus monkey, baboon, and bat cell lines (amplicon = 237 bp); murine GAPDH for mouse and rat cell lines (796 bp); and bovine GAPDH for bovine, ovine, and feline cell lines (857 bp). Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA), lane 2, fetal lamb kidney cell line, positive control; lane 3, water substituted for DNA template, negative control; lane 4, Rous sarcoma virus; lane 5, murine sarcoma virus; lane 6, mouse mammary tumor virus; lane 7, Mason-Pfizer monkey virus; lane 8, murine leukemia virus; lane 9, feline leukemia virus; lane 10, BLV Bat 2 Cl 6 ; lane 11, Tb 1 Lu (known BLV-negative cell line), negative control; lane 12, simian T-cell leukemia virus; lane 13, human T-cell leukemia virus 1; lane 14, human T-cell leukemia virus 2; lane 15, HIV-1; lane 16, HIV-2; lane 17, human papillomavirus 16; lane 18, human papillomavirus 18; lane 19, Epstein-Barr virus; lane 20, human endogenous retrovirus K; lane 21, env of human endogenous retrovirus K.

    Journal: Emerging Infectious Diseases

    Article Title: Bovine Leukemia Virus DNA in Human Breast Tissue

    doi: 10.3201/eid2005.131298

    Figure Lengend Snippet: Test results showing lack of cross - reactivity of bovine leukemia virus (BLV)–specific primers with representatives of all mammalian and avian retrovirus subfamilies and human exogenous and endogenous viruses previously identified in human breast tissue. Nested liquid-phase PCR used primers from 5 BLV genome regions with template DNA from the viruses in lanes 4–10 and 12–21. PCR products for each virus, loaded into 1 well, were separated by agarose gel (1.5%) electrophoresis on the basis of size differences. Amplicons were generated only for known BLV-positive cell lines (FLK and Bat 2 Cl 6 ). Samples in lanes 13–21 were run simultaneously in the same gel in wells below samples in lanes 4–12. The section below the white line shows glyceraldehyde 3-phosphate dehydrogenase (GAPDH) amplification of each sample to indicate DNA quality. Human GAPDH primers were used for human, rhesus monkey, baboon, and bat cell lines (amplicon = 237 bp); murine GAPDH for mouse and rat cell lines (796 bp); and bovine GAPDH for bovine, ovine, and feline cell lines (857 bp). Lane 1, molecular weight marker (HyperLadder IV; Bioline, Taunton, MA, USA), lane 2, fetal lamb kidney cell line, positive control; lane 3, water substituted for DNA template, negative control; lane 4, Rous sarcoma virus; lane 5, murine sarcoma virus; lane 6, mouse mammary tumor virus; lane 7, Mason-Pfizer monkey virus; lane 8, murine leukemia virus; lane 9, feline leukemia virus; lane 10, BLV Bat 2 Cl 6 ; lane 11, Tb 1 Lu (known BLV-negative cell line), negative control; lane 12, simian T-cell leukemia virus; lane 13, human T-cell leukemia virus 1; lane 14, human T-cell leukemia virus 2; lane 15, HIV-1; lane 16, HIV-2; lane 17, human papillomavirus 16; lane 18, human papillomavirus 18; lane 19, Epstein-Barr virus; lane 20, human endogenous retrovirus K; lane 21, env of human endogenous retrovirus K.

    Article Snippet: For nested L-PCR, extracted DNA (0.85 µg) was added to 50 μL of PCR mix (2.0 mmol/L MgCl2 , 0.2 mmol/L dNTPs, 0.025 U/µL Taq polymerase [all from Promega, Madison, WI, USA], and 0.2 μmol/L outer primers for each BLV gene [ ]) in Hot Start Micro 50 tubes (MolecularBio Products, San Diego, CA, USA).

    Techniques: Polymerase Chain Reaction, Agarose Gel Electrophoresis, Electrophoresis, Generated, Amplification, Molecular Weight, Marker, Positive Control, Negative Control