taq dna polymerase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs taq dna polymerase
    Taq Dna Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 486 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/New England Biolabs
    Average 99 stars, based on 486 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Pseudomonas aeruginosa isolates from dental unit waterlines can be divided in two distinct groups, including one displaying phenotypes similar to isolates from cystic fibrosis patients
    Article Snippet: Paragraph title: CLONING THE 600-bp BAND SPECIFIC FOR CLUSTER III ISOLATES ... Taq polymerase and standard buffer (M0273L; NEB) were used.

    Article Title: Bacterial Diversity Associated with the Coccolithophorid Algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii
    Article Snippet: The PCR reaction contained a final concentration of 1.8 mM Mg2+ , 0.5 µ M of each primer, 1 U Taq polymerase and 1x PCR buffer (New England Biolabs). .. The amplification protocol was 94°C for 5 min, followed by 20 cycles of 55°C for 30 s, 72°C for 3 min, and 94°C for 10 s, followed by 72°C for 10 min. For each coccolithophore culture, the amplicons from three independent 50 μ L PCR reactions were pooled and purified with Montage PCR filters (Millipore) and then cloned using the pGEM-T Easy vector kit (Promega).

    Article Title: Nucleolar localization of non-structural protein 3b, a protein specifically encoded by the severe acute respiratory syndrome coronavirus.
    Article Snippet: Construction of p3b-EGFP, pEGFP-3b, serial of truncated 3b protein and pC23-DsRed, pB23-DsRed, pfibrillarin-DsRed The 3b used for this study was PCR amplified from SARS-CoV (ZJ01, AY297028) genome by using Taq DNA polymerase (NEB). .. This product was cut with XhoI and EcoRI, and the obtained gene was cloned into multiple cloning site (MCS) of pEGFP-N1 vector (Clontech), producing a p3b-EGFP plasmid.

    Centrifugation:

    Article Title: Bacterial Diversity Associated with the Coccolithophorid Algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii
    Article Snippet: Bacterial and algal cells were harvested by centrifugation (13,000 ×g for 10 min), the spent medium discarded and the cell pellets stored frozen at −80°C until DNA was extracted. .. The PCR reaction contained a final concentration of 1.8 mM Mg2+ , 0.5 µ M of each primer, 1 U Taq polymerase and 1x PCR buffer (New England Biolabs).

    Amplification:

    Article Title: Pseudomonas aeruginosa isolates from dental unit waterlines can be divided in two distinct groups, including one displaying phenotypes similar to isolates from cystic fibrosis patients
    Article Snippet: CLONING THE 600-bp BAND SPECIFIC FOR CLUSTER III ISOLATES Random amplified polymorphic DNA using primer OPA-10 was performed on PPF 2 and PPF 7 (cluster III) with parameters identical to those described above, with the following differences. .. Taq polymerase and standard buffer (M0273L; NEB) were used.

    Article Title: Bacterial Diversity Associated with the Coccolithophorid Algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii
    Article Snippet: DNA extraction used a cetyltrimethylammonium bromide purification method [ ] amended to suspend the cell pellet in 100 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 10 mM EDTA, to which lysozyme (5 mg mL−1 final concentration) was then added and incubated at 37°C for 30 min. Bacterial 16S rRNA gene sequences were amplified by the PCR from extracted DNA based on the universal bacterial primers 27f and 1492r [ ], except that 27f primer was modified to include the underlined 5′ adapter sequence (27f adapter; CTAATACGACTCAGCTATGCACT AGRGTTTGATCMTGGCTCAG). .. The PCR reaction contained a final concentration of 1.8 mM Mg2+ , 0.5 µ M of each primer, 1 U Taq polymerase and 1x PCR buffer (New England Biolabs).

    Article Title: Genes but Not Genomes Reveal Bacterial Domestication of Lactococcus Lactis
    Article Snippet: Internal fragments of each of the six loci, pepXP (X-prolyl-dipeptidyl aminopeptidase), recN (ATPase involved in DNA repair), pdp (pyrimidine-nucleoside phosphorylase), pgk (phosphoglycerate kinase), glyA (serine hydroxymethyltransferase), and bcaT (branched-chain-amino-acid aminotransferase), were amplified and double-strand sequenced (Eurofins MWG operon, Ebersberg, Germany) using the primers listed in (Supporting Information). .. PCR conditions were: initial denaturation at 94°C for 3 min; 30 cycles at 94°C for 45 s, 55°C for 1 min, 72°C for 1 min using a MJ Mini thermocycler (Bio-Rad, Hercules, USA) in a 50 µl-mixture containing 10 ng of genomic DNA, 200 µM of each dNTP, 0.2 µM of each primer, 2.5 U Taq polymerase in 1x thermopol buffer (New England Biolabs).

    Article Title: Nucleolar localization of non-structural protein 3b, a protein specifically encoded by the severe acute respiratory syndrome coronavirus.
    Article Snippet: .. Construction of p3b-EGFP, pEGFP-3b, serial of truncated 3b protein and pC23-DsRed, pB23-DsRed, pfibrillarin-DsRed The 3b used for this study was PCR amplified from SARS-CoV (ZJ01, AY297028) genome by using Taq DNA polymerase (NEB). .. PCR was performed with a forward primer (containing an XhoI site) and a reverse primer (containing an EcoRI site) complementary to the 3 end of 3b without stop codon to allow for reading-through.

    Article Title: Diversity of Beta-Propeller Phytase Genes in the Intestinal Contents of Grass Carp Provides Insight into the Release of Major Phosphorus from Phytate in Nature ▿
    Article Snippet: Briefly, the template DNA (∼50 to 100 ng) was added to a 50-μl reaction mixture containing 2.5 U Taq polymerase, 0.2 mM deoxynucleoside triphosphates, 1 mM of each primer, and 2 mM Mg2+ in the buffer supplied by the manufacturer (New England Biolabs, United States). .. The presence and size of amplification products were determined on agarose gels.

    Article Title: POPULATION GENETIC DATA SUGGEST A ROLE FOR MOSQUITO-MEDIATED DISPERSAL OF WEST NILE VIRUS ACROSS THE WESTERN UNITED STATES
    Article Snippet: Paragraph title: Microsatellite amplification and fragment size determination ... PCR was conducted in 10 μL reactions containing 0.8 units Taq polymerase, 1.0 μL 10X ThermoPol buffer (New England Biolabs, Ipswich, MA, U.S.A.), 0.2 mm each dNTP, 1 μm each microsatellite-specific primer (using the 5’ M13-tagged forward primer), 0.5 μm 5 ’ -fluorescently labeled M13 (uni-43) and 0.5 μL template DNA.

    Article Title: Regulation of Therapeutic Hypothermia on Inflammatory Cytokines, Microglia Polarization, Migration and Functional Recovery after Ischemic Stroke in Mice
    Article Snippet: .. RT product (1 µl) was subjected to PCR amplification with 10 pmole primer, 10X standard Taq reaction buffer, 10 mM dNTP, and 0.625 unit Taq polymerase in 20 µl PCR reaction buffer (#M0273L, #N0447S, #B9014S; New England Biolabs Inc., Ipswich, MA, USA). .. PCR primers were used as shown in and in our previous study ( ; ).

    Synthesized:

    Article Title: Combinatorial Effects of Transposable Elements on Gene Expression and Phenotypic Robustness in Drosophila melanogaster Development
    Article Snippet: Quantitative real-time (RT)-PCR, sequencing, and 5′ rapid amplication of cDNA ends (5′ RACE) RNA was prepared using Trizol (Ambion) or RNeasy kit (QIAGEN) from embryos (0−1.5 hr after fertilization) or adult males (2−5 days after eclosion), and first-strand cDNA was synthesized with the SuperScript II kit (Invitrogen). .. Taq Polymerase with ThermoPol buffer (NEB) and Expand HF kit (Roche) were used to amplify the tube transcript region and flanking regions for sequencing.

    Quantitative RT-PCR:

    Article Title: Combinatorial Effects of Transposable Elements on Gene Expression and Phenotypic Robustness in Drosophila melanogaster Development
    Article Snippet: Paragraph title: Quantitative real-time (RT)-PCR, sequencing, and 5′ rapid amplication of cDNA ends (5′ RACE) ... Taq Polymerase with ThermoPol buffer (NEB) and Expand HF kit (Roche) were used to amplify the tube transcript region and flanking regions for sequencing.

    SYBR Green Assay:

    Article Title: Combinatorial Effects of Transposable Elements on Gene Expression and Phenotypic Robustness in Drosophila melanogaster Development
    Article Snippet: Quantitative RT-PCR was performed on an iQ5 cycler (BioRad) using iQ SYBR Green Supermix (BioRad). .. Taq Polymerase with ThermoPol buffer (NEB) and Expand HF kit (Roche) were used to amplify the tube transcript region and flanking regions for sequencing.

    Incubation:

    Article Title: Bacterial Diversity Associated with the Coccolithophorid Algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii
    Article Snippet: DNA extraction used a cetyltrimethylammonium bromide purification method [ ] amended to suspend the cell pellet in 100 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 10 mM EDTA, to which lysozyme (5 mg mL−1 final concentration) was then added and incubated at 37°C for 30 min. Bacterial 16S rRNA gene sequences were amplified by the PCR from extracted DNA based on the universal bacterial primers 27f and 1492r [ ], except that 27f primer was modified to include the underlined 5′ adapter sequence (27f adapter; CTAATACGACTCAGCTATGCACT AGRGTTTGATCMTGGCTCAG). .. The PCR reaction contained a final concentration of 1.8 mM Mg2+ , 0.5 µ M of each primer, 1 U Taq polymerase and 1x PCR buffer (New England Biolabs).

    Article Title: Regulation of Therapeutic Hypothermia on Inflammatory Cytokines, Microglia Polarization, Migration and Functional Recovery after Ischemic Stroke in Mice
    Article Snippet: The RNA samples were reverse transcribed in 20 µl at 37°C for 60 min then incubated at 95°C for 5 min and transferred to 4°C. .. RT product (1 µl) was subjected to PCR amplification with 10 pmole primer, 10X standard Taq reaction buffer, 10 mM dNTP, and 0.625 unit Taq polymerase in 20 µl PCR reaction buffer (#M0273L, #N0447S, #B9014S; New England Biolabs Inc., Ipswich, MA, USA).

    Modification:

    Article Title: Bacterial Diversity Associated with the Coccolithophorid Algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii
    Article Snippet: DNA extraction used a cetyltrimethylammonium bromide purification method [ ] amended to suspend the cell pellet in 100 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 10 mM EDTA, to which lysozyme (5 mg mL−1 final concentration) was then added and incubated at 37°C for 30 min. Bacterial 16S rRNA gene sequences were amplified by the PCR from extracted DNA based on the universal bacterial primers 27f and 1492r [ ], except that 27f primer was modified to include the underlined 5′ adapter sequence (27f adapter; CTAATACGACTCAGCTATGCACT AGRGTTTGATCMTGGCTCAG). .. The PCR reaction contained a final concentration of 1.8 mM Mg2+ , 0.5 µ M of each primer, 1 U Taq polymerase and 1x PCR buffer (New England Biolabs).

    Sequencing:

    Article Title: Combinatorial Effects of Transposable Elements on Gene Expression and Phenotypic Robustness in Drosophila melanogaster Development
    Article Snippet: .. Taq Polymerase with ThermoPol buffer (NEB) and Expand HF kit (Roche) were used to amplify the tube transcript region and flanking regions for sequencing. .. Thermal asymmetric-interlaced (TAIL)-PCR was conducted essentially as described previously , except Phusion (NEB) was used as the polymerase.

    Article Title: Bacterial Diversity Associated with the Coccolithophorid Algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii
    Article Snippet: DNA extraction used a cetyltrimethylammonium bromide purification method [ ] amended to suspend the cell pellet in 100 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 10 mM EDTA, to which lysozyme (5 mg mL−1 final concentration) was then added and incubated at 37°C for 30 min. Bacterial 16S rRNA gene sequences were amplified by the PCR from extracted DNA based on the universal bacterial primers 27f and 1492r [ ], except that 27f primer was modified to include the underlined 5′ adapter sequence (27f adapter; CTAATACGACTCAGCTATGCACT AGRGTTTGATCMTGGCTCAG). .. The PCR reaction contained a final concentration of 1.8 mM Mg2+ , 0.5 µ M of each primer, 1 U Taq polymerase and 1x PCR buffer (New England Biolabs).

    Article Title: Genes but Not Genomes Reveal Bacterial Domestication of Lactococcus Lactis
    Article Snippet: PCR conditions were: initial denaturation at 94°C for 3 min; 30 cycles at 94°C for 45 s, 55°C for 1 min, 72°C for 1 min using a MJ Mini thermocycler (Bio-Rad, Hercules, USA) in a 50 µl-mixture containing 10 ng of genomic DNA, 200 µM of each dNTP, 0.2 µM of each primer, 2.5 U Taq polymerase in 1x thermopol buffer (New England Biolabs). .. The quality of every sequence chromatogram was checked manually and each SNP was considered as correct if present on both DNA strands.

    Article Title: POPULATION GENETIC DATA SUGGEST A ROLE FOR MOSQUITO-MEDIATED DISPERSAL OF WEST NILE VIRUS ACROSS THE WESTERN UNITED STATES
    Article Snippet: Forward primers were 5 ’ -tailed with the 23-basepair M13 (uni-43) sequence (AGGGTTTTCCCAGTCACGACGTT). .. PCR was conducted in 10 μL reactions containing 0.8 units Taq polymerase, 1.0 μL 10X ThermoPol buffer (New England Biolabs, Ipswich, MA, U.S.A.), 0.2 mm each dNTP, 1 μm each microsatellite-specific primer (using the 5’ M13-tagged forward primer), 0.5 μm 5 ’ -fluorescently labeled M13 (uni-43) and 0.5 μL template DNA.

    other:

    Article Title: DNA Aptamers to Human Immunodeficiency Virus Reverse Transcriptase Selected by a Primer-Free SELEX Method: Characterization and Comparison with Other Aptamers
    Article Snippet: Taq polymerase, restriction enzymes, and T4 polynucleotide kinase (PNK) were obtained from New England Biolabs.

    Polymerase Chain Reaction:

    Article Title: Combinatorial Effects of Transposable Elements on Gene Expression and Phenotypic Robustness in Drosophila melanogaster Development
    Article Snippet: Taq Polymerase with ThermoPol buffer (NEB) and Expand HF kit (Roche) were used to amplify the tube transcript region and flanking regions for sequencing. .. 5′ RACE was performed using the RLM-RACE kit (Ambion), and Phusion (NEB) was used as the PCR polymerase.

    Article Title: Pseudomonas aeruginosa isolates from dental unit waterlines can be divided in two distinct groups, including one displaying phenotypes similar to isolates from cystic fibrosis patients
    Article Snippet: Taq polymerase and standard buffer (M0273L; NEB) were used. .. No mineral oil was added to the PCR tubes.

    Article Title: Bacterial Diversity Associated with the Coccolithophorid Algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii
    Article Snippet: .. The PCR reaction contained a final concentration of 1.8 mM Mg2+ , 0.5 µ M of each primer, 1 U Taq polymerase and 1x PCR buffer (New England Biolabs). .. The amplification protocol was 94°C for 5 min, followed by 20 cycles of 55°C for 30 s, 72°C for 3 min, and 94°C for 10 s, followed by 72°C for 10 min. For each coccolithophore culture, the amplicons from three independent 50 μ L PCR reactions were pooled and purified with Montage PCR filters (Millipore) and then cloned using the pGEM-T Easy vector kit (Promega).

    Article Title: Genes but Not Genomes Reveal Bacterial Domestication of Lactococcus Lactis
    Article Snippet: .. PCR conditions were: initial denaturation at 94°C for 3 min; 30 cycles at 94°C for 45 s, 55°C for 1 min, 72°C for 1 min using a MJ Mini thermocycler (Bio-Rad, Hercules, USA) in a 50 µl-mixture containing 10 ng of genomic DNA, 200 µM of each dNTP, 0.2 µM of each primer, 2.5 U Taq polymerase in 1x thermopol buffer (New England Biolabs). .. PCR products were purified using the “QIAquick PCR” Purification Kit (Qiagen).

    Article Title: Nucleolar localization of non-structural protein 3b, a protein specifically encoded by the severe acute respiratory syndrome coronavirus.
    Article Snippet: .. Construction of p3b-EGFP, pEGFP-3b, serial of truncated 3b protein and pC23-DsRed, pB23-DsRed, pfibrillarin-DsRed The 3b used for this study was PCR amplified from SARS-CoV (ZJ01, AY297028) genome by using Taq DNA polymerase (NEB). .. PCR was performed with a forward primer (containing an XhoI site) and a reverse primer (containing an EcoRI site) complementary to the 3 end of 3b without stop codon to allow for reading-through.

    Article Title: Diversity of Beta-Propeller Phytase Genes in the Intestinal Contents of Grass Carp Provides Insight into the Release of Major Phosphorus from Phytate in Nature ▿
    Article Snippet: Briefly, the template DNA (∼50 to 100 ng) was added to a 50-μl reaction mixture containing 2.5 U Taq polymerase, 0.2 mM deoxynucleoside triphosphates, 1 mM of each primer, and 2 mM Mg2+ in the buffer supplied by the manufacturer (New England Biolabs, United States). .. The optimized PCR conditions for primers BPP-F and BPP-R were 4 min at 95°C, followed by eight cycles of 95°C for 30 s, 57°C (decreasing by 1°C after each cycle) for 30 s, and 72°C for 30 s, followed by 27 cycles of 95°C for 30 s, 48°C for 30 s, and 72°C for 30 s and then a final extension at 72°C for 5 min.

    Article Title: POPULATION GENETIC DATA SUGGEST A ROLE FOR MOSQUITO-MEDIATED DISPERSAL OF WEST NILE VIRUS ACROSS THE WESTERN UNITED STATES
    Article Snippet: .. PCR was conducted in 10 μL reactions containing 0.8 units Taq polymerase, 1.0 μL 10X ThermoPol buffer (New England Biolabs, Ipswich, MA, U.S.A.), 0.2 mm each dNTP, 1 μm each microsatellite-specific primer (using the 5’ M13-tagged forward primer), 0.5 μm 5 ’ -fluorescently labeled M13 (uni-43) and 0.5 μL template DNA. .. The M13 (uni-43) primer was 5’ -fluorescently tagged with HEX, 6-FAM or NED to facilitate multiplexing.

    Article Title: Regulation of Therapeutic Hypothermia on Inflammatory Cytokines, Microglia Polarization, Migration and Functional Recovery after Ischemic Stroke in Mice
    Article Snippet: .. RT product (1 µl) was subjected to PCR amplification with 10 pmole primer, 10X standard Taq reaction buffer, 10 mM dNTP, and 0.625 unit Taq polymerase in 20 µl PCR reaction buffer (#M0273L, #N0447S, #B9014S; New England Biolabs Inc., Ipswich, MA, USA). .. PCR primers were used as shown in and in our previous study ( ; ).

    Multiplexing:

    Article Title: POPULATION GENETIC DATA SUGGEST A ROLE FOR MOSQUITO-MEDIATED DISPERSAL OF WEST NILE VIRUS ACROSS THE WESTERN UNITED STATES
    Article Snippet: PCR was conducted in 10 μL reactions containing 0.8 units Taq polymerase, 1.0 μL 10X ThermoPol buffer (New England Biolabs, Ipswich, MA, U.S.A.), 0.2 mm each dNTP, 1 μm each microsatellite-specific primer (using the 5’ M13-tagged forward primer), 0.5 μm 5 ’ -fluorescently labeled M13 (uni-43) and 0.5 μL template DNA. .. The M13 (uni-43) primer was 5’ -fluorescently tagged with HEX, 6-FAM or NED to facilitate multiplexing.

    Isolation:

    Article Title: Regulation of Therapeutic Hypothermia on Inflammatory Cytokines, Microglia Polarization, Migration and Functional Recovery after Ischemic Stroke in Mice
    Article Snippet: Paragraph title: Isolation of total RNA and RT-PCR ... RT product (1 µl) was subjected to PCR amplification with 10 pmole primer, 10X standard Taq reaction buffer, 10 mM dNTP, and 0.625 unit Taq polymerase in 20 µl PCR reaction buffer (#M0273L, #N0447S, #B9014S; New England Biolabs Inc., Ipswich, MA, USA).

    Size-exclusion Chromatography:

    Article Title: Regulation of Therapeutic Hypothermia on Inflammatory Cytokines, Microglia Polarization, Migration and Functional Recovery after Ischemic Stroke in Mice
    Article Snippet: RT product (1 µl) was subjected to PCR amplification with 10 pmole primer, 10X standard Taq reaction buffer, 10 mM dNTP, and 0.625 unit Taq polymerase in 20 µl PCR reaction buffer (#M0273L, #N0447S, #B9014S; New England Biolabs Inc., Ipswich, MA, USA). .. PCR mixtures were heated to 95°C for 10 min and cycled 30–37 times for each primer; cycles consisted of 95°C for 15 sec, 58°C for 1 min, and 68°C for 30 sec. After additional incubation at 68°C for 10 min, the PCR samples were transferred to 4°C.

    Labeling:

    Article Title: POPULATION GENETIC DATA SUGGEST A ROLE FOR MOSQUITO-MEDIATED DISPERSAL OF WEST NILE VIRUS ACROSS THE WESTERN UNITED STATES
    Article Snippet: .. PCR was conducted in 10 μL reactions containing 0.8 units Taq polymerase, 1.0 μL 10X ThermoPol buffer (New England Biolabs, Ipswich, MA, U.S.A.), 0.2 mm each dNTP, 1 μm each microsatellite-specific primer (using the 5’ M13-tagged forward primer), 0.5 μm 5 ’ -fluorescently labeled M13 (uni-43) and 0.5 μL template DNA. .. The M13 (uni-43) primer was 5’ -fluorescently tagged with HEX, 6-FAM or NED to facilitate multiplexing.

    Purification:

    Article Title: Bacterial Diversity Associated with the Coccolithophorid Algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii
    Article Snippet: DNA extraction used a cetyltrimethylammonium bromide purification method [ ] amended to suspend the cell pellet in 100 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 10 mM EDTA, to which lysozyme (5 mg mL−1 final concentration) was then added and incubated at 37°C for 30 min. Bacterial 16S rRNA gene sequences were amplified by the PCR from extracted DNA based on the universal bacterial primers 27f and 1492r [ ], except that 27f primer was modified to include the underlined 5′ adapter sequence (27f adapter; CTAATACGACTCAGCTATGCACT AGRGTTTGATCMTGGCTCAG). .. The PCR reaction contained a final concentration of 1.8 mM Mg2+ , 0.5 µ M of each primer, 1 U Taq polymerase and 1x PCR buffer (New England Biolabs).

    Article Title: Genes but Not Genomes Reveal Bacterial Domestication of Lactococcus Lactis
    Article Snippet: PCR conditions were: initial denaturation at 94°C for 3 min; 30 cycles at 94°C for 45 s, 55°C for 1 min, 72°C for 1 min using a MJ Mini thermocycler (Bio-Rad, Hercules, USA) in a 50 µl-mixture containing 10 ng of genomic DNA, 200 µM of each dNTP, 0.2 µM of each primer, 2.5 U Taq polymerase in 1x thermopol buffer (New England Biolabs). .. PCR products were purified using the “QIAquick PCR” Purification Kit (Qiagen).

    Article Title: High-resolution mapping of DNA polymerase fidelity using nucleotide imbalances and next-generation sequencing
    Article Snippet: .. Purified Taq polymerase, Avian Myeloblastosis Virus (AMV) RT, Phi29 and Sulfolobus islandicus Dpo4 were purchased through New England Biolabs. .. Purified Sequenase 2.0 was purchased through Affymetrix.

    Article Title: High-resolution mapping of DNA polymerase fidelity using nucleotide imbalances and next-generation sequencing
    Article Snippet: .. Purified Taq polymerase, Avian Myeloblastosis Virus (AMV) RT, Phi29 and Sulfolobus islandicus Dpo4 were purchased through New England Biolabs. .. Purified Sequenase 2.0 was purchased through Affymetrix.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Regulation of Therapeutic Hypothermia on Inflammatory Cytokines, Microglia Polarization, Migration and Functional Recovery after Ischemic Stroke in Mice
    Article Snippet: Paragraph title: Isolation of total RNA and RT-PCR ... RT product (1 µl) was subjected to PCR amplification with 10 pmole primer, 10X standard Taq reaction buffer, 10 mM dNTP, and 0.625 unit Taq polymerase in 20 µl PCR reaction buffer (#M0273L, #N0447S, #B9014S; New England Biolabs Inc., Ipswich, MA, USA).

    Construct:

    Article Title: Bacterial Diversity Associated with the Coccolithophorid Algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii
    Article Snippet: 16S rRNA Gene Analysis 16S rRNA gene clone libraries were constructed from 1 mL of the suspended late log phase culture (as above). .. The PCR reaction contained a final concentration of 1.8 mM Mg2+ , 0.5 µ M of each primer, 1 U Taq polymerase and 1x PCR buffer (New England Biolabs).

    Article Title: Nucleolar localization of non-structural protein 3b, a protein specifically encoded by the severe acute respiratory syndrome coronavirus.
    Article Snippet: Construction of p3b-EGFP, pEGFP-3b, serial of truncated 3b protein and pC23-DsRed, pB23-DsRed, pfibrillarin-DsRed The 3b used for this study was PCR amplified from SARS-CoV (ZJ01, AY297028) genome by using Taq DNA polymerase (NEB). .. The pEGFP-3b, truncated 3b constructs were made in a similar fashion, and the oligonucleotide primers used were listed in Table 1 .

    Mouse Assay:

    Article Title: Regulation of Therapeutic Hypothermia on Inflammatory Cytokines, Microglia Polarization, Migration and Functional Recovery after Ischemic Stroke in Mice
    Article Snippet: Total RNA from tissues of stroke mice or neuronal cells was isolated according to manufacturer’s instruction (P/N 4387406; A & B Applied Biosystems). .. RT product (1 µl) was subjected to PCR amplification with 10 pmole primer, 10X standard Taq reaction buffer, 10 mM dNTP, and 0.625 unit Taq polymerase in 20 µl PCR reaction buffer (#M0273L, #N0447S, #B9014S; New England Biolabs Inc., Ipswich, MA, USA).

    Plasmid Preparation:

    Article Title: Pseudomonas aeruginosa isolates from dental unit waterlines can be divided in two distinct groups, including one displaying phenotypes similar to isolates from cystic fibrosis patients
    Article Snippet: Taq polymerase and standard buffer (M0273L; NEB) were used. .. The resulting 600-bp RAPD amplification product (OPA-10) was cloned into plasmid pCRTM -Blunt II TOPO®(Invitrogen) according to manufacturer’s protocol.

    Article Title: Bacterial Diversity Associated with the Coccolithophorid Algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii
    Article Snippet: The PCR reaction contained a final concentration of 1.8 mM Mg2+ , 0.5 µ M of each primer, 1 U Taq polymerase and 1x PCR buffer (New England Biolabs). .. The amplification protocol was 94°C for 5 min, followed by 20 cycles of 55°C for 30 s, 72°C for 3 min, and 94°C for 10 s, followed by 72°C for 10 min. For each coccolithophore culture, the amplicons from three independent 50 μ L PCR reactions were pooled and purified with Montage PCR filters (Millipore) and then cloned using the pGEM-T Easy vector kit (Promega).

    Article Title: Nucleolar localization of non-structural protein 3b, a protein specifically encoded by the severe acute respiratory syndrome coronavirus.
    Article Snippet: Construction of p3b-EGFP, pEGFP-3b, serial of truncated 3b protein and pC23-DsRed, pB23-DsRed, pfibrillarin-DsRed The 3b used for this study was PCR amplified from SARS-CoV (ZJ01, AY297028) genome by using Taq DNA polymerase (NEB). .. This product was cut with XhoI and EcoRI, and the obtained gene was cloned into multiple cloning site (MCS) of pEGFP-N1 vector (Clontech), producing a p3b-EGFP plasmid.

    Software:

    Article Title: Genes but Not Genomes Reveal Bacterial Domestication of Lactococcus Lactis
    Article Snippet: Primers were designed by standard procedures using Clone Manager version 9.0 software (Sci-Ed Software). .. PCR conditions were: initial denaturation at 94°C for 3 min; 30 cycles at 94°C for 45 s, 55°C for 1 min, 72°C for 1 min using a MJ Mini thermocycler (Bio-Rad, Hercules, USA) in a 50 µl-mixture containing 10 ng of genomic DNA, 200 µM of each dNTP, 0.2 µM of each primer, 2.5 U Taq polymerase in 1x thermopol buffer (New England Biolabs).

    Electrophoresis:

    Article Title: Regulation of Therapeutic Hypothermia on Inflammatory Cytokines, Microglia Polarization, Migration and Functional Recovery after Ischemic Stroke in Mice
    Article Snippet: RT product (1 µl) was subjected to PCR amplification with 10 pmole primer, 10X standard Taq reaction buffer, 10 mM dNTP, and 0.625 unit Taq polymerase in 20 µl PCR reaction buffer (#M0273L, #N0447S, #B9014S; New England Biolabs Inc., Ipswich, MA, USA). .. PCR products were subjected to electrophoresis in 2% agarose gel with ethidium bromide (EtBr).

    Agarose Gel Electrophoresis:

    Article Title: Regulation of Therapeutic Hypothermia on Inflammatory Cytokines, Microglia Polarization, Migration and Functional Recovery after Ischemic Stroke in Mice
    Article Snippet: RT product (1 µl) was subjected to PCR amplification with 10 pmole primer, 10X standard Taq reaction buffer, 10 mM dNTP, and 0.625 unit Taq polymerase in 20 µl PCR reaction buffer (#M0273L, #N0447S, #B9014S; New England Biolabs Inc., Ipswich, MA, USA). .. PCR products were subjected to electrophoresis in 2% agarose gel with ethidium bromide (EtBr).

    DNA Extraction:

    Article Title: Bacterial Diversity Associated with the Coccolithophorid Algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii
    Article Snippet: DNA extraction used a cetyltrimethylammonium bromide purification method [ ] amended to suspend the cell pellet in 100 mM Tris-HCl (pH 8.0), 150 mM NaCl, and 10 mM EDTA, to which lysozyme (5 mg mL−1 final concentration) was then added and incubated at 37°C for 30 min. Bacterial 16S rRNA gene sequences were amplified by the PCR from extracted DNA based on the universal bacterial primers 27f and 1492r [ ], except that 27f primer was modified to include the underlined 5′ adapter sequence (27f adapter; CTAATACGACTCAGCTATGCACT AGRGTTTGATCMTGGCTCAG). .. The PCR reaction contained a final concentration of 1.8 mM Mg2+ , 0.5 µ M of each primer, 1 U Taq polymerase and 1x PCR buffer (New England Biolabs).

    Concentration Assay:

    Article Title: Bacterial Diversity Associated with the Coccolithophorid Algae Emiliania huxleyi and Coccolithus pelagicus f. braarudii
    Article Snippet: .. The PCR reaction contained a final concentration of 1.8 mM Mg2+ , 0.5 µ M of each primer, 1 U Taq polymerase and 1x PCR buffer (New England Biolabs). .. The amplification protocol was 94°C for 5 min, followed by 20 cycles of 55°C for 30 s, 72°C for 3 min, and 94°C for 10 s, followed by 72°C for 10 min. For each coccolithophore culture, the amplicons from three independent 50 μ L PCR reactions were pooled and purified with Montage PCR filters (Millipore) and then cloned using the pGEM-T Easy vector kit (Promega).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs taq polymerase
    Guanine-rich templates from TCF3 and PBX1 block DNA synthesis in vitro . (A) <t>Klenow</t> polymerase extension assays using templates from the cytosine-rich strand (C-strand, left) or guanine-rich strand (G-strand, right) for each G4 sequence motif, resolved by denaturing PAGE. Reactions were performed in either KCl (K + ) or LiCl (Li + ). Shown are bands for stalled DNA synthesis (bracket) and full-length extension product (black arrow). G4 sequences begin at the bottom of the brackets. T-3′ differs from the motif listed in Table 1 , it includes 472 bp of surrounding genomic sequence (Supplementary Figure S2 ). (B) Primer extension reactions used <t>Taq</t> polymerase across a temperature range (50–80∘C) in either KCl (K + ) or (NH 4 ) 2 SO 4 (N) salt conditions on guanine-rich templates from TCF3 and PBX1 . Bands corresponding to stalled DNA synthesis (bracket) or full-length extension (black arrow) are shown.
    Taq Polymerase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq polymerase/product/New England Biolabs
    Average 99 stars, based on 66 article reviews
    Price from $9.99 to $1999.99
    taq polymerase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    94
    New England Biolabs neb longamp taq
    ssDNA production by aPCR. ( a ) aPCR reactions were assembled with a 50-molar excess of a forward primer for the amplification of a 1,000 nt ssDNA fragment using the M13mp18 ssDNA plasmid as template, and with 10 different polymerases that were tested for highest yield of ssDNA production (upper band: expected dsDNA size is 1,000 bp; lower band: expected ssDNA size is 1,000 nt) as judged by agarose gel electrophoresis (right panel). QuantaBio AccuStart HiFi, polymerase (lane 2, boxed) produced the highest amount without overlapping dsDNA contaminants. 1. Accustart; 2. Accustart HiFi; 3. Accustart II; 4. AccuPrime; 5. GoTaq; 6. DreamTaq; 7. Phusion; 8. Platinum SuperFi; 9. Q5; 10. Tth polymerase. ( b ) Biochemical validation of ssDNA production by incubating 1,000 nt aPCR reaction products with the ssDNA-specific ExoI or S1 nucleases or dsDNA-specific restriction enzymes Eco RI and Nae I (left panel). Agarose gel electrophoresis of the digestion products as labeled by lane (right panel). M: Marker, C: aPCR product control, ExoI: exonuclease I, S1: S1 nuclease, Enz: Eco RI + Nae I. ( c ) <t>NEB</t> <t>LongAmp</t> was used to generate ssDNA up to 15,000 nt long using lambda phage dsDNA as template. Purification of the 10 kb fragment shows a single band of higher molecular weight than the M13mp18 ssDNA (7,249 nt). ( d ) The primer design algorithm aPrime was used to select primers for product sizes between 500 and 3,000 nt using M13mp18 ssDNA as template and the Quantabio Accustart HiFi enzyme. SYBR Safe stained agarose gels illuminated under blue light show dsDNA as yellow bands, while ssDNA show as orange bands.
    Neb Longamp Taq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/neb longamp taq/product/New England Biolabs
    Average 94 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    neb longamp taq - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    N/A
    OneTaq Quick Load DNA Polymerase 500 units
      Buy from Supplier

    Image Search Results


    Guanine-rich templates from TCF3 and PBX1 block DNA synthesis in vitro . (A) Klenow polymerase extension assays using templates from the cytosine-rich strand (C-strand, left) or guanine-rich strand (G-strand, right) for each G4 sequence motif, resolved by denaturing PAGE. Reactions were performed in either KCl (K + ) or LiCl (Li + ). Shown are bands for stalled DNA synthesis (bracket) and full-length extension product (black arrow). G4 sequences begin at the bottom of the brackets. T-3′ differs from the motif listed in Table 1 , it includes 472 bp of surrounding genomic sequence (Supplementary Figure S2 ). (B) Primer extension reactions used Taq polymerase across a temperature range (50–80∘C) in either KCl (K + ) or (NH 4 ) 2 SO 4 (N) salt conditions on guanine-rich templates from TCF3 and PBX1 . Bands corresponding to stalled DNA synthesis (bracket) or full-length extension (black arrow) are shown.

    Journal: Frontiers in Genetics

    Article Title: Sites of instability in the human TCF3 (E2A) gene adopt G-quadruplex DNA structures in vitro

    doi: 10.3389/fgene.2015.00177

    Figure Lengend Snippet: Guanine-rich templates from TCF3 and PBX1 block DNA synthesis in vitro . (A) Klenow polymerase extension assays using templates from the cytosine-rich strand (C-strand, left) or guanine-rich strand (G-strand, right) for each G4 sequence motif, resolved by denaturing PAGE. Reactions were performed in either KCl (K + ) or LiCl (Li + ). Shown are bands for stalled DNA synthesis (bracket) and full-length extension product (black arrow). G4 sequences begin at the bottom of the brackets. T-3′ differs from the motif listed in Table 1 , it includes 472 bp of surrounding genomic sequence (Supplementary Figure S2 ). (B) Primer extension reactions used Taq polymerase across a temperature range (50–80∘C) in either KCl (K + ) or (NH 4 ) 2 SO 4 (N) salt conditions on guanine-rich templates from TCF3 and PBX1 . Bands corresponding to stalled DNA synthesis (bracket) or full-length extension (black arrow) are shown.

    Article Snippet: Single-stranded phagemid templates were primed with a 32 P 5′ end labeled M13 forward primer, which was extended with Klenow or Taq polymerase (NEB).

    Techniques: Blocking Assay, DNA Synthesis, In Vitro, Sequencing, Polyacrylamide Gel Electrophoresis

    PCR products of UBP4′: M-marker (bp) GeneRuler DNA Ladder Mix (Fermentas Life Sciences), lanes 1–8 UBP4′ gene (276 bp UBP4′ length and 26 bp for restriction enzymes sequence = 302 bp) PCR product: lanes 1, 2: PCR reaction with Biotools DNA polymerase and 23 cycles, lanes 3, 4: PCR reaction with Biotools DNA polymerase and 29 cycles, lanes 5, 6: PCR reaction with Biotools DNA polymerase and 29 cycles, and lanes 7, 8: PCR reaction with Taq DNA polymerase and 29 cycles.

    Journal: BioMed Research International

    Article Title: DNASynth: A Computer Program for Assembly of Artificial Gene Parts in Decreasing Temperature

    doi: 10.1155/2015/413262

    Figure Lengend Snippet: PCR products of UBP4′: M-marker (bp) GeneRuler DNA Ladder Mix (Fermentas Life Sciences), lanes 1–8 UBP4′ gene (276 bp UBP4′ length and 26 bp for restriction enzymes sequence = 302 bp) PCR product: lanes 1, 2: PCR reaction with Biotools DNA polymerase and 23 cycles, lanes 3, 4: PCR reaction with Biotools DNA polymerase and 29 cycles, lanes 5, 6: PCR reaction with Biotools DNA polymerase and 29 cycles, and lanes 7, 8: PCR reaction with Taq DNA polymerase and 29 cycles.

    Article Snippet: S.A. or Taq DNA polymerase with standard Taq buffer, New England Biolabs, Inc.), and 1 μ L as a template for 23 and 29 cycles using Eppendorf 5330 thermocycler.

    Techniques: Polymerase Chain Reaction, Marker, Sequencing

    Schematics of Cas9n/gRNA target sequence specific fluorescent labeling for whole genome DNA mapping. The Cas9n fluorescent nick-labeling system uses a guide RNA (gRNA) to direct the Cas9 nuclease to a targeted site. The gRNA is composed of a trans-activating crRNA (tracrRNA) and a crRNA that contains a 20 nucleotide sequence that is complementary to the site of interest. A mutation in the RuvC-like domain nuclease alters the Cas9 enzyme to make only a single cut three nucleotides upstream of a protospacer adjacent motif (PAM) of the 3′–5′ strand of the target DNA. In the nick labeling method, after Cas9n D10A generates a nick, fluorophores are directly incorporated to the nick sites using Taq DNA Polymerase. These fluorophores can be detected using fluorescence microscopy.

    Journal: Nucleic Acids Research

    Article Title: CRISPR-CAS9 D10A nickase target-specific fluorescent labeling of double strand DNA for whole genome mapping and structural variation analysis

    doi: 10.1093/nar/gkv878

    Figure Lengend Snippet: Schematics of Cas9n/gRNA target sequence specific fluorescent labeling for whole genome DNA mapping. The Cas9n fluorescent nick-labeling system uses a guide RNA (gRNA) to direct the Cas9 nuclease to a targeted site. The gRNA is composed of a trans-activating crRNA (tracrRNA) and a crRNA that contains a 20 nucleotide sequence that is complementary to the site of interest. A mutation in the RuvC-like domain nuclease alters the Cas9 enzyme to make only a single cut three nucleotides upstream of a protospacer adjacent motif (PAM) of the 3′–5′ strand of the target DNA. In the nick labeling method, after Cas9n D10A generates a nick, fluorophores are directly incorporated to the nick sites using Taq DNA Polymerase. These fluorophores can be detected using fluorescence microscopy.

    Article Snippet: The two color genome mapping with Cas9n fluorescent nick-labeling and sequence-motif labeling After nicking with Cas9n D10A as previously described in the Cas9n fluorescent nick-labeling section, the sample was digested with RNAseA (190 ng/μL, QIAGEN) at 37°C for 20 min. After digestion, the sample was labeled with ATTO 532-dATP, dTGC (100 nM) and 2.5 units of DNA Taq Polymerase (NEB) in the presence of 1X Thermopol Buffer (NEB) at 72°C for 1 h. The sample was treated with 1 unit of SAP (USB Products) and RNAseA (100 ng/μL) at 37°C for 20 min and then 65°C for 15 min.

    Techniques: Sequencing, Labeling, Mutagenesis, Fluorescence, Microscopy

    ssDNA production by aPCR. ( a ) aPCR reactions were assembled with a 50-molar excess of a forward primer for the amplification of a 1,000 nt ssDNA fragment using the M13mp18 ssDNA plasmid as template, and with 10 different polymerases that were tested for highest yield of ssDNA production (upper band: expected dsDNA size is 1,000 bp; lower band: expected ssDNA size is 1,000 nt) as judged by agarose gel electrophoresis (right panel). QuantaBio AccuStart HiFi, polymerase (lane 2, boxed) produced the highest amount without overlapping dsDNA contaminants. 1. Accustart; 2. Accustart HiFi; 3. Accustart II; 4. AccuPrime; 5. GoTaq; 6. DreamTaq; 7. Phusion; 8. Platinum SuperFi; 9. Q5; 10. Tth polymerase. ( b ) Biochemical validation of ssDNA production by incubating 1,000 nt aPCR reaction products with the ssDNA-specific ExoI or S1 nucleases or dsDNA-specific restriction enzymes Eco RI and Nae I (left panel). Agarose gel electrophoresis of the digestion products as labeled by lane (right panel). M: Marker, C: aPCR product control, ExoI: exonuclease I, S1: S1 nuclease, Enz: Eco RI + Nae I. ( c ) NEB LongAmp was used to generate ssDNA up to 15,000 nt long using lambda phage dsDNA as template. Purification of the 10 kb fragment shows a single band of higher molecular weight than the M13mp18 ssDNA (7,249 nt). ( d ) The primer design algorithm aPrime was used to select primers for product sizes between 500 and 3,000 nt using M13mp18 ssDNA as template and the Quantabio Accustart HiFi enzyme. SYBR Safe stained agarose gels illuminated under blue light show dsDNA as yellow bands, while ssDNA show as orange bands.

    Journal: Scientific Reports

    Article Title: In vitro synthesis of gene-length single-stranded DNA

    doi: 10.1038/s41598-018-24677-5

    Figure Lengend Snippet: ssDNA production by aPCR. ( a ) aPCR reactions were assembled with a 50-molar excess of a forward primer for the amplification of a 1,000 nt ssDNA fragment using the M13mp18 ssDNA plasmid as template, and with 10 different polymerases that were tested for highest yield of ssDNA production (upper band: expected dsDNA size is 1,000 bp; lower band: expected ssDNA size is 1,000 nt) as judged by agarose gel electrophoresis (right panel). QuantaBio AccuStart HiFi, polymerase (lane 2, boxed) produced the highest amount without overlapping dsDNA contaminants. 1. Accustart; 2. Accustart HiFi; 3. Accustart II; 4. AccuPrime; 5. GoTaq; 6. DreamTaq; 7. Phusion; 8. Platinum SuperFi; 9. Q5; 10. Tth polymerase. ( b ) Biochemical validation of ssDNA production by incubating 1,000 nt aPCR reaction products with the ssDNA-specific ExoI or S1 nucleases or dsDNA-specific restriction enzymes Eco RI and Nae I (left panel). Agarose gel electrophoresis of the digestion products as labeled by lane (right panel). M: Marker, C: aPCR product control, ExoI: exonuclease I, S1: S1 nuclease, Enz: Eco RI + Nae I. ( c ) NEB LongAmp was used to generate ssDNA up to 15,000 nt long using lambda phage dsDNA as template. Purification of the 10 kb fragment shows a single band of higher molecular weight than the M13mp18 ssDNA (7,249 nt). ( d ) The primer design algorithm aPrime was used to select primers for product sizes between 500 and 3,000 nt using M13mp18 ssDNA as template and the Quantabio Accustart HiFi enzyme. SYBR Safe stained agarose gels illuminated under blue light show dsDNA as yellow bands, while ssDNA show as orange bands.

    Article Snippet: Initial tests with two other Taq -based polymerase sets, NEB LongAmp® Taq and Takara LA® Taq , produced notable amounts of dsDNA byproduct when tested for amplification of the 1,000 nt and the 3,281 nt fragments and reduced amount of ssDNA per reaction for the 1,000 and 3,281 fragments respectively in comparison with the Accustart HiFi (Fig. and Supplementary Table , External Table ).

    Techniques: Amplification, Plasmid Preparation, Agarose Gel Electrophoresis, Produced, Labeling, Marker, Purification, Molecular Weight, Staining