taq dna ligase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Taq DNA Ligase
    Description:

    Catalog Number:
    M0208L
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs taq dna ligase
    PCR and Gibson assembly using cellular reagents. (a) Schematic depicting cellular PCR followed by cellular Gibson assembly for constructing new plasmids. Bacteria harboring target plasmids are mixed with polymerase-expressing cellular reagents and PCR is initiated by adding appropriate primers, buffer, and dNTP. The resulting PCR products are incubated with cellular reagents expressing Gibson assembly <t>enzymes–Taq</t> <t>DNA</t> polymerase, Taq DNA ligase, and T5 exonuclease–to assemble the new construct. (b) Cellular PCR amplification of vector and insert fragments directly from E . coli bacteria bearing target DNA plasmids using 2 x 10 7 cells of Phusion cellular reagents. Assembly parts include: (i) “pATetO 6XHis full length” vector for two part assembly with Kan r cassette bearing appropriate overlapping ends, and (ii) “pUC19 Fragments 1 and 2” for three part assembly with Kan r cassette whose ends overlap with pUC19 vector fragments. (c) Gibson assembly of agarose gel purified and unpurified cellular PCR products using pure or cellular Gibson assembly reagents. In “negative control” samples the PCR products were incubated in Gibson reaction buffer without pure or cellular Gibson enzymes. “pATetO 6XHis + Kan r ”represents a two part Gibson assembly while “Puc19 Fragment 1 + pUC19 Fragment 2 + Kan r ” represents a three-part Gibson assembly. Representative number of clones recovered in each case in the presence of both ampicillin and kanamycin are reported.

    https://www.bioz.com/result/taq dna ligase/product/New England Biolabs
    Average 99 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    taq dna ligase - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "Cellular reagents for diagnostics and synthetic biology"

    Article Title: Cellular reagents for diagnostics and synthetic biology

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0201681

    PCR and Gibson assembly using cellular reagents. (a) Schematic depicting cellular PCR followed by cellular Gibson assembly for constructing new plasmids. Bacteria harboring target plasmids are mixed with polymerase-expressing cellular reagents and PCR is initiated by adding appropriate primers, buffer, and dNTP. The resulting PCR products are incubated with cellular reagents expressing Gibson assembly enzymes–Taq DNA polymerase, Taq DNA ligase, and T5 exonuclease–to assemble the new construct. (b) Cellular PCR amplification of vector and insert fragments directly from E . coli bacteria bearing target DNA plasmids using 2 x 10 7 cells of Phusion cellular reagents. Assembly parts include: (i) “pATetO 6XHis full length” vector for two part assembly with Kan r cassette bearing appropriate overlapping ends, and (ii) “pUC19 Fragments 1 and 2” for three part assembly with Kan r cassette whose ends overlap with pUC19 vector fragments. (c) Gibson assembly of agarose gel purified and unpurified cellular PCR products using pure or cellular Gibson assembly reagents. In “negative control” samples the PCR products were incubated in Gibson reaction buffer without pure or cellular Gibson enzymes. “pATetO 6XHis + Kan r ”represents a two part Gibson assembly while “Puc19 Fragment 1 + pUC19 Fragment 2 + Kan r ” represents a three-part Gibson assembly. Representative number of clones recovered in each case in the presence of both ampicillin and kanamycin are reported.
    Figure Legend Snippet: PCR and Gibson assembly using cellular reagents. (a) Schematic depicting cellular PCR followed by cellular Gibson assembly for constructing new plasmids. Bacteria harboring target plasmids are mixed with polymerase-expressing cellular reagents and PCR is initiated by adding appropriate primers, buffer, and dNTP. The resulting PCR products are incubated with cellular reagents expressing Gibson assembly enzymes–Taq DNA polymerase, Taq DNA ligase, and T5 exonuclease–to assemble the new construct. (b) Cellular PCR amplification of vector and insert fragments directly from E . coli bacteria bearing target DNA plasmids using 2 x 10 7 cells of Phusion cellular reagents. Assembly parts include: (i) “pATetO 6XHis full length” vector for two part assembly with Kan r cassette bearing appropriate overlapping ends, and (ii) “pUC19 Fragments 1 and 2” for three part assembly with Kan r cassette whose ends overlap with pUC19 vector fragments. (c) Gibson assembly of agarose gel purified and unpurified cellular PCR products using pure or cellular Gibson assembly reagents. In “negative control” samples the PCR products were incubated in Gibson reaction buffer without pure or cellular Gibson enzymes. “pATetO 6XHis + Kan r ”represents a two part Gibson assembly while “Puc19 Fragment 1 + pUC19 Fragment 2 + Kan r ” represents a three-part Gibson assembly. Representative number of clones recovered in each case in the presence of both ampicillin and kanamycin are reported.

    Techniques Used: Polymerase Chain Reaction, Expressing, Incubation, Construct, Amplification, Plasmid Preparation, Agarose Gel Electrophoresis, Purification, Clone Assay

    RNA detection by two-step reverse transcription TaqMan qPCR using cellular reagents for MMLV RT and Taq DNA polymerase. Indicated copies of synthetic RNA template derived from Zika virus genomic sequence were tested using 2 x 10 7 cells each of MMLV RT and Taq DNA polymerase lyophilized cellular reagents. Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are presented. Color of the traces indicate presence (black traces) or absence (red traces) of MMLV RT cellular reagents, or the absence of templates (blue traces). The corresponding derivation of template copies from Cq analyses are tabulated. Cq values were converted to template copies using standard curve analyses of the same RNA samples with commercial qRT-PCR master mix ( S8 Fig ).
    Figure Legend Snippet: RNA detection by two-step reverse transcription TaqMan qPCR using cellular reagents for MMLV RT and Taq DNA polymerase. Indicated copies of synthetic RNA template derived from Zika virus genomic sequence were tested using 2 x 10 7 cells each of MMLV RT and Taq DNA polymerase lyophilized cellular reagents. Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are presented. Color of the traces indicate presence (black traces) or absence (red traces) of MMLV RT cellular reagents, or the absence of templates (blue traces). The corresponding derivation of template copies from Cq analyses are tabulated. Cq values were converted to template copies using standard curve analyses of the same RNA samples with commercial qRT-PCR master mix ( S8 Fig ).

    Techniques Used: RNA Detection, Real-time Polymerase Chain Reaction, Derivative Assay, Sequencing, Amplification, Fluorescence, Generated, Software, Quantitative RT-PCR

    TaqMan qPCR analysis using lyophilized Taq DNA polymerase cellular reagents. Indicated copies of synthetic DNA templates derived from Zika virus genomic sequence were amplified using 2.5 units of pure commercial Taq DNA polymerase (panels a and b) or 2 x 10 7 cells of rehydrated cellular reagents expressing Taq DNA polymerase (panels c and d). Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are depicted in panels a and c. Amplification curve colors distinguish starting template copies–yellow: 60,000 template copies; green: 6000 template copies; blue: 600 template copies; red: 60 template copies; and gray: no template control. These curves depict the real-time kinetics of PCR amplification mediated by pure versus cellular reagents. The corresponding standard curve analyses performed using the “Abs quant” protocol in the LightCycler 96 software are depicted in panels b and d, respectively. Standard curve analyses data for comparing amplification efficiency, linearity, and error are tabulated as insets.
    Figure Legend Snippet: TaqMan qPCR analysis using lyophilized Taq DNA polymerase cellular reagents. Indicated copies of synthetic DNA templates derived from Zika virus genomic sequence were amplified using 2.5 units of pure commercial Taq DNA polymerase (panels a and b) or 2 x 10 7 cells of rehydrated cellular reagents expressing Taq DNA polymerase (panels c and d). Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are depicted in panels a and c. Amplification curve colors distinguish starting template copies–yellow: 60,000 template copies; green: 6000 template copies; blue: 600 template copies; red: 60 template copies; and gray: no template control. These curves depict the real-time kinetics of PCR amplification mediated by pure versus cellular reagents. The corresponding standard curve analyses performed using the “Abs quant” protocol in the LightCycler 96 software are depicted in panels b and d, respectively. Standard curve analyses data for comparing amplification efficiency, linearity, and error are tabulated as insets.

    Techniques Used: Real-time Polymerase Chain Reaction, Derivative Assay, Sequencing, Amplification, Expressing, Fluorescence, Generated, Software, Polymerase Chain Reaction

    2) Product Images from "T5 exonuclease-dependent assembly offers a low-cost method for efficient cloning and site-directed mutagenesis"

    Article Title: T5 exonuclease-dependent assembly offers a low-cost method for efficient cloning and site-directed mutagenesis

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky1169

    Enzymes and buffer components required for TEDA. ( A ) The pKat-eGFP fragment was cloned into SmaI-digested pBluescript SK–. The assembly of the two fragments was used as a model for the test. ( B ) Taq DNA ligase, Phusion DNA polymerase, T5 exonuclease (T5 exo), NAD + were tested for their necessity for the DNA assembly. In addition, Prime-STAR or FastPfu was also used instead of Phusion for testing; ( C ) PEG 8000 and dNTPs were further tested for their necessity for the DNA assembly. The concentrations of relevant components mentioned above were indicated in the figure. The base solution contained 0.1 M Tris–HCl (pH 7.5), 10 mM MgCl 2 and 10 mM dithiothreitol. The reaction was processed at 50°C for 1 h, which was the same as the Gibson assembly. *, Gibson; **, Hot Fusion; **, TEDA with dNTPs and at 50°C; ****, TEDA without dNTPs at 50°C. The data are averages of three parallel experiments with STDEV.
    Figure Legend Snippet: Enzymes and buffer components required for TEDA. ( A ) The pKat-eGFP fragment was cloned into SmaI-digested pBluescript SK–. The assembly of the two fragments was used as a model for the test. ( B ) Taq DNA ligase, Phusion DNA polymerase, T5 exonuclease (T5 exo), NAD + were tested for their necessity for the DNA assembly. In addition, Prime-STAR or FastPfu was also used instead of Phusion for testing; ( C ) PEG 8000 and dNTPs were further tested for their necessity for the DNA assembly. The concentrations of relevant components mentioned above were indicated in the figure. The base solution contained 0.1 M Tris–HCl (pH 7.5), 10 mM MgCl 2 and 10 mM dithiothreitol. The reaction was processed at 50°C for 1 h, which was the same as the Gibson assembly. *, Gibson; **, Hot Fusion; **, TEDA with dNTPs and at 50°C; ****, TEDA without dNTPs at 50°C. The data are averages of three parallel experiments with STDEV.

    Techniques Used: Clone Assay

    Comparison of different assembly methods. ( A ) TEDA was compared with In-fusion and SLIC for the assembly of two fragments. Middle- lacZ and pBBR1MCS5::lacZ-truncated with 15-bp or 20-bp overlaps were used. 1:1, the same molar ratio of the insert to vector was used for DNA assembly; 1:2, double molar amount of the insert to vector was used for DNA assembly. ( B ) TEDA was compared with Gibson and non-optimized TEDA methods. The Pkat-eGFP and SmaI-pSK was used for cloning. TEDA(0.04U)−30°C, 0.04 U T5 exonuclease at 30°C for 40 min; TEDA(0.08 U)−30°C, 0.08 U T5 exonuclease at 30°C for 40 min; TEDA(0.04 U)−50°C, 0.04 U T5 exonuclease at 50°C for 40 min; Gibson, 0.08 U T5 exonuclease with Phusion and Taq DNA ligase at 50°C for 60 min. Neg, DNA fragments were transformed without TEDA treatment. ( C ) TEDA was compared with In-fusion for 4 fragments assembly. The 5Ptac-phbCAB operon was separated into three fragments (Figure 2A ), and they were assembled with linearized pBBR1MCS-2 to generate pBBR1MCS2::5Ptac-phbCAB. The data are averages of three parallel experiments with STDEV.
    Figure Legend Snippet: Comparison of different assembly methods. ( A ) TEDA was compared with In-fusion and SLIC for the assembly of two fragments. Middle- lacZ and pBBR1MCS5::lacZ-truncated with 15-bp or 20-bp overlaps were used. 1:1, the same molar ratio of the insert to vector was used for DNA assembly; 1:2, double molar amount of the insert to vector was used for DNA assembly. ( B ) TEDA was compared with Gibson and non-optimized TEDA methods. The Pkat-eGFP and SmaI-pSK was used for cloning. TEDA(0.04U)−30°C, 0.04 U T5 exonuclease at 30°C for 40 min; TEDA(0.08 U)−30°C, 0.08 U T5 exonuclease at 30°C for 40 min; TEDA(0.04 U)−50°C, 0.04 U T5 exonuclease at 50°C for 40 min; Gibson, 0.08 U T5 exonuclease with Phusion and Taq DNA ligase at 50°C for 60 min. Neg, DNA fragments were transformed without TEDA treatment. ( C ) TEDA was compared with In-fusion for 4 fragments assembly. The 5Ptac-phbCAB operon was separated into three fragments (Figure 2A ), and they were assembled with linearized pBBR1MCS-2 to generate pBBR1MCS2::5Ptac-phbCAB. The data are averages of three parallel experiments with STDEV.

    Techniques Used: Plasmid Preparation, Clone Assay, Transformation Assay

    3) Product Images from "Scarless assembly of unphosphorylated DNA fragments with a simplified DATEL method"

    Article Title: Scarless assembly of unphosphorylated DNA fragments with a simplified DATEL method

    Journal:

    doi: 10.1080/21655979.2017.1308986

    Principle and optimization of sDATEL assembly method. (A) Schematic diagram of sDATEL. The length of overhang was set as 30 nt while the primers for amplifying DNA fragments were designed with 40 nt. After denaturation and annealing, the displaced overhangs at the fork structures were cleaved by Taq DNA polymerase and the nicks were joined by Taq DNA ligase; (B) Schematic diagram of DATEL; (C), (D) and (E) were the effects on the assembly efficiency that caused by pH, NAD+ and Mg2+ , respectively.
    Figure Legend Snippet: Principle and optimization of sDATEL assembly method. (A) Schematic diagram of sDATEL. The length of overhang was set as 30 nt while the primers for amplifying DNA fragments were designed with 40 nt. After denaturation and annealing, the displaced overhangs at the fork structures were cleaved by Taq DNA polymerase and the nicks were joined by Taq DNA ligase; (B) Schematic diagram of DATEL; (C), (D) and (E) were the effects on the assembly efficiency that caused by pH, NAD+ and Mg2+ , respectively.

    Techniques Used:

    4) Product Images from "Cellular reagents for diagnostics and synthetic biology"

    Article Title: Cellular reagents for diagnostics and synthetic biology

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0201681

    RNA detection by two-step reverse transcription TaqMan qPCR using cellular reagents for MMLV RT and Taq DNA polymerase. Indicated copies of synthetic RNA template derived from Zika virus genomic sequence were tested using 2 x 107 cells each of MMLV RT and Taq DNA polymerase lyophilized cellular reagents. Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are presented. Color of the traces indicate presence (black traces) or absence (red traces) of MMLV RT cellular reagents, or the absence of templates (blue traces). The corresponding derivation of template copies from Cq analyses are tabulated. Cq values were converted to template copies using standard curve analyses of the same RNA samples with commercial qRT-PCR master mix .
    Figure Legend Snippet: RNA detection by two-step reverse transcription TaqMan qPCR using cellular reagents for MMLV RT and Taq DNA polymerase. Indicated copies of synthetic RNA template derived from Zika virus genomic sequence were tested using 2 x 107 cells each of MMLV RT and Taq DNA polymerase lyophilized cellular reagents. Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are presented. Color of the traces indicate presence (black traces) or absence (red traces) of MMLV RT cellular reagents, or the absence of templates (blue traces). The corresponding derivation of template copies from Cq analyses are tabulated. Cq values were converted to template copies using standard curve analyses of the same RNA samples with commercial qRT-PCR master mix .

    Techniques Used: RNA Detection, Real-time Polymerase Chain Reaction, Derivative Assay, Sequencing, Amplification, Fluorescence, Generated, Software, Quantitative RT-PCR

    TaqMan qPCR analysis using lyophilized Taq DNA polymerase cellular reagents. Indicated copies of synthetic DNA templates derived from Zika virus genomic sequence were amplified using 2.5 units of pure commercial Taq DNA polymerase (panels a and b) or 2 x 107 cells of rehydrated cellular reagents expressing Taq DNA polymerase (panels c and d). Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are depicted in panels a and c. Amplification curve colors distinguish starting template copies–yellow: 60,000 template copies; green: 6000 template copies; blue: 600 template copies; red: 60 template copies; and gray: no template control. These curves depict the real-time kinetics of PCR amplification mediated by pure versus cellular reagents. The corresponding standard curve analyses performed using the “Abs quant” protocol in the LightCycler 96 software are depicted in panels b and d, respectively. Standard curve analyses data for comparing amplification efficiency, linearity, and error are tabulated as insets.
    Figure Legend Snippet: TaqMan qPCR analysis using lyophilized Taq DNA polymerase cellular reagents. Indicated copies of synthetic DNA templates derived from Zika virus genomic sequence were amplified using 2.5 units of pure commercial Taq DNA polymerase (panels a and b) or 2 x 107 cells of rehydrated cellular reagents expressing Taq DNA polymerase (panels c and d). Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are depicted in panels a and c. Amplification curve colors distinguish starting template copies–yellow: 60,000 template copies; green: 6000 template copies; blue: 600 template copies; red: 60 template copies; and gray: no template control. These curves depict the real-time kinetics of PCR amplification mediated by pure versus cellular reagents. The corresponding standard curve analyses performed using the “Abs quant” protocol in the LightCycler 96 software are depicted in panels b and d, respectively. Standard curve analyses data for comparing amplification efficiency, linearity, and error are tabulated as insets.

    Techniques Used: Real-time Polymerase Chain Reaction, Derivative Assay, Sequencing, Amplification, Expressing, Fluorescence, Generated, Software, Polymerase Chain Reaction

    5) Product Images from "Seamless Insert-Plasmid Assembly at High Efficiency and Low Cost"

    Article Title: Seamless Insert-Plasmid Assembly at High Efficiency and Low Cost

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0153158

    “Dissection” of the Gibson assembly into its component reactions. In the Gibson assembly, single-stranded 3’-overhangs are produced using T5 exonuclease. After insert-to-plasmid annealing at complementary single-stranded DNA ends, gaps are filled-in by Phusion DNA polymerase, and finally, Taq DNA ligase ligates the nicks. Here, we compared the efficiencies at which insert-plasmid mixtures transformed chemically competent E . coli cells. We used untreated insert-plasmid mixtures (co-transformation cloning), insert-plasmid mixtures treated with T5 exonuclease (sequence- and ligation-independent cloning), insert-plasmid mixtures treated with T5 exonuclease and Phusion DNA polymerase (sequence- and ligation-independent cloning plus gap filling), and insert-plasmid mixtures treated with T5 exonuclease, Phusion DNA polymerase and Taq DNA ligase (Gibson assembly). A) Data points represent the number of positive (blue) colonies averaged over three experiments ±SD. B) Data points represent the percentage of positive colonies averaged over three experiments ±SD.
    Figure Legend Snippet: “Dissection” of the Gibson assembly into its component reactions. In the Gibson assembly, single-stranded 3’-overhangs are produced using T5 exonuclease. After insert-to-plasmid annealing at complementary single-stranded DNA ends, gaps are filled-in by Phusion DNA polymerase, and finally, Taq DNA ligase ligates the nicks. Here, we compared the efficiencies at which insert-plasmid mixtures transformed chemically competent E . coli cells. We used untreated insert-plasmid mixtures (co-transformation cloning), insert-plasmid mixtures treated with T5 exonuclease (sequence- and ligation-independent cloning), insert-plasmid mixtures treated with T5 exonuclease and Phusion DNA polymerase (sequence- and ligation-independent cloning plus gap filling), and insert-plasmid mixtures treated with T5 exonuclease, Phusion DNA polymerase and Taq DNA ligase (Gibson assembly). A) Data points represent the number of positive (blue) colonies averaged over three experiments ±SD. B) Data points represent the percentage of positive colonies averaged over three experiments ±SD.

    Techniques Used: Produced, Plasmid Preparation, Transformation Assay, Clone Assay, Sequencing, Ligation

    6) Product Images from "Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)"

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)

    Journal:

    doi:

    Scheme of Limes pathway. One round of Limes can be divided into three different parts: (i) preparation of PCR libraries, (ii) subtractive hybridization and ligation and (iii) purification and amplification of enriched tester sequences. The enriched material can be used for additional rounds of Limes. Initial PCR libraries were prepared by digestion of the subtraction partners with Tsp RI, by subsequent ligation of PCR-competent flanking sequences (N# and A#) to their ends with the Taq DNA ligase and amplification of the ligation products. The primers (S#) for the library amplification were identical to the respective N# primer apart from the lack of a Tsp RI recognition site at their 3′-end. In preparation for the subtractive hybridization, the tester library was digested with Tsp RI again and ligated with a new 5′ flanking N-primer. The driver was digested with Sal I. After denaturation and hybridization of tester to an excess of driver, the pool of perfectly matched tester/tester homohybrids containing the tester-specific sequences was ligated with 3′-biotinylated (closed circle) oligonucleotides and purified by separation with streptavidin-coupled beads (horseshoe-shaped magnet) from driver/driver as well as tester/driver hybrids and all kinds of partial hybrids. The purified sequences were amplified with tester-specific S-primers.
    Figure Legend Snippet: Scheme of Limes pathway. One round of Limes can be divided into three different parts: (i) preparation of PCR libraries, (ii) subtractive hybridization and ligation and (iii) purification and amplification of enriched tester sequences. The enriched material can be used for additional rounds of Limes. Initial PCR libraries were prepared by digestion of the subtraction partners with Tsp RI, by subsequent ligation of PCR-competent flanking sequences (N# and A#) to their ends with the Taq DNA ligase and amplification of the ligation products. The primers (S#) for the library amplification were identical to the respective N# primer apart from the lack of a Tsp RI recognition site at their 3′-end. In preparation for the subtractive hybridization, the tester library was digested with Tsp RI again and ligated with a new 5′ flanking N-primer. The driver was digested with Sal I. After denaturation and hybridization of tester to an excess of driver, the pool of perfectly matched tester/tester homohybrids containing the tester-specific sequences was ligated with 3′-biotinylated (closed circle) oligonucleotides and purified by separation with streptavidin-coupled beads (horseshoe-shaped magnet) from driver/driver as well as tester/driver hybrids and all kinds of partial hybrids. The purified sequences were amplified with tester-specific S-primers.

    Techniques Used: Polymerase Chain Reaction, Hybridization, Ligation, Purification, Amplification

    7) Product Images from "T5 exonuclease-dependent assembly offers a low-cost method for efficient cloning and site-directed mutagenesis"

    Article Title: T5 exonuclease-dependent assembly offers a low-cost method for efficient cloning and site-directed mutagenesis

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky1169

    Enzymes and buffer components required for TEDA. ( A ) The pKat-eGFP fragment was cloned into SmaI-digested pBluescript SK–. The assembly of the two fragments was used as a model for the test. ( B ) Taq DNA ligase, Phusion DNA polymerase, T5 exonuclease (T5 exo), NAD + were tested for their necessity for the DNA assembly. In addition, Prime-STAR or FastPfu was also used instead of Phusion for testing; ( C ) PEG 8000 and dNTPs were further tested for their necessity for the DNA assembly. The concentrations of relevant components mentioned above were indicated in the figure. The base solution contained 0.1 M Tris–HCl (pH 7.5), 10 mM MgCl 2 and 10 mM dithiothreitol. The reaction was processed at 50°C for 1 h, which was the same as the Gibson assembly. *, Gibson; **, Hot Fusion; **, TEDA with dNTPs and at 50°C; ****, TEDA without dNTPs at 50°C. The data are averages of three parallel experiments with STDEV.
    Figure Legend Snippet: Enzymes and buffer components required for TEDA. ( A ) The pKat-eGFP fragment was cloned into SmaI-digested pBluescript SK–. The assembly of the two fragments was used as a model for the test. ( B ) Taq DNA ligase, Phusion DNA polymerase, T5 exonuclease (T5 exo), NAD + were tested for their necessity for the DNA assembly. In addition, Prime-STAR or FastPfu was also used instead of Phusion for testing; ( C ) PEG 8000 and dNTPs were further tested for their necessity for the DNA assembly. The concentrations of relevant components mentioned above were indicated in the figure. The base solution contained 0.1 M Tris–HCl (pH 7.5), 10 mM MgCl 2 and 10 mM dithiothreitol. The reaction was processed at 50°C for 1 h, which was the same as the Gibson assembly. *, Gibson; **, Hot Fusion; **, TEDA with dNTPs and at 50°C; ****, TEDA without dNTPs at 50°C. The data are averages of three parallel experiments with STDEV.

    Techniques Used: Clone Assay

    Comparison of different assembly methods. ( A ) TEDA was compared with In-fusion and SLIC for the assembly of two fragments. Middle- lacZ and pBBR1MCS5::lacZ-truncated with 15-bp or 20-bp overlaps were used. 1:1, the same molar ratio of the insert to vector was used for DNA assembly; 1:2, double molar amount of the insert to vector was used for DNA assembly. ( B ) TEDA was compared with Gibson and non-optimized TEDA methods. The Pkat-eGFP and SmaI-pSK was used for cloning. TEDA(0.04U)−30°C, 0.04 U T5 exonuclease at 30°C for 40 min; TEDA(0.08 U)−30°C, 0.08 U T5 exonuclease at 30°C for 40 min; TEDA(0.04 U)−50°C, 0.04 U T5 exonuclease at 50°C for 40 min; Gibson, 0.08 U T5 exonuclease with Phusion and Taq DNA ligase at 50°C for 60 min. Neg, DNA fragments were transformed without TEDA treatment. ( C ) TEDA was compared with In-fusion for 4 fragments assembly. The 5Ptac-phbCAB operon was separated into three fragments (Figure 2A ), and they were assembled with linearized pBBR1MCS-2 to generate pBBR1MCS2::5Ptac-phbCAB. The data are averages of three parallel experiments with STDEV.
    Figure Legend Snippet: Comparison of different assembly methods. ( A ) TEDA was compared with In-fusion and SLIC for the assembly of two fragments. Middle- lacZ and pBBR1MCS5::lacZ-truncated with 15-bp or 20-bp overlaps were used. 1:1, the same molar ratio of the insert to vector was used for DNA assembly; 1:2, double molar amount of the insert to vector was used for DNA assembly. ( B ) TEDA was compared with Gibson and non-optimized TEDA methods. The Pkat-eGFP and SmaI-pSK was used for cloning. TEDA(0.04U)−30°C, 0.04 U T5 exonuclease at 30°C for 40 min; TEDA(0.08 U)−30°C, 0.08 U T5 exonuclease at 30°C for 40 min; TEDA(0.04 U)−50°C, 0.04 U T5 exonuclease at 50°C for 40 min; Gibson, 0.08 U T5 exonuclease with Phusion and Taq DNA ligase at 50°C for 60 min. Neg, DNA fragments were transformed without TEDA treatment. ( C ) TEDA was compared with In-fusion for 4 fragments assembly. The 5Ptac-phbCAB operon was separated into three fragments (Figure 2A ), and they were assembled with linearized pBBR1MCS-2 to generate pBBR1MCS2::5Ptac-phbCAB. The data are averages of three parallel experiments with STDEV.

    Techniques Used: Plasmid Preparation, Clone Assay, Transformation Assay

    8) Product Images from "Single Nucleotide Polymorphism Genotyping by Nanoparticle-Enhanced SPR Imaging Measurements of Surface Ligation Reactions"

    Article Title: Single Nucleotide Polymorphism Genotyping by Nanoparticle-Enhanced SPR Imaging Measurements of Surface Ligation Reactions

    Journal: Analytical chemistry

    doi: 10.1021/ac0600151

    Schematic representation of the SNP genotyping method based on a combination of surface ligation chemistry and nanoparticle enhanced SPRI. Two array elements with different DNA probes are shown. The array probes ( PA and PG ) differ only by the last nucleotide at their 3′ ends. When target DNA ( T ), ligation probe DNA ( L ) and Taq DNA ligase are simultaneously introduced to the array, surface duplexes form at both array elements. However, ligation only occurs if the duplex is perfectly complementary. After denaturation with 8 M urea, the perfectly matched PG is extended with the L sequence while PA returns to its original state. The presence of L is then detected by the hybridization adsorption of gold nanoparticles modified with oligonucleotides ( LC ) complementary to L .
    Figure Legend Snippet: Schematic representation of the SNP genotyping method based on a combination of surface ligation chemistry and nanoparticle enhanced SPRI. Two array elements with different DNA probes are shown. The array probes ( PA and PG ) differ only by the last nucleotide at their 3′ ends. When target DNA ( T ), ligation probe DNA ( L ) and Taq DNA ligase are simultaneously introduced to the array, surface duplexes form at both array elements. However, ligation only occurs if the duplex is perfectly complementary. After denaturation with 8 M urea, the perfectly matched PG is extended with the L sequence while PA returns to its original state. The presence of L is then detected by the hybridization adsorption of gold nanoparticles modified with oligonucleotides ( LC ) complementary to L .

    Techniques Used: Ligation, Sequencing, Hybridization, Adsorption, Modification, Liquid Chromatography

    9) Product Images from "Bleomycin-induced genome structural variations in normal, non-tumor cells"

    Article Title: Bleomycin-induced genome structural variations in normal, non-tumor cells

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-34580-8

    Ligation-mediated Chimera-Free (LCF) protocol ensures preparation of sequencing libraries virtually free from artificial chimeras. ( A ) LCF protocol outline. LCF is based on assignment of sequencing adapters as single-stranded oligonucleotides at elevated temperature using thermostable Taq DNA ligase. The ligation is facilitated by hybridization of adapter carrying thymine residuals on 3′-end and DNA fragment with A-overhangs at 3′-ends of both strands. At the final step sequencing library is completed by treatment with T4 DNA polymerase in the presence of dNTPs. ( B ) Frequency of artificial chimeras in sequencing libraries prepared with different approaches. ( C ) Spectra of artificial chimeras in sequencing libraries prepared with different approaches. Data in ( B ) shown as the average ± s.d.; n = 3 for each, ligation-based and MuPlus libraries and n = 8 for LCF libraries; statistically significant differences determined by two-tailed t-test.
    Figure Legend Snippet: Ligation-mediated Chimera-Free (LCF) protocol ensures preparation of sequencing libraries virtually free from artificial chimeras. ( A ) LCF protocol outline. LCF is based on assignment of sequencing adapters as single-stranded oligonucleotides at elevated temperature using thermostable Taq DNA ligase. The ligation is facilitated by hybridization of adapter carrying thymine residuals on 3′-end and DNA fragment with A-overhangs at 3′-ends of both strands. At the final step sequencing library is completed by treatment with T4 DNA polymerase in the presence of dNTPs. ( B ) Frequency of artificial chimeras in sequencing libraries prepared with different approaches. ( C ) Spectra of artificial chimeras in sequencing libraries prepared with different approaches. Data in ( B ) shown as the average ± s.d.; n = 3 for each, ligation-based and MuPlus libraries and n = 8 for LCF libraries; statistically significant differences determined by two-tailed t-test.

    Techniques Used: Ligation, Sequencing, Hybridization, Two Tailed Test

    10) Product Images from "Removal of mismatched bases from synthetic genes by enzymatic mismatch cleavage"

    Article Title: Removal of mismatched bases from synthetic genes by enzymatic mismatch cleavage

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gni058

    Synthesis of a functional chloramphenicol acetyltransferase gene with changed codon composition. The ratio r of ‘active clones’ to ‘analyzed clones’ as described in the text is shown for different gene synthesis methods with or without an EMC step. A significant increase of r can be observed only in the cases where EMC is combined with an exonuclease activity present in the reaction or in the later amplification reaction. Prolonged incubation with E.coli endonuclease V results in no detectable product after the amplification steps (ss, single-stranded synthesis, ds, double-stranded synthesis; VII, T4 endonuclease VII; V, E.coli endonuclease V; T, Taq DNA polymerase; and Vn, Vent DNA polymerase).
    Figure Legend Snippet: Synthesis of a functional chloramphenicol acetyltransferase gene with changed codon composition. The ratio r of ‘active clones’ to ‘analyzed clones’ as described in the text is shown for different gene synthesis methods with or without an EMC step. A significant increase of r can be observed only in the cases where EMC is combined with an exonuclease activity present in the reaction or in the later amplification reaction. Prolonged incubation with E.coli endonuclease V results in no detectable product after the amplification steps (ss, single-stranded synthesis, ds, double-stranded synthesis; VII, T4 endonuclease VII; V, E.coli endonuclease V; T, Taq DNA polymerase; and Vn, Vent DNA polymerase).

    Techniques Used: Functional Assay, Clone Assay, Activity Assay, Amplification, Incubation

    11) Product Images from "SNPWaveTM: a flexible multiplexed SNP genotyping technology"

    Article Title: SNPWaveTM: a flexible multiplexed SNP genotyping technology

    Journal:

    doi: 10.1093/nar/gnh045

    Principle of the SNPWave method. Allele-specific ligation probes are hybridized to denatured genomic DNA. SNP allele discrimination is based on the specificity of the Taq ( Thermus aquaticus ) DNA ligase. ( A and B ) Closed circular probes are formed only
    Figure Legend Snippet: Principle of the SNPWave method. Allele-specific ligation probes are hybridized to denatured genomic DNA. SNP allele discrimination is based on the specificity of the Taq ( Thermus aquaticus ) DNA ligase. ( A and B ) Closed circular probes are formed only

    Techniques Used: Ligation

    12) Product Images from "A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli"

    Article Title: A strategy of gene overexpression based on tandem repetitive promoters in Escherichia coli

    Journal: Microbial Cell Factories

    doi: 10.1186/1475-2859-11-19

    Construction outline of the MCP tac s promoter clusters . Fragment 5CP tac s with the flanking sequence was amplified by PCR with p5TG as the template. Fragment 1 was generated by digesting fragment 5CP tac s with BamH I. Fragment 2 was digested from fragment 5CP tac s with BamH I and Hind III. Fragment 3 was linearized from the plasmid p5TG with Hind III. Then, the three fragments were assembled together under the action of T5 exonuclease, Phusion DNA polymerase and Taq DNA ligase in the isothermal process.
    Figure Legend Snippet: Construction outline of the MCP tac s promoter clusters . Fragment 5CP tac s with the flanking sequence was amplified by PCR with p5TG as the template. Fragment 1 was generated by digesting fragment 5CP tac s with BamH I. Fragment 2 was digested from fragment 5CP tac s with BamH I and Hind III. Fragment 3 was linearized from the plasmid p5TG with Hind III. Then, the three fragments were assembled together under the action of T5 exonuclease, Phusion DNA polymerase and Taq DNA ligase in the isothermal process.

    Techniques Used: Sequencing, Amplification, Polymerase Chain Reaction, Generated, Plasmid Preparation

    13) Product Images from "T5 exonuclease-dependent assembly offers a low-cost method for efficient cloning and site-directed mutagenesis"

    Article Title: T5 exonuclease-dependent assembly offers a low-cost method for efficient cloning and site-directed mutagenesis

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky1169

    Enzymes and buffer components required for TEDA. ( A ) The pKat-eGFP fragment was cloned into SmaI-digested pBluescript SK–. The assembly of the two fragments was used as a model for the test. ( B ) Taq DNA ligase, Phusion DNA polymerase, T5 exonuclease (T5 exo), NAD + were tested for their necessity for the DNA assembly. In addition, Prime-STAR or FastPfu was also used instead of Phusion for testing; ( C ) PEG 8000 and dNTPs were further tested for their necessity for the DNA assembly. The concentrations of relevant components mentioned above were indicated in the figure. The base solution contained 0.1 M Tris–HCl (pH 7.5), 10 mM MgCl 2 and 10 mM dithiothreitol. The reaction was processed at 50°C for 1 h, which was the same as the Gibson assembly. *, Gibson; **, Hot Fusion; **, TEDA with dNTPs and at 50°C; ****, TEDA without dNTPs at 50°C. The data are averages of three parallel experiments with STDEV.
    Figure Legend Snippet: Enzymes and buffer components required for TEDA. ( A ) The pKat-eGFP fragment was cloned into SmaI-digested pBluescript SK–. The assembly of the two fragments was used as a model for the test. ( B ) Taq DNA ligase, Phusion DNA polymerase, T5 exonuclease (T5 exo), NAD + were tested for their necessity for the DNA assembly. In addition, Prime-STAR or FastPfu was also used instead of Phusion for testing; ( C ) PEG 8000 and dNTPs were further tested for their necessity for the DNA assembly. The concentrations of relevant components mentioned above were indicated in the figure. The base solution contained 0.1 M Tris–HCl (pH 7.5), 10 mM MgCl 2 and 10 mM dithiothreitol. The reaction was processed at 50°C for 1 h, which was the same as the Gibson assembly. *, Gibson; **, Hot Fusion; **, TEDA with dNTPs and at 50°C; ****, TEDA without dNTPs at 50°C. The data are averages of three parallel experiments with STDEV.

    Techniques Used: Clone Assay

    Comparison of different assembly methods. ( A ) TEDA was compared with In-fusion and SLIC for the assembly of two fragments. Middle- lacZ and pBBR1MCS5::lacZ-truncated with 15-bp or 20-bp overlaps were used. 1:1, the same molar ratio of the insert to vector was used for DNA assembly; 1:2, double molar amount of the insert to vector was used for DNA assembly. ( B ) TEDA was compared with Gibson and non-optimized TEDA methods. The Pkat-eGFP and SmaI-pSK was used for cloning. TEDA(0.04U)−30°C, 0.04 U T5 exonuclease at 30°C for 40 min; TEDA(0.08 U)−30°C, 0.08 U T5 exonuclease at 30°C for 40 min; TEDA(0.04 U)−50°C, 0.04 U T5 exonuclease at 50°C for 40 min; Gibson, 0.08 U T5 exonuclease with Phusion and Taq DNA ligase at 50°C for 60 min. Neg, DNA fragments were transformed without TEDA treatment. ( C ) TEDA was compared with In-fusion for 4 fragments assembly. The 5Ptac-phbCAB operon was separated into three fragments (Figure 2A ), and they were assembled with linearized pBBR1MCS-2 to generate pBBR1MCS2::5Ptac-phbCAB. The data are averages of three parallel experiments with STDEV.
    Figure Legend Snippet: Comparison of different assembly methods. ( A ) TEDA was compared with In-fusion and SLIC for the assembly of two fragments. Middle- lacZ and pBBR1MCS5::lacZ-truncated with 15-bp or 20-bp overlaps were used. 1:1, the same molar ratio of the insert to vector was used for DNA assembly; 1:2, double molar amount of the insert to vector was used for DNA assembly. ( B ) TEDA was compared with Gibson and non-optimized TEDA methods. The Pkat-eGFP and SmaI-pSK was used for cloning. TEDA(0.04U)−30°C, 0.04 U T5 exonuclease at 30°C for 40 min; TEDA(0.08 U)−30°C, 0.08 U T5 exonuclease at 30°C for 40 min; TEDA(0.04 U)−50°C, 0.04 U T5 exonuclease at 50°C for 40 min; Gibson, 0.08 U T5 exonuclease with Phusion and Taq DNA ligase at 50°C for 60 min. Neg, DNA fragments were transformed without TEDA treatment. ( C ) TEDA was compared with In-fusion for 4 fragments assembly. The 5Ptac-phbCAB operon was separated into three fragments (Figure 2A ), and they were assembled with linearized pBBR1MCS-2 to generate pBBR1MCS2::5Ptac-phbCAB. The data are averages of three parallel experiments with STDEV.

    Techniques Used: Plasmid Preparation, Clone Assay, Transformation Assay

    14) Product Images from "T5 exonuclease-dependent assembly offers a low-cost method for efficient cloning and site-directed mutagenesis"

    Article Title: T5 exonuclease-dependent assembly offers a low-cost method for efficient cloning and site-directed mutagenesis

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky1169

    Enzymes and buffer components required for TEDA. ( A ) The pKat-eGFP fragment was cloned into SmaI-digested pBluescript SK–. The assembly of the two fragments was used as a model for the test. ( B ) Taq DNA ligase, Phusion DNA polymerase, T5 exonuclease (T5 exo), NAD + were tested for their necessity for the DNA assembly. In addition, Prime-STAR or FastPfu was also used instead of Phusion for testing; ( C ) PEG 8000 and dNTPs were further tested for their necessity for the DNA assembly. The concentrations of relevant components mentioned above were indicated in the figure. The base solution contained 0.1 M Tris–HCl (pH 7.5), 10 mM MgCl 2 and 10 mM dithiothreitol. The reaction was processed at 50°C for 1 h, which was the same as the Gibson assembly. *, Gibson; **, Hot Fusion; **, TEDA with dNTPs and at 50°C; ****, TEDA without dNTPs at 50°C. The data are averages of three parallel experiments with STDEV.
    Figure Legend Snippet: Enzymes and buffer components required for TEDA. ( A ) The pKat-eGFP fragment was cloned into SmaI-digested pBluescript SK–. The assembly of the two fragments was used as a model for the test. ( B ) Taq DNA ligase, Phusion DNA polymerase, T5 exonuclease (T5 exo), NAD + were tested for their necessity for the DNA assembly. In addition, Prime-STAR or FastPfu was also used instead of Phusion for testing; ( C ) PEG 8000 and dNTPs were further tested for their necessity for the DNA assembly. The concentrations of relevant components mentioned above were indicated in the figure. The base solution contained 0.1 M Tris–HCl (pH 7.5), 10 mM MgCl 2 and 10 mM dithiothreitol. The reaction was processed at 50°C for 1 h, which was the same as the Gibson assembly. *, Gibson; **, Hot Fusion; **, TEDA with dNTPs and at 50°C; ****, TEDA without dNTPs at 50°C. The data are averages of three parallel experiments with STDEV.

    Techniques Used: Clone Assay

    Comparison of different assembly methods. ( A ) TEDA was compared with In-fusion and SLIC for the assembly of two fragments. Middle- lacZ and pBBR1MCS5::lacZ-truncated with 15-bp or 20-bp overlaps were used. 1:1, the same molar ratio of the insert to vector was used for DNA assembly; 1:2, double molar amount of the insert to vector was used for DNA assembly. ( B ) TEDA was compared with Gibson and non-optimized TEDA methods. The Pkat-eGFP and SmaI-pSK was used for cloning. TEDA(0.04U)−30°C, 0.04 U T5 exonuclease at 30°C for 40 min; TEDA(0.08 U)−30°C, 0.08 U T5 exonuclease at 30°C for 40 min; TEDA(0.04 U)−50°C, 0.04 U T5 exonuclease at 50°C for 40 min; Gibson, 0.08 U T5 exonuclease with Phusion and Taq DNA ligase at 50°C for 60 min. Neg, DNA fragments were transformed without TEDA treatment. ( C ) TEDA was compared with In-fusion for 4 fragments assembly. The 5Ptac-phbCAB operon was separated into three fragments (Figure 2A ), and they were assembled with linearized pBBR1MCS-2 to generate pBBR1MCS2::5Ptac-phbCAB. The data are averages of three parallel experiments with STDEV.
    Figure Legend Snippet: Comparison of different assembly methods. ( A ) TEDA was compared with In-fusion and SLIC for the assembly of two fragments. Middle- lacZ and pBBR1MCS5::lacZ-truncated with 15-bp or 20-bp overlaps were used. 1:1, the same molar ratio of the insert to vector was used for DNA assembly; 1:2, double molar amount of the insert to vector was used for DNA assembly. ( B ) TEDA was compared with Gibson and non-optimized TEDA methods. The Pkat-eGFP and SmaI-pSK was used for cloning. TEDA(0.04U)−30°C, 0.04 U T5 exonuclease at 30°C for 40 min; TEDA(0.08 U)−30°C, 0.08 U T5 exonuclease at 30°C for 40 min; TEDA(0.04 U)−50°C, 0.04 U T5 exonuclease at 50°C for 40 min; Gibson, 0.08 U T5 exonuclease with Phusion and Taq DNA ligase at 50°C for 60 min. Neg, DNA fragments were transformed without TEDA treatment. ( C ) TEDA was compared with In-fusion for 4 fragments assembly. The 5Ptac-phbCAB operon was separated into three fragments (Figure 2A ), and they were assembled with linearized pBBR1MCS-2 to generate pBBR1MCS2::5Ptac-phbCAB. The data are averages of three parallel experiments with STDEV.

    Techniques Used: Plasmid Preparation, Clone Assay, Transformation Assay

    15) Product Images from "Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)"

    Article Title: Identification of sample-specific sequences in mammalian cDNA and genomic DNA by the novel ligation-mediated subtraction (Limes)

    Journal:

    doi:

    Scheme of Limes pathway. One round of Limes can be divided into three different parts: (i) preparation of PCR libraries, (ii) subtractive hybridization and ligation and (iii) purification and amplification of enriched tester sequences. The enriched material can be used for additional rounds of Limes. Initial PCR libraries were prepared by digestion of the subtraction partners with Tsp RI, by subsequent ligation of PCR-competent flanking sequences (N# and A#) to their ends with the Taq DNA ligase and amplification of the ligation products. The primers (S#) for the library amplification were identical to the respective N# primer apart from the lack of a Tsp RI recognition site at their 3′-end. In preparation for the subtractive hybridization, the tester library was digested with Tsp RI again and ligated with a new 5′ flanking N-primer. The driver was digested with Sal I. After denaturation and hybridization of tester to an excess of driver, the pool of perfectly matched tester/tester homohybrids containing the tester-specific sequences was ligated with 3′-biotinylated (closed circle) oligonucleotides and purified by separation with streptavidin-coupled beads (horseshoe-shaped magnet) from driver/driver as well as tester/driver hybrids and all kinds of partial hybrids. The purified sequences were amplified with tester-specific S-primers.
    Figure Legend Snippet: Scheme of Limes pathway. One round of Limes can be divided into three different parts: (i) preparation of PCR libraries, (ii) subtractive hybridization and ligation and (iii) purification and amplification of enriched tester sequences. The enriched material can be used for additional rounds of Limes. Initial PCR libraries were prepared by digestion of the subtraction partners with Tsp RI, by subsequent ligation of PCR-competent flanking sequences (N# and A#) to their ends with the Taq DNA ligase and amplification of the ligation products. The primers (S#) for the library amplification were identical to the respective N# primer apart from the lack of a Tsp RI recognition site at their 3′-end. In preparation for the subtractive hybridization, the tester library was digested with Tsp RI again and ligated with a new 5′ flanking N-primer. The driver was digested with Sal I. After denaturation and hybridization of tester to an excess of driver, the pool of perfectly matched tester/tester homohybrids containing the tester-specific sequences was ligated with 3′-biotinylated (closed circle) oligonucleotides and purified by separation with streptavidin-coupled beads (horseshoe-shaped magnet) from driver/driver as well as tester/driver hybrids and all kinds of partial hybrids. The purified sequences were amplified with tester-specific S-primers.

    Techniques Used: Polymerase Chain Reaction, Hybridization, Ligation, Purification, Amplification

    Related Articles

    Clone Assay:

    Article Title: Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome
    Article Snippet: For the PCR screening, 10 clones were pooled in LB medium (12.5 μg ml−1 chloramphenicol) for a total of 10 MTP pools. .. A standard PCR mixture (25 μl) contained 1× Taq 2× master mix (New England BioLabs, Ipswich, United Kingdom) (12.5 μl), 0.4 μM (each) primer (1 μl degenerated primer) (Sigma-Aldrich, Vienna, Austria) (see Table S1 in the supplemental material), ddH2 O (4.25 μl), 5% (vol/vol) dimethyl sulfoxide (DMSO) (1.25 μl), and 5 μl of pooled template DNA.

    Centrifugation:

    Article Title: Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome
    Article Snippet: Denaturation (15 min at 99°C) of MTP cultures (diluted 1:2 in double-distilled water [ddH2 O]) and centrifugation (4,000 rpm, 5 min) were performed in order to make the fosmid DNA accessible to PCR screening with the two previously reported degenerated NRPS1 and NRPS2 primer pairs ( ) which are given in Table S1 in the supplemental material. .. A standard PCR mixture (25 μl) contained 1× Taq 2× master mix (New England BioLabs, Ipswich, United Kingdom) (12.5 μl), 0.4 μM (each) primer (1 μl degenerated primer) (Sigma-Aldrich, Vienna, Austria) (see Table S1 in the supplemental material), ddH2 O (4.25 μl), 5% (vol/vol) dimethyl sulfoxide (DMSO) (1.25 μl), and 5 μl of pooled template DNA.

    Amplification:

    Article Title: Complexity Reduction of Polymorphic Sequences (CRoPS(TM)): A Novel Approach for Large-Scale Polymorphism Discovery in Complex Genomes
    Article Snippet: In short, ligation reactions were carried out in 10 µl volume containing 200–400 ng total genomic DNA, 1×Taq DNA ligase buffer [20 mM tris-HCl, 25 mM KAc, 10 mM MgAc2 , 10 mM dithiothreitol (DTT), 1 mM NAD, 0.1% triton X-100; pH 7.6 at 25°C; New England Biolabs Inc], 2 U Taq DNA ligase (New England Biolabs Inc) and 0.5 fmol of each of the ligation probes. .. After ligation, the mixture was diluted with 30 µl of 1×Taq DNA ligase buffer to 40 µl.

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: After the completion of the amplification, 1 μl of proteinase K (20 mg/ml) was added, then heated at 70°C for 10 min and quenched at 94°C for 15 min. .. The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O.

    Article Title: The Human Myotrophin Variant Attenuates MicroRNA-Let-7 Binding Ability but Not Risk of Left Ventricular Hypertrophy in Human Essential Hypertension
    Article Snippet: Reactions were performed on a thermal cycler Gene Amp PCR system 9600 (Perkin Elmer, Waltham, MA, USA). .. Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O. .. The LDR conditions included initial denaturing at 95°C for 2 min, followed by 35 cycles of denaturing at 94°C for 30 s and annealing at 50°C for 2 min. LDR products (1 μl) were mixed with 1 μl of ROX (ABI, Foster City, CA, USA) and 1 μl of loading buffer, detected in an ABI PRISM 377 DNA Sequencer, and analyzed with Genemapper (ABI, Foster City, CA, USA).

    Article Title: Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas
    Article Snippet: Following PCR amplification, products were further processed by a ligation detection reaction (LDR) that has been described in detail for a variety of additional studies [ , – ]. .. This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA).

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: The PCR amplification included an initial activation step at 95°C for 15 min, denaturation at 94°C for 30 s, primer annealing at 60°C for 90 s, extension at 72°C for 1 min, and final extension at 60°C for 30 min. .. The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: The SNPs I333V, I379V, A665T, and Q687STOP were simultaneously amplified in a 25 μL multiplex PCR using primer sets previously reported ( ). .. Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs).

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: The resulting covalently attached cDNA was amplified by ligation-mediated amplification. .. For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript.

    Article Title: Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase
    Article Snippet: Both sequences were amplified by PCR and restricted with a blunt-end restriction enzyme. .. Taq DNA ligase (New England Biolabs, Beverly, MA) was then added to 12–15 μ g of each product, then thermocycled for 15 cycles as follows: melt at 95°C for 20 s, plunged to 4°C and held for 1 min, ligate at 65°C for 20 min. After digesting any remaining linear DNA using exonucleases I and III (New England Biolabs), the monomeric circular DNA was estimated by denaturing PAGE to comprise ∼99% of the exonuclease-resistant product (see in the ) and was used without further purification.

    Article Title: Suppression of stress induction of the 78-kilodalton glucose regulated protein (GRP78) in cancer by IT-139, an anti-tumor ruthenium small molecule inhibitor
    Article Snippet: Total RNA was extracted using TRIzol (Fisher Scientific). .. Superscript III and oligo(dT) (Fisher Scientific) was used to perform reverse transcription and cDNA was amplified using DNA Taq (NEB). .. RT-PCR was performed using the following primers: GRP78: Forward: 5′-CAGCACAGACAGATTGACCTAT-3′ and Reverse: p3: 5′-GACATCAGCACCGCACTTCTCA-3′; β- actin: Forward: 5′-TCGTGCGTGACATTAAGGAG-3′ and Reverse: 5′-AGCACTGTGTTGGCGTACAG-3′.

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: Genomic DNA was extracted using the AllPrep kit (Qiagen, Germantown, MD, US). .. The MGAT1 gene was PCR amplified using the primers F_CAGGCAAGCCAAAGGCAGCCTTG and R_CTCAGGGACTGCAGGCCTGTCTC (Eurofins Genomics, Louisville, KY, US) with Taq and dNTPs supplied by New England BioLabs (Ipswich, MA, US). .. The PCR product was gel purified using a Zymoclean kit (Zymo Research, Irvine, CA, US) and then sequenced by Sanger method at UC Berkeley, Berkeley, CA, US.

    Synthesized:

    Article Title: The Regulation of Exosporium-Related Genes in Bacillus thuringiensis
    Article Snippet: PCR was performed using Taq and KOD DNA polymerase (New England BioLabs Ltd., Beijing, China). .. PCR was performed using Taq and KOD DNA polymerase (New England BioLabs Ltd., Beijing, China).

    Electrophoresis:

    Article Title:
    Article Snippet: To measure the length of telomeric 3′ G-tails, genomic DNA was isolated from KB-3-1 cells treated with or without HXDV, followed by an oligonucleotide ligation assay according to the published procedure with slight modifications ( ). .. Briefly, reactions (20 μl each) containing genomic DNA (5 μg), [γ-32 P]ATP-labeled CA18 ((CCCTAA)3 ) (2 μl), and Taq DNA ligase (2 μl, 40 units/μl, New England BioLabs) in 1× Taq DNA ligase buffer (20 m m Tris, pH 7.6, 25 m m potassium acetate, 10 m m magnesium acetate, 10 m m dithiothreitol, 1 m m NAD, and 0.1% Triton X-100) were incubated at 45 °C for 5 h, followed by addition of 15 μl of an alkaline formamide dye solution (90% formamide, 10 m m sodium hydroxide, and 1 m m EDTA) and electrophoresis analysis in 8% urea gel. .. HXDV was shown to exhibit anti-proliferative activity against many tumor cells with IC50 values varying in a narrow range of 0.2 to 0.6 μ m ( ).

    Microarray:

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: Paragraph title: High-throughput gene expression screen for proximal apoptosis genes and gene expression profiling by microarray ... For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript.

    Article Title: Mapping chromatin interactions with 5C technology
    Article Snippet: We suggest titrating 3C libraries two-fold over a range of 50,000–800,000 haploid genome equivalents as a starting point. .. Cellular 3C library Control 3C library ( required only when probing by microarray hybridization ) Deionized autoclaved water used in all solutions and dilutions Forward 5C primer pool stocks resuspended in 1X TE (desalted) Reverse 5C primer pool stocks resuspended in 1X TE (desalted and phosphorylated) 80 µM universal tail PCR primer stocks ( reverse microarray PCR primers must be fluorescently labeled at their 5’ ends ) 10 mg/mlNEB Buffer 4 10 mg/ml salmon testes DA (Sigma, cat. no. D7656-1ML) Taq DNA ligase and buffer (NEB, cat. no. M0208S) 10X PCR buffer: 600 mM Tris-SO4 , (pH 8.9), 180 mM (NH4 )2 SO4 50 mM MgSO4 25 mM dNTPs (Invitrogen, cat. no. 10297-117) Taq DNA polymerase (NEB, cat. no. M0273L) or AmpliTaq Gold® (Invitrogen, cat. no. 4398808) QIAquick gel extraction kit (Qiagen, cat. no. 28704) or MinElute PCR purification kit (Qiagen, cat. no. 28004) if libraries are analyzed with microarrays. .. Agarose (Wisent, cat. no. 800-015-CG) 10X Tris-borate-EDTA (TBE) buffer: 890 mM Tris Base, 890 mM Boric Acid, 20 mM EDTA 10 mg/ml ethidium bromide solution (Bio-Rad cat. no. 161–0433) 4X agarose gel loading solution: 10% Ficoll, 0.15% Xylene Cyanol.

    Incubation:

    Article Title:
    Article Snippet: To measure the length of telomeric 3′ G-tails, genomic DNA was isolated from KB-3-1 cells treated with or without HXDV, followed by an oligonucleotide ligation assay according to the published procedure with slight modifications ( ). .. Briefly, reactions (20 μl each) containing genomic DNA (5 μg), [γ-32 P]ATP-labeled CA18 ((CCCTAA)3 ) (2 μl), and Taq DNA ligase (2 μl, 40 units/μl, New England BioLabs) in 1× Taq DNA ligase buffer (20 m m Tris, pH 7.6, 25 m m potassium acetate, 10 m m magnesium acetate, 10 m m dithiothreitol, 1 m m NAD, and 0.1% Triton X-100) were incubated at 45 °C for 5 h, followed by addition of 15 μl of an alkaline formamide dye solution (90% formamide, 10 m m sodium hydroxide, and 1 m m EDTA) and electrophoresis analysis in 8% urea gel. .. HXDV was shown to exhibit anti-proliferative activity against many tumor cells with IC50 values varying in a narrow range of 0.2 to 0.6 μ m ( ).

    Expressing:

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: Paragraph title: High-throughput gene expression screen for proximal apoptosis genes and gene expression profiling by microarray ... For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript.

    Modification:

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: The reporter probes were modified at the 3′ end by the addition of a 17-base sequence (GTAAAACGACGGCCAGT) that is complementary to a biotin-labeled “universal oligonucleotide.” The multiplex OLA reactions were done according to the protocol provided by Luminex Corporation. .. Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs).

    Hybridization:

    Article Title: Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas
    Article Snippet: This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA). .. This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA).

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The ligation product was PCR amplified using biotin-conjugated universal primers.

    Article Title: Mapping chromatin interactions with 5C technology
    Article Snippet: We suggest titrating 3C libraries two-fold over a range of 50,000–800,000 haploid genome equivalents as a starting point. .. Cellular 3C library Control 3C library ( required only when probing by microarray hybridization ) Deionized autoclaved water used in all solutions and dilutions Forward 5C primer pool stocks resuspended in 1X TE (desalted) Reverse 5C primer pool stocks resuspended in 1X TE (desalted and phosphorylated) 80 µM universal tail PCR primer stocks ( reverse microarray PCR primers must be fluorescently labeled at their 5’ ends ) 10 mg/mlNEB Buffer 4 10 mg/ml salmon testes DA (Sigma, cat. no. D7656-1ML) Taq DNA ligase and buffer (NEB, cat. no. M0208S) 10X PCR buffer: 600 mM Tris-SO4 , (pH 8.9), 180 mM (NH4 )2 SO4 50 mM MgSO4 25 mM dNTPs (Invitrogen, cat. no. 10297-117) Taq DNA polymerase (NEB, cat. no. M0273L) or AmpliTaq Gold® (Invitrogen, cat. no. 4398808) QIAquick gel extraction kit (Qiagen, cat. no. 28704) or MinElute PCR purification kit (Qiagen, cat. no. 28004) if libraries are analyzed with microarrays. .. Agarose (Wisent, cat. no. 800-015-CG) 10X Tris-borate-EDTA (TBE) buffer: 890 mM Tris Base, 890 mM Boric Acid, 20 mM EDTA 10 mg/ml ethidium bromide solution (Bio-Rad cat. no. 161–0433) 4X agarose gel loading solution: 10% Ficoll, 0.15% Xylene Cyanol.

    Ligation:

    Article Title: Complexity Reduction of Polymorphic Sequences (CRoPS(TM)): A Novel Approach for Large-Scale Polymorphism Discovery in Complex Genomes
    Article Snippet: SNPWave reactions were carried out as described previously . .. In short, ligation reactions were carried out in 10 µl volume containing 200–400 ng total genomic DNA, 1×Taq DNA ligase buffer [20 mM tris-HCl, 25 mM KAc, 10 mM MgAc2 , 10 mM dithiothreitol (DTT), 1 mM NAD, 0.1% triton X-100; pH 7.6 at 25°C; New England Biolabs Inc], 2 U Taq DNA ligase (New England Biolabs Inc) and 0.5 fmol of each of the ligation probes. .. Next, 10 cycles of repeated denaturation, probe hybridization and ligation were performed in a Perkin Elmer 9700 thermal cycler (Applied Biosystems) using the following profile: initial denaturation for 2 min at 94°C, followed by 10 cycles of 15 s at 94°C and 60 min at 60°C, and storage at 4°C.

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: After the completion of the amplification, 1 μl of proteinase K (20 mg/ml) was added, then heated at 70°C for 10 min and quenched at 94°C for 15 min. .. The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O. .. The LDR was performed using 25 cycles of 94°C for 30 sec and 55°C for 4 min.

    Article Title: Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas
    Article Snippet: Following PCR amplification, products were further processed by a ligation detection reaction (LDR) that has been described in detail for a variety of additional studies [ , – ]. .. This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA).

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs). .. The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: The reporter probes were phosphorylated at the 5′ end to allow ligation in the presence of the appropriate allele specific probe. .. Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs).

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: The resulting covalently attached cDNA was amplified by ligation-mediated amplification. .. For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The ligation product was PCR amplified using biotin-conjugated universal primers.

    Article Title:
    Article Snippet: Paragraph title: Oligonucleotide Ligation Assay ... Briefly, reactions (20 μl each) containing genomic DNA (5 μg), [γ-32 P]ATP-labeled CA18 ((CCCTAA)3 ) (2 μl), and Taq DNA ligase (2 μl, 40 units/μl, New England BioLabs) in 1× Taq DNA ligase buffer (20 m m Tris, pH 7.6, 25 m m potassium acetate, 10 m m magnesium acetate, 10 m m dithiothreitol, 1 m m NAD, and 0.1% Triton X-100) were incubated at 45 °C for 5 h, followed by addition of 15 μl of an alkaline formamide dye solution (90% formamide, 10 m m sodium hydroxide, and 1 m m EDTA) and electrophoresis analysis in 8% urea gel.

    Article Title: Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase
    Article Snippet: After ligation by a thermophilic DNA ligase, however, the closed minicircle is incapable of melting, and hence accumulates in solution. .. Taq DNA ligase (New England Biolabs, Beverly, MA) was then added to 12–15 μ g of each product, then thermocycled for 15 cycles as follows: melt at 95°C for 20 s, plunged to 4°C and held for 1 min, ligate at 65°C for 20 min. After digesting any remaining linear DNA using exonucleases I and III (New England Biolabs), the monomeric circular DNA was estimated by denaturing PAGE to comprise ∼99% of the exonuclease-resistant product (see in the ) and was used without further purification.

    Genomic Sequencing:

    Article Title: Identification of QTLs Associated with Callogenesis and Embryogenesis in Oil Palm Using Genetic Linkage Maps Improved with SSR Markers
    Article Snippet: SSRs developed from E. guineensis expressed sequence tags (ESTs), E. guineensis genomic sequences, E. oleifera genomic sequences and interspecific hybrid (E. guineensis ×E. oleifera) genomic sequences were labeled sEg, sMg, sMo and sMh, respectively. .. PCR was carried out in a 10.0 ul volume containing 100 ng DNA, 1×PCR buffer (NEB, USA), 2 mM of each dNTP (NEB, USA), 2.5 uM of each primer (Fwd 5′-M13, reverse unlabelled primer and dye-M13 primer) and 0.5 U Taq DNA polymerase (NEB, USA).

    Generated:

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: The resulting covalently attached cDNA was amplified by ligation-mediated amplification. .. For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The ligation product was PCR amplified using biotin-conjugated universal primers.

    other:

    Article Title: Novel Quantitative Real-Time LCR for the Sensitive Detection of SNP Frequencies in Pooled DNA: Method Development, Evaluation and Application
    Article Snippet: Moreover, substitution of Taq DNA ligase (protocol 1) by PFU thermostable ligase (protocol 7) did not lead to any considerable improvement regarding LOD and LOQ values ( ).

    Article Title: Self-regulated 1-butanol production in Escherichia coli based on the endogenous fermentative control
    Article Snippet: Taq DNA ligase, Phusion High-Fidelity DNA polymerase, and T5 exonuclease were obtained from New England Biolabs (Ipswich, MA).

    Article Title: Simultaneous detection of 19 K-ras mutations by free-solution conjugate electrophoresis of ligase detection reaction products on glass microchips
    Article Snippet: The reaction mixture consisted of 50 nM each of the discriminating primer – drag-tag conjugate and the 3′ FAM-labeled common primer, 5 nM of the ssDNA template, 40 U of Taq DNA ligase (M0208 New England Biolabs, Ipswich, Massachusetts), and 1 X Taq ligase buffer (20 mM Tris-HCl, 25 mM potassium acetate, 10 mM magnesium acetate, 10 mM dithiothreitol, 1.0 mM NAD, and 0.1% Triton X-100 at pH 7.6) in a final volume of 20 μL.

    DNA Sequencing:

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O. .. The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O.

    DNA Labeling:

    Article Title: High-throughput single-molecule mapping links subtelomeric variants and long-range haplotypes with specific telomeres
    Article Snippet: Paragraph title: DNA labeling ... After labeling, the nicks were ligated with Taq ligase (NEB) in the presence of dNTPs.

    Sequencing:

    Article Title: The Human Myotrophin Variant Attenuates MicroRNA-Let-7 Binding Ability but Not Risk of Left Ventricular Hypertrophy in Human Essential Hypertension
    Article Snippet: Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O. .. Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O.

    Article Title: Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas
    Article Snippet: G6PD genotyping focused on four single nucleotide polymorphism positions identified through Illumina sequence analysis (202G → A, 376A → G, 563C → T and 1311C → T; nucleotide reference information based on wild-type cDNA sequence; GenBank X03674). .. This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA).

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: Paragraph title: SLC25A46 polymorphism routine sequencing ... The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: The reporter probes were modified at the 3′ end by the addition of a 17-base sequence (GTAAAACGACGGCCAGT) that is complementary to a biotin-labeled “universal oligonucleotide.” The multiplex OLA reactions were done according to the protocol provided by Luminex Corporation. .. Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs).

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: The resulting covalently attached cDNA was amplified by ligation-mediated amplification. .. For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The ligation product was PCR amplified using biotin-conjugated universal primers.

    Article Title: Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase
    Article Snippet: Briefly, two double-stranded DNA sequences (each the length of the desired minicircle template) were designed such that the first half of one sequence is complementary to the second half of the other. .. Taq DNA ligase (New England Biolabs, Beverly, MA) was then added to 12–15 μ g of each product, then thermocycled for 15 cycles as follows: melt at 95°C for 20 s, plunged to 4°C and held for 1 min, ligate at 65°C for 20 min. After digesting any remaining linear DNA using exonucleases I and III (New England Biolabs), the monomeric circular DNA was estimated by denaturing PAGE to comprise ∼99% of the exonuclease-resistant product (see in the ) and was used without further purification.

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: Paragraph title: Gene sequencing ... The MGAT1 gene was PCR amplified using the primers F_CAGGCAAGCCAAAGGCAGCCTTG and R_CTCAGGGACTGCAGGCCTGTCTC (Eurofins Genomics, Louisville, KY, US) with Taq and dNTPs supplied by New England BioLabs (Ipswich, MA, US).

    Article Title: Identification of QTLs Associated with Callogenesis and Embryogenesis in Oil Palm Using Genetic Linkage Maps Improved with SSR Markers
    Article Snippet: A 19-bp M13 sequence ( CACGACGTTGTAAAACGAC ) was attached to each of the forward primers (Fwd 5′-M13) and the fluorescent dye (HEX−/6-FAM−/NED-M13). .. PCR was carried out in a 10.0 ul volume containing 100 ng DNA, 1×PCR buffer (NEB, USA), 2 mM of each dNTP (NEB, USA), 2.5 uM of each primer (Fwd 5′-M13, reverse unlabelled primer and dye-M13 primer) and 0.5 U Taq DNA polymerase (NEB, USA).

    Recombinant:

    Article Title: ComEA Is Essential for the Transfer of External DNA into the Periplasm in Naturally Transformable Vibrio cholerae Cells
    Article Snippet: Paragraph title: Recombinant DNA techniques ... Restriction enzymes and DNA modifying enzymes were obtained from New England Biolabs, Taq DNA polymerase (GoTaq) was obtained from Promega and used for colony PCR, and Pwo DNA Polymerase (Roche) was used for high-fidelity PCR amplifications.

    DNA Extraction:

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: Paragraph title: DNA extraction and genotyping ... The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O.

    Fluorescence:

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The products were subsequently stained with streptavidin-phycoerythrin (SAPE) (Invitrogen, Carlsbad, CA).

    Isolation:

    Article Title:
    Article Snippet: To measure the length of telomeric 3′ G-tails, genomic DNA was isolated from KB-3-1 cells treated with or without HXDV, followed by an oligonucleotide ligation assay according to the published procedure with slight modifications ( ). .. Briefly, reactions (20 μl each) containing genomic DNA (5 μg), [γ-32 P]ATP-labeled CA18 ((CCCTAA)3 ) (2 μl), and Taq DNA ligase (2 μl, 40 units/μl, New England BioLabs) in 1× Taq DNA ligase buffer (20 m m Tris, pH 7.6, 25 m m potassium acetate, 10 m m magnesium acetate, 10 m m dithiothreitol, 1 m m NAD, and 0.1% Triton X-100) were incubated at 45 °C for 5 h, followed by addition of 15 μl of an alkaline formamide dye solution (90% formamide, 10 m m sodium hydroxide, and 1 m m EDTA) and electrophoresis analysis in 8% urea gel.

    Labeling:

    Article Title: Mapping chromatin interactions with 5C technology
    Article Snippet: We suggest titrating 3C libraries two-fold over a range of 50,000–800,000 haploid genome equivalents as a starting point. .. Cellular 3C library Control 3C library ( required only when probing by microarray hybridization ) Deionized autoclaved water used in all solutions and dilutions Forward 5C primer pool stocks resuspended in 1X TE (desalted) Reverse 5C primer pool stocks resuspended in 1X TE (desalted and phosphorylated) 80 µM universal tail PCR primer stocks ( reverse microarray PCR primers must be fluorescently labeled at their 5’ ends ) 10 mg/mlNEB Buffer 4 10 mg/ml salmon testes DA (Sigma, cat. no. D7656-1ML) Taq DNA ligase and buffer (NEB, cat. no. M0208S) 10X PCR buffer: 600 mM Tris-SO4 , (pH 8.9), 180 mM (NH4 )2 SO4 50 mM MgSO4 25 mM dNTPs (Invitrogen, cat. no. 10297-117) Taq DNA polymerase (NEB, cat. no. M0273L) or AmpliTaq Gold® (Invitrogen, cat. no. 4398808) QIAquick gel extraction kit (Qiagen, cat. no. 28704) or MinElute PCR purification kit (Qiagen, cat. no. 28004) if libraries are analyzed with microarrays. .. Agarose (Wisent, cat. no. 800-015-CG) 10X Tris-borate-EDTA (TBE) buffer: 890 mM Tris Base, 890 mM Boric Acid, 20 mM EDTA 10 mg/ml ethidium bromide solution (Bio-Rad cat. no. 161–0433) 4X agarose gel loading solution: 10% Ficoll, 0.15% Xylene Cyanol.

    Article Title: High-throughput single-molecule mapping links subtelomeric variants and long-range haplotypes with specific telomeres
    Article Snippet: The nicked DNA was labeled with a fluorescent-dUTP nucleotide analog using Taq polymerase (NEB) for 1 h at 72°C. .. After labeling, the nicks were ligated with Taq ligase (NEB) in the presence of dNTPs. .. The backbone of fluorescently labeled DNA was stained with YOYO-1 (Invitrogen).

    Article Title: Identification of QTLs Associated with Callogenesis and Embryogenesis in Oil Palm Using Genetic Linkage Maps Improved with SSR Markers
    Article Snippet: SSRs developed from E. guineensis expressed sequence tags (ESTs), E. guineensis genomic sequences, E. oleifera genomic sequences and interspecific hybrid (E. guineensis ×E. oleifera) genomic sequences were labeled sEg, sMg, sMo and sMh, respectively. .. PCR was carried out in a 10.0 ul volume containing 100 ng DNA, 1×PCR buffer (NEB, USA), 2 mM of each dNTP (NEB, USA), 2.5 uM of each primer (Fwd 5′-M13, reverse unlabelled primer and dye-M13 primer) and 0.5 U Taq DNA polymerase (NEB, USA).

    Purification:

    Article Title: Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase
    Article Snippet: Both sequences were amplified by PCR and restricted with a blunt-end restriction enzyme. .. Taq DNA ligase (New England Biolabs, Beverly, MA) was then added to 12–15 μ g of each product, then thermocycled for 15 cycles as follows: melt at 95°C for 20 s, plunged to 4°C and held for 1 min, ligate at 65°C for 20 min. After digesting any remaining linear DNA using exonucleases I and III (New England Biolabs), the monomeric circular DNA was estimated by denaturing PAGE to comprise ∼99% of the exonuclease-resistant product (see in the ) and was used without further purification. .. Minicircle template (0.5 nM) was incubated with 8.5 nM T7 RNAP (Fermentas, Hanover, MD) for 10 min in transcription buffer (40 mM Tris-acetate, 10 mM Mg-acetate, 0.05% v/v Tween-20, 10 mM DTT, pH 8.0), supplemented with 1 mM each of ATP, GTP, and CTP (Fermentas) and 20 nM 2′-o-methyl-RNA molecular beacons (Sigma Life Science, The Woodlands, TX); 5 mg/ml heparin (Sigma Life Science) was added to inactivate free T7 RNAP, and incubated for 5 min before the initiation of transcription with the addition of 1 mM UTP (Fermentas).

    Article Title: Mapping chromatin interactions with 5C technology
    Article Snippet: We suggest titrating 3C libraries two-fold over a range of 50,000–800,000 haploid genome equivalents as a starting point. .. Cellular 3C library Control 3C library ( required only when probing by microarray hybridization ) Deionized autoclaved water used in all solutions and dilutions Forward 5C primer pool stocks resuspended in 1X TE (desalted) Reverse 5C primer pool stocks resuspended in 1X TE (desalted and phosphorylated) 80 µM universal tail PCR primer stocks ( reverse microarray PCR primers must be fluorescently labeled at their 5’ ends ) 10 mg/mlNEB Buffer 4 10 mg/ml salmon testes DA (Sigma, cat. no. D7656-1ML) Taq DNA ligase and buffer (NEB, cat. no. M0208S) 10X PCR buffer: 600 mM Tris-SO4 , (pH 8.9), 180 mM (NH4 )2 SO4 50 mM MgSO4 25 mM dNTPs (Invitrogen, cat. no. 10297-117) Taq DNA polymerase (NEB, cat. no. M0273L) or AmpliTaq Gold® (Invitrogen, cat. no. 4398808) QIAquick gel extraction kit (Qiagen, cat. no. 28704) or MinElute PCR purification kit (Qiagen, cat. no. 28004) if libraries are analyzed with microarrays. .. Agarose (Wisent, cat. no. 800-015-CG) 10X Tris-borate-EDTA (TBE) buffer: 890 mM Tris Base, 890 mM Boric Acid, 20 mM EDTA 10 mg/ml ethidium bromide solution (Bio-Rad cat. no. 161–0433) 4X agarose gel loading solution: 10% Ficoll, 0.15% Xylene Cyanol.

    Article Title: High-throughput single-molecule mapping links subtelomeric variants and long-range haplotypes with specific telomeres
    Article Snippet: Specifically, 300 ng of purified genomic DNA was nicked with 7 U nicking endonuclease Nt.BspQI (New England BioLabs, NEB) at 37°C for 2 h in NEB Buffer 3.1. .. After labeling, the nicks were ligated with Taq ligase (NEB) in the presence of dNTPs.

    Polymerase Chain Reaction:

    Article Title: Complexity Reduction of Polymorphic Sequences (CRoPS(TM)): A Novel Approach for Large-Scale Polymorphism Discovery in Complex Genomes
    Article Snippet: In short, ligation reactions were carried out in 10 µl volume containing 200–400 ng total genomic DNA, 1×Taq DNA ligase buffer [20 mM tris-HCl, 25 mM KAc, 10 mM MgAc2 , 10 mM dithiothreitol (DTT), 1 mM NAD, 0.1% triton X-100; pH 7.6 at 25°C; New England Biolabs Inc], 2 U Taq DNA ligase (New England Biolabs Inc) and 0.5 fmol of each of the ligation probes. .. After ligation, the mixture was diluted with 30 µl of 1×Taq DNA ligase buffer to 40 µl.

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: The target DNA sequences were amplified using a multiplex PCR method. .. The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O.

    Article Title: The Human Myotrophin Variant Attenuates MicroRNA-Let-7 Binding Ability but Not Risk of Left Ventricular Hypertrophy in Human Essential Hypertension
    Article Snippet: Reactions were performed on a thermal cycler Gene Amp PCR system 9600 (Perkin Elmer, Waltham, MA, USA). .. Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O.

    Article Title: Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas
    Article Snippet: Following PCR amplification, products were further processed by a ligation detection reaction (LDR) that has been described in detail for a variety of additional studies [ , – ]. .. This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA). .. LDR probes consisted of eight allele-specific oligonucleotides and three fluorescently labelled conserved-sequence oligonucleotides.

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs). .. The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: The reporter probes were modified at the 3′ end by the addition of a 17-base sequence (GTAAAACGACGGCCAGT) that is complementary to a biotin-labeled “universal oligonucleotide.” The multiplex OLA reactions were done according to the protocol provided by Luminex Corporation. .. Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs). .. The OLA reactions were initially heated at 96°C for 2 min, followed by 30 thermal cycles at 94°C for 15 s then 37.0°C for 1 min.

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The ligation product was PCR amplified using biotin-conjugated universal primers.

    Article Title: Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase
    Article Snippet: Both sequences were amplified by PCR and restricted with a blunt-end restriction enzyme. .. Taq DNA ligase (New England Biolabs, Beverly, MA) was then added to 12–15 μ g of each product, then thermocycled for 15 cycles as follows: melt at 95°C for 20 s, plunged to 4°C and held for 1 min, ligate at 65°C for 20 min. After digesting any remaining linear DNA using exonucleases I and III (New England Biolabs), the monomeric circular DNA was estimated by denaturing PAGE to comprise ∼99% of the exonuclease-resistant product (see in the ) and was used without further purification.

    Article Title: Mapping chromatin interactions with 5C technology
    Article Snippet: We suggest titrating 3C libraries two-fold over a range of 50,000–800,000 haploid genome equivalents as a starting point. .. Cellular 3C library Control 3C library ( required only when probing by microarray hybridization ) Deionized autoclaved water used in all solutions and dilutions Forward 5C primer pool stocks resuspended in 1X TE (desalted) Reverse 5C primer pool stocks resuspended in 1X TE (desalted and phosphorylated) 80 µM universal tail PCR primer stocks ( reverse microarray PCR primers must be fluorescently labeled at their 5’ ends ) 10 mg/mlNEB Buffer 4 10 mg/ml salmon testes DA (Sigma, cat. no. D7656-1ML) Taq DNA ligase and buffer (NEB, cat. no. M0208S) 10X PCR buffer: 600 mM Tris-SO4 , (pH 8.9), 180 mM (NH4 )2 SO4 50 mM MgSO4 25 mM dNTPs (Invitrogen, cat. no. 10297-117) Taq DNA polymerase (NEB, cat. no. M0273L) or AmpliTaq Gold® (Invitrogen, cat. no. 4398808) QIAquick gel extraction kit (Qiagen, cat. no. 28704) or MinElute PCR purification kit (Qiagen, cat. no. 28004) if libraries are analyzed with microarrays. .. Agarose (Wisent, cat. no. 800-015-CG) 10X Tris-borate-EDTA (TBE) buffer: 890 mM Tris Base, 890 mM Boric Acid, 20 mM EDTA 10 mg/ml ethidium bromide solution (Bio-Rad cat. no. 161–0433) 4X agarose gel loading solution: 10% Ficoll, 0.15% Xylene Cyanol.

    Article Title: The Regulation of Exosporium-Related Genes in Bacillus thuringiensis
    Article Snippet: The antibiotic concentrations used for bacterial selection were as follows: 100 μg/ml kanamycin and 10 μg/ml erythromycin for Bt, and 100 μg/ml ampicillin for E. coli . .. PCR was performed using Taq and KOD DNA polymerase (New England BioLabs Ltd., Beijing, China). .. Amplified fragments were purified using purification kits (Axygen, Union City, CA, USA).

    Article Title: Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome
    Article Snippet: Denaturation (15 min at 99°C) of MTP cultures (diluted 1:2 in double-distilled water [ddH2 O]) and centrifugation (4,000 rpm, 5 min) were performed in order to make the fosmid DNA accessible to PCR screening with the two previously reported degenerated NRPS1 and NRPS2 primer pairs ( ) which are given in Table S1 in the supplemental material. .. A standard PCR mixture (25 μl) contained 1× Taq 2× master mix (New England BioLabs, Ipswich, United Kingdom) (12.5 μl), 0.4 μM (each) primer (1 μl degenerated primer) (Sigma-Aldrich, Vienna, Austria) (see Table S1 in the supplemental material), ddH2 O (4.25 μl), 5% (vol/vol) dimethyl sulfoxide (DMSO) (1.25 μl), and 5 μl of pooled template DNA. .. The following PCR program was used: 95°C for 5 min; 35 cycles of 95°C for 1 min, 57°C for 1 min, and 68°C for 1 min; and elongation at 68°C for 10 min. PCR products were analyzed by 2% agarose–Tris-acetate-EDTA (TAE) gel electrophoresis.

    Article Title: Suppression of stress induction of the 78-kilodalton glucose regulated protein (GRP78) in cancer by IT-139, an anti-tumor ruthenium small molecule inhibitor
    Article Snippet: Superscript III and oligo(dT) (Fisher Scientific) was used to perform reverse transcription and cDNA was amplified using DNA Taq (NEB). .. Superscript III and oligo(dT) (Fisher Scientific) was used to perform reverse transcription and cDNA was amplified using DNA Taq (NEB).

    Article Title: CRISPR/Cas9 gene editing for the creation of an MGAT1-deficient CHO cell line to control HIV-1 vaccine glycosylation
    Article Snippet: Genomic DNA was extracted using the AllPrep kit (Qiagen, Germantown, MD, US). .. The MGAT1 gene was PCR amplified using the primers F_CAGGCAAGCCAAAGGCAGCCTTG and R_CTCAGGGACTGCAGGCCTGTCTC (Eurofins Genomics, Louisville, KY, US) with Taq and dNTPs supplied by New England BioLabs (Ipswich, MA, US). .. The PCR product was gel purified using a Zymoclean kit (Zymo Research, Irvine, CA, US) and then sequenced by Sanger method at UC Berkeley, Berkeley, CA, US.

    Article Title: Identification of QTLs Associated with Callogenesis and Embryogenesis in Oil Palm Using Genetic Linkage Maps Improved with SSR Markers
    Article Snippet: A 19-bp M13 sequence ( CACGACGTTGTAAAACGAC ) was attached to each of the forward primers (Fwd 5′-M13) and the fluorescent dye (HEX−/6-FAM−/NED-M13). .. PCR was carried out in a 10.0 ul volume containing 100 ng DNA, 1×PCR buffer (NEB, USA), 2 mM of each dNTP (NEB, USA), 2.5 uM of each primer (Fwd 5′-M13, reverse unlabelled primer and dye-M13 primer) and 0.5 U Taq DNA polymerase (NEB, USA). .. PCR was carried out as described by .

    Article Title: ComEA Is Essential for the Transfer of External DNA into the Periplasm in Naturally Transformable Vibrio cholerae Cells
    Article Snippet: Standard molecular biology-based methods were used for DNA manipulations. .. Restriction enzymes and DNA modifying enzymes were obtained from New England Biolabs, Taq DNA polymerase (GoTaq) was obtained from Promega and used for colony PCR, and Pwo DNA Polymerase (Roche) was used for high-fidelity PCR amplifications. .. Modified DNA sequences were verified using Sanger sequencing (Microsynth, CH).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Bending the Rules of Transcriptional Repression: Tightly Looped DNA Directly Represses T7 RNA Polymerase
    Article Snippet: Both sequences were amplified by PCR and restricted with a blunt-end restriction enzyme. .. Taq DNA ligase (New England Biolabs, Beverly, MA) was then added to 12–15 μ g of each product, then thermocycled for 15 cycles as follows: melt at 95°C for 20 s, plunged to 4°C and held for 1 min, ligate at 65°C for 20 min. After digesting any remaining linear DNA using exonucleases I and III (New England Biolabs), the monomeric circular DNA was estimated by denaturing PAGE to comprise ∼99% of the exonuclease-resistant product (see in the ) and was used without further purification. .. Minicircle template (0.5 nM) was incubated with 8.5 nM T7 RNAP (Fermentas, Hanover, MD) for 10 min in transcription buffer (40 mM Tris-acetate, 10 mM Mg-acetate, 0.05% v/v Tween-20, 10 mM DTT, pH 8.0), supplemented with 1 mM each of ATP, GTP, and CTP (Fermentas) and 20 nM 2′-o-methyl-RNA molecular beacons (Sigma Life Science, The Woodlands, TX); 5 mg/ml heparin (Sigma Life Science) was added to inactivate free T7 RNAP, and incubated for 5 min before the initiation of transcription with the addition of 1 mM UTP (Fermentas).

    Staining:

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The PCR products were then captured by hybridization to probes complementary to the barcodes that were linked to uniquely colored polystyrene beads (Luminex, Austin, TX).

    Software:

    Article Title: Complexity Reduction of Polymorphic Sequences (CRoPS(TM)): A Novel Approach for Large-Scale Polymorphism Discovery in Complex Genomes
    Article Snippet: Probes were designed for 30 putative SNPs in two multiplex (15-plex) SNPWave assays using ProbeDesigner software (Keygene N.V.) as described previously . .. In short, ligation reactions were carried out in 10 µl volume containing 200–400 ng total genomic DNA, 1×Taq DNA ligase buffer [20 mM tris-HCl, 25 mM KAc, 10 mM MgAc2 , 10 mM dithiothreitol (DTT), 1 mM NAD, 0.1% triton X-100; pH 7.6 at 25°C; New England Biolabs Inc], 2 U Taq DNA ligase (New England Biolabs Inc) and 0.5 fmol of each of the ligation probes.

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs). .. The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: Each allele specific probe was modified at the 5′ end by the addition of a unique 24-base FlexMAP TAG sequence (Luminex Corporation) using TAG-IT software (TM Biosciences). .. Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs).

    Multiplex Assay:

    Article Title: Complexity Reduction of Polymorphic Sequences (CRoPS(TM)): A Novel Approach for Large-Scale Polymorphism Discovery in Complex Genomes
    Article Snippet: Probes were designed for 30 putative SNPs in two multiplex (15-plex) SNPWave assays using ProbeDesigner software (Keygene N.V.) as described previously . .. In short, ligation reactions were carried out in 10 µl volume containing 200–400 ng total genomic DNA, 1×Taq DNA ligase buffer [20 mM tris-HCl, 25 mM KAc, 10 mM MgAc2 , 10 mM dithiothreitol (DTT), 1 mM NAD, 0.1% triton X-100; pH 7.6 at 25°C; New England Biolabs Inc], 2 U Taq DNA ligase (New England Biolabs Inc) and 0.5 fmol of each of the ligation probes.

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: The target DNA sequences were amplified using a multiplex PCR method. .. The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O.

    Article Title: The Human Myotrophin Variant Attenuates MicroRNA-Let-7 Binding Ability but Not Risk of Left Ventricular Hypertrophy in Human Essential Hypertension
    Article Snippet: Reactions were performed on a thermal cycler Gene Amp PCR system 9600 (Perkin Elmer, Waltham, MA, USA). .. Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O. .. The LDR conditions included initial denaturing at 95°C for 2 min, followed by 35 cycles of denaturing at 94°C for 30 s and annealing at 50°C for 2 min. LDR products (1 μl) were mixed with 1 μl of ROX (ABI, Foster City, CA, USA) and 1 μl of loading buffer, detected in an ABI PRISM 377 DNA Sequencer, and analyzed with Genemapper (ABI, Foster City, CA, USA).

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: The PCR amplification was performed in a final volume of 10 μl using a Qiagen Multiplex PCR Kit, 10−50 ng of template DNA and 2.0 pmol of each primer. .. The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Article Title: Genetic Variants in TAP Are Associated with High-Grade Cervical Neoplasia
    Article Snippet: Paragraph title: Multiplex PCR and OLA ... Briefly, the OLA reactions were done in a final volume of 20 AL containing 1× Taq DNA Ligase Buffer [20 mmol/L Tris-HCl buffer (pH 7.6),25 mmol/L potassium acetate, 10 mmol/L magnesium acetate,1 mmol/L NAD+, 10 mmol/L dithiothrietol, 0.1% Triton X-100; New England Biolabs], 5 nmol/L of each allele specific probe,250 nmol/L of each reporter probe,5 AL of multiplexed PCR product, and 10 units of Taq DNA ligase (New England Biolabs).

    Selection:

    Article Title: The Human Myotrophin Variant Attenuates MicroRNA-Let-7 Binding Ability but Not Risk of Left Ventricular Hypertrophy in Human Essential Hypertension
    Article Snippet: Paragraph title: Gene variant selection and genotyping ... Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O.

    Agarose Gel Electrophoresis:

    Article Title: Suppression of stress induction of the 78-kilodalton glucose regulated protein (GRP78) in cancer by IT-139, an anti-tumor ruthenium small molecule inhibitor
    Article Snippet: Superscript III and oligo(dT) (Fisher Scientific) was used to perform reverse transcription and cDNA was amplified using DNA Taq (NEB). .. Superscript III and oligo(dT) (Fisher Scientific) was used to perform reverse transcription and cDNA was amplified using DNA Taq (NEB).

    Activation Assay:

    Article Title: Bovine and murine models highlight novel roles for SLC25A46 in mitochondrial dynamics and metabolism, with implications for human and animal healthNovel Insights into SLC25A46-Related Pathologies in a Genetic Mouse Model
    Article Snippet: The PCR amplification included an initial activation step at 95°C for 15 min, denaturation at 94°C for 30 s, primer annealing at 60°C for 90 s, extension at 72°C for 1 min, and final extension at 60°C for 30 min. .. The reaction contained 2 pmol of each probe, 1.5 U of Taq DNA Ligase and reaction buffer (New ENGLAND BioLabs).

    Concentration Assay:

    Article Title: Mining for Nonribosomal Peptide Synthetase and Polyketide Synthase Genes Revealed a High Level of Diversity in the Sphagnum Bog Metagenome
    Article Snippet: MTP cultures were grown at 37°C overnight with shaking at 225 rpm and were finally stored at −70°C after addition of glycerol to each well to achieve a final concentration of 25% (vol/vol). .. A standard PCR mixture (25 μl) contained 1× Taq 2× master mix (New England BioLabs, Ipswich, United Kingdom) (12.5 μl), 0.4 μM (each) primer (1 μl degenerated primer) (Sigma-Aldrich, Vienna, Austria) (see Table S1 in the supplemental material), ddH2 O (4.25 μl), 5% (vol/vol) dimethyl sulfoxide (DMSO) (1.25 μl), and 5 μl of pooled template DNA.

    DNA Purification:

    Article Title: Lack of Family-Based Association between Common Variations in WNK1 and Blood Pressure Level
    Article Snippet: Genomic DNA was extracted from whole blood using the Maxwell 16 DNA Purification Kit (Promega Corporation, Madison, WI). .. The ligation reaction for each subject was carried out in a final volume of 10 μl containing 2 μl of multi-PCR product, 1 μl of probe, 0.125 μl of 40 U/μl Taq DNA ligase (NEB, USA), 1 μl of 10× Taq DNA ligase buffer, and 6 μl H2 O.

    High Throughput Screening Assay:

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: Paragraph title: High-throughput gene expression screen for proximal apoptosis genes and gene expression profiling by microarray ... For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript.

    Gel Extraction:

    Article Title: Mapping chromatin interactions with 5C technology
    Article Snippet: We suggest titrating 3C libraries two-fold over a range of 50,000–800,000 haploid genome equivalents as a starting point. .. Cellular 3C library Control 3C library ( required only when probing by microarray hybridization ) Deionized autoclaved water used in all solutions and dilutions Forward 5C primer pool stocks resuspended in 1X TE (desalted) Reverse 5C primer pool stocks resuspended in 1X TE (desalted and phosphorylated) 80 µM universal tail PCR primer stocks ( reverse microarray PCR primers must be fluorescently labeled at their 5’ ends ) 10 mg/mlNEB Buffer 4 10 mg/ml salmon testes DA (Sigma, cat. no. D7656-1ML) Taq DNA ligase and buffer (NEB, cat. no. M0208S) 10X PCR buffer: 600 mM Tris-SO4 , (pH 8.9), 180 mM (NH4 )2 SO4 50 mM MgSO4 25 mM dNTPs (Invitrogen, cat. no. 10297-117) Taq DNA polymerase (NEB, cat. no. M0273L) or AmpliTaq Gold® (Invitrogen, cat. no. 4398808) QIAquick gel extraction kit (Qiagen, cat. no. 28704) or MinElute PCR purification kit (Qiagen, cat. no. 28004) if libraries are analyzed with microarrays. .. Agarose (Wisent, cat. no. 800-015-CG) 10X Tris-borate-EDTA (TBE) buffer: 890 mM Tris Base, 890 mM Boric Acid, 20 mM EDTA 10 mg/ml ethidium bromide solution (Bio-Rad cat. no. 161–0433) 4X agarose gel loading solution: 10% Ficoll, 0.15% Xylene Cyanol.

    Variant Assay:

    Article Title: The Human Myotrophin Variant Attenuates MicroRNA-Let-7 Binding Ability but Not Risk of Left Ventricular Hypertrophy in Human Essential Hypertension
    Article Snippet: Paragraph title: Gene variant selection and genotyping ... Further amplification was performed in a 10 μl volume of multiplex LDR reaction mixture, containing 1 μl (100 ng) of the resultant probe mix, 1 μl of probe mix, 0.05 μl of NEB Taq DNA ligase and 7.95 μl of ddH2 O.

    Luminex:

    Article Title: Prevalence and genetic variants of G6PD deficiency among two Malagasy populations living in Plasmodium vivax-endemic areas
    Article Snippet: This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA). .. This LDR was performed in a reaction mixture (15 μL) containing 20 mM Tris–HCl buffer (pH 7.6), 25 mM potassium acetate, 10 mM magnesium acetate, 1 mM NAD+ , 10 mM DTT, 0.1% Triton X-100, 13 nM each LDR probe, 1 μL of PCR product, and 2 units of Taq DNA ligase (New England BioLabs, Ipswich, MA).

    Article Title: Chemical Genomics Identifies Small-Molecule MCL1 Repressors and BCL-xL as a Predictor of MCL1 Dependency
    Article Snippet: For each gene to be assayed, upstream and downstream probes with unique barcode tag and universal primer sites were annealed to targeted cDNA and ligation by Taq DNA ligase (New England Biolabs, Ipswich, MA) generated a sequence complementary to the transcript. .. The ligation product was PCR amplified using biotin-conjugated universal primers.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs taq dna ligase
    PCR and Gibson assembly using cellular reagents. (a) Schematic depicting cellular PCR followed by cellular Gibson assembly for constructing new plasmids. Bacteria harboring target plasmids are mixed with polymerase-expressing cellular reagents and PCR is initiated by adding appropriate primers, buffer, and dNTP. The resulting PCR products are incubated with cellular reagents expressing Gibson assembly <t>enzymes–Taq</t> <t>DNA</t> polymerase, Taq DNA ligase, and T5 exonuclease–to assemble the new construct. (b) Cellular PCR amplification of vector and insert fragments directly from E . coli bacteria bearing target DNA plasmids using 2 x 10 7 cells of Phusion cellular reagents. Assembly parts include: (i) “pATetO 6XHis full length” vector for two part assembly with Kan r cassette bearing appropriate overlapping ends, and (ii) “pUC19 Fragments 1 and 2” for three part assembly with Kan r cassette whose ends overlap with pUC19 vector fragments. (c) Gibson assembly of agarose gel purified and unpurified cellular PCR products using pure or cellular Gibson assembly reagents. In “negative control” samples the PCR products were incubated in Gibson reaction buffer without pure or cellular Gibson enzymes. “pATetO 6XHis + Kan r ”represents a two part Gibson assembly while “Puc19 Fragment 1 + pUC19 Fragment 2 + Kan r ” represents a three-part Gibson assembly. Representative number of clones recovered in each case in the presence of both ampicillin and kanamycin are reported.
    Taq Dna Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 108 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna ligase/product/New England Biolabs
    Average 99 stars, based on 108 article reviews
    Price from $9.99 to $1999.99
    taq dna ligase - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    PCR and Gibson assembly using cellular reagents. (a) Schematic depicting cellular PCR followed by cellular Gibson assembly for constructing new plasmids. Bacteria harboring target plasmids are mixed with polymerase-expressing cellular reagents and PCR is initiated by adding appropriate primers, buffer, and dNTP. The resulting PCR products are incubated with cellular reagents expressing Gibson assembly enzymes–Taq DNA polymerase, Taq DNA ligase, and T5 exonuclease–to assemble the new construct. (b) Cellular PCR amplification of vector and insert fragments directly from E . coli bacteria bearing target DNA plasmids using 2 x 10 7 cells of Phusion cellular reagents. Assembly parts include: (i) “pATetO 6XHis full length” vector for two part assembly with Kan r cassette bearing appropriate overlapping ends, and (ii) “pUC19 Fragments 1 and 2” for three part assembly with Kan r cassette whose ends overlap with pUC19 vector fragments. (c) Gibson assembly of agarose gel purified and unpurified cellular PCR products using pure or cellular Gibson assembly reagents. In “negative control” samples the PCR products were incubated in Gibson reaction buffer without pure or cellular Gibson enzymes. “pATetO 6XHis + Kan r ”represents a two part Gibson assembly while “Puc19 Fragment 1 + pUC19 Fragment 2 + Kan r ” represents a three-part Gibson assembly. Representative number of clones recovered in each case in the presence of both ampicillin and kanamycin are reported.

    Journal: PLoS ONE

    Article Title: Cellular reagents for diagnostics and synthetic biology

    doi: 10.1371/journal.pone.0201681

    Figure Lengend Snippet: PCR and Gibson assembly using cellular reagents. (a) Schematic depicting cellular PCR followed by cellular Gibson assembly for constructing new plasmids. Bacteria harboring target plasmids are mixed with polymerase-expressing cellular reagents and PCR is initiated by adding appropriate primers, buffer, and dNTP. The resulting PCR products are incubated with cellular reagents expressing Gibson assembly enzymes–Taq DNA polymerase, Taq DNA ligase, and T5 exonuclease–to assemble the new construct. (b) Cellular PCR amplification of vector and insert fragments directly from E . coli bacteria bearing target DNA plasmids using 2 x 10 7 cells of Phusion cellular reagents. Assembly parts include: (i) “pATetO 6XHis full length” vector for two part assembly with Kan r cassette bearing appropriate overlapping ends, and (ii) “pUC19 Fragments 1 and 2” for three part assembly with Kan r cassette whose ends overlap with pUC19 vector fragments. (c) Gibson assembly of agarose gel purified and unpurified cellular PCR products using pure or cellular Gibson assembly reagents. In “negative control” samples the PCR products were incubated in Gibson reaction buffer without pure or cellular Gibson enzymes. “pATetO 6XHis + Kan r ”represents a two part Gibson assembly while “Puc19 Fragment 1 + pUC19 Fragment 2 + Kan r ” represents a three-part Gibson assembly. Representative number of clones recovered in each case in the presence of both ampicillin and kanamycin are reported.

    Article Snippet: Assemblies using pure enzymes contained 0.08 units of T5 exonuclease (NEB), 0.5 units of Phusion DNA polymerase (NEB) and 80 units of Taq DNA ligase (NEB).

    Techniques: Polymerase Chain Reaction, Expressing, Incubation, Construct, Amplification, Plasmid Preparation, Agarose Gel Electrophoresis, Purification, Clone Assay

    RNA detection by two-step reverse transcription TaqMan qPCR using cellular reagents for MMLV RT and Taq DNA polymerase. Indicated copies of synthetic RNA template derived from Zika virus genomic sequence were tested using 2 x 10 7 cells each of MMLV RT and Taq DNA polymerase lyophilized cellular reagents. Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are presented. Color of the traces indicate presence (black traces) or absence (red traces) of MMLV RT cellular reagents, or the absence of templates (blue traces). The corresponding derivation of template copies from Cq analyses are tabulated. Cq values were converted to template copies using standard curve analyses of the same RNA samples with commercial qRT-PCR master mix ( S8 Fig ).

    Journal: PLoS ONE

    Article Title: Cellular reagents for diagnostics and synthetic biology

    doi: 10.1371/journal.pone.0201681

    Figure Lengend Snippet: RNA detection by two-step reverse transcription TaqMan qPCR using cellular reagents for MMLV RT and Taq DNA polymerase. Indicated copies of synthetic RNA template derived from Zika virus genomic sequence were tested using 2 x 10 7 cells each of MMLV RT and Taq DNA polymerase lyophilized cellular reagents. Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are presented. Color of the traces indicate presence (black traces) or absence (red traces) of MMLV RT cellular reagents, or the absence of templates (blue traces). The corresponding derivation of template copies from Cq analyses are tabulated. Cq values were converted to template copies using standard curve analyses of the same RNA samples with commercial qRT-PCR master mix ( S8 Fig ).

    Article Snippet: Assemblies using pure enzymes contained 0.08 units of T5 exonuclease (NEB), 0.5 units of Phusion DNA polymerase (NEB) and 80 units of Taq DNA ligase (NEB).

    Techniques: RNA Detection, Real-time Polymerase Chain Reaction, Derivative Assay, Sequencing, Amplification, Fluorescence, Generated, Software, Quantitative RT-PCR

    TaqMan qPCR analysis using lyophilized Taq DNA polymerase cellular reagents. Indicated copies of synthetic DNA templates derived from Zika virus genomic sequence were amplified using 2.5 units of pure commercial Taq DNA polymerase (panels a and b) or 2 x 10 7 cells of rehydrated cellular reagents expressing Taq DNA polymerase (panels c and d). Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are depicted in panels a and c. Amplification curve colors distinguish starting template copies–yellow: 60,000 template copies; green: 6000 template copies; blue: 600 template copies; red: 60 template copies; and gray: no template control. These curves depict the real-time kinetics of PCR amplification mediated by pure versus cellular reagents. The corresponding standard curve analyses performed using the “Abs quant” protocol in the LightCycler 96 software are depicted in panels b and d, respectively. Standard curve analyses data for comparing amplification efficiency, linearity, and error are tabulated as insets.

    Journal: PLoS ONE

    Article Title: Cellular reagents for diagnostics and synthetic biology

    doi: 10.1371/journal.pone.0201681

    Figure Lengend Snippet: TaqMan qPCR analysis using lyophilized Taq DNA polymerase cellular reagents. Indicated copies of synthetic DNA templates derived from Zika virus genomic sequence were amplified using 2.5 units of pure commercial Taq DNA polymerase (panels a and b) or 2 x 10 7 cells of rehydrated cellular reagents expressing Taq DNA polymerase (panels c and d). Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are depicted in panels a and c. Amplification curve colors distinguish starting template copies–yellow: 60,000 template copies; green: 6000 template copies; blue: 600 template copies; red: 60 template copies; and gray: no template control. These curves depict the real-time kinetics of PCR amplification mediated by pure versus cellular reagents. The corresponding standard curve analyses performed using the “Abs quant” protocol in the LightCycler 96 software are depicted in panels b and d, respectively. Standard curve analyses data for comparing amplification efficiency, linearity, and error are tabulated as insets.

    Article Snippet: Assemblies using pure enzymes contained 0.08 units of T5 exonuclease (NEB), 0.5 units of Phusion DNA polymerase (NEB) and 80 units of Taq DNA ligase (NEB).

    Techniques: Real-time Polymerase Chain Reaction, Derivative Assay, Sequencing, Amplification, Expressing, Fluorescence, Generated, Software, Polymerase Chain Reaction

    Single strand binding protein, ET SSB, only has a minor effect on the reduction of artifacts. Taq (NE Biolabs) and AccuPrime Pfx (Life Technologies) DNA polymerases were used in amplification of TALE DNA repeats. The arrows indicate the expected size of the amplification products. PCR conditions are given in the supplementary material .

    Journal: Scientific Reports

    Article Title: PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications

    doi: 10.1038/srep05052

    Figure Lengend Snippet: Single strand binding protein, ET SSB, only has a minor effect on the reduction of artifacts. Taq (NE Biolabs) and AccuPrime Pfx (Life Technologies) DNA polymerases were used in amplification of TALE DNA repeats. The arrows indicate the expected size of the amplification products. PCR conditions are given in the supplementary material .

    Article Snippet: Even the use of a non-proofreading but robust DNA polymerase, Taq (NE Biolabs) failed to amplify only the desired fragment ( ).

    Techniques: Binding Assay, Amplification, Polymerase Chain Reaction

    Primers that anneal far away from the repetitive DNA perform much better in amplifying the desired product. Taq DNA polymerase (NE Biolabs) was used in the PCR amplification of the indicated region of the pdTALE12 plasmid. PCR conditions are given in the supplementary material .

    Journal: Scientific Reports

    Article Title: PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications

    doi: 10.1038/srep05052

    Figure Lengend Snippet: Primers that anneal far away from the repetitive DNA perform much better in amplifying the desired product. Taq DNA polymerase (NE Biolabs) was used in the PCR amplification of the indicated region of the pdTALE12 plasmid. PCR conditions are given in the supplementary material .

    Article Snippet: Even the use of a non-proofreading but robust DNA polymerase, Taq (NE Biolabs) failed to amplify only the desired fragment ( ).

    Techniques: Polymerase Chain Reaction, Amplification, Plasmid Preparation

    PCR fragments generated upon a typical PCR amplification from the pTAL2 vector with 12.5 TALE DNA-binding repeats. Plasmid map is shown in Supplementary Fig. 3 . Proofreading Pfu polymerase (Bioline) and normal Taq polymerase (NE Biolabs) were used in PCR amplification. PCR conditions are described in the supplementary material .

    Journal: Scientific Reports

    Article Title: PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications

    doi: 10.1038/srep05052

    Figure Lengend Snippet: PCR fragments generated upon a typical PCR amplification from the pTAL2 vector with 12.5 TALE DNA-binding repeats. Plasmid map is shown in Supplementary Fig. 3 . Proofreading Pfu polymerase (Bioline) and normal Taq polymerase (NE Biolabs) were used in PCR amplification. PCR conditions are described in the supplementary material .

    Article Snippet: Even the use of a non-proofreading but robust DNA polymerase, Taq (NE Biolabs) failed to amplify only the desired fragment ( ).

    Techniques: Polymerase Chain Reaction, Generated, Amplification, Plasmid Preparation, Binding Assay

    Testing the generality of the model to other template DNAs with repetitive sequences. (A). GFP-coding sequences were cloned into the pBasicS1 vector and their integrity were checked by sequencing and restriction enzyme digestions. (B). PCR results obtained with primers 390 and 570. Taq DNA polymerase (NE Biolabs) was used in PCR amplification. The arrow indicates the sequenced artifact product which contained only one copy of the GFP lacking the filler sequence. See the supplementary material for PCR conditions.

    Journal: Scientific Reports

    Article Title: PCR amplification of repetitive DNA: a limitation to genome editing technologies and many other applications

    doi: 10.1038/srep05052

    Figure Lengend Snippet: Testing the generality of the model to other template DNAs with repetitive sequences. (A). GFP-coding sequences were cloned into the pBasicS1 vector and their integrity were checked by sequencing and restriction enzyme digestions. (B). PCR results obtained with primers 390 and 570. Taq DNA polymerase (NE Biolabs) was used in PCR amplification. The arrow indicates the sequenced artifact product which contained only one copy of the GFP lacking the filler sequence. See the supplementary material for PCR conditions.

    Article Snippet: Even the use of a non-proofreading but robust DNA polymerase, Taq (NE Biolabs) failed to amplify only the desired fragment ( ).

    Techniques: Clone Assay, Plasmid Preparation, Sequencing, Polymerase Chain Reaction, Amplification

    RNA detection by two-step reverse transcription TaqMan qPCR using cellular reagents for MMLV RT and Taq DNA polymerase. Indicated copies of synthetic RNA template derived from Zika virus genomic sequence were tested using 2 x 107 cells each of MMLV RT and Taq DNA polymerase lyophilized cellular reagents. Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are presented. Color of the traces indicate presence (black traces) or absence (red traces) of MMLV RT cellular reagents, or the absence of templates (blue traces). The corresponding derivation of template copies from Cq analyses are tabulated. Cq values were converted to template copies using standard curve analyses of the same RNA samples with commercial qRT-PCR master mix .

    Journal: PLoS ONE

    Article Title: Cellular reagents for diagnostics and synthetic biology

    doi: 10.1371/journal.pone.0201681

    Figure Lengend Snippet: RNA detection by two-step reverse transcription TaqMan qPCR using cellular reagents for MMLV RT and Taq DNA polymerase. Indicated copies of synthetic RNA template derived from Zika virus genomic sequence were tested using 2 x 107 cells each of MMLV RT and Taq DNA polymerase lyophilized cellular reagents. Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are presented. Color of the traces indicate presence (black traces) or absence (red traces) of MMLV RT cellular reagents, or the absence of templates (blue traces). The corresponding derivation of template copies from Cq analyses are tabulated. Cq values were converted to template copies using standard curve analyses of the same RNA samples with commercial qRT-PCR master mix .

    Article Snippet: Assemblies using pure enzymes contained 0.08 units of T5 exonuclease (NEB), 0.5 units of Phusion DNA polymerase (NEB) and 80 units of Taq DNA ligase (NEB).

    Techniques: RNA Detection, Real-time Polymerase Chain Reaction, Derivative Assay, Sequencing, Amplification, Fluorescence, Generated, Software, Quantitative RT-PCR

    TaqMan qPCR analysis using lyophilized Taq DNA polymerase cellular reagents. Indicated copies of synthetic DNA templates derived from Zika virus genomic sequence were amplified using 2.5 units of pure commercial Taq DNA polymerase (panels a and b) or 2 x 107 cells of rehydrated cellular reagents expressing Taq DNA polymerase (panels c and d). Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are depicted in panels a and c. Amplification curve colors distinguish starting template copies–yellow: 60,000 template copies; green: 6000 template copies; blue: 600 template copies; red: 60 template copies; and gray: no template control. These curves depict the real-time kinetics of PCR amplification mediated by pure versus cellular reagents. The corresponding standard curve analyses performed using the “Abs quant” protocol in the LightCycler 96 software are depicted in panels b and d, respectively. Standard curve analyses data for comparing amplification efficiency, linearity, and error are tabulated as insets.

    Journal: PLoS ONE

    Article Title: Cellular reagents for diagnostics and synthetic biology

    doi: 10.1371/journal.pone.0201681

    Figure Lengend Snippet: TaqMan qPCR analysis using lyophilized Taq DNA polymerase cellular reagents. Indicated copies of synthetic DNA templates derived from Zika virus genomic sequence were amplified using 2.5 units of pure commercial Taq DNA polymerase (panels a and b) or 2 x 107 cells of rehydrated cellular reagents expressing Taq DNA polymerase (panels c and d). Amplification was assessed in real-time by measuring increase in TaqMan probe fluorescence over time. Representative amplification curves generated using the “Abs quant” analysis in the LightCycler 96 software are depicted in panels a and c. Amplification curve colors distinguish starting template copies–yellow: 60,000 template copies; green: 6000 template copies; blue: 600 template copies; red: 60 template copies; and gray: no template control. These curves depict the real-time kinetics of PCR amplification mediated by pure versus cellular reagents. The corresponding standard curve analyses performed using the “Abs quant” protocol in the LightCycler 96 software are depicted in panels b and d, respectively. Standard curve analyses data for comparing amplification efficiency, linearity, and error are tabulated as insets.

    Article Snippet: Assemblies using pure enzymes contained 0.08 units of T5 exonuclease (NEB), 0.5 units of Phusion DNA polymerase (NEB) and 80 units of Taq DNA ligase (NEB).

    Techniques: Real-time Polymerase Chain Reaction, Derivative Assay, Sequencing, Amplification, Expressing, Fluorescence, Generated, Software, Polymerase Chain Reaction

    Enzymes and buffer components required for TEDA. ( A ) The pKat-eGFP fragment was cloned into SmaI-digested pBluescript SK–. The assembly of the two fragments was used as a model for the test. ( B ) Taq DNA ligase, Phusion DNA polymerase, T5 exonuclease (T5 exo), NAD + were tested for their necessity for the DNA assembly. In addition, Prime-STAR or FastPfu was also used instead of Phusion for testing; ( C ) PEG 8000 and dNTPs were further tested for their necessity for the DNA assembly. The concentrations of relevant components mentioned above were indicated in the figure. The base solution contained 0.1 M Tris–HCl (pH 7.5), 10 mM MgCl 2 and 10 mM dithiothreitol. The reaction was processed at 50°C for 1 h, which was the same as the Gibson assembly. *, Gibson; **, Hot Fusion; **, TEDA with dNTPs and at 50°C; ****, TEDA without dNTPs at 50°C. The data are averages of three parallel experiments with STDEV.

    Journal: Nucleic Acids Research

    Article Title: T5 exonuclease-dependent assembly offers a low-cost method for efficient cloning and site-directed mutagenesis

    doi: 10.1093/nar/gky1169

    Figure Lengend Snippet: Enzymes and buffer components required for TEDA. ( A ) The pKat-eGFP fragment was cloned into SmaI-digested pBluescript SK–. The assembly of the two fragments was used as a model for the test. ( B ) Taq DNA ligase, Phusion DNA polymerase, T5 exonuclease (T5 exo), NAD + were tested for their necessity for the DNA assembly. In addition, Prime-STAR or FastPfu was also used instead of Phusion for testing; ( C ) PEG 8000 and dNTPs were further tested for their necessity for the DNA assembly. The concentrations of relevant components mentioned above were indicated in the figure. The base solution contained 0.1 M Tris–HCl (pH 7.5), 10 mM MgCl 2 and 10 mM dithiothreitol. The reaction was processed at 50°C for 1 h, which was the same as the Gibson assembly. *, Gibson; **, Hot Fusion; **, TEDA with dNTPs and at 50°C; ****, TEDA without dNTPs at 50°C. The data are averages of three parallel experiments with STDEV.

    Article Snippet: Taq DNA ligase (New England Biolab) was used to prepare the self-produced Gibson reaction mixture.

    Techniques: Clone Assay

    Comparison of different assembly methods. ( A ) TEDA was compared with In-fusion and SLIC for the assembly of two fragments. Middle- lacZ and pBBR1MCS5::lacZ-truncated with 15-bp or 20-bp overlaps were used. 1:1, the same molar ratio of the insert to vector was used for DNA assembly; 1:2, double molar amount of the insert to vector was used for DNA assembly. ( B ) TEDA was compared with Gibson and non-optimized TEDA methods. The Pkat-eGFP and SmaI-pSK was used for cloning. TEDA(0.04U)−30°C, 0.04 U T5 exonuclease at 30°C for 40 min; TEDA(0.08 U)−30°C, 0.08 U T5 exonuclease at 30°C for 40 min; TEDA(0.04 U)−50°C, 0.04 U T5 exonuclease at 50°C for 40 min; Gibson, 0.08 U T5 exonuclease with Phusion and Taq DNA ligase at 50°C for 60 min. Neg, DNA fragments were transformed without TEDA treatment. ( C ) TEDA was compared with In-fusion for 4 fragments assembly. The 5Ptac-phbCAB operon was separated into three fragments (Figure 2A ), and they were assembled with linearized pBBR1MCS-2 to generate pBBR1MCS2::5Ptac-phbCAB. The data are averages of three parallel experiments with STDEV.

    Journal: Nucleic Acids Research

    Article Title: T5 exonuclease-dependent assembly offers a low-cost method for efficient cloning and site-directed mutagenesis

    doi: 10.1093/nar/gky1169

    Figure Lengend Snippet: Comparison of different assembly methods. ( A ) TEDA was compared with In-fusion and SLIC for the assembly of two fragments. Middle- lacZ and pBBR1MCS5::lacZ-truncated with 15-bp or 20-bp overlaps were used. 1:1, the same molar ratio of the insert to vector was used for DNA assembly; 1:2, double molar amount of the insert to vector was used for DNA assembly. ( B ) TEDA was compared with Gibson and non-optimized TEDA methods. The Pkat-eGFP and SmaI-pSK was used for cloning. TEDA(0.04U)−30°C, 0.04 U T5 exonuclease at 30°C for 40 min; TEDA(0.08 U)−30°C, 0.08 U T5 exonuclease at 30°C for 40 min; TEDA(0.04 U)−50°C, 0.04 U T5 exonuclease at 50°C for 40 min; Gibson, 0.08 U T5 exonuclease with Phusion and Taq DNA ligase at 50°C for 60 min. Neg, DNA fragments were transformed without TEDA treatment. ( C ) TEDA was compared with In-fusion for 4 fragments assembly. The 5Ptac-phbCAB operon was separated into three fragments (Figure 2A ), and they were assembled with linearized pBBR1MCS-2 to generate pBBR1MCS2::5Ptac-phbCAB. The data are averages of three parallel experiments with STDEV.

    Article Snippet: Taq DNA ligase (New England Biolab) was used to prepare the self-produced Gibson reaction mixture.

    Techniques: Plasmid Preparation, Clone Assay, Transformation Assay