Structured Review

Roche t7 rna polymerase
Effect of the CT-oligomer on IRES-dependent translation. ( A ) A schematic diagram of the reporter constructs. Capped mRNAs were generated by in vitro transcription with <t>T7</t> RNA polymerase in the presence of m 7 GpppG. The mRNAs (RPF, RHF and RRF) contain
T7 Rna Polymerase, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 213 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t7 rna polymerase/product/Roche
Average 99 stars, based on 213 article reviews
Price from $9.99 to $1999.99
t7 rna polymerase - by Bioz Stars, 2020-01
99/100 stars

Images

1) Product Images from "Identification of cellular proteins enhancing activities of internal ribosomal entry sites by competition with oligodeoxynucleotides"

Article Title: Identification of cellular proteins enhancing activities of internal ribosomal entry sites by competition with oligodeoxynucleotides

Journal:

doi: 10.1093/nar/gkh300

Effect of the CT-oligomer on IRES-dependent translation. ( A ) A schematic diagram of the reporter constructs. Capped mRNAs were generated by in vitro transcription with T7 RNA polymerase in the presence of m 7 GpppG. The mRNAs (RPF, RHF and RRF) contain
Figure Legend Snippet: Effect of the CT-oligomer on IRES-dependent translation. ( A ) A schematic diagram of the reporter constructs. Capped mRNAs were generated by in vitro transcription with T7 RNA polymerase in the presence of m 7 GpppG. The mRNAs (RPF, RHF and RRF) contain

Techniques Used: Construct, Generated, In Vitro

2) Product Images from "Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries"

Article Title: Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries

Journal:

doi: 10.1016/j.ajhg.2013.10.002

Schematic of the Whole-Genome In-Solution Capture Process To generate the RNA “bait” library, a human genomic library is created via adapters containing T7 RNA polymerase promoters (green boxes). This library is subjected to in vitro transcription via T7 RNA polymerase and biotin-16-UTP (stars), creating a biotinylated bait library. Meanwhile, the ancient DNA library (aDNA “pond”) is prepared via standard indexed Illumina adapters (purple boxes). These aDNA libraries often contain < 1% endogenous DNA, with the remainder being environmental in origin. During hybridization, the bait and pond are combined in the presence of adaptor-blocking RNA oligos (blue zigzags), which are complimentary to the indexed Illumina adapters and thus prevent nonspecific hybridization between adapters in the aDNA library. After hybridization, the biotinylated bait and bound aDNA is pulled down with streptavidin-coated magnetic beads, and any unbound DNA is washed away. Finally, the DNA is eluted and amplified for sequencing.
Figure Legend Snippet: Schematic of the Whole-Genome In-Solution Capture Process To generate the RNA “bait” library, a human genomic library is created via adapters containing T7 RNA polymerase promoters (green boxes). This library is subjected to in vitro transcription via T7 RNA polymerase and biotin-16-UTP (stars), creating a biotinylated bait library. Meanwhile, the ancient DNA library (aDNA “pond”) is prepared via standard indexed Illumina adapters (purple boxes). These aDNA libraries often contain < 1% endogenous DNA, with the remainder being environmental in origin. During hybridization, the bait and pond are combined in the presence of adaptor-blocking RNA oligos (blue zigzags), which are complimentary to the indexed Illumina adapters and thus prevent nonspecific hybridization between adapters in the aDNA library. After hybridization, the biotinylated bait and bound aDNA is pulled down with streptavidin-coated magnetic beads, and any unbound DNA is washed away. Finally, the DNA is eluted and amplified for sequencing.

Techniques Used: In Vitro, Ancient DNA Assay, Hybridization, Blocking Assay, Magnetic Beads, Amplification, Sequencing

3) Product Images from "R-Loop Formation In Trans at an AGGAG Repeat"

Article Title: R-Loop Formation In Trans at an AGGAG Repeat

Journal: Journal of Nucleic Acids

doi: 10.1155/2013/629218

R-loop formation  in trans  detected by radiolabeling of the transcript. (a) Agarose gel stained with ethidium bromide and (b) autoradiogram of the same gel. Lane 1: pBluescript SK(−) linearized with  Xba  I; lane 2: supercoiled pHC624-(AGGAG) 22 ; lane 3: pHC624-(AGGAG) 22  linearized with  Sca  I; lane 4: pSK-(AGGAG) 22  linearized with  Xba  I; lane 5: linearized pSK-(AGGAG) 22  and supercoiled pHC624-(AGGAG) 22 ; and lane 6: linearized pSK-(AGGAG) 22  and linearized pHC624-(AGGAG) 22 . All DNAs were incubated in the transcription mixture with T7 RNA polymerase.
Figure Legend Snippet: R-loop formation in trans detected by radiolabeling of the transcript. (a) Agarose gel stained with ethidium bromide and (b) autoradiogram of the same gel. Lane 1: pBluescript SK(−) linearized with Xba I; lane 2: supercoiled pHC624-(AGGAG) 22 ; lane 3: pHC624-(AGGAG) 22 linearized with Sca I; lane 4: pSK-(AGGAG) 22 linearized with Xba I; lane 5: linearized pSK-(AGGAG) 22 and supercoiled pHC624-(AGGAG) 22 ; and lane 6: linearized pSK-(AGGAG) 22 and linearized pHC624-(AGGAG) 22 . All DNAs were incubated in the transcription mixture with T7 RNA polymerase.

Techniques Used: Radioactivity, Agarose Gel Electrophoresis, Staining, Incubation

R-loop formation on pSK-(AGGAG) 22  and effects of RNase T1 on the formation. A plasmid containing a (AGGAG) 22  repeat was transcribed with T7 RNA polymerase and the effects on the topology of the plasmid were examined by agarose gel electrophoresis. (a) Lane 1: mock transcribed; lane 2: transcribed with T7 RNA polymerase; lane 3: transcribed with T3 RNA polymerase. (b) lane 1: mock transcribed, lane 2: transcribed with T7 RNA polymerase, Lane 3: transcribed with T7 RNA polymerase in the presence of 3 units of RNase T1; lane 4: transcribed with T7 RNA polymerase and ethanol-precipitated; and lane 5: transcribed with T7 RNA polymerase, ethanol-precipitated, and then incubated with 3 units of RNase T1.
Figure Legend Snippet: R-loop formation on pSK-(AGGAG) 22 and effects of RNase T1 on the formation. A plasmid containing a (AGGAG) 22 repeat was transcribed with T7 RNA polymerase and the effects on the topology of the plasmid were examined by agarose gel electrophoresis. (a) Lane 1: mock transcribed; lane 2: transcribed with T7 RNA polymerase; lane 3: transcribed with T3 RNA polymerase. (b) lane 1: mock transcribed, lane 2: transcribed with T7 RNA polymerase, Lane 3: transcribed with T7 RNA polymerase in the presence of 3 units of RNase T1; lane 4: transcribed with T7 RNA polymerase and ethanol-precipitated; and lane 5: transcribed with T7 RNA polymerase, ethanol-precipitated, and then incubated with 3 units of RNase T1.

Techniques Used: Plasmid Preparation, Agarose Gel Electrophoresis, Electrophoresis, Incubation

R-loop formation  in trans  and its dependence on supercoiling of the target DNA. RNA containing an AGGAG repeat was produced from linearized pSK-(AGGAG) 22 , and the effects on a T7 promoterless plasmid containing an AGGAG repeat, pHC624-(AGGAG) 22 , were examined by agarose gel electrophoresis. Lane 1: pSK-(AGGAG) 22  linearized with  Xba  I; lane 2: linearized pSK-(AGGAG) 22  transcribed with T7 RNA polymerase; lane 3: supercoiled pHC624-(AGGAG) 22 , which lacked T7 promoter; lane 4: supercoiled pHC624-(AGGAG) 22  incubated in transcription mixture with T7 RNA polymerase; lane 5: supercoiled pHC624-(AGGAG) 22  and linearized pSK-(AGGAG) 22  transcribed with T7 RNA polymerase; lane 6: supercoiled pHC624-(AGGAG) 22  and pBluescript SK(−) linearized with  Xba  I, transcribed with T7 RNA polymerase; lane 7: supercoiled pHC624; lane 8: supercoiled pHC624 and linearized pSK-(AGGAG) 22  incubated in transcription mixture with T7 RNA polymerase; lane 9: pHC624-(AGGAG) 22  relaxed with vaccinia topoisomerase I; lane 10: relaxed pHC624-(AGAAG) 22  and linearized pSK-(AGGAG) 22  transcribed with T7 RNA polymerase; lane 11: same as lane 5 and ethanol-precipitated; lane 12: same as lane 11 and treated with 90 units of  E. coli  RNase H (TaKaRa) in 40 mM Tris · HCl pH 7.7, 4 mM MgCl 2 , 1 mM DTT, 4% glycerol, and 0.003% bovine serum albumin at 37°C for 1 h.
Figure Legend Snippet: R-loop formation in trans and its dependence on supercoiling of the target DNA. RNA containing an AGGAG repeat was produced from linearized pSK-(AGGAG) 22 , and the effects on a T7 promoterless plasmid containing an AGGAG repeat, pHC624-(AGGAG) 22 , were examined by agarose gel electrophoresis. Lane 1: pSK-(AGGAG) 22 linearized with Xba I; lane 2: linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 3: supercoiled pHC624-(AGGAG) 22 , which lacked T7 promoter; lane 4: supercoiled pHC624-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 5: supercoiled pHC624-(AGGAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 6: supercoiled pHC624-(AGGAG) 22 and pBluescript SK(−) linearized with Xba I, transcribed with T7 RNA polymerase; lane 7: supercoiled pHC624; lane 8: supercoiled pHC624 and linearized pSK-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 9: pHC624-(AGGAG) 22 relaxed with vaccinia topoisomerase I; lane 10: relaxed pHC624-(AGAAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 11: same as lane 5 and ethanol-precipitated; lane 12: same as lane 11 and treated with 90 units of E. coli RNase H (TaKaRa) in 40 mM Tris · HCl pH 7.7, 4 mM MgCl 2 , 1 mM DTT, 4% glycerol, and 0.003% bovine serum albumin at 37°C for 1 h.

Techniques Used: Produced, Plasmid Preparation, Agarose Gel Electrophoresis, Electrophoresis, Incubation

4) Product Images from "Human mitochondrial RNA polymerase primes lagging-strand DNA synthesis in vitro"

Article Title: Human mitochondrial RNA polymerase primes lagging-strand DNA synthesis in vitro

Journal:

doi: 10.1073/pnas.0805399105

RNA synthesis of POLRMT and T7 RNA polymerase on ssDNA and dsDNA templates. RNA synthesis by POLRMT (500 fmol) or by T7 RNA polymerase (0.8 units) were monitored as described in Material and Methods . ( A ) RNA products formed on the M13mp18 ssDNA template
Figure Legend Snippet: RNA synthesis of POLRMT and T7 RNA polymerase on ssDNA and dsDNA templates. RNA synthesis by POLRMT (500 fmol) or by T7 RNA polymerase (0.8 units) were monitored as described in Material and Methods . ( A ) RNA products formed on the M13mp18 ssDNA template

Techniques Used:

5) Product Images from "R-Loop Formation In Trans at an AGGAG Repeat"

Article Title: R-Loop Formation In Trans at an AGGAG Repeat

Journal: Journal of Nucleic Acids

doi: 10.1155/2013/629218

R-loop formation  in trans  detected by radiolabeling of the transcript. (a) Agarose gel stained with ethidium bromide and (b) autoradiogram of the same gel. Lane 1: pBluescript SK(−) linearized with  Xba  I; lane 2: supercoiled pHC624-(AGGAG) 22 ; lane 3: pHC624-(AGGAG) 22  linearized with  Sca  I; lane 4: pSK-(AGGAG) 22  linearized with  Xba  I; lane 5: linearized pSK-(AGGAG) 22  and supercoiled pHC624-(AGGAG) 22 ; and lane 6: linearized pSK-(AGGAG) 22  and linearized pHC624-(AGGAG) 22 . All DNAs were incubated in the transcription mixture with T7 RNA polymerase.
Figure Legend Snippet: R-loop formation in trans detected by radiolabeling of the transcript. (a) Agarose gel stained with ethidium bromide and (b) autoradiogram of the same gel. Lane 1: pBluescript SK(−) linearized with Xba I; lane 2: supercoiled pHC624-(AGGAG) 22 ; lane 3: pHC624-(AGGAG) 22 linearized with Sca I; lane 4: pSK-(AGGAG) 22 linearized with Xba I; lane 5: linearized pSK-(AGGAG) 22 and supercoiled pHC624-(AGGAG) 22 ; and lane 6: linearized pSK-(AGGAG) 22 and linearized pHC624-(AGGAG) 22 . All DNAs were incubated in the transcription mixture with T7 RNA polymerase.

Techniques Used: Radioactivity, Agarose Gel Electrophoresis, Staining, Incubation

R-loop formation on pSK-(AGGAG) 22  and effects of RNase T1 on the formation. A plasmid containing a (AGGAG) 22  repeat was transcribed with T7 RNA polymerase and the effects on the topology of the plasmid were examined by agarose gel electrophoresis. (a) Lane 1: mock transcribed; lane 2: transcribed with T7 RNA polymerase; lane 3: transcribed with T3 RNA polymerase. (b) lane 1: mock transcribed, lane 2: transcribed with T7 RNA polymerase, Lane 3: transcribed with T7 RNA polymerase in the presence of 3 units of RNase T1; lane 4: transcribed with T7 RNA polymerase and ethanol-precipitated; and lane 5: transcribed with T7 RNA polymerase, ethanol-precipitated, and then incubated with 3 units of RNase T1.
Figure Legend Snippet: R-loop formation on pSK-(AGGAG) 22 and effects of RNase T1 on the formation. A plasmid containing a (AGGAG) 22 repeat was transcribed with T7 RNA polymerase and the effects on the topology of the plasmid were examined by agarose gel electrophoresis. (a) Lane 1: mock transcribed; lane 2: transcribed with T7 RNA polymerase; lane 3: transcribed with T3 RNA polymerase. (b) lane 1: mock transcribed, lane 2: transcribed with T7 RNA polymerase, Lane 3: transcribed with T7 RNA polymerase in the presence of 3 units of RNase T1; lane 4: transcribed with T7 RNA polymerase and ethanol-precipitated; and lane 5: transcribed with T7 RNA polymerase, ethanol-precipitated, and then incubated with 3 units of RNase T1.

Techniques Used: Plasmid Preparation, Agarose Gel Electrophoresis, Electrophoresis, Incubation

R-loop formation  in trans  and its dependence on supercoiling of the target DNA. RNA containing an AGGAG repeat was produced from linearized pSK-(AGGAG) 22 , and the effects on a T7 promoterless plasmid containing an AGGAG repeat, pHC624-(AGGAG) 22 , were examined by agarose gel electrophoresis. Lane 1: pSK-(AGGAG) 22  linearized with  Xba  I; lane 2: linearized pSK-(AGGAG) 22  transcribed with T7 RNA polymerase; lane 3: supercoiled pHC624-(AGGAG) 22 , which lacked T7 promoter; lane 4: supercoiled pHC624-(AGGAG) 22  incubated in transcription mixture with T7 RNA polymerase; lane 5: supercoiled pHC624-(AGGAG) 22  and linearized pSK-(AGGAG) 22  transcribed with T7 RNA polymerase; lane 6: supercoiled pHC624-(AGGAG) 22  and pBluescript SK(−) linearized with  Xba  I, transcribed with T7 RNA polymerase; lane 7: supercoiled pHC624; lane 8: supercoiled pHC624 and linearized pSK-(AGGAG) 22  incubated in transcription mixture with T7 RNA polymerase; lane 9: pHC624-(AGGAG) 22  relaxed with vaccinia topoisomerase I; lane 10: relaxed pHC624-(AGAAG) 22  and linearized pSK-(AGGAG) 22  transcribed with T7 RNA polymerase; lane 11: same as lane 5 and ethanol-precipitated; lane 12: same as lane 11 and treated with 90 units of  E. coli  RNase H (TaKaRa) in 40 mM Tris · HCl pH 7.7, 4 mM MgCl 2 , 1 mM DTT, 4% glycerol, and 0.003% bovine serum albumin at 37°C for 1 h.
Figure Legend Snippet: R-loop formation in trans and its dependence on supercoiling of the target DNA. RNA containing an AGGAG repeat was produced from linearized pSK-(AGGAG) 22 , and the effects on a T7 promoterless plasmid containing an AGGAG repeat, pHC624-(AGGAG) 22 , were examined by agarose gel electrophoresis. Lane 1: pSK-(AGGAG) 22 linearized with Xba I; lane 2: linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 3: supercoiled pHC624-(AGGAG) 22 , which lacked T7 promoter; lane 4: supercoiled pHC624-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 5: supercoiled pHC624-(AGGAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 6: supercoiled pHC624-(AGGAG) 22 and pBluescript SK(−) linearized with Xba I, transcribed with T7 RNA polymerase; lane 7: supercoiled pHC624; lane 8: supercoiled pHC624 and linearized pSK-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 9: pHC624-(AGGAG) 22 relaxed with vaccinia topoisomerase I; lane 10: relaxed pHC624-(AGAAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 11: same as lane 5 and ethanol-precipitated; lane 12: same as lane 11 and treated with 90 units of E. coli RNase H (TaKaRa) in 40 mM Tris · HCl pH 7.7, 4 mM MgCl 2 , 1 mM DTT, 4% glycerol, and 0.003% bovine serum albumin at 37°C for 1 h.

Techniques Used: Produced, Plasmid Preparation, Agarose Gel Electrophoresis, Electrophoresis, Incubation

6) Product Images from "R-Loop Formation In Trans at an AGGAG Repeat"

Article Title: R-Loop Formation In Trans at an AGGAG Repeat

Journal: Journal of Nucleic Acids

doi: 10.1155/2013/629218

R-loop formation  in trans  detected by radiolabeling of the transcript. (a) Agarose gel stained with ethidium bromide and (b) autoradiogram of the same gel. Lane 1: pBluescript SK(−) linearized with  Xba  I; lane 2: supercoiled pHC624-(AGGAG) 22 ; lane 3: pHC624-(AGGAG) 22  linearized with  Sca  I; lane 4: pSK-(AGGAG) 22  linearized with  Xba  I; lane 5: linearized pSK-(AGGAG) 22  and supercoiled pHC624-(AGGAG) 22 ; and lane 6: linearized pSK-(AGGAG) 22  and linearized pHC624-(AGGAG) 22 . All DNAs were incubated in the transcription mixture with T7 RNA polymerase.
Figure Legend Snippet: R-loop formation in trans detected by radiolabeling of the transcript. (a) Agarose gel stained with ethidium bromide and (b) autoradiogram of the same gel. Lane 1: pBluescript SK(−) linearized with Xba I; lane 2: supercoiled pHC624-(AGGAG) 22 ; lane 3: pHC624-(AGGAG) 22 linearized with Sca I; lane 4: pSK-(AGGAG) 22 linearized with Xba I; lane 5: linearized pSK-(AGGAG) 22 and supercoiled pHC624-(AGGAG) 22 ; and lane 6: linearized pSK-(AGGAG) 22 and linearized pHC624-(AGGAG) 22 . All DNAs were incubated in the transcription mixture with T7 RNA polymerase.

Techniques Used: Radioactivity, Agarose Gel Electrophoresis, Staining, Incubation

R-loop formation on pSK-(AGGAG) 22  and effects of RNase T1 on the formation. A plasmid containing a (AGGAG) 22  repeat was transcribed with T7 RNA polymerase and the effects on the topology of the plasmid were examined by agarose gel electrophoresis. (a) Lane 1: mock transcribed; lane 2: transcribed with T7 RNA polymerase; lane 3: transcribed with T3 RNA polymerase. (b) lane 1: mock transcribed, lane 2: transcribed with T7 RNA polymerase, Lane 3: transcribed with T7 RNA polymerase in the presence of 3 units of RNase T1; lane 4: transcribed with T7 RNA polymerase and ethanol-precipitated; and lane 5: transcribed with T7 RNA polymerase, ethanol-precipitated, and then incubated with 3 units of RNase T1.
Figure Legend Snippet: R-loop formation on pSK-(AGGAG) 22 and effects of RNase T1 on the formation. A plasmid containing a (AGGAG) 22 repeat was transcribed with T7 RNA polymerase and the effects on the topology of the plasmid were examined by agarose gel electrophoresis. (a) Lane 1: mock transcribed; lane 2: transcribed with T7 RNA polymerase; lane 3: transcribed with T3 RNA polymerase. (b) lane 1: mock transcribed, lane 2: transcribed with T7 RNA polymerase, Lane 3: transcribed with T7 RNA polymerase in the presence of 3 units of RNase T1; lane 4: transcribed with T7 RNA polymerase and ethanol-precipitated; and lane 5: transcribed with T7 RNA polymerase, ethanol-precipitated, and then incubated with 3 units of RNase T1.

Techniques Used: Plasmid Preparation, Agarose Gel Electrophoresis, Electrophoresis, Incubation

R-loop formation  in trans  and its dependence on supercoiling of the target DNA. RNA containing an AGGAG repeat was produced from linearized pSK-(AGGAG) 22 , and the effects on a T7 promoterless plasmid containing an AGGAG repeat, pHC624-(AGGAG) 22 , were examined by agarose gel electrophoresis. Lane 1: pSK-(AGGAG) 22  linearized with  Xba  I; lane 2: linearized pSK-(AGGAG) 22  transcribed with T7 RNA polymerase; lane 3: supercoiled pHC624-(AGGAG) 22 , which lacked T7 promoter; lane 4: supercoiled pHC624-(AGGAG) 22  incubated in transcription mixture with T7 RNA polymerase; lane 5: supercoiled pHC624-(AGGAG) 22  and linearized pSK-(AGGAG) 22  transcribed with T7 RNA polymerase; lane 6: supercoiled pHC624-(AGGAG) 22  and pBluescript SK(−) linearized with  Xba  I, transcribed with T7 RNA polymerase; lane 7: supercoiled pHC624; lane 8: supercoiled pHC624 and linearized pSK-(AGGAG) 22  incubated in transcription mixture with T7 RNA polymerase; lane 9: pHC624-(AGGAG) 22  relaxed with vaccinia topoisomerase I; lane 10: relaxed pHC624-(AGAAG) 22  and linearized pSK-(AGGAG) 22  transcribed with T7 RNA polymerase; lane 11: same as lane 5 and ethanol-precipitated; lane 12: same as lane 11 and treated with 90 units of  E. coli  RNase H (TaKaRa) in 40 mM Tris · HCl pH 7.7, 4 mM MgCl 2 , 1 mM DTT, 4% glycerol, and 0.003% bovine serum albumin at 37°C for 1 h.
Figure Legend Snippet: R-loop formation in trans and its dependence on supercoiling of the target DNA. RNA containing an AGGAG repeat was produced from linearized pSK-(AGGAG) 22 , and the effects on a T7 promoterless plasmid containing an AGGAG repeat, pHC624-(AGGAG) 22 , were examined by agarose gel electrophoresis. Lane 1: pSK-(AGGAG) 22 linearized with Xba I; lane 2: linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 3: supercoiled pHC624-(AGGAG) 22 , which lacked T7 promoter; lane 4: supercoiled pHC624-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 5: supercoiled pHC624-(AGGAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 6: supercoiled pHC624-(AGGAG) 22 and pBluescript SK(−) linearized with Xba I, transcribed with T7 RNA polymerase; lane 7: supercoiled pHC624; lane 8: supercoiled pHC624 and linearized pSK-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 9: pHC624-(AGGAG) 22 relaxed with vaccinia topoisomerase I; lane 10: relaxed pHC624-(AGAAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 11: same as lane 5 and ethanol-precipitated; lane 12: same as lane 11 and treated with 90 units of E. coli RNase H (TaKaRa) in 40 mM Tris · HCl pH 7.7, 4 mM MgCl 2 , 1 mM DTT, 4% glycerol, and 0.003% bovine serum albumin at 37°C for 1 h.

Techniques Used: Produced, Plasmid Preparation, Agarose Gel Electrophoresis, Electrophoresis, Incubation

7) Product Images from "Northern blot detection of endogenous small RNAs (~14 nt) in bacterial total RNA extracts"

Article Title: Northern blot detection of endogenous small RNAs (~14 nt) in bacterial total RNA extracts

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkq437

Secondary structure presentation of ( A ) mature  B. subtilis  6S-1 RNA (190 nt), adapted from (  11 ), and ( B ) of  E. coli  6S RNA according to (  9 ); both RNAs were transcribed with two artificially added G residues (lowercase letters) for reasons of efficient synthesis by T7 RNA polymerase. In both panels, the black lines along the sequence indicate the region of  B. subtilis  6S-1 RNA and  E. coli  6S RNA that serve as a template for the synthesis of small transcripts (product RNAs = pRNAs) by RNA polymerase (this study, 9); arrows mark the starting point of pRNA transcription; the chemically synthesized pRNA mimics are depicted in the grey boxes on the left above the 6S RNA structures. In panel A, 6S-1 RNA nt 151–157 complementary to nt 2–8 of the LNA probe are boxed. LNA probes for pRNA detection are shown in grey boxes on the right above the secondary structures; DIG, digoxigenin attached to the 5′-end via a C6 linker; small letters depict DNA residues, capital letters LNA residues.
Figure Legend Snippet: Secondary structure presentation of ( A ) mature B. subtilis 6S-1 RNA (190 nt), adapted from ( 11 ), and ( B ) of E. coli 6S RNA according to ( 9 ); both RNAs were transcribed with two artificially added G residues (lowercase letters) for reasons of efficient synthesis by T7 RNA polymerase. In both panels, the black lines along the sequence indicate the region of B. subtilis 6S-1 RNA and E. coli 6S RNA that serve as a template for the synthesis of small transcripts (product RNAs = pRNAs) by RNA polymerase (this study, 9); arrows mark the starting point of pRNA transcription; the chemically synthesized pRNA mimics are depicted in the grey boxes on the left above the 6S RNA structures. In panel A, 6S-1 RNA nt 151–157 complementary to nt 2–8 of the LNA probe are boxed. LNA probes for pRNA detection are shown in grey boxes on the right above the secondary structures; DIG, digoxigenin attached to the 5′-end via a C6 linker; small letters depict DNA residues, capital letters LNA residues.

Techniques Used: Sequencing, Synthesized

8) Product Images from "Exploiting cis-Acting Replication Elements To Direct Hepatitis C Virus-Dependent Transgene Expression"

Article Title: Exploiting cis-Acting Replication Elements To Direct Hepatitis C Virus-Dependent Transgene Expression

Journal:

doi: 10.1128/JVI.79.10.5923-5932.2005

Determination of cis -acting replication elements in the NS5B coding region. (A) Schematic display of T7-based HCV minigenome reporter constructs. HCV minigenome containing the antisense (left) or sense (right) sequence of the Renilla luciferase gene and the antisense sequence of the EMCV IRES flanked by the 5′ end (1 to 377) and differently truncated NS5B coding region-connected 3′ UTR or 3′ UTR alone was juxtaposed precisely at the T7 transcription start site and followed by the HDV ribozyme gene. (B) The indicated reporter vectors were transfected into Huh-NNRZ cells with or without pAM8-1 expressing T7 RNA polymerase. Relative Renilla luciferase activities in the lysates were determined at 48 h posttransfection. The columns and bars represent the means and standard deviations of three independent triplicate transfections. (C) Huh-NNRZ cells were transfected with in vitro transcribed cRLNS5B1 RNA (left) or EMCVRLNS5B1 RNA (right) together with capped firefly luciferase RNA as an internal control. Relative Renilla luciferase activities in the lysates were determined at 24 h posttransfection. Absolute values of Renilla and firefly luciferase activity are listed below the corresponding bars.
Figure Legend Snippet: Determination of cis -acting replication elements in the NS5B coding region. (A) Schematic display of T7-based HCV minigenome reporter constructs. HCV minigenome containing the antisense (left) or sense (right) sequence of the Renilla luciferase gene and the antisense sequence of the EMCV IRES flanked by the 5′ end (1 to 377) and differently truncated NS5B coding region-connected 3′ UTR or 3′ UTR alone was juxtaposed precisely at the T7 transcription start site and followed by the HDV ribozyme gene. (B) The indicated reporter vectors were transfected into Huh-NNRZ cells with or without pAM8-1 expressing T7 RNA polymerase. Relative Renilla luciferase activities in the lysates were determined at 48 h posttransfection. The columns and bars represent the means and standard deviations of three independent triplicate transfections. (C) Huh-NNRZ cells were transfected with in vitro transcribed cRLNS5B1 RNA (left) or EMCVRLNS5B1 RNA (right) together with capped firefly luciferase RNA as an internal control. Relative Renilla luciferase activities in the lysates were determined at 24 h posttransfection. Absolute values of Renilla and firefly luciferase activity are listed below the corresponding bars.

Techniques Used: Construct, Sequencing, Luciferase, Transfection, Expressing, In Vitro, Activity Assay

9) Product Images from "R-Loop Formation In Trans at an AGGAG Repeat"

Article Title: R-Loop Formation In Trans at an AGGAG Repeat

Journal: Journal of Nucleic Acids

doi: 10.1155/2013/629218

R-loop formation  in trans  detected by radiolabeling of the transcript. (a) Agarose gel stained with ethidium bromide and (b) autoradiogram of the same gel. Lane 1: pBluescript SK(−) linearized with  Xba  I; lane 2: supercoiled pHC624-(AGGAG) 22 ; lane 3: pHC624-(AGGAG) 22  linearized with  Sca  I; lane 4: pSK-(AGGAG) 22  linearized with  Xba  I; lane 5: linearized pSK-(AGGAG) 22  and supercoiled pHC624-(AGGAG) 22 ; and lane 6: linearized pSK-(AGGAG) 22  and linearized pHC624-(AGGAG) 22 . All DNAs were incubated in the transcription mixture with T7 RNA polymerase.
Figure Legend Snippet: R-loop formation in trans detected by radiolabeling of the transcript. (a) Agarose gel stained with ethidium bromide and (b) autoradiogram of the same gel. Lane 1: pBluescript SK(−) linearized with Xba I; lane 2: supercoiled pHC624-(AGGAG) 22 ; lane 3: pHC624-(AGGAG) 22 linearized with Sca I; lane 4: pSK-(AGGAG) 22 linearized with Xba I; lane 5: linearized pSK-(AGGAG) 22 and supercoiled pHC624-(AGGAG) 22 ; and lane 6: linearized pSK-(AGGAG) 22 and linearized pHC624-(AGGAG) 22 . All DNAs were incubated in the transcription mixture with T7 RNA polymerase.

Techniques Used: Radioactivity, Agarose Gel Electrophoresis, Staining, Incubation

R-loop formation on pSK-(AGGAG) 22  and effects of RNase T1 on the formation. A plasmid containing a (AGGAG) 22  repeat was transcribed with T7 RNA polymerase and the effects on the topology of the plasmid were examined by agarose gel electrophoresis. (a) Lane 1: mock transcribed; lane 2: transcribed with T7 RNA polymerase; lane 3: transcribed with T3 RNA polymerase. (b) lane 1: mock transcribed, lane 2: transcribed with T7 RNA polymerase, Lane 3: transcribed with T7 RNA polymerase in the presence of 3 units of RNase T1; lane 4: transcribed with T7 RNA polymerase and ethanol-precipitated; and lane 5: transcribed with T7 RNA polymerase, ethanol-precipitated, and then incubated with 3 units of RNase T1.
Figure Legend Snippet: R-loop formation on pSK-(AGGAG) 22 and effects of RNase T1 on the formation. A plasmid containing a (AGGAG) 22 repeat was transcribed with T7 RNA polymerase and the effects on the topology of the plasmid were examined by agarose gel electrophoresis. (a) Lane 1: mock transcribed; lane 2: transcribed with T7 RNA polymerase; lane 3: transcribed with T3 RNA polymerase. (b) lane 1: mock transcribed, lane 2: transcribed with T7 RNA polymerase, Lane 3: transcribed with T7 RNA polymerase in the presence of 3 units of RNase T1; lane 4: transcribed with T7 RNA polymerase and ethanol-precipitated; and lane 5: transcribed with T7 RNA polymerase, ethanol-precipitated, and then incubated with 3 units of RNase T1.

Techniques Used: Plasmid Preparation, Agarose Gel Electrophoresis, Electrophoresis, Incubation

R-loop formation  in trans  and its dependence on supercoiling of the target DNA. RNA containing an AGGAG repeat was produced from linearized pSK-(AGGAG) 22 , and the effects on a T7 promoterless plasmid containing an AGGAG repeat, pHC624-(AGGAG) 22 , were examined by agarose gel electrophoresis. Lane 1: pSK-(AGGAG) 22  linearized with  Xba  I; lane 2: linearized pSK-(AGGAG) 22  transcribed with T7 RNA polymerase; lane 3: supercoiled pHC624-(AGGAG) 22 , which lacked T7 promoter; lane 4: supercoiled pHC624-(AGGAG) 22  incubated in transcription mixture with T7 RNA polymerase; lane 5: supercoiled pHC624-(AGGAG) 22  and linearized pSK-(AGGAG) 22  transcribed with T7 RNA polymerase; lane 6: supercoiled pHC624-(AGGAG) 22  and pBluescript SK(−) linearized with  Xba  I, transcribed with T7 RNA polymerase; lane 7: supercoiled pHC624; lane 8: supercoiled pHC624 and linearized pSK-(AGGAG) 22  incubated in transcription mixture with T7 RNA polymerase; lane 9: pHC624-(AGGAG) 22  relaxed with vaccinia topoisomerase I; lane 10: relaxed pHC624-(AGAAG) 22  and linearized pSK-(AGGAG) 22  transcribed with T7 RNA polymerase; lane 11: same as lane 5 and ethanol-precipitated; lane 12: same as lane 11 and treated with 90 units of  E. coli  RNase H (TaKaRa) in 40 mM Tris · HCl pH 7.7, 4 mM MgCl 2 , 1 mM DTT, 4% glycerol, and 0.003% bovine serum albumin at 37°C for 1 h.
Figure Legend Snippet: R-loop formation in trans and its dependence on supercoiling of the target DNA. RNA containing an AGGAG repeat was produced from linearized pSK-(AGGAG) 22 , and the effects on a T7 promoterless plasmid containing an AGGAG repeat, pHC624-(AGGAG) 22 , were examined by agarose gel electrophoresis. Lane 1: pSK-(AGGAG) 22 linearized with Xba I; lane 2: linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 3: supercoiled pHC624-(AGGAG) 22 , which lacked T7 promoter; lane 4: supercoiled pHC624-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 5: supercoiled pHC624-(AGGAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 6: supercoiled pHC624-(AGGAG) 22 and pBluescript SK(−) linearized with Xba I, transcribed with T7 RNA polymerase; lane 7: supercoiled pHC624; lane 8: supercoiled pHC624 and linearized pSK-(AGGAG) 22 incubated in transcription mixture with T7 RNA polymerase; lane 9: pHC624-(AGGAG) 22 relaxed with vaccinia topoisomerase I; lane 10: relaxed pHC624-(AGAAG) 22 and linearized pSK-(AGGAG) 22 transcribed with T7 RNA polymerase; lane 11: same as lane 5 and ethanol-precipitated; lane 12: same as lane 11 and treated with 90 units of E. coli RNase H (TaKaRa) in 40 mM Tris · HCl pH 7.7, 4 mM MgCl 2 , 1 mM DTT, 4% glycerol, and 0.003% bovine serum albumin at 37°C for 1 h.

Techniques Used: Produced, Plasmid Preparation, Agarose Gel Electrophoresis, Electrophoresis, Incubation

Related Articles

Clone Assay:

Article Title: LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression
Article Snippet: LncRNA and 18S fragments were cloned into PCDNA4 plasmid and northern probes were produced using Biotin RNA Labeling Mix (catalogue 11685597910, Roche). .. T7 RNA polymerase (catalogue 10881767001, Roche) was used for in vitro transcription.

Luciferase:

Article Title: Identification of cellular proteins enhancing activities of internal ribosomal entry sites by competition with oligodeoxynucleotides
Article Snippet: Transcription reactions were performed using T7 RNA polymerase (Roche Molecular Biochemicals) at 37°C for 90 min according to the manufacturer’s instructions. .. In vitro translation reactions in micrococcal nuclease-treated HeLa S-10 were performed for 1 h in 12.5 µl reaction mixtures containing 10 nM mRNA at 30°C.

Synthesized:

Article Title: Northern blot detection of endogenous small RNAs (~14 nt) in bacterial total RNA extracts
Article Snippet: 14- or 16-mer probes complementary to pRNAs included 5′-digoxigenin-aGt tTt gAc cGa Ac-3′ (probe for B. subtilis wt 6S-1 pRNA), 5′-digoxigenin-aGt cgT gAC cga Ac-3′ (probe for B. subtilis mutant 6S-1 pRNA), 5′-digoxigenin-tcC cCt gAg cCg At-3′ (E. coli 6S pRNA probe 1), 5′-digoxigenin-tcc ccT gag ccg At-3′ (E. coli 6S pRNA probe 2) and 5′-digoxigenin-agT ccc ctg agc cgA t-3′ (E. coli 6S pRNA probe 3), with uppercase letters indicating LNA and lowercase letters DNA residues ( and ); 5′-digoxigenin-labeled, LNA-containing probes were obtained from Exiqon (Vedbaek, Denmark). .. For specific detection of B. subtilis and E. coli 5S rRNA loading controls and for E. coli 6S RNA, antisense transcripts covering the respective full-length RNA and internally labeled with digoxigenin-UTP were synthesized from PCR templates by T7 RNA polymerase (according to the DIG RNA Labeling Mix protocol provided by Roche Diagnostics, Mannheim, Germany). .. For native PAGE, samples were adjusted to 1× native loading buffer by mixing with 6× native loading buffer [0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanol blue, 30% (v/v) glycerol].

Article Title: Mutations in the HECT domain of NEDD4L lead to AKT/mTOR pathway deregulation and cause periventricular nodular heterotopia
Article Snippet: Because of the very low level of expression of NEDD4L, efficiency experiments were conducted using co-transfection of WT NEDD4L cDNA and shRNA constructs in N2A cells and Western blot analysis. .. Mouse Nedd4l sense and antisense probes (nt 462 to 1470 of the transcript NM_0114386) were synthesized using a T7 RNA polymerase (Roche) from pJET2.1-Nedd4l (nt 462 to 1470) and pJET2.1-Nedd4l (nt 1470 to 462) plasmids. .. Non-radioactive RNA in situ hybridization on frozen brain sections was performed as previously described .

Article Title: Spliceosomal protein eftud2 mutation leads to p53-dependent apoptosis in zebrafish neural progenitors
Article Snippet: PCR fragments for tuba, nestin, map2, eftud2, foxa3 and wt1a were amplified from a 48 hpf embryonic cDNA library and confirmed by Sanger sequencing; the T7 RNA polymerase binding site was introduced to make anti-sense RNA probes. .. Digoxigenin-labeled probes were synthesized using T7 RNA polymerase (Roche). .. The RNA probes of pax2a, myoD, cmyb, lyzC, amhc and vmhc were synthesized as previously reported ( ).

Article Title: Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons
Article Snippet: RNA was transferred to a positively charged nylon membrane (Roche) by capillary blotting and crosslinked by UV irradiation. .. The probe recognizing all three C9ORF72 isoforms was synthesized with T7 RNA polymerase (Roche) from cDNAs obtained by PCR with specific primers (Table S1). .. RNA probes specifically detecting V2 and V3 isoforms were chemically synthesized and 5′ modified to add Dig label (sequence in Table S1).

TA Cloning:

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: To develop an RNA standard for the quantitative reverse transcription real time PCR (qRT-PCR)) assay, a target amplicon targeting the non-structural protein 1 (nSP1) of SAV-1 [ ] was generated and ligated into a pCR® II plasmid using a TA cloning® kit, with PCR II Vector and One Shot Top10F’ chemically competent E coli (Life Technologies, Paisley, UK) following manufacturer´s instructions. .. DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA.

Quantitative RT-PCR:

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: Paragraph title: RT-qPCR assay for heart and liver tissue ... DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA.

Article Title: Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons
Article Snippet: Paragraph title: qRT-PCR and northern blot ... The probe recognizing all three C9ORF72 isoforms was synthesized with T7 RNA polymerase (Roche) from cDNAs obtained by PCR with specific primers (Table S1).

Real-time Polymerase Chain Reaction:

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: To develop an RNA standard for the quantitative reverse transcription real time PCR (qRT-PCR)) assay, a target amplicon targeting the non-structural protein 1 (nSP1) of SAV-1 [ ] was generated and ligated into a pCR® II plasmid using a TA cloning® kit, with PCR II Vector and One Shot Top10F’ chemically competent E coli (Life Technologies, Paisley, UK) following manufacturer´s instructions. .. DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA.

Article Title: Long non-coding RNA PVT1 promotes tumor progression by regulating the miR-143/HK2 axis in gallbladder cancer
Article Snippet: A DNA fragment containing the full-length PVT1 sequence or a negative control sequence was PCR amplified using T7 RNA polymerase (Roche, Basel, Switzerland). .. The resulting plasmid DNA was linearized using the restriction enzyme Xho I. Biotin-labeled RNA was reverse transcribed using Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase (Takara Biomedical Technology).

Incubation:

Article Title: R-Loop Formation In Trans at an AGGAG Repeat
Article Snippet: Standard transcription reaction was carried out with 6 units of T7 RNA polymerase (Roche Diagnostics) on 0.3 μ g DNA (0.3 μ g for each DNA, when two DNA species were present) at 37°C for 20 min in 20 μ L of 50 mM NaCl, 40 mM Tris· HCl pH 8.0, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT, and 0.6 mM each of ATP, CTP, GTP, and UTP [ , ]. .. Standard transcription reaction was carried out with 6 units of T7 RNA polymerase (Roche Diagnostics) on 0.3 μ g DNA (0.3 μ g for each DNA, when two DNA species were present) at 37°C for 20 min in 20 μ L of 50 mM NaCl, 40 mM Tris· HCl pH 8.0, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT, and 0.6 mM each of ATP, CTP, GTP, and UTP [ , ].

Article Title: LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression
Article Snippet: T7 RNA polymerase (catalogue 10881767001, Roche) was used for in vitro transcription. .. T7 RNA polymerase (catalogue 10881767001, Roche) was used for in vitro transcription.

Article Title: The novel lncRNA lnc-NR2F1 is pro-neurogenic and mutated in human neurodevelopmental disorders
Article Snippet: Subsequently, incubated with an alkaline phosphatase (AP)-coupled antibody (Roche) at 4°C overnight. .. Probes were generated by in vitro transcription with T7 RNA polymerase (Roche) using the DNA templates containing a promoter sequence of T7 RNA polymerase promoter (TAA TAC GAC TCA CTA TAG GG) followed by a complimentary sequence of target RNA.

Article Title: Telomerase regulation by the long non-coding RNA H19 in human acute promyelocytic leukemia cells
Article Snippet: H19 and GFP RNA molecules were generated by in vitro transcription using the T7 RNA polymerase (Roche). .. The reaction was performed in a final volume of 20 μl containing 1 μg of linearized plasmid, 1× reaction buffer (40 mM Tris, pH 8.0, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT, 10 mM each ATP, GTP, UTP, and CTP, 1 μl RNase inhibitor (20 U/μl), and 2 μl T7 RNA polymerase (20 U/μl).

Amplification:

Article Title: Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries
Article Snippet: The reactions were pooled and purified with AMPure XP beads (Beckman Coulter), eluting in 25 μl H2 O. .. To transcribe the bait libraries into biotinylated RNA, we assembled the following in vitro transcription reaction mixture: 5 μl amplified library (∼500 ng), 15.2 μl H2 O, 10 μl 5× NASBA buffer (185 mM Tris-HCl [pH 8.5], 93 mM MgCl2 , 185 mM KCl, 46% DMSO), 2.5 μl 0.1 M DTT, 0.5 μl 10 mg/ml BSA, 12.5 μl 10 mM NTP mix (10 mM ATP, 10 mM CTP, 10 mM GTP, 6.5 mM UTP, 3.5 mM biotin-16-UTP), 1.5 μl T7 RNA Polymerase (20 U/μl, Roche), 0.3 μl Pyrophosphatase (0.1 U/μl, NEB), and 2.5 μl SUPERase-In RNase inhibitor (20 U/μl, Life Technologies). .. The reaction was incubated at 37°C overnight, treated for 15 min at 37°C with 1 μl TURBO DNase (2 U/μl, Life Technologies), and then purified with an RNeasy Mini kit (QIAGEN) according to the manufacturer’s instructions, eluting twice in the same 30 μl of H2 O.

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: The total RNA was PCR amplified using a 108 bp long primer pair (nSP1-F ‘CCGGCCCTGAACCAGTT3’ and nSP1-R ‘GTAGCCAAGTGGGAGAAAGCT3’) to prepare the DNA template for ligation into the pCR® II Vector with a Dual Promoter (Invitrogen, Thermo Fisher Scientific, Leicestershire, UK). .. DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA.

Article Title: Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition
Article Snippet: Template for in situ probes were amplified from shield stage cDNA and a T7-promoter sequence added for in vitro transcription. .. Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription in 20μL reactions consisting of 100ng purified PCR product (8μL), 2μL DIG RNA labeling mix (Roche), 2μl 10X transcription buffer (Roche), and 2μl T7 RNA polymerase (Roche) in RNAse-free water and purified using a QIAGEN RNEasy kit.

Article Title: Long non-coding RNA PVT1 promotes tumor progression by regulating the miR-143/HK2 axis in gallbladder cancer
Article Snippet: Subsequently, the retrieved RNA was assayed by qPCR. .. A DNA fragment containing the full-length PVT1 sequence or a negative control sequence was PCR amplified using T7 RNA polymerase (Roche, Basel, Switzerland). .. The resulting plasmid DNA was linearized using the restriction enzyme Xho I. Biotin-labeled RNA was reverse transcribed using Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase (Takara Biomedical Technology).

Article Title: Spliceosomal protein eftud2 mutation leads to p53-dependent apoptosis in zebrafish neural progenitors
Article Snippet: PCR fragments for tuba, nestin, map2, eftud2, foxa3 and wt1a were amplified from a 48 hpf embryonic cDNA library and confirmed by Sanger sequencing; the T7 RNA polymerase binding site was introduced to make anti-sense RNA probes. .. Digoxigenin-labeled probes were synthesized using T7 RNA polymerase (Roche).

Article Title: Astrocyte Hypertrophy and Microglia Activation in the Rat Auditory Midbrain Is Induced by Electrical Intracochlear Stimulation
Article Snippet: From this construct a linearized fos fragment flanked by the T3 and T7 promoters was amplified. .. Sense riboprobes were made after transcription with T7 RNA polymerase (Roche, Cat. No. 10881767001).

Activity Assay:

Article Title: Identification of cellular proteins enhancing activities of internal ribosomal entry sites by competition with oligodeoxynucleotides
Article Snippet: Transcription reactions were performed using T7 RNA polymerase (Roche Molecular Biochemicals) at 37°C for 90 min according to the manufacturer’s instructions. .. In vitro translation reactions in micrococcal nuclease-treated HeLa S-10 were performed for 1 h in 12.5 µl reaction mixtures containing 10 nM mRNA at 30°C.

Expressing:

Article Title: Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons
Article Snippet: The 2exp (−ΔΔCt) method was used to determine the relative expression of each gene. .. The probe recognizing all three C9ORF72 isoforms was synthesized with T7 RNA polymerase (Roche) from cDNAs obtained by PCR with specific primers (Table S1).

Hybridization:

Article Title: Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition
Article Snippet: Paragraph title: In situ hybridization ... Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription in 20μL reactions consisting of 100ng purified PCR product (8μL), 2μL DIG RNA labeling mix (Roche), 2μl 10X transcription buffer (Roche), and 2μl T7 RNA polymerase (Roche) in RNAse-free water and purified using a QIAGEN RNEasy kit.

Countercurrent Chromatography:

Article Title: Northern blot detection of endogenous small RNAs (~14 nt) in bacterial total RNA extracts
Article Snippet: 14- or 16-mer probes complementary to pRNAs included 5′-digoxigenin-aGt tTt gAc cGa Ac-3′ (probe for B. subtilis wt 6S-1 pRNA), 5′-digoxigenin-aGt cgT gAC cga Ac-3′ (probe for B. subtilis mutant 6S-1 pRNA), 5′-digoxigenin-tcC cCt gAg cCg At-3′ (E. coli 6S pRNA probe 1), 5′-digoxigenin-tcc ccT gag ccg At-3′ (E. coli 6S pRNA probe 2) and 5′-digoxigenin-agT ccc ctg agc cgA t-3′ (E. coli 6S pRNA probe 3), with uppercase letters indicating LNA and lowercase letters DNA residues ( and ); 5′-digoxigenin-labeled, LNA-containing probes were obtained from Exiqon (Vedbaek, Denmark). .. For specific detection of B. subtilis and E. coli 5S rRNA loading controls and for E. coli 6S RNA, antisense transcripts covering the respective full-length RNA and internally labeled with digoxigenin-UTP were synthesized from PCR templates by T7 RNA polymerase (according to the DIG RNA Labeling Mix protocol provided by Roche Diagnostics, Mannheim, Germany).

Ligation:

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: The total RNA was PCR amplified using a 108 bp long primer pair (nSP1-F ‘CCGGCCCTGAACCAGTT3’ and nSP1-R ‘GTAGCCAAGTGGGAGAAAGCT3’) to prepare the DNA template for ligation into the pCR® II Vector with a Dual Promoter (Invitrogen, Thermo Fisher Scientific, Leicestershire, UK). .. DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA.

Northern Blot:

Article Title: Northern blot detection of endogenous small RNAs (~14 nt) in bacterial total RNA extracts
Article Snippet: Paragraph title: Northern blotting ... For specific detection of B. subtilis and E. coli 5S rRNA loading controls and for E. coli 6S RNA, antisense transcripts covering the respective full-length RNA and internally labeled with digoxigenin-UTP were synthesized from PCR templates by T7 RNA polymerase (according to the DIG RNA Labeling Mix protocol provided by Roche Diagnostics, Mannheim, Germany).

Article Title: LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression
Article Snippet: Paragraph title: Northern blot ... T7 RNA polymerase (catalogue 10881767001, Roche) was used for in vitro transcription.

Article Title: Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons
Article Snippet: Paragraph title: qRT-PCR and northern blot ... The probe recognizing all three C9ORF72 isoforms was synthesized with T7 RNA polymerase (Roche) from cDNAs obtained by PCR with specific primers (Table S1).

Generated:

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: To develop an RNA standard for the quantitative reverse transcription real time PCR (qRT-PCR)) assay, a target amplicon targeting the non-structural protein 1 (nSP1) of SAV-1 [ ] was generated and ligated into a pCR® II plasmid using a TA cloning® kit, with PCR II Vector and One Shot Top10F’ chemically competent E coli (Life Technologies, Paisley, UK) following manufacturer´s instructions. .. DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA.

Article Title: Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition
Article Snippet: Template for in situ probes were amplified from shield stage cDNA and a T7-promoter sequence added for in vitro transcription. .. Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription in 20μL reactions consisting of 100ng purified PCR product (8μL), 2μL DIG RNA labeling mix (Roche), 2μl 10X transcription buffer (Roche), and 2μl T7 RNA polymerase (Roche) in RNAse-free water and purified using a QIAGEN RNEasy kit. .. In situ protocol was followed as detailed in .

Article Title: The novel lncRNA lnc-NR2F1 is pro-neurogenic and mutated in human neurodevelopmental disorders
Article Snippet: The DIG-labeled sense RNA probe for both, NR2F1 and lnc-Nr2f1 , corresponds to the same region as the antisense probe in the reverse direction. .. Probes were generated by in vitro transcription with T7 RNA polymerase (Roche) using the DNA templates containing a promoter sequence of T7 RNA polymerase promoter (TAA TAC GAC TCA CTA TAG GG) followed by a complimentary sequence of target RNA. .. DNA templates were amplified by PCR with the following primers: For lnc-Nr2f1 probe: (F) GTG GCC ATG GAA TGG TGT AGC AGA, and (R) GTC TGA GTG TTT GTT TGA CTG AAT GT; NR2F1 probe: (F) CGG TTC AGC GAG GAA GAA TGC CT, and (R) CTA GGA ACA CTG GAT GGA CAT GTA AG.

Article Title: Telomerase regulation by the long non-coding RNA H19 in human acute promyelocytic leukemia cells
Article Snippet: The products of digestion were purified using the plasmid DNA purification kit (Nucleobond® PC20, Macherey Nagel) and used as templates for subsequent in vitro transcription. .. H19 and GFP RNA molecules were generated by in vitro transcription using the T7 RNA polymerase (Roche). .. The reaction was performed in a final volume of 20 μl containing 1 μg of linearized plasmid, 1× reaction buffer (40 mM Tris, pH 8.0, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT, 10 mM each ATP, GTP, UTP, and CTP, 1 μl RNase inhibitor (20 U/μl), and 2 μl T7 RNA polymerase (20 U/μl).

Article Title: Astrocyte Hypertrophy and Microglia Activation in the Rat Auditory Midbrain Is Induced by Electrical Intracochlear Stimulation
Article Snippet: For both fragments, digoxigenin (DIG)-labeled antisense riboprobes were generated from the 313 bp rat fos cDNA after transcription with T3 RNA polymerase (Roche, Cat. No. 11031163001). .. Sense riboprobes were made after transcription with T7 RNA polymerase (Roche, Cat. No. 10881767001).

other:

Article Title: R-Loop Formation In Trans at an AGGAG Repeat
Article Snippet: Thus, the result indicated that the transcript was separated from and reassociated with the template and that the “separator” function of T7 RNA polymerase was not compromised on the CTCCT-repeat template, in agreement with results reported for other class-switch regions and a telomeric repeat [ ].

Polymerase Chain Reaction:

Article Title: Northern blot detection of endogenous small RNAs (~14 nt) in bacterial total RNA extracts
Article Snippet: 14- or 16-mer probes complementary to pRNAs included 5′-digoxigenin-aGt tTt gAc cGa Ac-3′ (probe for B. subtilis wt 6S-1 pRNA), 5′-digoxigenin-aGt cgT gAC cga Ac-3′ (probe for B. subtilis mutant 6S-1 pRNA), 5′-digoxigenin-tcC cCt gAg cCg At-3′ (E. coli 6S pRNA probe 1), 5′-digoxigenin-tcc ccT gag ccg At-3′ (E. coli 6S pRNA probe 2) and 5′-digoxigenin-agT ccc ctg agc cgA t-3′ (E. coli 6S pRNA probe 3), with uppercase letters indicating LNA and lowercase letters DNA residues ( and ); 5′-digoxigenin-labeled, LNA-containing probes were obtained from Exiqon (Vedbaek, Denmark). .. For specific detection of B. subtilis and E. coli 5S rRNA loading controls and for E. coli 6S RNA, antisense transcripts covering the respective full-length RNA and internally labeled with digoxigenin-UTP were synthesized from PCR templates by T7 RNA polymerase (according to the DIG RNA Labeling Mix protocol provided by Roche Diagnostics, Mannheim, Germany). .. For native PAGE, samples were adjusted to 1× native loading buffer by mixing with 6× native loading buffer [0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanol blue, 30% (v/v) glycerol].

Article Title: Antisense-oligonucleotide-directed inhibition of nonsense-mediated mRNA decay
Article Snippet: Rabbit anti-GFP (Sigma G1544) and mouse anti-α-tubulin (Sigma T9026) antibodies were used with IRDye 800CW secondary antibodies (LI-COR) for Western blotting, and the blots were imaged and quantified using the Odyssey Infrared Imaging System (LI-COR). .. Pre-mRNA for in vitro splicing was transcribed using T7 RNA polymerase (Roche) in the presence of α-32 P-UTP, using a PCR product as the template. .. The template contains portions of exons 2 and 3 and the intact intron 2 of HBB , and was amplified from human genomic DNA using the primer pair T7HBB-Ex2-F and HBB-Ex3-R ( ).

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: The total RNA was PCR amplified using a 108 bp long primer pair (nSP1-F ‘CCGGCCCTGAACCAGTT3’ and nSP1-R ‘GTAGCCAAGTGGGAGAAAGCT3’) to prepare the DNA template for ligation into the pCR® II Vector with a Dual Promoter (Invitrogen, Thermo Fisher Scientific, Leicestershire, UK). .. DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA.

Article Title: Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition
Article Snippet: Template for in situ probes were amplified from shield stage cDNA and a T7-promoter sequence added for in vitro transcription. .. Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription in 20μL reactions consisting of 100ng purified PCR product (8μL), 2μL DIG RNA labeling mix (Roche), 2μl 10X transcription buffer (Roche), and 2μl T7 RNA polymerase (Roche) in RNAse-free water and purified using a QIAGEN RNEasy kit. .. In situ protocol was followed as detailed in .

Article Title: Long non-coding RNA PVT1 promotes tumor progression by regulating the miR-143/HK2 axis in gallbladder cancer
Article Snippet: Subsequently, the retrieved RNA was assayed by qPCR. .. A DNA fragment containing the full-length PVT1 sequence or a negative control sequence was PCR amplified using T7 RNA polymerase (Roche, Basel, Switzerland). .. The resulting plasmid DNA was linearized using the restriction enzyme Xho I. Biotin-labeled RNA was reverse transcribed using Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase (Takara Biomedical Technology).

Article Title: Spliceosomal protein eftud2 mutation leads to p53-dependent apoptosis in zebrafish neural progenitors
Article Snippet: PCR fragments for tuba, nestin, map2, eftud2, foxa3 and wt1a were amplified from a 48 hpf embryonic cDNA library and confirmed by Sanger sequencing; the T7 RNA polymerase binding site was introduced to make anti-sense RNA probes. .. Digoxigenin-labeled probes were synthesized using T7 RNA polymerase (Roche).

Article Title: Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons
Article Snippet: RNA was transferred to a positively charged nylon membrane (Roche) by capillary blotting and crosslinked by UV irradiation. .. The probe recognizing all three C9ORF72 isoforms was synthesized with T7 RNA polymerase (Roche) from cDNAs obtained by PCR with specific primers (Table S1). .. RNA probes specifically detecting V2 and V3 isoforms were chemically synthesized and 5′ modified to add Dig label (sequence in Table S1).

Injection:

Article Title: Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition
Article Snippet: Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription in 20μL reactions consisting of 100ng purified PCR product (8μL), 2μL DIG RNA labeling mix (Roche), 2μl 10X transcription buffer (Roche), and 2μl T7 RNA polymerase (Roche) in RNAse-free water and purified using a QIAGEN RNEasy kit. .. Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription in 20μL reactions consisting of 100ng purified PCR product (8μL), 2μL DIG RNA labeling mix (Roche), 2μl 10X transcription buffer (Roche), and 2μl T7 RNA polymerase (Roche) in RNAse-free water and purified using a QIAGEN RNEasy kit.

Recombinant:

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: The recombinant plasmid DNA was extracted with a Wizard® Plus SV Miniprep DNA purification system (Promega, Southampton, UK). .. DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA.

Molecular Cloning:

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: To prepare the DNA template for molecular cloning, viral RNA was extracted from SAV culture supernatant using a NucleoSpin® RNA Virus isolation kit (Macherey-Nagel, Fisher Scientific, Leicestershire, UK). .. DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA.

Pull Down Assay:

Article Title: Long non-coding RNA PVT1 promotes tumor progression by regulating the miR-143/HK2 axis in gallbladder cancer
Article Snippet: Paragraph title: RNA pull-down assay ... A DNA fragment containing the full-length PVT1 sequence or a negative control sequence was PCR amplified using T7 RNA polymerase (Roche, Basel, Switzerland).

Mutagenesis:

Article Title: Northern blot detection of endogenous small RNAs (~14 nt) in bacterial total RNA extracts
Article Snippet: 14- or 16-mer probes complementary to pRNAs included 5′-digoxigenin-aGt tTt gAc cGa Ac-3′ (probe for B. subtilis wt 6S-1 pRNA), 5′-digoxigenin-aGt cgT gAC cga Ac-3′ (probe for B. subtilis mutant 6S-1 pRNA), 5′-digoxigenin-tcC cCt gAg cCg At-3′ (E. coli 6S pRNA probe 1), 5′-digoxigenin-tcc ccT gag ccg At-3′ (E. coli 6S pRNA probe 2) and 5′-digoxigenin-agT ccc ctg agc cgA t-3′ (E. coli 6S pRNA probe 3), with uppercase letters indicating LNA and lowercase letters DNA residues ( and ); 5′-digoxigenin-labeled, LNA-containing probes were obtained from Exiqon (Vedbaek, Denmark). .. For specific detection of B. subtilis and E. coli 5S rRNA loading controls and for E. coli 6S RNA, antisense transcripts covering the respective full-length RNA and internally labeled with digoxigenin-UTP were synthesized from PCR templates by T7 RNA polymerase (according to the DIG RNA Labeling Mix protocol provided by Roche Diagnostics, Mannheim, Germany).

Labeling:

Article Title: Northern blot detection of endogenous small RNAs (~14 nt) in bacterial total RNA extracts
Article Snippet: 14- or 16-mer probes complementary to pRNAs included 5′-digoxigenin-aGt tTt gAc cGa Ac-3′ (probe for B. subtilis wt 6S-1 pRNA), 5′-digoxigenin-aGt cgT gAC cga Ac-3′ (probe for B. subtilis mutant 6S-1 pRNA), 5′-digoxigenin-tcC cCt gAg cCg At-3′ (E. coli 6S pRNA probe 1), 5′-digoxigenin-tcc ccT gag ccg At-3′ (E. coli 6S pRNA probe 2) and 5′-digoxigenin-agT ccc ctg agc cgA t-3′ (E. coli 6S pRNA probe 3), with uppercase letters indicating LNA and lowercase letters DNA residues ( and ); 5′-digoxigenin-labeled, LNA-containing probes were obtained from Exiqon (Vedbaek, Denmark). .. For specific detection of B. subtilis and E. coli 5S rRNA loading controls and for E. coli 6S RNA, antisense transcripts covering the respective full-length RNA and internally labeled with digoxigenin-UTP were synthesized from PCR templates by T7 RNA polymerase (according to the DIG RNA Labeling Mix protocol provided by Roche Diagnostics, Mannheim, Germany). .. For native PAGE, samples were adjusted to 1× native loading buffer by mixing with 6× native loading buffer [0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanol blue, 30% (v/v) glycerol].

Article Title: Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition
Article Snippet: Template for in situ probes were amplified from shield stage cDNA and a T7-promoter sequence added for in vitro transcription. .. Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription in 20μL reactions consisting of 100ng purified PCR product (8μL), 2μL DIG RNA labeling mix (Roche), 2μl 10X transcription buffer (Roche), and 2μl T7 RNA polymerase (Roche) in RNAse-free water and purified using a QIAGEN RNEasy kit. .. In situ protocol was followed as detailed in .

Article Title: LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression
Article Snippet: LncRNA and 18S fragments were cloned into PCDNA4 plasmid and northern probes were produced using Biotin RNA Labeling Mix (catalogue 11685597910, Roche). .. T7 RNA polymerase (catalogue 10881767001, Roche) was used for in vitro transcription.

Purification:

Article Title: R-Loop Formation In Trans at an AGGAG Repeat
Article Snippet: In order to create a simplified model of Sα , an AGGAG repeat was synthesized by the nontemplate PCR method [ ] and cloned into the Eco R V site of pBluescript SK(−).One clone contained GAG(AGGAG)22 at the site in the direction that transcription from the T7 promoter would produce an AGGAG-repeat transcript. .. The plasmid, designated pSK-(AGGAG)22 , purified from E. coli and negatively supercoiled, was transcribed with T7 RNA polymerase. .. Agarose gel electrophoresis showed extensive relaxation of the DNA ( , lane 2) indicative of R-loop formation.

Article Title: Human mitochondrial RNA polymerase primes lagging-strand DNA synthesis in vitro
Article Snippet: In our experiment we refer only to the activity of POLRMT because the amount of TFB2M activity in the purified fractions was negligible (data not shown). .. The reaction mixture (25 μl), contained 35 fmol of single-stranded M13mp18 DNA (New England Biolabs), 10 mM Tris·HCl (pH 8.0), 20 mM MgCl2 , 1 mM DTT, 100 μg/ml BSA, 400 μM ATP, 150 μM CTP, and GTP, 10 μM UTP, 0.2 μM α-32 P UTP (3,000 Ci/mmol), 4 units of RNase inhibitor (Amersham Biosciences), and the indicated concentrations of T7 RNA polymerase (Roche) or purified POLRMT protein. .. We stopped the reaction after 30 min at 32°C by adding 200 μl of stop buffer [10 mM Tris·HCl (pH 8.0), 0.2 mM NaCl, 1 mM EDTA, and 0.1 mg/ml glycogen].

Article Title: Antisense-oligonucleotide-directed inhibition of nonsense-mediated mRNA decay
Article Snippet: Pre-mRNA for in vitro splicing was transcribed using T7 RNA polymerase (Roche) in the presence of α-32 P-UTP, using a PCR product as the template. .. The template contains portions of exons 2 and 3 and the intact intron 2 of HBB , and was amplified from human genomic DNA using the primer pair T7HBB-Ex2-F and HBB-Ex3-R ( ).

Article Title: Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition
Article Snippet: Template for in situ probes were amplified from shield stage cDNA and a T7-promoter sequence added for in vitro transcription. .. Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription in 20μL reactions consisting of 100ng purified PCR product (8μL), 2μL DIG RNA labeling mix (Roche), 2μl 10X transcription buffer (Roche), and 2μl T7 RNA polymerase (Roche) in RNAse-free water and purified using a QIAGEN RNEasy kit. .. In situ protocol was followed as detailed in .

Article Title: Long non-coding RNA PVT1 promotes tumor progression by regulating the miR-143/HK2 axis in gallbladder cancer
Article Snippet: A DNA fragment containing the full-length PVT1 sequence or a negative control sequence was PCR amplified using T7 RNA polymerase (Roche, Basel, Switzerland). .. The resulting plasmid DNA was linearized using the restriction enzyme Xho I. Biotin-labeled RNA was reverse transcribed using Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase (Takara Biomedical Technology).

Article Title: Telomerase regulation by the long non-coding RNA H19 in human acute promyelocytic leukemia cells
Article Snippet: The products of digestion were purified using the plasmid DNA purification kit (Nucleobond® PC20, Macherey Nagel) and used as templates for subsequent in vitro transcription. .. H19 and GFP RNA molecules were generated by in vitro transcription using the T7 RNA polymerase (Roche).

Sequencing:

Article Title: Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition
Article Snippet: Template for in situ probes were amplified from shield stage cDNA and a T7-promoter sequence added for in vitro transcription. .. Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription in 20μL reactions consisting of 100ng purified PCR product (8μL), 2μL DIG RNA labeling mix (Roche), 2μl 10X transcription buffer (Roche), and 2μl T7 RNA polymerase (Roche) in RNAse-free water and purified using a QIAGEN RNEasy kit.

Article Title: Long non-coding RNA PVT1 promotes tumor progression by regulating the miR-143/HK2 axis in gallbladder cancer
Article Snippet: Subsequently, the retrieved RNA was assayed by qPCR. .. A DNA fragment containing the full-length PVT1 sequence or a negative control sequence was PCR amplified using T7 RNA polymerase (Roche, Basel, Switzerland). .. The resulting plasmid DNA was linearized using the restriction enzyme Xho I. Biotin-labeled RNA was reverse transcribed using Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase (Takara Biomedical Technology).

Article Title: Spliceosomal protein eftud2 mutation leads to p53-dependent apoptosis in zebrafish neural progenitors
Article Snippet: PCR fragments for tuba, nestin, map2, eftud2, foxa3 and wt1a were amplified from a 48 hpf embryonic cDNA library and confirmed by Sanger sequencing; the T7 RNA polymerase binding site was introduced to make anti-sense RNA probes. .. Digoxigenin-labeled probes were synthesized using T7 RNA polymerase (Roche).

Article Title: The novel lncRNA lnc-NR2F1 is pro-neurogenic and mutated in human neurodevelopmental disorders
Article Snippet: The DIG-labeled sense RNA probe for both, NR2F1 and lnc-Nr2f1 , corresponds to the same region as the antisense probe in the reverse direction. .. Probes were generated by in vitro transcription with T7 RNA polymerase (Roche) using the DNA templates containing a promoter sequence of T7 RNA polymerase promoter (TAA TAC GAC TCA CTA TAG GG) followed by a complimentary sequence of target RNA. .. DNA templates were amplified by PCR with the following primers: For lnc-Nr2f1 probe: (F) GTG GCC ATG GAA TGG TGT AGC AGA, and (R) GTC TGA GTG TTT GTT TGA CTG AAT GT; NR2F1 probe: (F) CGG TTC AGC GAG GAA GAA TGC CT, and (R) CTA GGA ACA CTG GAT GGA CAT GTA AG.

Article Title: Astrocyte Hypertrophy and Microglia Activation in the Rat Auditory Midbrain Is Induced by Electrical Intracochlear Stimulation
Article Snippet: Based on the cDNA, a 313 base pairs (bp) long DNA fragment of the fos gene (NCBI Sequence Read Archive, NM_022197, GI: 148298807) was amplified with the following primers: F1-FBJ/fos (5′-AGCTCCCACCAGTGTCTACC-3′) and R1-JB/fos (5′-CCACGGAGGAGACCAGAGTG-3′). .. Sense riboprobes were made after transcription with T7 RNA polymerase (Roche, Cat. No. 10881767001).

Blocking Assay:

Article Title: The novel lncRNA lnc-NR2F1 is pro-neurogenic and mutated in human neurodevelopmental disorders
Article Snippet: Hybridized sections were washed two times in washing solution (2 × SSC, 50% formamide, 0.1% Tween 20) at 65°C for 60 min. After washing, sections were incubated for 1 hr in 1% (weight/volume) blocking reagent (0.1M Maleic Acid, 0.15M NaCl (pH 7.5), 0.1% Tween 20, Roche). .. Probes were generated by in vitro transcription with T7 RNA polymerase (Roche) using the DNA templates containing a promoter sequence of T7 RNA polymerase promoter (TAA TAC GAC TCA CTA TAG GG) followed by a complimentary sequence of target RNA.

Polyacrylamide Gel Electrophoresis:

Article Title: Northern blot detection of endogenous small RNAs (~14 nt) in bacterial total RNA extracts
Article Snippet: For specific detection of B. subtilis and E. coli 5S rRNA loading controls and for E. coli 6S RNA, antisense transcripts covering the respective full-length RNA and internally labeled with digoxigenin-UTP were synthesized from PCR templates by T7 RNA polymerase (according to the DIG RNA Labeling Mix protocol provided by Roche Diagnostics, Mannheim, Germany). .. For native PAGE, samples were adjusted to 1× native loading buffer by mixing with 6× native loading buffer [0.25% (w/v) bromophenol blue, 0.25% (w/v) xylene cyanol blue, 30% (v/v) glycerol].

Article Title: Antisense-oligonucleotide-directed inhibition of nonsense-mediated mRNA decay
Article Snippet: Pre-mRNA for in vitro splicing was transcribed using T7 RNA polymerase (Roche) in the presence of α-32 P-UTP, using a PCR product as the template. .. The template contains portions of exons 2 and 3 and the intact intron 2 of HBB , and was amplified from human genomic DNA using the primer pair T7HBB-Ex2-F and HBB-Ex3-R ( ).

cDNA Library Assay:

Article Title: Spliceosomal protein eftud2 mutation leads to p53-dependent apoptosis in zebrafish neural progenitors
Article Snippet: PCR fragments for tuba, nestin, map2, eftud2, foxa3 and wt1a were amplified from a 48 hpf embryonic cDNA library and confirmed by Sanger sequencing; the T7 RNA polymerase binding site was introduced to make anti-sense RNA probes. .. Digoxigenin-labeled probes were synthesized using T7 RNA polymerase (Roche).

In Situ Hybridization:

Article Title: Mutations in the HECT domain of NEDD4L lead to AKT/mTOR pathway deregulation and cause periventricular nodular heterotopia
Article Snippet: Paragraph title: In situ hybridization ... Mouse Nedd4l sense and antisense probes (nt 462 to 1470 of the transcript NM_0114386) were synthesized using a T7 RNA polymerase (Roche) from pJET2.1-Nedd4l (nt 462 to 1470) and pJET2.1-Nedd4l (nt 1470 to 462) plasmids.

Article Title: Spliceosomal protein eftud2 mutation leads to p53-dependent apoptosis in zebrafish neural progenitors
Article Snippet: Paragraph title: In situ hybridization ... Digoxigenin-labeled probes were synthesized using T7 RNA polymerase (Roche).

Article Title: The novel lncRNA lnc-NR2F1 is pro-neurogenic and mutated in human neurodevelopmental disorders
Article Snippet: Paragraph title: In situ hybridization ... Probes were generated by in vitro transcription with T7 RNA polymerase (Roche) using the DNA templates containing a promoter sequence of T7 RNA polymerase promoter (TAA TAC GAC TCA CTA TAG GG) followed by a complimentary sequence of target RNA.

Plasmid Preparation:

Article Title: R-Loop Formation In Trans at an AGGAG Repeat
Article Snippet: In order to create a simplified model of Sα , an AGGAG repeat was synthesized by the nontemplate PCR method [ ] and cloned into the Eco R V site of pBluescript SK(−).One clone contained GAG(AGGAG)22 at the site in the direction that transcription from the T7 promoter would produce an AGGAG-repeat transcript. .. The plasmid, designated pSK-(AGGAG)22 , purified from E. coli and negatively supercoiled, was transcribed with T7 RNA polymerase. .. Agarose gel electrophoresis showed extensive relaxation of the DNA ( , lane 2) indicative of R-loop formation.

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: The recombinant plasmid DNA was extracted with a Wizard® Plus SV Miniprep DNA purification system (Promega, Southampton, UK). .. DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA.

Article Title: LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression
Article Snippet: LncRNA and 18S fragments were cloned into PCDNA4 plasmid and northern probes were produced using Biotin RNA Labeling Mix (catalogue 11685597910, Roche). .. T7 RNA polymerase (catalogue 10881767001, Roche) was used for in vitro transcription.

Article Title: Telomerase regulation by the long non-coding RNA H19 in human acute promyelocytic leukemia cells
Article Snippet: The products of digestion were purified using the plasmid DNA purification kit (Nucleobond® PC20, Macherey Nagel) and used as templates for subsequent in vitro transcription. .. H19 and GFP RNA molecules were generated by in vitro transcription using the T7 RNA polymerase (Roche).

In Vitro:

Article Title: Northern blot detection of endogenous small RNAs (~14 nt) in bacterial total RNA extracts
Article Snippet: Mature B. subtilis 6S-1 RNA (190 nt) and E. coli 6S RNA (186 nt) included as controls ( ) were synthesized by in vitro runoff transcription using T7 RNA polymerase. .. For specific detection of B. subtilis and E. coli 5S rRNA loading controls and for E. coli 6S RNA, antisense transcripts covering the respective full-length RNA and internally labeled with digoxigenin-UTP were synthesized from PCR templates by T7 RNA polymerase (according to the DIG RNA Labeling Mix protocol provided by Roche Diagnostics, Mannheim, Germany).

Article Title: Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries
Article Snippet: The reactions were pooled and purified with AMPure XP beads (Beckman Coulter), eluting in 25 μl H2 O. .. To transcribe the bait libraries into biotinylated RNA, we assembled the following in vitro transcription reaction mixture: 5 μl amplified library (∼500 ng), 15.2 μl H2 O, 10 μl 5× NASBA buffer (185 mM Tris-HCl [pH 8.5], 93 mM MgCl2 , 185 mM KCl, 46% DMSO), 2.5 μl 0.1 M DTT, 0.5 μl 10 mg/ml BSA, 12.5 μl 10 mM NTP mix (10 mM ATP, 10 mM CTP, 10 mM GTP, 6.5 mM UTP, 3.5 mM biotin-16-UTP), 1.5 μl T7 RNA Polymerase (20 U/μl, Roche), 0.3 μl Pyrophosphatase (0.1 U/μl, NEB), and 2.5 μl SUPERase-In RNase inhibitor (20 U/μl, Life Technologies). .. The reaction was incubated at 37°C overnight, treated for 15 min at 37°C with 1 μl TURBO DNase (2 U/μl, Life Technologies), and then purified with an RNeasy Mini kit (QIAGEN) according to the manufacturer’s instructions, eluting twice in the same 30 μl of H2 O.

Article Title: Exploiting cis-Acting Replication Elements To Direct Hepatitis C Virus-Dependent Transgene Expression
Article Snippet: Paragraph title: In vitro transcription. ... Plasmids were linearized at SalI site located immediately downstream of the HDV ribozyme, and these fragments were used as templates for runoff RNA synthesis with T7 RNA polymerase according to the protocol supplied by the manufacturer (Roche).

Article Title: Human mitochondrial RNA polymerase primes lagging-strand DNA synthesis in vitro
Article Snippet: Paragraph title: In Vitro Transcription on ssDNA. ... The reaction mixture (25 μl), contained 35 fmol of single-stranded M13mp18 DNA (New England Biolabs), 10 mM Tris·HCl (pH 8.0), 20 mM MgCl2 , 1 mM DTT, 100 μg/ml BSA, 400 μM ATP, 150 μM CTP, and GTP, 10 μM UTP, 0.2 μM α-32 P UTP (3,000 Ci/mmol), 4 units of RNase inhibitor (Amersham Biosciences), and the indicated concentrations of T7 RNA polymerase (Roche) or purified POLRMT protein.

Article Title: Identification of cellular proteins enhancing activities of internal ribosomal entry sites by competition with oligodeoxynucleotides
Article Snippet: Paragraph title: In vitro transcription and translation ... Transcription reactions were performed using T7 RNA polymerase (Roche Molecular Biochemicals) at 37°C for 90 min according to the manufacturer’s instructions.

Article Title: Antisense-oligonucleotide-directed inhibition of nonsense-mediated mRNA decay
Article Snippet: Rabbit anti-GFP (Sigma G1544) and mouse anti-α-tubulin (Sigma T9026) antibodies were used with IRDye 800CW secondary antibodies (LI-COR) for Western blotting, and the blots were imaged and quantified using the Odyssey Infrared Imaging System (LI-COR). .. Pre-mRNA for in vitro splicing was transcribed using T7 RNA polymerase (Roche) in the presence of α-32 P-UTP, using a PCR product as the template. .. The template contains portions of exons 2 and 3 and the intact intron 2 of HBB , and was amplified from human genomic DNA using the primer pair T7HBB-Ex2-F and HBB-Ex3-R ( ).

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: The recombinant plasmid DNA was extracted with a Wizard® Plus SV Miniprep DNA purification system (Promega, Southampton, UK). .. DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA. .. The RNA quantity present in the reaction was measured using a Quant-iT™ RiboGreen® Assay Kit (Life Technologies) and RNA copy number present in the TVT-RNA was determined as described by Fronhoffs et al .

Article Title: Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition
Article Snippet: Template for in situ probes were amplified from shield stage cDNA and a T7-promoter sequence added for in vitro transcription. .. Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription in 20μL reactions consisting of 100ng purified PCR product (8μL), 2μL DIG RNA labeling mix (Roche), 2μl 10X transcription buffer (Roche), and 2μl T7 RNA polymerase (Roche) in RNAse-free water and purified using a QIAGEN RNEasy kit. .. In situ protocol was followed as detailed in .

Article Title: LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression
Article Snippet: LncRNA and 18S fragments were cloned into PCDNA4 plasmid and northern probes were produced using Biotin RNA Labeling Mix (catalogue 11685597910, Roche). .. T7 RNA polymerase (catalogue 10881767001, Roche) was used for in vitro transcription. .. For northern blot, the samples were separated by electrophoresis using formaldehyde gel, followed by membrane transferring.

Article Title: The novel lncRNA lnc-NR2F1 is pro-neurogenic and mutated in human neurodevelopmental disorders
Article Snippet: The DIG-labeled sense RNA probe for both, NR2F1 and lnc-Nr2f1 , corresponds to the same region as the antisense probe in the reverse direction. .. Probes were generated by in vitro transcription with T7 RNA polymerase (Roche) using the DNA templates containing a promoter sequence of T7 RNA polymerase promoter (TAA TAC GAC TCA CTA TAG GG) followed by a complimentary sequence of target RNA. .. DNA templates were amplified by PCR with the following primers: For lnc-Nr2f1 probe: (F) GTG GCC ATG GAA TGG TGT AGC AGA, and (R) GTC TGA GTG TTT GTT TGA CTG AAT GT; NR2F1 probe: (F) CGG TTC AGC GAG GAA GAA TGC CT, and (R) CTA GGA ACA CTG GAT GGA CAT GTA AG.

Article Title: Telomerase regulation by the long non-coding RNA H19 in human acute promyelocytic leukemia cells
Article Snippet: The products of digestion were purified using the plasmid DNA purification kit (Nucleobond® PC20, Macherey Nagel) and used as templates for subsequent in vitro transcription. .. H19 and GFP RNA molecules were generated by in vitro transcription using the T7 RNA polymerase (Roche). .. The reaction was performed in a final volume of 20 μl containing 1 μg of linearized plasmid, 1× reaction buffer (40 mM Tris, pH 8.0, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT, 10 mM each ATP, GTP, UTP, and CTP, 1 μl RNase inhibitor (20 U/μl), and 2 μl T7 RNA polymerase (20 U/μl).

Irradiation:

Article Title: Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons
Article Snippet: RNA was transferred to a positively charged nylon membrane (Roche) by capillary blotting and crosslinked by UV irradiation. .. The probe recognizing all three C9ORF72 isoforms was synthesized with T7 RNA polymerase (Roche) from cDNAs obtained by PCR with specific primers (Table S1).

Negative Control:

Article Title: Long non-coding RNA PVT1 promotes tumor progression by regulating the miR-143/HK2 axis in gallbladder cancer
Article Snippet: Subsequently, the retrieved RNA was assayed by qPCR. .. A DNA fragment containing the full-length PVT1 sequence or a negative control sequence was PCR amplified using T7 RNA polymerase (Roche, Basel, Switzerland). .. The resulting plasmid DNA was linearized using the restriction enzyme Xho I. Biotin-labeled RNA was reverse transcribed using Biotin RNA Labeling Mix (Roche) and T7 RNA polymerase (Takara Biomedical Technology).

Binding Assay:

Article Title: Spliceosomal protein eftud2 mutation leads to p53-dependent apoptosis in zebrafish neural progenitors
Article Snippet: PCR fragments for tuba, nestin, map2, eftud2, foxa3 and wt1a were amplified from a 48 hpf embryonic cDNA library and confirmed by Sanger sequencing; the T7 RNA polymerase binding site was introduced to make anti-sense RNA probes. .. Digoxigenin-labeled probes were synthesized using T7 RNA polymerase (Roche).

Agarose Gel Electrophoresis:

Article Title: Modeling key pathological features of frontotemporal dementia with C9ORF72 repeat expansion in iPSC-derived human neurons
Article Snippet: For northern blot analysis, total RNA (2–5 μg) was loaded into a 0.8 % agarose gel containing 1.8 % formaldehyde. .. The probe recognizing all three C9ORF72 isoforms was synthesized with T7 RNA polymerase (Roche) from cDNAs obtained by PCR with specific primers (Table S1).

In Situ:

Article Title: Nanog, Pou5f1 and SoxB1 activate zygotic gene expression during the maternal-to-zygotic transition
Article Snippet: Paragraph title: In situ hybridization ... Antisense digoxigenin (DIG) RNA probes were generated by in vitro transcription in 20μL reactions consisting of 100ng purified PCR product (8μL), 2μL DIG RNA labeling mix (Roche), 2μl 10X transcription buffer (Roche), and 2μl T7 RNA polymerase (Roche) in RNAse-free water and purified using a QIAGEN RNEasy kit.

Article Title: Astrocyte Hypertrophy and Microglia Activation in the Rat Auditory Midbrain Is Induced by Electrical Intracochlear Stimulation
Article Snippet: Paragraph title: In Situ Probes ... Sense riboprobes were made after transcription with T7 RNA polymerase (Roche, Cat. No. 10881767001).

Produced:

Article Title: R-Loop Formation In Trans at an AGGAG Repeat
Article Snippet: The plasmid, pHC624-(AGGAG)22 , was constructed by inserting the AGGAG repeat in a small cloning vector, pHC624 [ ]. .. An AGGAG-repeat transcript was produced by transcribing linearized pSK-(AGGAG)22 with T7 RNA polymerase, and effects on the target pHC624-(AGGAG)22 were examined. .. Change in DNA topology was observed for supercoiled pHC624-(AGGAG)22 ( , lanes 4 and 5).

Article Title: Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries
Article Snippet: To transcribe the bait libraries into biotinylated RNA, we assembled the following in vitro transcription reaction mixture: 5 μl amplified library (∼500 ng), 15.2 μl H2 O, 10 μl 5× NASBA buffer (185 mM Tris-HCl [pH 8.5], 93 mM MgCl2 , 185 mM KCl, 46% DMSO), 2.5 μl 0.1 M DTT, 0.5 μl 10 mg/ml BSA, 12.5 μl 10 mM NTP mix (10 mM ATP, 10 mM CTP, 10 mM GTP, 6.5 mM UTP, 3.5 mM biotin-16-UTP), 1.5 μl T7 RNA Polymerase (20 U/μl, Roche), 0.3 μl Pyrophosphatase (0.1 U/μl, NEB), and 2.5 μl SUPERase-In RNase inhibitor (20 U/μl, Life Technologies). .. The reaction was incubated at 37°C overnight, treated for 15 min at 37°C with 1 μl TURBO DNase (2 U/μl, Life Technologies), and then purified with an RNeasy Mini kit (QIAGEN) according to the manufacturer’s instructions, eluting twice in the same 30 μl of H2 O.

Article Title: LncSox4 promotes the self-renewal of liver tumour-initiating cells through Stat3-mediated Sox4 expression
Article Snippet: LncRNA and 18S fragments were cloned into PCDNA4 plasmid and northern probes were produced using Biotin RNA Labeling Mix (catalogue 11685597910, Roche). .. T7 RNA polymerase (catalogue 10881767001, Roche) was used for in vitro transcription.

Concentration Assay:

Article Title: R-Loop Formation In Trans at an AGGAG Repeat
Article Snippet: Standard transcription reaction was carried out with 6 units of T7 RNA polymerase (Roche Diagnostics) on 0.3 μ g DNA (0.3 μ g for each DNA, when two DNA species were present) at 37°C for 20 min in 20 μ L of 50 mM NaCl, 40 mM Tris· HCl pH 8.0, 6 mM MgCl2 , 2 mM spermidine, 10 mM DTT, and 0.6 mM each of ATP, CTP, GTP, and UTP [ , ]. .. After incubation at 37°C for 1 h, the reaction was extracted with phenol/chloroform/isoamylalcohol.

Article Title: Antisense-oligonucleotide-directed inhibition of nonsense-mediated mRNA decay
Article Snippet: Pre-mRNA for in vitro splicing was transcribed using T7 RNA polymerase (Roche) in the presence of α-32 P-UTP, using a PCR product as the template. .. The template contains portions of exons 2 and 3 and the intact intron 2 of HBB , and was amplified from human genomic DNA using the primer pair T7HBB-Ex2-F and HBB-Ex3-R ( ).

Construct:

Article Title: Astrocyte Hypertrophy and Microglia Activation in the Rat Auditory Midbrain Is Induced by Electrical Intracochlear Stimulation
Article Snippet: From this construct a linearized fos fragment flanked by the T3 and T7 promoters was amplified. .. Sense riboprobes were made after transcription with T7 RNA polymerase (Roche, Cat. No. 10881767001).

DNA Purification:

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: The recombinant plasmid DNA was extracted with a Wizard® Plus SV Miniprep DNA purification system (Promega, Southampton, UK). .. DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA.

Article Title: Telomerase regulation by the long non-coding RNA H19 in human acute promyelocytic leukemia cells
Article Snippet: The products of digestion were purified using the plasmid DNA purification kit (Nucleobond® PC20, Macherey Nagel) and used as templates for subsequent in vitro transcription. .. H19 and GFP RNA molecules were generated by in vitro transcription using the T7 RNA polymerase (Roche).

Virus Isolation Assay:

Article Title: Impact of Salmonid alphavirus infection in diploid and triploid Atlantic salmon (Salmo salar L.) fry
Article Snippet: To prepare the DNA template for molecular cloning, viral RNA was extracted from SAV culture supernatant using a NucleoSpin® RNA Virus isolation kit (Macherey-Nagel, Fisher Scientific, Leicestershire, UK). .. DNA from the clone with sense orientation was then in vitro transcribed using a T7 RNA polymerase (Roche, West Sussex, UK) in order to obtain IVT-RNA.

CTG Assay:

Article Title: Northern blot detection of endogenous small RNAs (~14 nt) in bacterial total RNA extracts
Article Snippet: 14- or 16-mer probes complementary to pRNAs included 5′-digoxigenin-aGt tTt gAc cGa Ac-3′ (probe for B. subtilis wt 6S-1 pRNA), 5′-digoxigenin-aGt cgT gAC cga Ac-3′ (probe for B. subtilis mutant 6S-1 pRNA), 5′-digoxigenin-tcC cCt gAg cCg At-3′ (E. coli 6S pRNA probe 1), 5′-digoxigenin-tcc ccT gag ccg At-3′ (E. coli 6S pRNA probe 2) and 5′-digoxigenin-agT ccc ctg agc cgA t-3′ (E. coli 6S pRNA probe 3), with uppercase letters indicating LNA and lowercase letters DNA residues ( and ); 5′-digoxigenin-labeled, LNA-containing probes were obtained from Exiqon (Vedbaek, Denmark). .. For specific detection of B. subtilis and E. coli 5S rRNA loading controls and for E. coli 6S RNA, antisense transcripts covering the respective full-length RNA and internally labeled with digoxigenin-UTP were synthesized from PCR templates by T7 RNA polymerase (according to the DIG RNA Labeling Mix protocol provided by Roche Diagnostics, Mannheim, Germany).

Staining:

Article Title: Pulling out the 1%: Whole-Genome Capture for the Targeted Enrichment of Ancient DNA Sequencing Libraries
Article Snippet: To transcribe the bait libraries into biotinylated RNA, we assembled the following in vitro transcription reaction mixture: 5 μl amplified library (∼500 ng), 15.2 μl H2 O, 10 μl 5× NASBA buffer (185 mM Tris-HCl [pH 8.5], 93 mM MgCl2 , 185 mM KCl, 46% DMSO), 2.5 μl 0.1 M DTT, 0.5 μl 10 mg/ml BSA, 12.5 μl 10 mM NTP mix (10 mM ATP, 10 mM CTP, 10 mM GTP, 6.5 mM UTP, 3.5 mM biotin-16-UTP), 1.5 μl T7 RNA Polymerase (20 U/μl, Roche), 0.3 μl Pyrophosphatase (0.1 U/μl, NEB), and 2.5 μl SUPERase-In RNase inhibitor (20 U/μl, Life Technologies). .. A single reaction produced ∼50 μg of RNA.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Roche expand high fidelity pcr system
    Silencing of BdPDS in B. distachyon leaves A Leaves of B. distachyon infected with <t>BSMV-GFP</t> 375 or BSMV-BdPDS. B BdPDS RNA expression levels in experiments 2 and 3 (Table 1) determined by <t>qRT-PCR</t> (normalization to 18 S rRNA). Plants were inoculated with either BSMV-BdPDS (black bars) or BSMV-GFP 375 (white bars). From left to right, the bars represent 16, 13, 6 and 6 samples, respectively. Error bars denote standard deviations. AU - Arbitrary units. Significantly differences: * ( p
    Expand High Fidelity Pcr System, supplied by Roche, used in various techniques. Bioz Stars score: 99/100, based on 1114 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand high fidelity pcr system/product/Roche
    Average 99 stars, based on 1114 article reviews
    Price from $9.99 to $1999.99
    expand high fidelity pcr system - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    77
    Roche good transcriptomes
    Evaluation of case study 3 (chestnut stem) set of assemblies. a PCA plot of the first two dimensions coloured by clusters using the two plant reference <t>transcriptomes.</t> Only three clusters are observed, marked as green (containing only the poplar reference transcriptome), red (containing the Arabidopsis reference transcriptome and most Illumina and Roche/454 combinations), and black. b PCA plot of the same data as in a , but using only the Arabidopsis reference transcriptome in the plot and for clustering. Four significant clusters can be now distinguished. Cluster 5.1 (blue dots) contains the Arabidopsis reference transcriptome, three assembly-assembly combinations of OASES scaffolding that includes the k -mer 25 with the Roche/454 reconciled assembly using Minimus2, the Minimus 2 merging of all Illumina scaffolded assemblies with the Roche/454 reconciled assembly, and four Illumina OASES-scaffolded assemblies with k -mer 25. Cluster 5.2 (red dots): two (MIRA4 and reconciled) Roche/454 assemblies, the all Illumina assemblies combined with Roche/454 reads using MIRA4, and the RAY assemblies with k -mer 35 merged with the Roche/454 reconciled assembly using Minimus2. Cluster 5.3 (green dots): all assembly-assembly combinations performed with Minimus2, except for the RAY merging using k -mer 25, the reads-reads combined assembly using RAY with k -mer 35, and the all Illumina assemblies, excepting RAY assemblies with k -mer 35. Cluster 5.4 (black dots): all RAY assembly-assembly combinations, Roche/454 primary assembly with EULER-SR, Illumina assemblies using RAY with k -mer 35 and reads-reads combination assembly using RAY with k -mer 35
    Good Transcriptomes, supplied by Roche, used in various techniques. Bioz Stars score: 77/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/good transcriptomes/product/Roche
    Average 77 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    good transcriptomes - by Bioz Stars, 2020-01
    77/100 stars
      Buy from Supplier

    82
    Roche epiphytic transcriptome
    Evaluation of case study 3 (chestnut stem) set of assemblies. a PCA plot of the first two dimensions coloured by clusters using the two plant reference transcriptomes. Only three clusters are observed, marked as green (containing only the poplar reference <t>transcriptome),</t> red (containing the Arabidopsis reference transcriptome and most Illumina and Roche/454 combinations), and black. b PCA plot of the same data as in a , but using only the Arabidopsis reference transcriptome in the plot and for clustering. Four significant clusters can be now distinguished. Cluster 5.1 (blue dots) contains the Arabidopsis reference transcriptome, three assembly-assembly combinations of OASES scaffolding that includes the k -mer 25 with the Roche/454 reconciled assembly using Minimus2, the Minimus 2 merging of all Illumina scaffolded assemblies with the Roche/454 reconciled assembly, and four Illumina OASES-scaffolded assemblies with k -mer 25. Cluster 5.2 (red dots): two (MIRA4 and reconciled) Roche/454 assemblies, the all Illumina assemblies combined with Roche/454 reads using MIRA4, and the RAY assemblies with k -mer 35 merged with the Roche/454 reconciled assembly using Minimus2. Cluster 5.3 (green dots): all assembly-assembly combinations performed with Minimus2, except for the RAY merging using k -mer 25, the reads-reads combined assembly using RAY with k -mer 35, and the all Illumina assemblies, excepting RAY assemblies with k -mer 35. Cluster 5.4 (black dots): all RAY assembly-assembly combinations, Roche/454 primary assembly with EULER-SR, Illumina assemblies using RAY with k -mer 35 and reads-reads combination assembly using RAY with k -mer 35
    Epiphytic Transcriptome, supplied by Roche, used in various techniques. Bioz Stars score: 82/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/epiphytic transcriptome/product/Roche
    Average 82 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    epiphytic transcriptome - by Bioz Stars, 2020-01
    82/100 stars
      Buy from Supplier

    Image Search Results


    Silencing of BdPDS in B. distachyon leaves A Leaves of B. distachyon infected with BSMV-GFP 375 or BSMV-BdPDS. B BdPDS RNA expression levels in experiments 2 and 3 (Table 1) determined by qRT-PCR (normalization to 18 S rRNA). Plants were inoculated with either BSMV-BdPDS (black bars) or BSMV-GFP 375 (white bars). From left to right, the bars represent 16, 13, 6 and 6 samples, respectively. Error bars denote standard deviations. AU - Arbitrary units. Significantly differences: * ( p

    Journal: Plant Methods

    Article Title: Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

    doi: 10.1186/1746-4811-6-26

    Figure Lengend Snippet: Silencing of BdPDS in B. distachyon leaves A Leaves of B. distachyon infected with BSMV-GFP 375 or BSMV-BdPDS. B BdPDS RNA expression levels in experiments 2 and 3 (Table 1) determined by qRT-PCR (normalization to 18 S rRNA). Plants were inoculated with either BSMV-BdPDS (black bars) or BSMV-GFP 375 (white bars). From left to right, the bars represent 16, 13, 6 and 6 samples, respectively. Error bars denote standard deviations. AU - Arbitrary units. Significantly differences: * ( p

    Article Snippet: Gene fragments for insertion into BSMV were PCR amplified using Expand High Fidelity PCR System (Roche Diagnostics, Mannheim, Germany) with the primers shown in Additional file .

    Techniques: Infection, RNA Expression, Quantitative RT-PCR

    Silencing of HvIPS1 in barley roots and shoots . A HvIPS1 RNA expression levels in root tissue determined by qRT-PCR (normalization to ubiquitin). Plants inoculated with BSMV-IPS1 (black bars) or BSMV-GFP 250 (white bars). Plants were grown in 0 (5, 7, 9 dpi) or 1 mM Pi (9 dpi) and harvested at 5, 7, or 9 dpi. Each bar represents three samples (with one exception - only two samples for the 0 Pi, GFP, 9dpi bar). Error bars denote standard deviations. AU - Arbitrary units. B Stability of the BSMV-IPS1 construct in roots of inoculated plants. cDNA prepared for qRT-PCR (A) was used for PCR with primers flanking the insert. Lanes 1, 2, 3: 0 mM Pi, 5 dpi; 4, 5, 6: 0 mM Pi, 7 dpi; 7, 8, 9: 0 mM Pi, 9 dpi; 10, 11, 12: 1 mM Pi, 9 dpi; 13: plasmid containing BSMVγ-IPS1; 14: water control. M4: GeneRuler 50 bp DNA Ladder (Fermentas); white arrow represents DNA fragment of 500 bp; bands below are 400, 300, and 250 bp. C Stability of the BSMV-GFP 250 construct in roots of inoculated plants. cDNA prepared for qRT-PCR (panel A) was used for PCR with primers flanking the insert. Lanes 1, 2, 3: 0 mM Pi, 5 dpi; 4, 5, 6: 0 mM Pi, 7 dpi; 7, 8: 0 mM Pi, 9 dpi; 9, 10, 11: 1 mM Pi, 9 dpi. D HvIPS1 RNA expression levels in root and shoot tissue determined by qRT-PCR (normalization to ubiquitin). BSMV-IPS1 (black bars), BSMV-GFP 250 (white bars). Plant were grown in 0 mM Pi and harvested at 9 dpi. Each bar represents five samples. Error bars denote standard deviations.

    Journal: Plant Methods

    Article Title: Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

    doi: 10.1186/1746-4811-6-26

    Figure Lengend Snippet: Silencing of HvIPS1 in barley roots and shoots . A HvIPS1 RNA expression levels in root tissue determined by qRT-PCR (normalization to ubiquitin). Plants inoculated with BSMV-IPS1 (black bars) or BSMV-GFP 250 (white bars). Plants were grown in 0 (5, 7, 9 dpi) or 1 mM Pi (9 dpi) and harvested at 5, 7, or 9 dpi. Each bar represents three samples (with one exception - only two samples for the 0 Pi, GFP, 9dpi bar). Error bars denote standard deviations. AU - Arbitrary units. B Stability of the BSMV-IPS1 construct in roots of inoculated plants. cDNA prepared for qRT-PCR (A) was used for PCR with primers flanking the insert. Lanes 1, 2, 3: 0 mM Pi, 5 dpi; 4, 5, 6: 0 mM Pi, 7 dpi; 7, 8, 9: 0 mM Pi, 9 dpi; 10, 11, 12: 1 mM Pi, 9 dpi; 13: plasmid containing BSMVγ-IPS1; 14: water control. M4: GeneRuler 50 bp DNA Ladder (Fermentas); white arrow represents DNA fragment of 500 bp; bands below are 400, 300, and 250 bp. C Stability of the BSMV-GFP 250 construct in roots of inoculated plants. cDNA prepared for qRT-PCR (panel A) was used for PCR with primers flanking the insert. Lanes 1, 2, 3: 0 mM Pi, 5 dpi; 4, 5, 6: 0 mM Pi, 7 dpi; 7, 8: 0 mM Pi, 9 dpi; 9, 10, 11: 1 mM Pi, 9 dpi. D HvIPS1 RNA expression levels in root and shoot tissue determined by qRT-PCR (normalization to ubiquitin). BSMV-IPS1 (black bars), BSMV-GFP 250 (white bars). Plant were grown in 0 mM Pi and harvested at 9 dpi. Each bar represents five samples. Error bars denote standard deviations.

    Article Snippet: Gene fragments for insertion into BSMV were PCR amplified using Expand High Fidelity PCR System (Roche Diagnostics, Mannheim, Germany) with the primers shown in Additional file .

    Techniques: RNA Expression, Quantitative RT-PCR, Construct, Polymerase Chain Reaction, Plasmid Preparation

    BSMVγ constructs selected for relative stability also produce successful gene silencing in barley roots . A RT-PCR analysis of the stability of BSMVγ constructs in barley roots. Expected lengths for the PCR products are presented in brackets. Lanes 1, 2: BSMV-IPS1 (493 bp); 3, 4: BSMV-Pht1;1 (610 bp); 5, 6: BSMV-Pht1;4 (616 bp); 7, 8: BSMV-Pht1;7 (623 bp); 9, 10: BSMV-PHR1 (495 bp); 11, 12: BSMV-PHO2 247 (511 bp); 13, 14: BSMV-PHO2 387 (651 bp); 15, 16: GFP 250 (492 bp); 17: control plasmid carrying BSMVγ-GFP 375 (617 bp); 18: control plasmid carrying BSMVγ-IPS1 (493 bp); M4: GeneRuler 50 bp DNA Ladder (Fermentas); M5: O'GeneRuler 50bp DNA Ladder (Fermentas). White arrow represents DNA fragment of 500 bp; bands below are 400, 300, and 250 bp. B and C HvPHR1 expression levels in root tissue determined by qRT-PCR, normalization to 18 S rRNA. BSMV-PHR1 (black bars), BSMV-GFP 250 (white bars). Samples in B are identical to those shown in A, lanes 9, 10 and 15,16. In C, each bar represents five independent samples. AU - arbitrary units; error bars denote standard deviations. D HvPHO2 expression levels in root and leaf tissue determined by qRT-PCR, normalization to 18 S rRNA. BSMV-PHO2 247 (black bars), BSMV-GFP 250 (white bars). E As D, but bars represent Pi content in inoculated plants (in μmol Pi/g of fresh weight).

    Journal: Plant Methods

    Article Title: Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

    doi: 10.1186/1746-4811-6-26

    Figure Lengend Snippet: BSMVγ constructs selected for relative stability also produce successful gene silencing in barley roots . A RT-PCR analysis of the stability of BSMVγ constructs in barley roots. Expected lengths for the PCR products are presented in brackets. Lanes 1, 2: BSMV-IPS1 (493 bp); 3, 4: BSMV-Pht1;1 (610 bp); 5, 6: BSMV-Pht1;4 (616 bp); 7, 8: BSMV-Pht1;7 (623 bp); 9, 10: BSMV-PHR1 (495 bp); 11, 12: BSMV-PHO2 247 (511 bp); 13, 14: BSMV-PHO2 387 (651 bp); 15, 16: GFP 250 (492 bp); 17: control plasmid carrying BSMVγ-GFP 375 (617 bp); 18: control plasmid carrying BSMVγ-IPS1 (493 bp); M4: GeneRuler 50 bp DNA Ladder (Fermentas); M5: O'GeneRuler 50bp DNA Ladder (Fermentas). White arrow represents DNA fragment of 500 bp; bands below are 400, 300, and 250 bp. B and C HvPHR1 expression levels in root tissue determined by qRT-PCR, normalization to 18 S rRNA. BSMV-PHR1 (black bars), BSMV-GFP 250 (white bars). Samples in B are identical to those shown in A, lanes 9, 10 and 15,16. In C, each bar represents five independent samples. AU - arbitrary units; error bars denote standard deviations. D HvPHO2 expression levels in root and leaf tissue determined by qRT-PCR, normalization to 18 S rRNA. BSMV-PHO2 247 (black bars), BSMV-GFP 250 (white bars). E As D, but bars represent Pi content in inoculated plants (in μmol Pi/g of fresh weight).

    Article Snippet: Gene fragments for insertion into BSMV were PCR amplified using Expand High Fidelity PCR System (Roche Diagnostics, Mannheim, Germany) with the primers shown in Additional file .

    Techniques: Construct, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Plasmid Preparation, Expressing, Quantitative RT-PCR

    Short inverted repeats are not inherently more stable or efficient for BSMV induced VIGS in barley roots . A HvCel1 RNA expression levels in root tissue determined by qRT-PCR (normalization to 18 S rRNA). Plants were inoculated with either BSMV-Cel1-1, BSMV-Cel1-3, BSMV-Cel1-IR, or BSMV-GFP 375 . Each bar represents five samples, each consisting of one plant in a pot. Error bars denote standard deviations. AU - Arbitrary units. B and C Stability of the BSMV constructs in roots of infected plants. cDNA prepared for qRT-PCR (panel A) was used for PCR with primers flanking the insert. B lanes 1-5: plants infected with BSMV-Cel1-1 (643 bp); lane 6: plasmid containing BSMV-Cel1-1 (643 bp); lane 7: plasmid containing BSMV without insert (242 bp); lanes 8-12: plants infected with BSMV-Cel1-3 (641 bp). C lanes 1-5: plants infected with BSMV-Cel1-IR (388 bp); lane 6: plasmid containing BSMV-Cel1-IR (388 bp); lane 7: plasmid containing BSMV without insert (242 bp); lane 8: plasmid containing BSMV-GFP 375 (617 bp); lanes 9-12: plants infected with BSMV-GFP 375 (617 bp). M5: O'Gene Ruler 50 bp DNA ladder (Fermentas). Expected lengths for the PCR products are given in brackets.

    Journal: Plant Methods

    Article Title: Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

    doi: 10.1186/1746-4811-6-26

    Figure Lengend Snippet: Short inverted repeats are not inherently more stable or efficient for BSMV induced VIGS in barley roots . A HvCel1 RNA expression levels in root tissue determined by qRT-PCR (normalization to 18 S rRNA). Plants were inoculated with either BSMV-Cel1-1, BSMV-Cel1-3, BSMV-Cel1-IR, or BSMV-GFP 375 . Each bar represents five samples, each consisting of one plant in a pot. Error bars denote standard deviations. AU - Arbitrary units. B and C Stability of the BSMV constructs in roots of infected plants. cDNA prepared for qRT-PCR (panel A) was used for PCR with primers flanking the insert. B lanes 1-5: plants infected with BSMV-Cel1-1 (643 bp); lane 6: plasmid containing BSMV-Cel1-1 (643 bp); lane 7: plasmid containing BSMV without insert (242 bp); lanes 8-12: plants infected with BSMV-Cel1-3 (641 bp). C lanes 1-5: plants infected with BSMV-Cel1-IR (388 bp); lane 6: plasmid containing BSMV-Cel1-IR (388 bp); lane 7: plasmid containing BSMV without insert (242 bp); lane 8: plasmid containing BSMV-GFP 375 (617 bp); lanes 9-12: plants infected with BSMV-GFP 375 (617 bp). M5: O'Gene Ruler 50 bp DNA ladder (Fermentas). Expected lengths for the PCR products are given in brackets.

    Article Snippet: Gene fragments for insertion into BSMV were PCR amplified using Expand High Fidelity PCR System (Roche Diagnostics, Mannheim, Germany) with the primers shown in Additional file .

    Techniques: RNA Expression, Quantitative RT-PCR, Construct, Infection, Polymerase Chain Reaction, Plasmid Preparation

    Attempt at silencing HvPht1;1 expression in barley roots . A HvPht1;1 mRNA expression levels in root tissue determined by qRT-PCR (normalization to ubiquitin). Plants were inoculated with either BSMV-Pht1;1 (black bars) or BSMV-GFP 375 (white bars). Plants were grown in hydroponic culture containing 0 or 1 mM Pi. Each bar represents three samples, error bars denote standard deviations. AU - Arbitrary units. B Schematic view of BSMVγ with introduced insert. Arrows show the position of the primers BSMVgbF and BSMVgbR used for assessing stability of insert. The length of virus sequence 5' and 3' of the insert is shown. PCR products of

    Journal: Plant Methods

    Article Title: Investigations of barley stripe mosaic virus as a gene silencing vector in barley roots and in Brachypodium distachyon and oat

    doi: 10.1186/1746-4811-6-26

    Figure Lengend Snippet: Attempt at silencing HvPht1;1 expression in barley roots . A HvPht1;1 mRNA expression levels in root tissue determined by qRT-PCR (normalization to ubiquitin). Plants were inoculated with either BSMV-Pht1;1 (black bars) or BSMV-GFP 375 (white bars). Plants were grown in hydroponic culture containing 0 or 1 mM Pi. Each bar represents three samples, error bars denote standard deviations. AU - Arbitrary units. B Schematic view of BSMVγ with introduced insert. Arrows show the position of the primers BSMVgbF and BSMVgbR used for assessing stability of insert. The length of virus sequence 5' and 3' of the insert is shown. PCR products of "USER cloning" BSMV vectors are longer by 22 bp compared with restriction enzymes cloning. Not drawn to scale. C Stability of the BSMV-Pht1;1 and BSMV-GFP 375 constructs in roots of inoculated plants. cDNA prepared for qRT-PCR (panel A) was used for PCR with primers flanking the insert as shown in B. Lanes 1, 2, 3: BSMV-Pht1;1, 0 mM Pi (610 bp); 4, 5, 6: BSMV-Pht1;1, 1 mM Pi (610 bp); 7, 8, 9: BSMV-GFP 375 , 0 mM Pi (617 bp); 10, 11, 12: BSMV-GFP 375 ,1 mM Pi (617 bp); 13: plasmid containing BSMVγ-PDS cassette (643 bp); 14: water control; M2: DNA marker; black arrow represents DNA fragment of 564 bp. The expected lengths for PCR products are given in brackets.

    Article Snippet: Gene fragments for insertion into BSMV were PCR amplified using Expand High Fidelity PCR System (Roche Diagnostics, Mannheim, Germany) with the primers shown in Additional file .

    Techniques: Expressing, Quantitative RT-PCR, Sequencing, Polymerase Chain Reaction, Clone Assay, Construct, Plasmid Preparation, Marker

    Evaluation of case study 3 (chestnut stem) set of assemblies. a PCA plot of the first two dimensions coloured by clusters using the two plant reference transcriptomes. Only three clusters are observed, marked as green (containing only the poplar reference transcriptome), red (containing the Arabidopsis reference transcriptome and most Illumina and Roche/454 combinations), and black. b PCA plot of the same data as in a , but using only the Arabidopsis reference transcriptome in the plot and for clustering. Four significant clusters can be now distinguished. Cluster 5.1 (blue dots) contains the Arabidopsis reference transcriptome, three assembly-assembly combinations of OASES scaffolding that includes the k -mer 25 with the Roche/454 reconciled assembly using Minimus2, the Minimus 2 merging of all Illumina scaffolded assemblies with the Roche/454 reconciled assembly, and four Illumina OASES-scaffolded assemblies with k -mer 25. Cluster 5.2 (red dots): two (MIRA4 and reconciled) Roche/454 assemblies, the all Illumina assemblies combined with Roche/454 reads using MIRA4, and the RAY assemblies with k -mer 35 merged with the Roche/454 reconciled assembly using Minimus2. Cluster 5.3 (green dots): all assembly-assembly combinations performed with Minimus2, except for the RAY merging using k -mer 25, the reads-reads combined assembly using RAY with k -mer 35, and the all Illumina assemblies, excepting RAY assemblies with k -mer 35. Cluster 5.4 (black dots): all RAY assembly-assembly combinations, Roche/454 primary assembly with EULER-SR, Illumina assemblies using RAY with k -mer 35 and reads-reads combination assembly using RAY with k -mer 35

    Journal: BMC Bioinformatics

    Article Title: TransFlow: a modular framework for assembling and assessing accurate de novo transcriptomes in non-model organisms

    doi: 10.1186/s12859-018-2384-y

    Figure Lengend Snippet: Evaluation of case study 3 (chestnut stem) set of assemblies. a PCA plot of the first two dimensions coloured by clusters using the two plant reference transcriptomes. Only three clusters are observed, marked as green (containing only the poplar reference transcriptome), red (containing the Arabidopsis reference transcriptome and most Illumina and Roche/454 combinations), and black. b PCA plot of the same data as in a , but using only the Arabidopsis reference transcriptome in the plot and for clustering. Four significant clusters can be now distinguished. Cluster 5.1 (blue dots) contains the Arabidopsis reference transcriptome, three assembly-assembly combinations of OASES scaffolding that includes the k -mer 25 with the Roche/454 reconciled assembly using Minimus2, the Minimus 2 merging of all Illumina scaffolded assemblies with the Roche/454 reconciled assembly, and four Illumina OASES-scaffolded assemblies with k -mer 25. Cluster 5.2 (red dots): two (MIRA4 and reconciled) Roche/454 assemblies, the all Illumina assemblies combined with Roche/454 reads using MIRA4, and the RAY assemblies with k -mer 35 merged with the Roche/454 reconciled assembly using Minimus2. Cluster 5.3 (green dots): all assembly-assembly combinations performed with Minimus2, except for the RAY merging using k -mer 25, the reads-reads combined assembly using RAY with k -mer 35, and the all Illumina assemblies, excepting RAY assemblies with k -mer 35. Cluster 5.4 (black dots): all RAY assembly-assembly combinations, Roche/454 primary assembly with EULER-SR, Illumina assemblies using RAY with k -mer 35 and reads-reads combination assembly using RAY with k -mer 35

    Article Snippet: It has been revealed that 2×100 nt reads (or maybe longer) and OASES assembler can provide very good transcriptomes, and that the contribution of Roche/454 reads is noticeable only when short, single-reads were used.

    Techniques: Scaffolding

    Overview and dependencies of TransFlow modules. Raw reads from sequencing platforms are used as input whether any de novo assembling is desired. Each module is independent, except for Module 5, which requires internal or external transcriptomes. Merging module (Module 3) is also optional since it is only required when combination of reads from different platforms is desired. Solid arrows, independently of their colour, indicate compulsory dependencies when the parent module is present; dashed arrows indicate optional dependencies even if the parent module is present

    Journal: BMC Bioinformatics

    Article Title: TransFlow: a modular framework for assembling and assessing accurate de novo transcriptomes in non-model organisms

    doi: 10.1186/s12859-018-2384-y

    Figure Lengend Snippet: Overview and dependencies of TransFlow modules. Raw reads from sequencing platforms are used as input whether any de novo assembling is desired. Each module is independent, except for Module 5, which requires internal or external transcriptomes. Merging module (Module 3) is also optional since it is only required when combination of reads from different platforms is desired. Solid arrows, independently of their colour, indicate compulsory dependencies when the parent module is present; dashed arrows indicate optional dependencies even if the parent module is present

    Article Snippet: It has been revealed that 2×100 nt reads (or maybe longer) and OASES assembler can provide very good transcriptomes, and that the contribution of Roche/454 reads is noticeable only when short, single-reads were used.

    Techniques: Sequencing

    Classification of candidates to plant reference transcriptomes based on the evaluation parameters of Table 2 . a Radar plot of evaluation parameters for the six plant transcriptomes analysed in this work: Arabidopsis ( Arabidopsis thaliana ), poplar ( Populus trichocarpa ), grapevine ( Vitis vinifera ), wheat ( Triticum aestivum ), rice ( Oryza sativa ) and maize ( Zea mays ). b Dendrogram on the two first dimensions of the PCA, coloured by cluster

    Journal: BMC Bioinformatics

    Article Title: TransFlow: a modular framework for assembling and assessing accurate de novo transcriptomes in non-model organisms

    doi: 10.1186/s12859-018-2384-y

    Figure Lengend Snippet: Classification of candidates to plant reference transcriptomes based on the evaluation parameters of Table 2 . a Radar plot of evaluation parameters for the six plant transcriptomes analysed in this work: Arabidopsis ( Arabidopsis thaliana ), poplar ( Populus trichocarpa ), grapevine ( Vitis vinifera ), wheat ( Triticum aestivum ), rice ( Oryza sativa ) and maize ( Zea mays ). b Dendrogram on the two first dimensions of the PCA, coloured by cluster

    Article Snippet: It has been revealed that 2×100 nt reads (or maybe longer) and OASES assembler can provide very good transcriptomes, and that the contribution of Roche/454 reads is noticeable only when short, single-reads were used.

    Techniques:

    Evaluation of case study 2 (olive tree pollen) set of assemblies. PCA plot of the first two dimensions with the three significant clusters found by HCPC analysis is shown. Cluster 4.1 (red dots): the 2 plant reference transcriptomes, all Illumina assemblies combined with Roche/454 reads using MIRA4, and 2 Roche/454 assemblies (one using only MIRA4 and the other is the CAP3 reconciled assembly). Cluster 4.2 (green dots): all (primary and scaffolded) Illumina assemblies, except using RAY, executed with k -mer 35, the 2 Roche/454 and Illumina reads-reads merging using RAY with k -mers 25 and 35, all the assembly-assembly combinations using Minimus2 and the 2 all-to-all reconciliations using Minimus2. Cluster 4.3 (black dots): EULER-SR primary assembly, Illumina RAY assembly with k -mer 35, all the Illumina assemblies merged with Roche/454 reads using RAY, and all the assembly-assembly combinations performed with RAY

    Journal: BMC Bioinformatics

    Article Title: TransFlow: a modular framework for assembling and assessing accurate de novo transcriptomes in non-model organisms

    doi: 10.1186/s12859-018-2384-y

    Figure Lengend Snippet: Evaluation of case study 2 (olive tree pollen) set of assemblies. PCA plot of the first two dimensions with the three significant clusters found by HCPC analysis is shown. Cluster 4.1 (red dots): the 2 plant reference transcriptomes, all Illumina assemblies combined with Roche/454 reads using MIRA4, and 2 Roche/454 assemblies (one using only MIRA4 and the other is the CAP3 reconciled assembly). Cluster 4.2 (green dots): all (primary and scaffolded) Illumina assemblies, except using RAY, executed with k -mer 35, the 2 Roche/454 and Illumina reads-reads merging using RAY with k -mers 25 and 35, all the assembly-assembly combinations using Minimus2 and the 2 all-to-all reconciliations using Minimus2. Cluster 4.3 (black dots): EULER-SR primary assembly, Illumina RAY assembly with k -mer 35, all the Illumina assemblies merged with Roche/454 reads using RAY, and all the assembly-assembly combinations performed with RAY

    Article Snippet: It has been revealed that 2×100 nt reads (or maybe longer) and OASES assembler can provide very good transcriptomes, and that the contribution of Roche/454 reads is noticeable only when short, single-reads were used.

    Techniques:

    Evaluation of case study 1 (grapevine leaves) set of assemblies using PCA plots coloured by clusters. a PCA plot of the first two dimensions with the three significant clusters found by HCPC analysis marked as green (3.1), red (3.2) and black (3.3). The primary assembly ctOasesK35 and the scaffolded assembly scOasesK35 are boxed in blue to highlight the improvement of OASES when contigs are scaffolded. b Tree of assemblies where clusters are boxed in the same colours as a . Cluster 3.1 (green box): the 2 plant reference transcriptomes and the 3 OASES scaffolded assemblies. Cluster 3.2 (red box): 13 assemblies, 9 of them being scaffolded assemblies. Cluster 3.3 (black box): 14 assemblies, 11 of them being primary assemblies

    Journal: BMC Bioinformatics

    Article Title: TransFlow: a modular framework for assembling and assessing accurate de novo transcriptomes in non-model organisms

    doi: 10.1186/s12859-018-2384-y

    Figure Lengend Snippet: Evaluation of case study 1 (grapevine leaves) set of assemblies using PCA plots coloured by clusters. a PCA plot of the first two dimensions with the three significant clusters found by HCPC analysis marked as green (3.1), red (3.2) and black (3.3). The primary assembly ctOasesK35 and the scaffolded assembly scOasesK35 are boxed in blue to highlight the improvement of OASES when contigs are scaffolded. b Tree of assemblies where clusters are boxed in the same colours as a . Cluster 3.1 (green box): the 2 plant reference transcriptomes and the 3 OASES scaffolded assemblies. Cluster 3.2 (red box): 13 assemblies, 9 of them being scaffolded assemblies. Cluster 3.3 (black box): 14 assemblies, 11 of them being primary assemblies

    Article Snippet: It has been revealed that 2×100 nt reads (or maybe longer) and OASES assembler can provide very good transcriptomes, and that the contribution of Roche/454 reads is noticeable only when short, single-reads were used.

    Techniques:

    Evaluation of case study 3 (chestnut stem) set of assemblies. a PCA plot of the first two dimensions coloured by clusters using the two plant reference transcriptomes. Only three clusters are observed, marked as green (containing only the poplar reference transcriptome), red (containing the Arabidopsis reference transcriptome and most Illumina and Roche/454 combinations), and black. b PCA plot of the same data as in a , but using only the Arabidopsis reference transcriptome in the plot and for clustering. Four significant clusters can be now distinguished. Cluster 5.1 (blue dots) contains the Arabidopsis reference transcriptome, three assembly-assembly combinations of OASES scaffolding that includes the k -mer 25 with the Roche/454 reconciled assembly using Minimus2, the Minimus 2 merging of all Illumina scaffolded assemblies with the Roche/454 reconciled assembly, and four Illumina OASES-scaffolded assemblies with k -mer 25. Cluster 5.2 (red dots): two (MIRA4 and reconciled) Roche/454 assemblies, the all Illumina assemblies combined with Roche/454 reads using MIRA4, and the RAY assemblies with k -mer 35 merged with the Roche/454 reconciled assembly using Minimus2. Cluster 5.3 (green dots): all assembly-assembly combinations performed with Minimus2, except for the RAY merging using k -mer 25, the reads-reads combined assembly using RAY with k -mer 35, and the all Illumina assemblies, excepting RAY assemblies with k -mer 35. Cluster 5.4 (black dots): all RAY assembly-assembly combinations, Roche/454 primary assembly with EULER-SR, Illumina assemblies using RAY with k -mer 35 and reads-reads combination assembly using RAY with k -mer 35

    Journal: BMC Bioinformatics

    Article Title: TransFlow: a modular framework for assembling and assessing accurate de novo transcriptomes in non-model organisms

    doi: 10.1186/s12859-018-2384-y

    Figure Lengend Snippet: Evaluation of case study 3 (chestnut stem) set of assemblies. a PCA plot of the first two dimensions coloured by clusters using the two plant reference transcriptomes. Only three clusters are observed, marked as green (containing only the poplar reference transcriptome), red (containing the Arabidopsis reference transcriptome and most Illumina and Roche/454 combinations), and black. b PCA plot of the same data as in a , but using only the Arabidopsis reference transcriptome in the plot and for clustering. Four significant clusters can be now distinguished. Cluster 5.1 (blue dots) contains the Arabidopsis reference transcriptome, three assembly-assembly combinations of OASES scaffolding that includes the k -mer 25 with the Roche/454 reconciled assembly using Minimus2, the Minimus 2 merging of all Illumina scaffolded assemblies with the Roche/454 reconciled assembly, and four Illumina OASES-scaffolded assemblies with k -mer 25. Cluster 5.2 (red dots): two (MIRA4 and reconciled) Roche/454 assemblies, the all Illumina assemblies combined with Roche/454 reads using MIRA4, and the RAY assemblies with k -mer 35 merged with the Roche/454 reconciled assembly using Minimus2. Cluster 5.3 (green dots): all assembly-assembly combinations performed with Minimus2, except for the RAY merging using k -mer 25, the reads-reads combined assembly using RAY with k -mer 35, and the all Illumina assemblies, excepting RAY assemblies with k -mer 35. Cluster 5.4 (black dots): all RAY assembly-assembly combinations, Roche/454 primary assembly with EULER-SR, Illumina assemblies using RAY with k -mer 35 and reads-reads combination assembly using RAY with k -mer 35

    Article Snippet: Finally, data presented in Table also serve to decide that the best haustorium transcriptome (where only Illumina reads are available) is again a scaffolded assembly using OASES, and that the best epiphytic transcriptome (made only from Roche/454 reads) was obtained after the reconciliation of MIRA4 and EULER-SR primary assemblies using CAP3, as was empirically performed in the original study [ ].

    Techniques: Scaffolding

    Overview and dependencies of TransFlow modules. Raw reads from sequencing platforms are used as input whether any de novo assembling is desired. Each module is independent, except for Module 5, which requires internal or external transcriptomes. Merging module (Module 3) is also optional since it is only required when combination of reads from different platforms is desired. Solid arrows, independently of their colour, indicate compulsory dependencies when the parent module is present; dashed arrows indicate optional dependencies even if the parent module is present

    Journal: BMC Bioinformatics

    Article Title: TransFlow: a modular framework for assembling and assessing accurate de novo transcriptomes in non-model organisms

    doi: 10.1186/s12859-018-2384-y

    Figure Lengend Snippet: Overview and dependencies of TransFlow modules. Raw reads from sequencing platforms are used as input whether any de novo assembling is desired. Each module is independent, except for Module 5, which requires internal or external transcriptomes. Merging module (Module 3) is also optional since it is only required when combination of reads from different platforms is desired. Solid arrows, independently of their colour, indicate compulsory dependencies when the parent module is present; dashed arrows indicate optional dependencies even if the parent module is present

    Article Snippet: Finally, data presented in Table also serve to decide that the best haustorium transcriptome (where only Illumina reads are available) is again a scaffolded assembly using OASES, and that the best epiphytic transcriptome (made only from Roche/454 reads) was obtained after the reconciliation of MIRA4 and EULER-SR primary assemblies using CAP3, as was empirically performed in the original study [ ].

    Techniques: Sequencing

    Classification of candidates to plant reference transcriptomes based on the evaluation parameters of Table 2 . a Radar plot of evaluation parameters for the six plant transcriptomes analysed in this work: Arabidopsis ( Arabidopsis thaliana ), poplar ( Populus trichocarpa ), grapevine ( Vitis vinifera ), wheat ( Triticum aestivum ), rice ( Oryza sativa ) and maize ( Zea mays ). b Dendrogram on the two first dimensions of the PCA, coloured by cluster

    Journal: BMC Bioinformatics

    Article Title: TransFlow: a modular framework for assembling and assessing accurate de novo transcriptomes in non-model organisms

    doi: 10.1186/s12859-018-2384-y

    Figure Lengend Snippet: Classification of candidates to plant reference transcriptomes based on the evaluation parameters of Table 2 . a Radar plot of evaluation parameters for the six plant transcriptomes analysed in this work: Arabidopsis ( Arabidopsis thaliana ), poplar ( Populus trichocarpa ), grapevine ( Vitis vinifera ), wheat ( Triticum aestivum ), rice ( Oryza sativa ) and maize ( Zea mays ). b Dendrogram on the two first dimensions of the PCA, coloured by cluster

    Article Snippet: Finally, data presented in Table also serve to decide that the best haustorium transcriptome (where only Illumina reads are available) is again a scaffolded assembly using OASES, and that the best epiphytic transcriptome (made only from Roche/454 reads) was obtained after the reconciliation of MIRA4 and EULER-SR primary assemblies using CAP3, as was empirically performed in the original study [ ].

    Techniques:

    Evaluation of case study 2 (olive tree pollen) set of assemblies. PCA plot of the first two dimensions with the three significant clusters found by HCPC analysis is shown. Cluster 4.1 (red dots): the 2 plant reference transcriptomes, all Illumina assemblies combined with Roche/454 reads using MIRA4, and 2 Roche/454 assemblies (one using only MIRA4 and the other is the CAP3 reconciled assembly). Cluster 4.2 (green dots): all (primary and scaffolded) Illumina assemblies, except using RAY, executed with k -mer 35, the 2 Roche/454 and Illumina reads-reads merging using RAY with k -mers 25 and 35, all the assembly-assembly combinations using Minimus2 and the 2 all-to-all reconciliations using Minimus2. Cluster 4.3 (black dots): EULER-SR primary assembly, Illumina RAY assembly with k -mer 35, all the Illumina assemblies merged with Roche/454 reads using RAY, and all the assembly-assembly combinations performed with RAY

    Journal: BMC Bioinformatics

    Article Title: TransFlow: a modular framework for assembling and assessing accurate de novo transcriptomes in non-model organisms

    doi: 10.1186/s12859-018-2384-y

    Figure Lengend Snippet: Evaluation of case study 2 (olive tree pollen) set of assemblies. PCA plot of the first two dimensions with the three significant clusters found by HCPC analysis is shown. Cluster 4.1 (red dots): the 2 plant reference transcriptomes, all Illumina assemblies combined with Roche/454 reads using MIRA4, and 2 Roche/454 assemblies (one using only MIRA4 and the other is the CAP3 reconciled assembly). Cluster 4.2 (green dots): all (primary and scaffolded) Illumina assemblies, except using RAY, executed with k -mer 35, the 2 Roche/454 and Illumina reads-reads merging using RAY with k -mers 25 and 35, all the assembly-assembly combinations using Minimus2 and the 2 all-to-all reconciliations using Minimus2. Cluster 4.3 (black dots): EULER-SR primary assembly, Illumina RAY assembly with k -mer 35, all the Illumina assemblies merged with Roche/454 reads using RAY, and all the assembly-assembly combinations performed with RAY

    Article Snippet: Finally, data presented in Table also serve to decide that the best haustorium transcriptome (where only Illumina reads are available) is again a scaffolded assembly using OASES, and that the best epiphytic transcriptome (made only from Roche/454 reads) was obtained after the reconciliation of MIRA4 and EULER-SR primary assemblies using CAP3, as was empirically performed in the original study [ ].

    Techniques:

    Evaluation of case study 1 (grapevine leaves) set of assemblies using PCA plots coloured by clusters. a PCA plot of the first two dimensions with the three significant clusters found by HCPC analysis marked as green (3.1), red (3.2) and black (3.3). The primary assembly ctOasesK35 and the scaffolded assembly scOasesK35 are boxed in blue to highlight the improvement of OASES when contigs are scaffolded. b Tree of assemblies where clusters are boxed in the same colours as a . Cluster 3.1 (green box): the 2 plant reference transcriptomes and the 3 OASES scaffolded assemblies. Cluster 3.2 (red box): 13 assemblies, 9 of them being scaffolded assemblies. Cluster 3.3 (black box): 14 assemblies, 11 of them being primary assemblies

    Journal: BMC Bioinformatics

    Article Title: TransFlow: a modular framework for assembling and assessing accurate de novo transcriptomes in non-model organisms

    doi: 10.1186/s12859-018-2384-y

    Figure Lengend Snippet: Evaluation of case study 1 (grapevine leaves) set of assemblies using PCA plots coloured by clusters. a PCA plot of the first two dimensions with the three significant clusters found by HCPC analysis marked as green (3.1), red (3.2) and black (3.3). The primary assembly ctOasesK35 and the scaffolded assembly scOasesK35 are boxed in blue to highlight the improvement of OASES when contigs are scaffolded. b Tree of assemblies where clusters are boxed in the same colours as a . Cluster 3.1 (green box): the 2 plant reference transcriptomes and the 3 OASES scaffolded assemblies. Cluster 3.2 (red box): 13 assemblies, 9 of them being scaffolded assemblies. Cluster 3.3 (black box): 14 assemblies, 11 of them being primary assemblies

    Article Snippet: Finally, data presented in Table also serve to decide that the best haustorium transcriptome (where only Illumina reads are available) is again a scaffolded assembly using OASES, and that the best epiphytic transcriptome (made only from Roche/454 reads) was obtained after the reconciliation of MIRA4 and EULER-SR primary assemblies using CAP3, as was empirically performed in the original study [ ].

    Techniques: