taq dna polymerase  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Millipore taq dna polymerase
    Performance of four thermostable <t>DNA</t> polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: Q5 Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: <t>Taq</t> DNA polymerase. M2: NZYladder I
    Taq Dna Polymerase, supplied by Millipore, used in various techniques. Bioz Stars score: 96/100, based on 321 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/Millipore
    Average 96 stars, based on 321 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2019-12
    96/100 stars

    Images

    1) Product Images from "Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins"

    Article Title: Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins

    Journal: BMC Biotechnology

    doi: 10.1186/s12896-016-0316-3

    Performance of four thermostable DNA polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: Q5 Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I
    Figure Legend Snippet: Performance of four thermostable DNA polymerases for the synthesis of gene B using PCA-DTF. Lane 1: negative control reaction performed at the same conditions, without addition of primers; lane 2: KOD Hot Start DNA polymerase; lane 3: Q5 Hot Start High Fidelity DNA polymerase; lane 4: Pfu Turbo DNA polymerase and lane 5: Taq DNA polymerase. M2: NZYladder I

    Techniques Used: Negative Control

    Related Articles

    Methylation Sequencing:

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: Paragraph title: Bisulfite sequencing ... To amplify the Rasal1 and Kl promoter fragments, a touchdown PCR program was performed using Taq DNA Polymerase (Sigma-Aldrich, St. Louis, USA).

    Clone Assay:

    Article Title: T-ARMS PCR genotyping of SNP rs445709131 using thermostable strand displacement polymerase
    Article Snippet: The current study used a cloned mutant allele (Additional file ) as mutant genotype. .. We have reported the standard procedure of T-ARMS PCR for genotyping of the SNP rs445709131 using Taq polymerase (Sigma-Aldrich, USA, Cat.No.D6677) [ ].

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: To amplify the Rasal1 and Kl promoter fragments, a touchdown PCR program was performed using Taq DNA Polymerase (Sigma-Aldrich, St. Louis, USA). .. The sequences of the PCR primers are listed in Supplementary Table .

    Article Title: RNase III Processing of rRNA in the Lyme Disease Spirochete Borrelia burgdorferi
    Article Snippet: Genomic regions encompassing 1.3 kb upstream and 1.3 kb downstream of rnc Bb were amplified by PCR using Taq polymerase (Sigma-Aldrich), cloned into pCR2.1-TOPO, confirmed by DNA sequencing, and ligated together. .. The plasmid was linearized with ScaI and electroporated into B. burgdorferi , as previously described ( , ).

    Amplification:

    Article Title: Chromosome-scale comparative sequence analysis unravels molecular mechanisms of genome dynamics between two wheat cultivars
    Article Snippet: To verify the haploblock c region we designed a PCR probe (forward primer GCCACGAGCGTGGTCGTG, reverse primer CCTTCATAGCTCCGTAGAAG) spanning the left border of the haploblock c of CH Campala Lr22a . .. The PCR amplification was performed in 20 μl reaction mixture containing 65 ng of genomic DNA, 1 μl of 2.5 mM dNTP’s, 1 μl of 10 μM of each primer and 0.25 units of Sigma Taq polymerase at 60 °C annealing temperature for 35 cycles. .. The cycling parameters used were pre-denaturation at 95 °C for 4 min, which was followed by 35 cycles of 95 °C for 30 s, annealing at 60 °C for 30 s, 72 °C for 2 min and a final extension at 72 °C for 10 min.

    Article Title: Selection for background matching drives sympatric speciation in Wall Gecko
    Article Snippet: Polymerase chain reaction (PCR) amplifications were carried out in 10 μl final volumes containing 20 ng of genomic DNA, 0.50 μM of each primer, 10X PCR buffer (160 mM (NH4)2 SO4 ; 670 mM Tris-HCl pH 8.8; 15 mM MgCl2 ; 0.1% Tween 20), 0.2 U Taq polymerase (SIGMA Dream Taq), 0.25 mM each dNTP. .. Polymerase chain reaction (PCR) amplifications were carried out in 10 μl final volumes containing 20 ng of genomic DNA, 0.50 μM of each primer, 10X PCR buffer (160 mM (NH4)2 SO4 ; 670 mM Tris-HCl pH 8.8; 15 mM MgCl2 ; 0.1% Tween 20), 0.2 U Taq polymerase (SIGMA Dream Taq), 0.25 mM each dNTP.

    Article Title: CRISPR/Cas9-Induced (CTG⋅CAG)n Repeat Instability in the Myotonic Dystrophy Type 1 Locus: Implications for Therapeutic Genome Editing
    Article Snippet: Taq polymerase (Sigma-Aldrich) was used at 1 unit per 10 μL of reaction. .. Taq polymerase (Sigma-Aldrich) was used at 1 unit per 10 μL of reaction.

    Article Title: Intertidal marine sediment harbours Actinobacteria with promising bioactive and biosynthetic potential
    Article Snippet: Paragraph title: PCR amplification of PKS-II and NRPS fragments ... Reaction mixture contained 200 µM of each dNTP, 0.5% DMSO (v/v), 1 m M of degenerate primers, 25 ng of genomic DNA and 0.5 units of Taq polymerase (Sigma-Aldrich, USA) in 50 µL of 1X PCR buffer.

    Article Title: Characterization of Biosurfactant Produced during Degradation of Hydrocarbons Using Crude Oil As Sole Source of Carbon
    Article Snippet: The16S rDNA was PCR amplified using universal primer pair, 968F (AACGCGAAGAACCTTAC) and 1541R (AAGGAGGTGATCCAGCCGCA) (White et al., ). .. Polymerase chain reaction (PCR) was performed in a 25 μl volume in thermal cycler (Mastercycler Nexus gradient, Eppendorf, Germany) with a final concentration of 1X standard buffer, 1.5 m mol l−1 MgCl2 , 0.2 μ mol l−1 each primer, 0.2 m mol l−1 dNTPs and 0.25 U Taq DNA polymerase (Sigma Aldrich, USA) and 25 ng of template DNA.

    Article Title: Vertebrate SLRP family evolution and the subfunctionalization of osteoglycin gene duplicates in teleost fish
    Article Snippet: A standard curve relating initial template quantity to amplification cycle was generated using serial dilutions of known concentrations of the target template. .. The templates for the standard curves were generated by conventional PCR using standard conditions, 10 ng cDNA, 1.5 U of Taq polymerase (Readymix Taq PCR Reaction Mix, Sigma-Aldrich) and 200 nM of long-forward and long-reverse primers (Table ) in a final volume of 50 μl.

    Article Title: Selection of reference genes suitable for normalization of qPCR data under abiotic stresses in bioenergy crop Arundo donax L.
    Article Snippet: First strand cDNA was reversed transcribed from 1 µg of total RNA primed with oligo-dT in a total reaction mixture of 20 µL using SuperScript® III Reverse Transcriptase (Life Technologies) according to the manufacture’s instruction. .. To assess the amplification specificity of each primer pair prior to qPCR analysis, PCR amplification was performed in a total volume of 10 µL containing 1 µl of 6-fold diluted cDNA (8 ng of starting RNA), 1x PCR Buffer, 100 nM dNTPs, 200 nM of each primer, 0.5 unit of Taq polymerase (Sigma) and 4.9 µl of H2 O; The PCR programme was as follows: 8 min at 95 °C, 33 cycles of 40 s at 94 °C, 30 s at 60 °C and 20 s at 72 °C, with 5 min final extension at 72 °C. .. The PCR products were run on 2% agarose gel to check single amplification (Supplementary Figure ).

    Article Title: RNase III Processing of rRNA in the Lyme Disease Spirochete Borrelia burgdorferi
    Article Snippet: The rnc Bb gene ( bb0705 ) was disrupted by replacement with flgBp-aacC1 , which confers gentamicin resistance , as previously described ( , ). .. Genomic regions encompassing 1.3 kb upstream and 1.3 kb downstream of rnc Bb were amplified by PCR using Taq polymerase (Sigma-Aldrich), cloned into pCR2.1-TOPO, confirmed by DNA sequencing, and ligated together. .. The gentamicin resistance cassette was ligated into a synthetic AatII site between the two flanking sequences.

    Article Title: Metabolic adaptation to a high-fat diet is associated with a change in the gut microbiota
    Article Snippet: Total DNA was extracted from frozen caecum contents using the TriPure reagent (Roche Diagnostics, Meylan, France) according to the manufacturer's protocol. .. 200 ng DNA were amplified by PCR using a Taq Polymerase (Sigma Aldrich, St Louis, Missouri, USA) and 300 nM denaturing gradient gel electrophoresis (DGGE)-specific 16S rRNA universal primers (forward primer 5′-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAC TCCTACGGGAGGCAGCAGT-3′; reverse primer 5′-GTATTACCGCGGCTGCTGGCAC-3′), carrying (forward primer only) a GC-enriched region (GC clamp), generating 233 bp amplicons. .. The size of the latter was checked by 2% agarose gel electrophoresis.

    Polymerase Chain Reaction:

    Article Title: T-ARMS PCR genotyping of SNP rs445709131 using thermostable strand displacement polymerase
    Article Snippet: The current study used a cloned mutant allele (Additional file ) as mutant genotype. .. We have reported the standard procedure of T-ARMS PCR for genotyping of the SNP rs445709131 using Taq polymerase (Sigma-Aldrich, USA, Cat.No.D6677) [ ]. .. The SD polymerase (Bioron GmbH, Germany, Cat. No. 108702) T-ARMS PCR reaction mix was different from the standard T-ARMS (Table ).

    Article Title: Development of a gene synthesis platform for the efficient large scale production of small genes encoding animal toxins
    Article Snippet: Paragraph title: Optimization of PCR conditions for successful gene synthesis protocol ... Four DNA polymerases were selected for these studies: KOD Hot Start DNA polymerase (EMD-Millipore), Q5® Hot Star High Fidelity DNA polymerase (New England Biolabs), Pfu Turbo DNA polymerase (Agilent Technologies) and Taq DNA polymerase (Sigma-Aldrich).

    Article Title: Methylomic profiling and replication implicates deregulation of PCSK9 in alcohol use disorder
    Article Snippet: Sodium bisulfite conversion was carried out using EZ DNA Methylation Gold Kit (Zymo Research, Irvine, CA) according to the manufacturer's instructions on 500 ng of DNA from tested human tissues. .. Nested PCR amplifications were performed with a standard PCR protocol in 25 μl volume reactions containing 3-4 μl of sodium-bisulfite-treated DNA, 0.2 μM primers, and master mix containing Taq DNA polymerase (Sigma Aldrich, St. Louis, MO). .. Primer annealing temperatures for the outside and inside nested PCR were 58.6 and 61.9 degrees C, respectively.

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: To amplify the Rasal1 and Kl promoter fragments, a touchdown PCR program was performed using Taq DNA Polymerase (Sigma-Aldrich, St. Louis, USA). .. To amplify the Rasal1 and Kl promoter fragments, a touchdown PCR program was performed using Taq DNA Polymerase (Sigma-Aldrich, St. Louis, USA).

    Article Title: Chromosome-scale comparative sequence analysis unravels molecular mechanisms of genome dynamics between two wheat cultivars
    Article Snippet: To verify the haploblock c region we designed a PCR probe (forward primer GCCACGAGCGTGGTCGTG, reverse primer CCTTCATAGCTCCGTAGAAG) spanning the left border of the haploblock c of CH Campala Lr22a . .. The PCR amplification was performed in 20 μl reaction mixture containing 65 ng of genomic DNA, 1 μl of 2.5 mM dNTP’s, 1 μl of 10 μM of each primer and 0.25 units of Sigma Taq polymerase at 60 °C annealing temperature for 35 cycles. .. The cycling parameters used were pre-denaturation at 95 °C for 4 min, which was followed by 35 cycles of 95 °C for 30 s, annealing at 60 °C for 30 s, 72 °C for 2 min and a final extension at 72 °C for 10 min.

    Article Title: Selection for background matching drives sympatric speciation in Wall Gecko
    Article Snippet: We analysed 8 polymorphic microsatellite loci: 6 (Tb8, Tb35, Tb71, Tb192, Tb213, Tb240) developed from Tarentola boettgeri , and 2 (Mt6 and Mt27) developed from Tarentola mauritanica . .. Polymerase chain reaction (PCR) amplifications were carried out in 10 μl final volumes containing 20 ng of genomic DNA, 0.50 μM of each primer, 10X PCR buffer (160 mM (NH4)2 SO4 ; 670 mM Tris-HCl pH 8.8; 15 mM MgCl2 ; 0.1% Tween 20), 0.2 U Taq polymerase (SIGMA Dream Taq), 0.25 mM each dNTP. .. The thermocycler profile started with an initial denaturation step at 94 °C for 3 min, followed by 35 cycles at 94 °C for 30 s, temperature annealing at 50–55 °C for 1 min, 72 °C for 1 min followed by 72 °C for 5 min. A negative control was run with each round of PCR.

    Article Title: CRISPR/Cas9-Induced (CTG⋅CAG)n Repeat Instability in the Myotonic Dystrophy Type 1 Locus: Implications for Therapeutic Genome Editing
    Article Snippet: Paragraph title: Small-Pool PCR ... Taq polymerase (Sigma-Aldrich) was used at 1 unit per 10 μL of reaction.

    Article Title: Intertidal marine sediment harbours Actinobacteria with promising bioactive and biosynthetic potential
    Article Snippet: Similarity, adenylation domain of NRPS system was targeted using the degenerate primers set, NRPSF 5′- CGC GCG CAT GTA CTG GAC NGG NGA YYT -3′ and NRPSR (5′- GGA GTG GCC GCC CAR NYB RAA RAA -3′) . .. Reaction mixture contained 200 µM of each dNTP, 0.5% DMSO (v/v), 1 m M of degenerate primers, 25 ng of genomic DNA and 0.5 units of Taq polymerase (Sigma-Aldrich, USA) in 50 µL of 1X PCR buffer. .. The PCR was performed in a BioRad T100 Thermal cycler (BioRad, USA), with the thermal cycling started with initial denaturation at 95 °C for 5 min, followed by a 30 cycles of denaturation at 95 °C for 30 Sec; annealing at either 61 °C (PKS-II) or 63 °C (NRPS) for 45 Sec and extension at 72 °C for 90 Sec, and a final extension at 72 °C for 10 min. Streptomyces kanamyceticus MTCC 324 and Micromonospora echinospora MTCC 930 were used as the positive controls with each set of reactions, while a negative control lacks template.

    Article Title: Characterization of Biosurfactant Produced during Degradation of Hydrocarbons Using Crude Oil As Sole Source of Carbon
    Article Snippet: The16S rDNA was PCR amplified using universal primer pair, 968F (AACGCGAAGAACCTTAC) and 1541R (AAGGAGGTGATCCAGCCGCA) (White et al., ). .. Polymerase chain reaction (PCR) was performed in a 25 μl volume in thermal cycler (Mastercycler Nexus gradient, Eppendorf, Germany) with a final concentration of 1X standard buffer, 1.5 m mol l−1 MgCl2 , 0.2 μ mol l−1 each primer, 0.2 m mol l−1 dNTPs and 0.25 U Taq DNA polymerase (Sigma Aldrich, USA) and 25 ng of template DNA. .. The PCR reaction conditions consisted of initial denaturation at 94°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 45 s, and a final extension at 72°C for 7 min. PCR products were analyzed on 1.2% agarose gel and visualized under Bio Doc-It Imaging System (UVP, USA).

    Article Title: The prevalence of submicroscopic Plasmodium falciparum gametocyte carriage and multiplicity of infection in children, pregnant women and adults in a low malaria transmission area in Southern Ghana
    Article Snippet: The initial outer reaction contained 4 mM of MgCl2 , 200 µM DNTPs, 0.0625 μM of each primer and one unit of Taq DNA polymerase (Sigma-Aldrich, USA). .. The initial outer reaction contained 4 mM of MgCl2 , 200 µM DNTPs, 0.0625 μM of each primer and one unit of Taq DNA polymerase (Sigma-Aldrich, USA).

    Article Title: Vertebrate SLRP family evolution and the subfunctionalization of osteoglycin gene duplicates in teleost fish
    Article Snippet: A standard curve relating initial template quantity to amplification cycle was generated using serial dilutions of known concentrations of the target template. .. The templates for the standard curves were generated by conventional PCR using standard conditions, 10 ng cDNA, 1.5 U of Taq polymerase (Readymix Taq PCR Reaction Mix, Sigma-Aldrich) and 200 nM of long-forward and long-reverse primers (Table ) in a final volume of 50 μl. .. PCR products were all sequenced to confirm reaction specificity and PCR products for standards were column purified (Illustra™ GFX™ PCR DNA and Gel Band Purification Kit, GE Healthcare) and quantified (NanoDrop1000; Thermo Scientific).

    Article Title: Viral immunogenicity determines epidemiological fitness in a cohort of DENV-1 infection in Brazil
    Article Snippet: Successful isolation was confirmed by RT-PCR of the culture supernatant, as previously described for the sequencing reaction, followed by PCR. .. PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water. .. The reactions were subjected to the following cycle conditions: 94°C for 2 min, followed by 30 cycles of 94°C for 45 sec, 56°C for 45 sec and 72°C for 45 sec. A final extension step was performed at 72°C for 10 min. Amplification was confirmed by electrophoresis on a 1.5% agarose gel.

    Article Title: Selection of reference genes suitable for normalization of qPCR data under abiotic stresses in bioenergy crop Arundo donax L.
    Article Snippet: First strand cDNA was reversed transcribed from 1 µg of total RNA primed with oligo-dT in a total reaction mixture of 20 µL using SuperScript® III Reverse Transcriptase (Life Technologies) according to the manufacture’s instruction. .. To assess the amplification specificity of each primer pair prior to qPCR analysis, PCR amplification was performed in a total volume of 10 µL containing 1 µl of 6-fold diluted cDNA (8 ng of starting RNA), 1x PCR Buffer, 100 nM dNTPs, 200 nM of each primer, 0.5 unit of Taq polymerase (Sigma) and 4.9 µl of H2 O; The PCR programme was as follows: 8 min at 95 °C, 33 cycles of 40 s at 94 °C, 30 s at 60 °C and 20 s at 72 °C, with 5 min final extension at 72 °C. .. The PCR products were run on 2% agarose gel to check single amplification (Supplementary Figure ).

    Article Title: Cancer testis antigen Sperm Protein 17 as a new target for triple negative breast cancer immunotherapy
    Article Snippet: RNAs from normal human tissues were obtained from FirstChoice® Total RNA (Ambion, Austin, TX). .. 1/20 of retro-transcription reaction volume was PCR-amplified in 20 μL reaction with PCR Core kit with Taq DNA polymerase (Sigma-Aldrich, Saint Louis, MO). .. Primers sequences were: SP17 left 5’-GCTCGGAGAGAAAGGAGGTTC-3’, SP17 right 5’-TACTCCCCCATTCTGCTGGA-3’, Human β-actin Real-Time Primer Mix (1 nmol/200 μL, Origene cat. # HP204660).

    Article Title: RNase III Processing of rRNA in the Lyme Disease Spirochete Borrelia burgdorferi
    Article Snippet: The rnc Bb gene ( bb0705 ) was disrupted by replacement with flgBp-aacC1 , which confers gentamicin resistance , as previously described ( , ). .. Genomic regions encompassing 1.3 kb upstream and 1.3 kb downstream of rnc Bb were amplified by PCR using Taq polymerase (Sigma-Aldrich), cloned into pCR2.1-TOPO, confirmed by DNA sequencing, and ligated together. .. The gentamicin resistance cassette was ligated into a synthetic AatII site between the two flanking sequences.

    Article Title: Metabolic adaptation to a high-fat diet is associated with a change in the gut microbiota
    Article Snippet: Total DNA was extracted from frozen caecum contents using the TriPure reagent (Roche Diagnostics, Meylan, France) according to the manufacturer's protocol. .. 200 ng DNA were amplified by PCR using a Taq Polymerase (Sigma Aldrich, St Louis, Missouri, USA) and 300 nM denaturing gradient gel electrophoresis (DGGE)-specific 16S rRNA universal primers (forward primer 5′-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAC TCCTACGGGAGGCAGCAGT-3′; reverse primer 5′-GTATTACCGCGGCTGCTGGCAC-3′), carrying (forward primer only) a GC-enriched region (GC clamp), generating 233 bp amplicons. .. The size of the latter was checked by 2% agarose gel electrophoresis.

    Cytometry:

    Article Title: Viral immunogenicity determines epidemiological fitness in a cohort of DENV-1 infection in Brazil
    Article Snippet: PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water. .. PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water.

    Quantitative RT-PCR:

    Article Title: Selection of reference genes suitable for normalization of qPCR data under abiotic stresses in bioenergy crop Arundo donax L.
    Article Snippet: To assess the amplification specificity of each primer pair prior to qPCR analysis, PCR amplification was performed in a total volume of 10 µL containing 1 µl of 6-fold diluted cDNA (8 ng of starting RNA), 1x PCR Buffer, 100 nM dNTPs, 200 nM of each primer, 0.5 unit of Taq polymerase (Sigma) and 4.9 µl of H2 O; The PCR programme was as follows: 8 min at 95 °C, 33 cycles of 40 s at 94 °C, 30 s at 60 °C and 20 s at 72 °C, with 5 min final extension at 72 °C. .. The qPCR reaction was conducted by mixing 1 µL of 10-fold diluted cDNA (5 ng of starting RNA), 200 nM of each primer and 6.25 µL of Platinum® SYBR® Green qPCR SuperMix-UDG (Invitrogen) in a final volume of 12.5 µl.

    Real-time Polymerase Chain Reaction:

    Article Title: Vertebrate SLRP family evolution and the subfunctionalization of osteoglycin gene duplicates in teleost fish
    Article Snippet: Paragraph title: Quantitative real-time PCR (qPCR) ... The templates for the standard curves were generated by conventional PCR using standard conditions, 10 ng cDNA, 1.5 U of Taq polymerase (Readymix Taq PCR Reaction Mix, Sigma-Aldrich) and 200 nM of long-forward and long-reverse primers (Table ) in a final volume of 50 μl.

    Article Title: Selection of reference genes suitable for normalization of qPCR data under abiotic stresses in bioenergy crop Arundo donax L.
    Article Snippet: First strand cDNA was reversed transcribed from 1 µg of total RNA primed with oligo-dT in a total reaction mixture of 20 µL using SuperScript® III Reverse Transcriptase (Life Technologies) according to the manufacture’s instruction. .. To assess the amplification specificity of each primer pair prior to qPCR analysis, PCR amplification was performed in a total volume of 10 µL containing 1 µl of 6-fold diluted cDNA (8 ng of starting RNA), 1x PCR Buffer, 100 nM dNTPs, 200 nM of each primer, 0.5 unit of Taq polymerase (Sigma) and 4.9 µl of H2 O; The PCR programme was as follows: 8 min at 95 °C, 33 cycles of 40 s at 94 °C, 30 s at 60 °C and 20 s at 72 °C, with 5 min final extension at 72 °C. .. The PCR products were run on 2% agarose gel to check single amplification (Supplementary Figure ).

    Acrylamide Gel Assay:

    Article Title: Metabolic adaptation to a high-fat diet is associated with a change in the gut microbiota
    Article Snippet: 200 ng DNA were amplified by PCR using a Taq Polymerase (Sigma Aldrich, St Louis, Missouri, USA) and 300 nM denaturing gradient gel electrophoresis (DGGE)-specific 16S rRNA universal primers (forward primer 5′-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAC TCCTACGGGAGGCAGCAGT-3′; reverse primer 5′-GTATTACCGCGGCTGCTGGCAC-3′), carrying (forward primer only) a GC-enriched region (GC clamp), generating 233 bp amplicons. .. 200 ng DNA were amplified by PCR using a Taq Polymerase (Sigma Aldrich, St Louis, Missouri, USA) and 300 nM denaturing gradient gel electrophoresis (DGGE)-specific 16S rRNA universal primers (forward primer 5′-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAC TCCTACGGGAGGCAGCAGT-3′; reverse primer 5′-GTATTACCGCGGCTGCTGGCAC-3′), carrying (forward primer only) a GC-enriched region (GC clamp), generating 233 bp amplicons.

    Incubation:

    Article Title: Viral immunogenicity determines epidemiological fitness in a cohort of DENV-1 infection in Brazil
    Article Snippet: Briefly, viruses selected from L1 or L6 DENV-1 human sera were diluted 1:10 in L-15 and used to inoculate C6/36 cells, which were then incubated at 28°C for 7–10 days. .. PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water.

    Expressing:

    Article Title: Vertebrate SLRP family evolution and the subfunctionalization of osteoglycin gene duplicates in teleost fish
    Article Snippet: The templates for the standard curves were generated by conventional PCR using standard conditions, 10 ng cDNA, 1.5 U of Taq polymerase (Readymix Taq PCR Reaction Mix, Sigma-Aldrich) and 200 nM of long-forward and long-reverse primers (Table ) in a final volume of 50 μl. .. The templates for the standard curves were generated by conventional PCR using standard conditions, 10 ng cDNA, 1.5 U of Taq polymerase (Readymix Taq PCR Reaction Mix, Sigma-Aldrich) and 200 nM of long-forward and long-reverse primers (Table ) in a final volume of 50 μl.

    Touchdown PCR:

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: Purified cellular DNA was bisulfite-treated using the EZ DNA Methylation-Lightning Kit (Zymoresearch, Irvine, USA) according to the manufacture’s protocol. .. To amplify the Rasal1 and Kl promoter fragments, a touchdown PCR program was performed using Taq DNA Polymerase (Sigma-Aldrich, St. Louis, USA). .. The first round of PCR consisted of the following cycling conditions: 94 °C for 2 min, 6 cycles consisting of 30 s at 94 °C, 30 s at 60–55 °C (reduce 1 °C after each cycle), and 30 s at 72 °C.

    Modification:

    Article Title: Methylomic profiling and replication implicates deregulation of PCSK9 in alcohol use disorder
    Article Snippet: Nested PCR amplifications were performed with a standard PCR protocol in 25 μl volume reactions containing 3-4 μl of sodium-bisulfite-treated DNA, 0.2 μM primers, and master mix containing Taq DNA polymerase (Sigma Aldrich, St. Louis, MO). .. Primer annealing temperatures for the outside and inside nested PCR were 58.6 and 61.9 degrees C, respectively.

    Article Title: Viral immunogenicity determines epidemiological fitness in a cohort of DENV-1 infection in Brazil
    Article Snippet: Vero E6 and LLC-MK2 cells (ATCC) were cultured in Minimum Essential Medium (MEM; Cultilab) and HepG2 cells (ATCC) in Dulbecco's Modified Eagle's Medium (DMEM; Cultilab) at 37°C in a 5% CO2 atmosphere. .. PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water.

    Transformation Assay:

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: To amplify the Rasal1 and Kl promoter fragments, a touchdown PCR program was performed using Taq DNA Polymerase (Sigma-Aldrich, St. Louis, USA). .. The sequences of the PCR primers are listed in Supplementary Table .

    Flow Cytometry:

    Article Title: Viral immunogenicity determines epidemiological fitness in a cohort of DENV-1 infection in Brazil
    Article Snippet: PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water. .. PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water.

    Gas Chromatography:

    Article Title: Metabolic adaptation to a high-fat diet is associated with a change in the gut microbiota
    Article Snippet: Total DNA was extracted from frozen caecum contents using the TriPure reagent (Roche Diagnostics, Meylan, France) according to the manufacturer's protocol. .. 200 ng DNA were amplified by PCR using a Taq Polymerase (Sigma Aldrich, St Louis, Missouri, USA) and 300 nM denaturing gradient gel electrophoresis (DGGE)-specific 16S rRNA universal primers (forward primer 5′-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAC TCCTACGGGAGGCAGCAGT-3′; reverse primer 5′-GTATTACCGCGGCTGCTGGCAC-3′), carrying (forward primer only) a GC-enriched region (GC clamp), generating 233 bp amplicons. .. The size of the latter was checked by 2% agarose gel electrophoresis.

    Cell Culture:

    Article Title: Viral immunogenicity determines epidemiological fitness in a cohort of DENV-1 infection in Brazil
    Article Snippet: Vero E6 and LLC-MK2 cells (ATCC) were cultured in Minimum Essential Medium (MEM; Cultilab) and HepG2 cells (ATCC) in Dulbecco's Modified Eagle's Medium (DMEM; Cultilab) at 37°C in a 5% CO2 atmosphere. .. PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water.

    Generated:

    Article Title: Chromosome-scale comparative sequence analysis unravels molecular mechanisms of genome dynamics between two wheat cultivars
    Article Snippet: For the identification of the haploblock region, we mapped previously generated Illumina reads of CH Campala Lr22a and CH Campala [ ] to the Chinese Spring pseudomolecule using CLC Main Workbench 7 (Qiagen) with standard parameters. .. The PCR amplification was performed in 20 μl reaction mixture containing 65 ng of genomic DNA, 1 μl of 2.5 mM dNTP’s, 1 μl of 10 μM of each primer and 0.25 units of Sigma Taq polymerase at 60 °C annealing temperature for 35 cycles.

    Article Title: Vertebrate SLRP family evolution and the subfunctionalization of osteoglycin gene duplicates in teleost fish
    Article Snippet: A standard curve relating initial template quantity to amplification cycle was generated using serial dilutions of known concentrations of the target template. .. The templates for the standard curves were generated by conventional PCR using standard conditions, 10 ng cDNA, 1.5 U of Taq polymerase (Readymix Taq PCR Reaction Mix, Sigma-Aldrich) and 200 nM of long-forward and long-reverse primers (Table ) in a final volume of 50 μl. .. PCR products were all sequenced to confirm reaction specificity and PCR products for standards were column purified (Illustra™ GFX™ PCR DNA and Gel Band Purification Kit, GE Healthcare) and quantified (NanoDrop1000; Thermo Scientific).

    CpG Methylation Assay:

    Article Title: Methylomic profiling and replication implicates deregulation of PCSK9 in alcohol use disorder
    Article Snippet: Nested PCR amplifications were performed with a standard PCR protocol in 25 μl volume reactions containing 3-4 μl of sodium-bisulfite-treated DNA, 0.2 μM primers, and master mix containing Taq DNA polymerase (Sigma Aldrich, St. Louis, MO). .. Outside primer sequences were as follows: Forward primer 5′- AGTAGTTAGTTGGTAAGGTTAGT-3′, Reverse primer 5′- ACCTTTTCAATATTTCCTAAATCCA -3′, Inside primer sequences were as follows: Forward primer 5′- GGTTAAGTTTAGAAGGTTGTTAGGT -3′, Reverse primer 5′- CCACCTTATCTCCTACTAACCAA -3′ with a biotin modification on the 5′ end.

    DNA Sequencing:

    Article Title: RNase III Processing of rRNA in the Lyme Disease Spirochete Borrelia burgdorferi
    Article Snippet: The rnc Bb gene ( bb0705 ) was disrupted by replacement with flgBp-aacC1 , which confers gentamicin resistance , as previously described ( , ). .. Genomic regions encompassing 1.3 kb upstream and 1.3 kb downstream of rnc Bb were amplified by PCR using Taq polymerase (Sigma-Aldrich), cloned into pCR2.1-TOPO, confirmed by DNA sequencing, and ligated together. .. The gentamicin resistance cassette was ligated into a synthetic AatII site between the two flanking sequences.

    DNA Labeling:

    Article Title: CRISPR/Cas9-Induced (CTG⋅CAG)n Repeat Instability in the Myotonic Dystrophy Type 1 Locus: Implications for Therapeutic Genome Editing
    Article Snippet: Taq polymerase (Sigma-Aldrich) was used at 1 unit per 10 μL of reaction. .. Taq polymerase (Sigma-Aldrich) was used at 1 unit per 10 μL of reaction.

    Sequencing:

    Article Title: T-ARMS PCR genotyping of SNP rs445709131 using thermostable strand displacement polymerase
    Article Snippet: In T-ARMS PCR, the interaction of primers is a complex phenomenon and may partially depend on its sequence. .. We have reported the standard procedure of T-ARMS PCR for genotyping of the SNP rs445709131 using Taq polymerase (Sigma-Aldrich, USA, Cat.No.D6677) [ ].

    Article Title: Selection for background matching drives sympatric speciation in Wall Gecko
    Article Snippet: Polymerase chain reaction (PCR) amplifications were carried out in 10 μl final volumes containing 20 ng of genomic DNA, 0.50 μM of each primer, 10X PCR buffer (160 mM (NH4)2 SO4 ; 670 mM Tris-HCl pH 8.8; 15 mM MgCl2 ; 0.1% Tween 20), 0.2 U Taq polymerase (SIGMA Dream Taq), 0.25 mM each dNTP. .. Polymerase chain reaction (PCR) amplifications were carried out in 10 μl final volumes containing 20 ng of genomic DNA, 0.50 μM of each primer, 10X PCR buffer (160 mM (NH4)2 SO4 ; 670 mM Tris-HCl pH 8.8; 15 mM MgCl2 ; 0.1% Tween 20), 0.2 U Taq polymerase (SIGMA Dream Taq), 0.25 mM each dNTP.

    Article Title: Characterization of Biosurfactant Produced during Degradation of Hydrocarbons Using Crude Oil As Sole Source of Carbon
    Article Snippet: Polymerase chain reaction (PCR) was performed in a 25 μl volume in thermal cycler (Mastercycler Nexus gradient, Eppendorf, Germany) with a final concentration of 1X standard buffer, 1.5 m mol l−1 MgCl2 , 0.2 μ mol l−1 each primer, 0.2 m mol l−1 dNTPs and 0.25 U Taq DNA polymerase (Sigma Aldrich, USA) and 25 ng of template DNA. .. Polymerase chain reaction (PCR) was performed in a 25 μl volume in thermal cycler (Mastercycler Nexus gradient, Eppendorf, Germany) with a final concentration of 1X standard buffer, 1.5 m mol l−1 MgCl2 , 0.2 μ mol l−1 each primer, 0.2 m mol l−1 dNTPs and 0.25 U Taq DNA polymerase (Sigma Aldrich, USA) and 25 ng of template DNA.

    Article Title: Viral immunogenicity determines epidemiological fitness in a cohort of DENV-1 infection in Brazil
    Article Snippet: PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water. .. PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water.

    Denaturing Gradient Gel Electrophoresis:

    Article Title: Metabolic adaptation to a high-fat diet is associated with a change in the gut microbiota
    Article Snippet: Total DNA was extracted from frozen caecum contents using the TriPure reagent (Roche Diagnostics, Meylan, France) according to the manufacturer's protocol. .. 200 ng DNA were amplified by PCR using a Taq Polymerase (Sigma Aldrich, St Louis, Missouri, USA) and 300 nM denaturing gradient gel electrophoresis (DGGE)-specific 16S rRNA universal primers (forward primer 5′-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAC TCCTACGGGAGGCAGCAGT-3′; reverse primer 5′-GTATTACCGCGGCTGCTGGCAC-3′), carrying (forward primer only) a GC-enriched region (GC clamp), generating 233 bp amplicons. .. The size of the latter was checked by 2% agarose gel electrophoresis.

    Molecular Weight:

    Article Title: CRISPR/Cas9-Induced (CTG⋅CAG)n Repeat Instability in the Myotonic Dystrophy Type 1 Locus: Implications for Therapeutic Genome Editing
    Article Snippet: Taq polymerase (Sigma-Aldrich) was used at 1 unit per 10 μL of reaction. .. Taq polymerase (Sigma-Aldrich) was used at 1 unit per 10 μL of reaction.

    Marker:

    Article Title: CRISPR/Cas9-Induced (CTG⋅CAG)n Repeat Instability in the Myotonic Dystrophy Type 1 Locus: Implications for Therapeutic Genome Editing
    Article Snippet: Taq polymerase (Sigma-Aldrich) was used at 1 unit per 10 μL of reaction. .. Taq polymerase (Sigma-Aldrich) was used at 1 unit per 10 μL of reaction.

    Methylation:

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: Purified cellular DNA was bisulfite-treated using the EZ DNA Methylation-Lightning Kit (Zymoresearch, Irvine, USA) according to the manufacture’s protocol. .. To amplify the Rasal1 and Kl promoter fragments, a touchdown PCR program was performed using Taq DNA Polymerase (Sigma-Aldrich, St. Louis, USA).

    Mutagenesis:

    Article Title: T-ARMS PCR genotyping of SNP rs445709131 using thermostable strand displacement polymerase
    Article Snippet: The current study used a cloned mutant allele (Additional file ) as mutant genotype. .. We have reported the standard procedure of T-ARMS PCR for genotyping of the SNP rs445709131 using Taq polymerase (Sigma-Aldrich, USA, Cat.No.D6677) [ ].

    Article Title: RNase III Processing of rRNA in the Lyme Disease Spirochete Borrelia burgdorferi
    Article Snippet: Paragraph title: Generation of an rnc Bb null mutant in B. burgdorferi . ... Genomic regions encompassing 1.3 kb upstream and 1.3 kb downstream of rnc Bb were amplified by PCR using Taq polymerase (Sigma-Aldrich), cloned into pCR2.1-TOPO, confirmed by DNA sequencing, and ligated together.

    Isolation:

    Article Title: Viral immunogenicity determines epidemiological fitness in a cohort of DENV-1 infection in Brazil
    Article Snippet: PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water. .. PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water.

    Article Title: Cancer testis antigen Sperm Protein 17 as a new target for triple negative breast cancer immunotherapy
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... 1/20 of retro-transcription reaction volume was PCR-amplified in 20 μL reaction with PCR Core kit with Taq DNA polymerase (Sigma-Aldrich, Saint Louis, MO).

    Labeling:

    Article Title: CRISPR/Cas9-Induced (CTG⋅CAG)n Repeat Instability in the Myotonic Dystrophy Type 1 Locus: Implications for Therapeutic Genome Editing
    Article Snippet: Taq polymerase (Sigma-Aldrich) was used at 1 unit per 10 μL of reaction. .. Taq polymerase (Sigma-Aldrich) was used at 1 unit per 10 μL of reaction.

    Purification:

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: Purified cellular DNA was bisulfite-treated using the EZ DNA Methylation-Lightning Kit (Zymoresearch, Irvine, USA) according to the manufacture’s protocol. .. To amplify the Rasal1 and Kl promoter fragments, a touchdown PCR program was performed using Taq DNA Polymerase (Sigma-Aldrich, St. Louis, USA).

    Article Title: Characterization of Biosurfactant Produced during Degradation of Hydrocarbons Using Crude Oil As Sole Source of Carbon
    Article Snippet: Polymerase chain reaction (PCR) was performed in a 25 μl volume in thermal cycler (Mastercycler Nexus gradient, Eppendorf, Germany) with a final concentration of 1X standard buffer, 1.5 m mol l−1 MgCl2 , 0.2 μ mol l−1 each primer, 0.2 m mol l−1 dNTPs and 0.25 U Taq DNA polymerase (Sigma Aldrich, USA) and 25 ng of template DNA. .. The PCR reaction conditions consisted of initial denaturation at 94°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 45 s, and a final extension at 72°C for 7 min. PCR products were analyzed on 1.2% agarose gel and visualized under Bio Doc-It Imaging System (UVP, USA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Viral immunogenicity determines epidemiological fitness in a cohort of DENV-1 infection in Brazil
    Article Snippet: PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water. .. PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water.

    Article Title: Cancer testis antigen Sperm Protein 17 as a new target for triple negative breast cancer immunotherapy
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... 1/20 of retro-transcription reaction volume was PCR-amplified in 20 μL reaction with PCR Core kit with Taq DNA polymerase (Sigma-Aldrich, Saint Louis, MO).

    Gel Extraction:

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: To amplify the Rasal1 and Kl promoter fragments, a touchdown PCR program was performed using Taq DNA Polymerase (Sigma-Aldrich, St. Louis, USA). .. The sequences of the PCR primers are listed in Supplementary Table .

    Nested PCR:

    Article Title: Methylomic profiling and replication implicates deregulation of PCSK9 in alcohol use disorder
    Article Snippet: Sodium bisulfite conversion was carried out using EZ DNA Methylation Gold Kit (Zymo Research, Irvine, CA) according to the manufacturer's instructions on 500 ng of DNA from tested human tissues. .. Nested PCR amplifications were performed with a standard PCR protocol in 25 μl volume reactions containing 3-4 μl of sodium-bisulfite-treated DNA, 0.2 μM primers, and master mix containing Taq DNA polymerase (Sigma Aldrich, St. Louis, MO). .. Primer annealing temperatures for the outside and inside nested PCR were 58.6 and 61.9 degrees C, respectively.

    Article Title: The prevalence of submicroscopic Plasmodium falciparum gametocyte carriage and multiplicity of infection in children, pregnant women and adults in a low malaria transmission area in Southern Ghana
    Article Snippet: The initial outer reaction contained 4 mM of MgCl2 , 200 µM DNTPs, 0.0625 μM of each primer and one unit of Taq DNA polymerase (Sigma-Aldrich, USA). .. The initial outer reaction contained 4 mM of MgCl2 , 200 µM DNTPs, 0.0625 μM of each primer and one unit of Taq DNA polymerase (Sigma-Aldrich, USA).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: T-ARMS PCR genotyping of SNP rs445709131 using thermostable strand displacement polymerase
    Article Snippet: The current study used a cloned mutant allele (Additional file ) as mutant genotype. .. We have reported the standard procedure of T-ARMS PCR for genotyping of the SNP rs445709131 using Taq polymerase (Sigma-Aldrich, USA, Cat.No.D6677) [ ]. .. The SD polymerase (Bioron GmbH, Germany, Cat. No. 108702) T-ARMS PCR reaction mix was different from the standard T-ARMS (Table ).

    Article Title: Intertidal marine sediment harbours Actinobacteria with promising bioactive and biosynthetic potential
    Article Snippet: Similarity, adenylation domain of NRPS system was targeted using the degenerate primers set, NRPSF 5′- CGC GCG CAT GTA CTG GAC NGG NGA YYT -3′ and NRPSR (5′- GGA GTG GCC GCC CAR NYB RAA RAA -3′) . .. Reaction mixture contained 200 µM of each dNTP, 0.5% DMSO (v/v), 1 m M of degenerate primers, 25 ng of genomic DNA and 0.5 units of Taq polymerase (Sigma-Aldrich, USA) in 50 µL of 1X PCR buffer.

    Titration:

    Article Title: Viral immunogenicity determines epidemiological fitness in a cohort of DENV-1 infection in Brazil
    Article Snippet: PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water. .. PCR was performed to amplify an 1,855-bp fragment using 2 μL of cDNA, 5 μL of 10X buffer, 2 μL of dNTPs (10 mM/μL), 2 μL of primers d1s3 and d1a17 (10 μM), 1 μL MgCl2 , 0.25 of Taq DNA polymerase (5 U/μL; Sigma-Aldrich) and DEPC-treated water.

    Plasmid Preparation:

    Article Title: High-fidelity CRISPR/Cas9- based gene-specific hydroxymethylation rescues gene expression and attenuates renal fibrosis
    Article Snippet: To amplify the Rasal1 and Kl promoter fragments, a touchdown PCR program was performed using Taq DNA Polymerase (Sigma-Aldrich, St. Louis, USA). .. The sequences of the PCR primers are listed in Supplementary Table .

    Article Title: RNase III Processing of rRNA in the Lyme Disease Spirochete Borrelia burgdorferi
    Article Snippet: Genomic regions encompassing 1.3 kb upstream and 1.3 kb downstream of rnc Bb were amplified by PCR using Taq polymerase (Sigma-Aldrich), cloned into pCR2.1-TOPO, confirmed by DNA sequencing, and ligated together. .. Genomic regions encompassing 1.3 kb upstream and 1.3 kb downstream of rnc Bb were amplified by PCR using Taq polymerase (Sigma-Aldrich), cloned into pCR2.1-TOPO, confirmed by DNA sequencing, and ligated together.

    Software:

    Article Title: Methylomic profiling and replication implicates deregulation of PCSK9 in alcohol use disorder
    Article Snippet: Nested PCR amplifications were performed with a standard PCR protocol in 25 μl volume reactions containing 3-4 μl of sodium-bisulfite-treated DNA, 0.2 μM primers, and master mix containing Taq DNA polymerase (Sigma Aldrich, St. Louis, MO). .. Outside primer sequences were as follows: Forward primer 5′- AGTAGTTAGTTGGTAAGGTTAGT-3′, Reverse primer 5′- ACCTTTTCAATATTTCCTAAATCCA -3′, Inside primer sequences were as follows: Forward primer 5′- GGTTAAGTTTAGAAGGTTGTTAGGT -3′, Reverse primer 5′- CCACCTTATCTCCTACTAACCAA -3′ with a biotin modification on the 5′ end.

    Article Title: Selection for background matching drives sympatric speciation in Wall Gecko
    Article Snippet: Polymerase chain reaction (PCR) amplifications were carried out in 10 μl final volumes containing 20 ng of genomic DNA, 0.50 μM of each primer, 10X PCR buffer (160 mM (NH4)2 SO4 ; 670 mM Tris-HCl pH 8.8; 15 mM MgCl2 ; 0.1% Tween 20), 0.2 U Taq polymerase (SIGMA Dream Taq), 0.25 mM each dNTP. .. Polymerase chain reaction (PCR) amplifications were carried out in 10 μl final volumes containing 20 ng of genomic DNA, 0.50 μM of each primer, 10X PCR buffer (160 mM (NH4)2 SO4 ; 670 mM Tris-HCl pH 8.8; 15 mM MgCl2 ; 0.1% Tween 20), 0.2 U Taq polymerase (SIGMA Dream Taq), 0.25 mM each dNTP.

    Article Title: Vertebrate SLRP family evolution and the subfunctionalization of osteoglycin gene duplicates in teleost fish
    Article Snippet: Quantification was performed in a StepOnePlus thermocycler (Applied Biosystems) using the standard-curve method (software StepOne™ Real-Time PCR Software v2.2) and the following program: 30 s at 95 °C, 45 cycles of 5 s at 95 °C and 15 s at 60 °C. .. The templates for the standard curves were generated by conventional PCR using standard conditions, 10 ng cDNA, 1.5 U of Taq polymerase (Readymix Taq PCR Reaction Mix, Sigma-Aldrich) and 200 nM of long-forward and long-reverse primers (Table ) in a final volume of 50 μl.

    Article Title: Cancer testis antigen Sperm Protein 17 as a new target for triple negative breast cancer immunotherapy
    Article Snippet: 1/20 of retro-transcription reaction volume was PCR-amplified in 20 μL reaction with PCR Core kit with Taq DNA polymerase (Sigma-Aldrich, Saint Louis, MO). .. 10 μL PCR reaction were run in 2% w/v agarose gel stained with ethidium bromide.

    SYBR Green Assay:

    Article Title: Selection of reference genes suitable for normalization of qPCR data under abiotic stresses in bioenergy crop Arundo donax L.
    Article Snippet: To assess the amplification specificity of each primer pair prior to qPCR analysis, PCR amplification was performed in a total volume of 10 µL containing 1 µl of 6-fold diluted cDNA (8 ng of starting RNA), 1x PCR Buffer, 100 nM dNTPs, 200 nM of each primer, 0.5 unit of Taq polymerase (Sigma) and 4.9 µl of H2 O; The PCR programme was as follows: 8 min at 95 °C, 33 cycles of 40 s at 94 °C, 30 s at 60 °C and 20 s at 72 °C, with 5 min final extension at 72 °C. .. The PCR products were run on 2% agarose gel to check single amplification (Supplementary Figure ).

    Agarose Gel Electrophoresis:

    Article Title: T-ARMS PCR genotyping of SNP rs445709131 using thermostable strand displacement polymerase
    Article Snippet: We have reported the standard procedure of T-ARMS PCR for genotyping of the SNP rs445709131 using Taq polymerase (Sigma-Aldrich, USA, Cat.No.D6677) [ ]. .. We have reported the standard procedure of T-ARMS PCR for genotyping of the SNP rs445709131 using Taq polymerase (Sigma-Aldrich, USA, Cat.No.D6677) [ ].

    Article Title: Intertidal marine sediment harbours Actinobacteria with promising bioactive and biosynthetic potential
    Article Snippet: Reaction mixture contained 200 µM of each dNTP, 0.5% DMSO (v/v), 1 m M of degenerate primers, 25 ng of genomic DNA and 0.5 units of Taq polymerase (Sigma-Aldrich, USA) in 50 µL of 1X PCR buffer. .. The PCR was performed in a BioRad T100 Thermal cycler (BioRad, USA), with the thermal cycling started with initial denaturation at 95 °C for 5 min, followed by a 30 cycles of denaturation at 95 °C for 30 Sec; annealing at either 61 °C (PKS-II) or 63 °C (NRPS) for 45 Sec and extension at 72 °C for 90 Sec, and a final extension at 72 °C for 10 min. Streptomyces kanamyceticus MTCC 324 and Micromonospora echinospora MTCC 930 were used as the positive controls with each set of reactions, while a negative control lacks template.

    Article Title: Cancer testis antigen Sperm Protein 17 as a new target for triple negative breast cancer immunotherapy
    Article Snippet: 1/20 of retro-transcription reaction volume was PCR-amplified in 20 μL reaction with PCR Core kit with Taq DNA polymerase (Sigma-Aldrich, Saint Louis, MO). .. 1/20 of retro-transcription reaction volume was PCR-amplified in 20 μL reaction with PCR Core kit with Taq DNA polymerase (Sigma-Aldrich, Saint Louis, MO).

    DNA Methylation Assay:

    Article Title: Methylomic profiling and replication implicates deregulation of PCSK9 in alcohol use disorder
    Article Snippet: Sodium bisulfite conversion was carried out using EZ DNA Methylation Gold Kit (Zymo Research, Irvine, CA) according to the manufacturer's instructions on 500 ng of DNA from tested human tissues. .. Nested PCR amplifications were performed with a standard PCR protocol in 25 μl volume reactions containing 3-4 μl of sodium-bisulfite-treated DNA, 0.2 μM primers, and master mix containing Taq DNA polymerase (Sigma Aldrich, St. Louis, MO).

    Concentration Assay:

    Article Title: Characterization of Biosurfactant Produced during Degradation of Hydrocarbons Using Crude Oil As Sole Source of Carbon
    Article Snippet: The16S rDNA was PCR amplified using universal primer pair, 968F (AACGCGAAGAACCTTAC) and 1541R (AAGGAGGTGATCCAGCCGCA) (White et al., ). .. Polymerase chain reaction (PCR) was performed in a 25 μl volume in thermal cycler (Mastercycler Nexus gradient, Eppendorf, Germany) with a final concentration of 1X standard buffer, 1.5 m mol l−1 MgCl2 , 0.2 μ mol l−1 each primer, 0.2 m mol l−1 dNTPs and 0.25 U Taq DNA polymerase (Sigma Aldrich, USA) and 25 ng of template DNA. .. The PCR reaction conditions consisted of initial denaturation at 94°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 45 s, and a final extension at 72°C for 7 min. PCR products were analyzed on 1.2% agarose gel and visualized under Bio Doc-It Imaging System (UVP, USA).

    CTG Assay:

    Article Title: Intertidal marine sediment harbours Actinobacteria with promising bioactive and biosynthetic potential
    Article Snippet: Similarity, adenylation domain of NRPS system was targeted using the degenerate primers set, NRPSF 5′- CGC GCG CAT GTA CTG GAC NGG NGA YYT -3′ and NRPSR (5′- GGA GTG GCC GCC CAR NYB RAA RAA -3′) . .. Reaction mixture contained 200 µM of each dNTP, 0.5% DMSO (v/v), 1 m M of degenerate primers, 25 ng of genomic DNA and 0.5 units of Taq polymerase (Sigma-Aldrich, USA) in 50 µL of 1X PCR buffer.

    Staining:

    Article Title: Cancer testis antigen Sperm Protein 17 as a new target for triple negative breast cancer immunotherapy
    Article Snippet: 1/20 of retro-transcription reaction volume was PCR-amplified in 20 μL reaction with PCR Core kit with Taq DNA polymerase (Sigma-Aldrich, Saint Louis, MO). .. 1/20 of retro-transcription reaction volume was PCR-amplified in 20 μL reaction with PCR Core kit with Taq DNA polymerase (Sigma-Aldrich, Saint Louis, MO).

    Article Title: Metabolic adaptation to a high-fat diet is associated with a change in the gut microbiota
    Article Snippet: 200 ng DNA were amplified by PCR using a Taq Polymerase (Sigma Aldrich, St Louis, Missouri, USA) and 300 nM denaturing gradient gel electrophoresis (DGGE)-specific 16S rRNA universal primers (forward primer 5′-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAC TCCTACGGGAGGCAGCAGT-3′; reverse primer 5′-GTATTACCGCGGCTGCTGGCAC-3′), carrying (forward primer only) a GC-enriched region (GC clamp), generating 233 bp amplicons. .. 200 ng DNA were amplified by PCR using a Taq Polymerase (Sigma Aldrich, St Louis, Missouri, USA) and 300 nM denaturing gradient gel electrophoresis (DGGE)-specific 16S rRNA universal primers (forward primer 5′-CGCCCGGGGCGCGCCCCGGGCGGGGCGGGGGCACGGGGGGAC TCCTACGGGAGGCAGCAGT-3′; reverse primer 5′-GTATTACCGCGGCTGCTGGCAC-3′), carrying (forward primer only) a GC-enriched region (GC clamp), generating 233 bp amplicons.

    Variant Assay:

    Article Title: Chromosome-scale comparative sequence analysis unravels molecular mechanisms of genome dynamics between two wheat cultivars
    Article Snippet: The mapped read file was later used for the variant call analysis by CLC Main Workbench 7 (Qiagen) using standard parameters. .. The PCR amplification was performed in 20 μl reaction mixture containing 65 ng of genomic DNA, 1 μl of 2.5 mM dNTP’s, 1 μl of 10 μM of each primer and 0.25 units of Sigma Taq polymerase at 60 °C annealing temperature for 35 cycles.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 82
    Millipore kodxtreme taq polymerase
    Kodxtreme Taq Polymerase, supplied by Millipore, used in various techniques. Bioz Stars score: 82/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kodxtreme taq polymerase/product/Millipore
    Average 82 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    kodxtreme taq polymerase - by Bioz Stars, 2019-12
    82/100 stars
      Buy from Supplier

    80
    Millipore nova taq dna polymerase
    Nova Taq Dna Polymerase, supplied by Millipore, used in various techniques. Bioz Stars score: 80/100, based on 322 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/nova taq dna polymerase/product/Millipore
    Average 80 stars, based on 322 article reviews
    Price from $9.99 to $1999.99
    nova taq dna polymerase - by Bioz Stars, 2019-12
    80/100 stars
      Buy from Supplier

    80
    Millipore kod high fidelity taq polymerase
    Kod High Fidelity Taq Polymerase, supplied by Millipore, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/kod high fidelity taq polymerase/product/Millipore
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    kod high fidelity taq polymerase - by Bioz Stars, 2019-12
    80/100 stars
      Buy from Supplier

    Image Search Results