Structured Review

Promega t7 rna polymerase
Setting up an in vitro HCV rolling-circle replication system. (A) Purification of HCV proteins and RPA. HCV proteins NS3-4A, NS3 helicase, NS5A (S25-C447) , NS5A (S25-K215) , NS5BΔ21 polymerase and the native human RPA were purified as described in Materials and Methods and analyzed using SDS-polyacrylamide gel electrophoresis and Coomassie blue staining. The arrowheads indicate the bands corresponding to individual proteins or protein subunits in the case of NS3-4A and RPA. (B) Design of the rolling-circle RNA template. Two RNA oligonucleotides (74 nt and 106 nt) were synthesized with <t>T7</t> RNA polymerase on the primed DNA templates with T7 promoter sequence primers as described in Materials and Methods. The 74-nt RNA oligonucleotide was hybridized with the DNA oligonucleotide “bridge” and ligated with DNA ligase to create a RNA circle. The rolling-circle RNA template was constructed by hybridization of the RNA circle and the 106-nt RNA oligonucleotide to complete the formation of the rolling-circle RNA template.
T7 Rna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 346 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t7 rna polymerase/product/Promega
Average 99 stars, based on 346 article reviews
Price from $9.99 to $1999.99
t7 rna polymerase - by Bioz Stars, 2020-02
99/100 stars

Images

1) Product Images from "Nonstructural Protein 5A (NS5A) and Human Replication Protein A Increase the Processivity of Hepatitis C Virus NS5B Polymerase Activity In Vitro"

Article Title: Nonstructural Protein 5A (NS5A) and Human Replication Protein A Increase the Processivity of Hepatitis C Virus NS5B Polymerase Activity In Vitro

Journal: Journal of Virology

doi: 10.1128/JVI.01677-14

Setting up an in vitro HCV rolling-circle replication system. (A) Purification of HCV proteins and RPA. HCV proteins NS3-4A, NS3 helicase, NS5A (S25-C447) , NS5A (S25-K215) , NS5BΔ21 polymerase and the native human RPA were purified as described in Materials and Methods and analyzed using SDS-polyacrylamide gel electrophoresis and Coomassie blue staining. The arrowheads indicate the bands corresponding to individual proteins or protein subunits in the case of NS3-4A and RPA. (B) Design of the rolling-circle RNA template. Two RNA oligonucleotides (74 nt and 106 nt) were synthesized with T7 RNA polymerase on the primed DNA templates with T7 promoter sequence primers as described in Materials and Methods. The 74-nt RNA oligonucleotide was hybridized with the DNA oligonucleotide “bridge” and ligated with DNA ligase to create a RNA circle. The rolling-circle RNA template was constructed by hybridization of the RNA circle and the 106-nt RNA oligonucleotide to complete the formation of the rolling-circle RNA template.
Figure Legend Snippet: Setting up an in vitro HCV rolling-circle replication system. (A) Purification of HCV proteins and RPA. HCV proteins NS3-4A, NS3 helicase, NS5A (S25-C447) , NS5A (S25-K215) , NS5BΔ21 polymerase and the native human RPA were purified as described in Materials and Methods and analyzed using SDS-polyacrylamide gel electrophoresis and Coomassie blue staining. The arrowheads indicate the bands corresponding to individual proteins or protein subunits in the case of NS3-4A and RPA. (B) Design of the rolling-circle RNA template. Two RNA oligonucleotides (74 nt and 106 nt) were synthesized with T7 RNA polymerase on the primed DNA templates with T7 promoter sequence primers as described in Materials and Methods. The 74-nt RNA oligonucleotide was hybridized with the DNA oligonucleotide “bridge” and ligated with DNA ligase to create a RNA circle. The rolling-circle RNA template was constructed by hybridization of the RNA circle and the 106-nt RNA oligonucleotide to complete the formation of the rolling-circle RNA template.

Techniques Used: In Vitro, Purification, Recombinase Polymerase Amplification, Polyacrylamide Gel Electrophoresis, Staining, Synthesized, Sequencing, Construct, Hybridization

2) Product Images from "Induced-fit recognition of DNA by organometallic complexes with dynamic stereogenic centers"

Article Title: Induced-fit recognition of DNA by organometallic complexes with dynamic stereogenic centers

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.2434016100

Inhibition of RNA synthesis. ( A ) Autoradiograms of 6% polyacrylamide/8 M urea sequencing gels showing inhibition of RNA synthesis by SP6 ( Left ) or T7 RNA polymerases ( Right )onthe Nde I/ Hpa I fragment containing adducts of Ru and Pt complexes ( r b 0.01). Lanes are: unmodified template control; templates modified by dienPt, transPt, cisPt, 2 and 3 ; C, G, U and A (chain terminated marker RNAs). ( B ) Schematic diagram showing portion of sequence used to monitor inhibition of RNA synthesis by 3 . Arrows indicate start of SP6 and T7 RNA polymerase, which used the bottom or upper strand of Nde I/ Hpa I fragment as templates. • indicate major stop signals (from A ) for 3 . Numbers correspond to nucleotide numbering in the sequence map of pSP73KB plasmid.
Figure Legend Snippet: Inhibition of RNA synthesis. ( A ) Autoradiograms of 6% polyacrylamide/8 M urea sequencing gels showing inhibition of RNA synthesis by SP6 ( Left ) or T7 RNA polymerases ( Right )onthe Nde I/ Hpa I fragment containing adducts of Ru and Pt complexes ( r b 0.01). Lanes are: unmodified template control; templates modified by dienPt, transPt, cisPt, 2 and 3 ; C, G, U and A (chain terminated marker RNAs). ( B ) Schematic diagram showing portion of sequence used to monitor inhibition of RNA synthesis by 3 . Arrows indicate start of SP6 and T7 RNA polymerase, which used the bottom or upper strand of Nde I/ Hpa I fragment as templates. • indicate major stop signals (from A ) for 3 . Numbers correspond to nucleotide numbering in the sequence map of pSP73KB plasmid.

Techniques Used: Inhibition, Sequencing, Modification, Marker, Plasmid Preparation

3) Product Images from "Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase *Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase * S⃞"

Article Title: Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase *Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase * S⃞

Journal:

doi: 10.1074/jbc.M802121200

Deamination activity of WT and mutant AID proteins on a transcribed linear dsDNA. Top , dsDNA template with an incorporated T7 promoter for transcription by T7 RNA polymerase. A single target C residue located on the nontranscribed strands is indicated
Figure Legend Snippet: Deamination activity of WT and mutant AID proteins on a transcribed linear dsDNA. Top , dsDNA template with an incorporated T7 promoter for transcription by T7 RNA polymerase. A single target C residue located on the nontranscribed strands is indicated

Techniques Used: Activity Assay, Mutagenesis

4) Product Images from "Influence of translation efficiency of homologous viral proteins on the endogenous presentation of CD8+ T cell epitopes"

Article Title: Influence of translation efficiency of homologous viral proteins on the endogenous presentation of CD8+ T cell epitopes

Journal: The Journal of Experimental Medicine

doi: 10.1084/jem.20062508

EBNA1 and EBNA1ΔGA translation efficiency and rapidly degrading polypeptides. (A) Detection of EBNA1 rapidly degrading polypeptides. HeLa cells treated with 50 μM of both MG132 and lactacystin during the final 30 min of a 60-min starvation in Met-free media were radiolabeled for 2 min and chased for 5 min. EBNA1-GFP immunoprecipitates were subjected to SDS-PAGE and autoradiograpy. Mol wt markers in kD are shown on the left. Arrows indicate full-length EBNA1-GFP and EBNA1ΔGA-GFP. (B) Measurement of EBNA1 synthesis. HEK293 cells transfected with either EBNA1-GFP or EBNA1ΔGA-GFP were metabolically labeled for 12–14 h in growth medium containing 20 μCi/ml of [ 3 H]methionine followed by a 30-min pulse with 100 μCi of [ 35 S]methionine. Cells were lysed and immunoprecipitated with either anti-GFP or antitubulin. Quantitation of EBNA1-GFP, EBNA1ΔGA-GFP, or tubulin synthesis was determined by measuring the [ 35 S] to [ 3 H] ratio for each protein by liquid scintillation counting. (C) In vitro translation assay of EBNA1 and EBNA1ΔGA. pcDNA3.1 expression constructs encoding either EBNA1 or EBNA1ΔGA were transcribed and translated in vitro with T7 RNA polymerase using a coupled transcription–translation reticulocyte lysate system supplemented with [ 35 S]methionine. Band intensities were quantified by densitometric analysis of the imaging data and graphed.
Figure Legend Snippet: EBNA1 and EBNA1ΔGA translation efficiency and rapidly degrading polypeptides. (A) Detection of EBNA1 rapidly degrading polypeptides. HeLa cells treated with 50 μM of both MG132 and lactacystin during the final 30 min of a 60-min starvation in Met-free media were radiolabeled for 2 min and chased for 5 min. EBNA1-GFP immunoprecipitates were subjected to SDS-PAGE and autoradiograpy. Mol wt markers in kD are shown on the left. Arrows indicate full-length EBNA1-GFP and EBNA1ΔGA-GFP. (B) Measurement of EBNA1 synthesis. HEK293 cells transfected with either EBNA1-GFP or EBNA1ΔGA-GFP were metabolically labeled for 12–14 h in growth medium containing 20 μCi/ml of [ 3 H]methionine followed by a 30-min pulse with 100 μCi of [ 35 S]methionine. Cells were lysed and immunoprecipitated with either anti-GFP or antitubulin. Quantitation of EBNA1-GFP, EBNA1ΔGA-GFP, or tubulin synthesis was determined by measuring the [ 35 S] to [ 3 H] ratio for each protein by liquid scintillation counting. (C) In vitro translation assay of EBNA1 and EBNA1ΔGA. pcDNA3.1 expression constructs encoding either EBNA1 or EBNA1ΔGA were transcribed and translated in vitro with T7 RNA polymerase using a coupled transcription–translation reticulocyte lysate system supplemented with [ 35 S]methionine. Band intensities were quantified by densitometric analysis of the imaging data and graphed.

Techniques Used: SDS Page, Transfection, Metabolic Labelling, Labeling, Immunoprecipitation, Quantitation Assay, In Vitro, Expressing, Construct, Imaging

5) Product Images from "Effects of Mutations of the Initiation Nucleotides on Hepatitis C Virus RNA Replication in the Cell"

Article Title: Effects of Mutations of the Initiation Nucleotides on Hepatitis C Virus RNA Replication in the Cell

Journal: Journal of Virology

doi: 10.1128/JVI.78.7.3633-3643.2004

Determination of nucleotides at the 5′ and 3′ ends of HCV replicon RNAs recovered from G418-resistant Huh7 cells. (A) Schematic of the RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE) (Ambion). An adapter RNA (open bar) was ligated to the 5′ end of either the positive-strand (for determination of the 5′-end nucleotide) or the negative-strand (for determination of the 3′-end nucleotide) HCV replicon RNA isolated from different cell lines. The cDNAs of both positive and negative strands of HCV RNA were reverse transcribed by using HCV-specific primers and amplified by PCR with 5′RACE outer/inner primers (gray arrow) and HCV-specific primers (open arrow). The 5′-end nucleotides of both positive and negative strands of HCV RNA were determined by DNA sequence analysis. (B) 5′- and 3′-end nucleotides of HCV RNA determined by RLM-RACE. Letters indicate nucleotides at the 5′ and 3′ ends as shown on the top. The number indicates the number of cell clones from which HCV replicon RNAs were analyzed. Numbers in parentheses indicate the frequency of the nucleotides determined. The HCV replicon RNAs given on the left column were the ones transcribed in vitro by a T7 RNA polymerase.
Figure Legend Snippet: Determination of nucleotides at the 5′ and 3′ ends of HCV replicon RNAs recovered from G418-resistant Huh7 cells. (A) Schematic of the RNA ligase-mediated rapid amplification of cDNA ends (RLM-RACE) (Ambion). An adapter RNA (open bar) was ligated to the 5′ end of either the positive-strand (for determination of the 5′-end nucleotide) or the negative-strand (for determination of the 3′-end nucleotide) HCV replicon RNA isolated from different cell lines. The cDNAs of both positive and negative strands of HCV RNA were reverse transcribed by using HCV-specific primers and amplified by PCR with 5′RACE outer/inner primers (gray arrow) and HCV-specific primers (open arrow). The 5′-end nucleotides of both positive and negative strands of HCV RNA were determined by DNA sequence analysis. (B) 5′- and 3′-end nucleotides of HCV RNA determined by RLM-RACE. Letters indicate nucleotides at the 5′ and 3′ ends as shown on the top. The number indicates the number of cell clones from which HCV replicon RNAs were analyzed. Numbers in parentheses indicate the frequency of the nucleotides determined. The HCV replicon RNAs given on the left column were the ones transcribed in vitro by a T7 RNA polymerase.

Techniques Used: Rapid Amplification of cDNA Ends, Isolation, Amplification, Polymerase Chain Reaction, Sequencing, Clone Assay, In Vitro

6) Product Images from "PATE, a gene expressed in prostate cancer, normal prostate, and testis, identified by a functional genomic approach"

Article Title: PATE, a gene expressed in prostate cancer, normal prostate, and testis, identified by a functional genomic approach

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.052713699

Analysis of the protein product encoded by PATE . ( A ) Analysis of the in vitro translated products of PATE cDNA. PATE cDNA was transcribed in vitro with T7 RNA polymerase and the RNA was translated with wheat germ extract in the presence of [ 35 S]methionine. The translated products were analyzed by SDS/PAGE and fluorography. Lanes: 1, PATE cDNA; 2, empty vector control; 3, luciferase cDNA as positive control. ( B ) Western blot analysis of PATE -transfected cell extract with anti-Myc-tag antibody. A specific band of molecular mass of about 16 kDa is detected by anti-Myc-tag antibody in the membrane fraction of the transfected cell line.
Figure Legend Snippet: Analysis of the protein product encoded by PATE . ( A ) Analysis of the in vitro translated products of PATE cDNA. PATE cDNA was transcribed in vitro with T7 RNA polymerase and the RNA was translated with wheat germ extract in the presence of [ 35 S]methionine. The translated products were analyzed by SDS/PAGE and fluorography. Lanes: 1, PATE cDNA; 2, empty vector control; 3, luciferase cDNA as positive control. ( B ) Western blot analysis of PATE -transfected cell extract with anti-Myc-tag antibody. A specific band of molecular mass of about 16 kDa is detected by anti-Myc-tag antibody in the membrane fraction of the transfected cell line.

Techniques Used: In Vitro, SDS Page, Plasmid Preparation, Luciferase, Positive Control, Western Blot, Transfection

7) Product Images from "In Vitro Import of a Nuclearly Encoded tRNA into the Mitochondrion of Trypanosoma brucei"

Article Title: In Vitro Import of a Nuclearly Encoded tRNA into the Mitochondrion of Trypanosoma brucei

Journal: Molecular and Cellular Biology

doi:

The tandem tRNA Ser -tRNA Leu is imported into isolated T. brucei mitochondria. (A) Schematic of the organization of the T. brucei tRNA Ser and tRNA Leu genes and the tRNA substrates transcribed in vitro with T7 RNA polymerase in the presence of [α- 32 P]UTP for uniform labeling. (B) A 100-μl standard import assay mixture contained 5 × 10 4 cpm of labeled substrate and isolated mitochondria from 3 × 10 8 cells. Following import, the mitochondria were collected by centrifugation and resuspended in 25 μl of SME-20 containing 5 mM CaCl 2 and 100 mM KCl. Proteinase K was added to a final concentration of 30 μg/ml and the mixture was incubated for 10 min; then 1 volume of SME-20 and 4 mM PMSF were added. The mitochondria were centrifuged, and the pellet was resuspended in 0.3 M sodium acetate–0.5% SDS and phenol-chloroform extracted. The RNAs were collected by precipitation in the presence of 95% ethanol (lanes 1, 4, 7, and 10). In the remaining reactions, proteinase K digestion preceded the addition of 10 U of micrococcal nuclease followed by 10 mM EGTA, lysis of the mitochondria, phenol-chloroform extraction, and ethanol precipitation of the RNAs (lanes 2, 5, 8, and 11). Other reaction mixtures were first treated with 2% CHAPS before proteinase K and micrococcal nuclease treatment (lanes 3, 6, 9, and 12). The isolated RNAs were run on a 6% polyacrylamide–8 M urea gel and visualized by autoradiography.
Figure Legend Snippet: The tandem tRNA Ser -tRNA Leu is imported into isolated T. brucei mitochondria. (A) Schematic of the organization of the T. brucei tRNA Ser and tRNA Leu genes and the tRNA substrates transcribed in vitro with T7 RNA polymerase in the presence of [α- 32 P]UTP for uniform labeling. (B) A 100-μl standard import assay mixture contained 5 × 10 4 cpm of labeled substrate and isolated mitochondria from 3 × 10 8 cells. Following import, the mitochondria were collected by centrifugation and resuspended in 25 μl of SME-20 containing 5 mM CaCl 2 and 100 mM KCl. Proteinase K was added to a final concentration of 30 μg/ml and the mixture was incubated for 10 min; then 1 volume of SME-20 and 4 mM PMSF were added. The mitochondria were centrifuged, and the pellet was resuspended in 0.3 M sodium acetate–0.5% SDS and phenol-chloroform extracted. The RNAs were collected by precipitation in the presence of 95% ethanol (lanes 1, 4, 7, and 10). In the remaining reactions, proteinase K digestion preceded the addition of 10 U of micrococcal nuclease followed by 10 mM EGTA, lysis of the mitochondria, phenol-chloroform extraction, and ethanol precipitation of the RNAs (lanes 2, 5, 8, and 11). Other reaction mixtures were first treated with 2% CHAPS before proteinase K and micrococcal nuclease treatment (lanes 3, 6, 9, and 12). The isolated RNAs were run on a 6% polyacrylamide–8 M urea gel and visualized by autoradiography.

Techniques Used: Isolation, In Vitro, Labeling, Centrifugation, Concentration Assay, Incubation, Lysis, Ethanol Precipitation, Autoradiography

8) Product Images from "Rescue of Mumps Virus from cDNA"

Article Title: Rescue of Mumps Virus from cDNA

Journal: Journal of Virology

doi:

Diagram (not to scale) showing the organization of the MUVCAT minireplicon DNA construct and T7 RNA polymerase-transcribed minireplicon antisense RNA genome. Key restriction endonuclease sites used in the assembly of the DNA construct are shown. The T7 RNA polymerase promoter sequence was designed to start transcription with the exact MUV 5′-terminal nucleotide, and an HDV ribozyme (Rib.) sequence was positioned to generate the precise MUV 3′-terminal nucleotide in minireplicon RNA transcripts. Duplicate T7 RNA polymerase termination signals were included after the HDV ribozyme sequence. The CAT ORF replaces all of the coding and intercistronic sequence of the MUV genome; the remaining essential MUV-specific sequence comprises the 3′ MUV leader (55 nt) with adjacent 90-nt NP gene untranslated region (UTR) and the 5′ MUV trailer (24 nt) adjacent to the 137-nt L gene untranslated region.
Figure Legend Snippet: Diagram (not to scale) showing the organization of the MUVCAT minireplicon DNA construct and T7 RNA polymerase-transcribed minireplicon antisense RNA genome. Key restriction endonuclease sites used in the assembly of the DNA construct are shown. The T7 RNA polymerase promoter sequence was designed to start transcription with the exact MUV 5′-terminal nucleotide, and an HDV ribozyme (Rib.) sequence was positioned to generate the precise MUV 3′-terminal nucleotide in minireplicon RNA transcripts. Duplicate T7 RNA polymerase termination signals were included after the HDV ribozyme sequence. The CAT ORF replaces all of the coding and intercistronic sequence of the MUV genome; the remaining essential MUV-specific sequence comprises the 3′ MUV leader (55 nt) with adjacent 90-nt NP gene untranslated region (UTR) and the 5′ MUV trailer (24 nt) adjacent to the 137-nt L gene untranslated region.

Techniques Used: Construct, Sequencing

Schematic representation (not to scale) of the MUV full-length genome cDNA construct showing the genetic organization of the MUV genome including the nontranscribed leader (Le) and trailer (Tr) and the proteins expressed from each gene. The subgenomic cDNA fragments and restriction endonuclease sites used in the assembly process are delineated by the horizontal solid lines and the vertical dotted lines, respectively. The T7 RNA polymerase promoter (T7-P) and the HDV ribozyme (Rib) sequence were positioned to initiate transcription with the exact 5′-terminal nucleotide and generate the precise 3′-terminal nucleotide of the MUV antisense genome, respectively. Tandem T7 RNA polymerase termination sequences were placed adjacent to the HDV ribozyme.
Figure Legend Snippet: Schematic representation (not to scale) of the MUV full-length genome cDNA construct showing the genetic organization of the MUV genome including the nontranscribed leader (Le) and trailer (Tr) and the proteins expressed from each gene. The subgenomic cDNA fragments and restriction endonuclease sites used in the assembly process are delineated by the horizontal solid lines and the vertical dotted lines, respectively. The T7 RNA polymerase promoter (T7-P) and the HDV ribozyme (Rib) sequence were positioned to initiate transcription with the exact 5′-terminal nucleotide and generate the precise 3′-terminal nucleotide of the MUV antisense genome, respectively. Tandem T7 RNA polymerase termination sequences were placed adjacent to the HDV ribozyme.

Techniques Used: Construct, Sequencing

9) Product Images from "Naturally Occurring Dicistronic Cricket Paralysis Virus RNA Is Regulated by Two Internal Ribosome Entry Sites"

Article Title: Naturally Occurring Dicistronic Cricket Paralysis Virus RNA Is Regulated by Two Internal Ribosome Entry Sites

Journal: Molecular and Cellular Biology

doi:

Accumulation of translation products encoded by plasmids expressing dicistronic mRNAs that contain the CrPV 5′NCR or the CrPV IGR in the intercistronic spacer region in cultured cells. (A) Diagram of the dual luciferase dicistronic construct. The locations of promoters for RNA polymerase II (simian virus 40 [SV40]) and for T7 RNA polymerase (T7) and sequences mediating polyadenylation [SV40 Late Poly(A) Signal] are indicated. Rluc and Fluc encode Renilla luciferase and firefly luciferase, respectively. ΔEMCV designates the cDNA that encodes highly structured RNA sequences to prevent translational readthrough or reinitiation (see Materials and Methods). The shaded triangle, labeled Insert, indicates the position at which the CrPV 5′NCR or CrPV IGR sequences were inserted. (B) The viral 5′NCR and IGR mediate the translation of second cistrons in dicistronic mRNAs. Luciferase activities in extracts from SL2 cells, transfected with expression vectors that contain no added insertion or insertions of the viral 5′NCR or the viral IGR in the intergenic spacer region (see panel A), are displayed. The ratio of relative luciferase activity represents the Fluc/Rluc ratios in reference to the construct with no insert, whose Fluc/Rluc ratio was set to 1. The mean values from three independent experiments are shown. Error bars indicate standard deviations.
Figure Legend Snippet: Accumulation of translation products encoded by plasmids expressing dicistronic mRNAs that contain the CrPV 5′NCR or the CrPV IGR in the intercistronic spacer region in cultured cells. (A) Diagram of the dual luciferase dicistronic construct. The locations of promoters for RNA polymerase II (simian virus 40 [SV40]) and for T7 RNA polymerase (T7) and sequences mediating polyadenylation [SV40 Late Poly(A) Signal] are indicated. Rluc and Fluc encode Renilla luciferase and firefly luciferase, respectively. ΔEMCV designates the cDNA that encodes highly structured RNA sequences to prevent translational readthrough or reinitiation (see Materials and Methods). The shaded triangle, labeled Insert, indicates the position at which the CrPV 5′NCR or CrPV IGR sequences were inserted. (B) The viral 5′NCR and IGR mediate the translation of second cistrons in dicistronic mRNAs. Luciferase activities in extracts from SL2 cells, transfected with expression vectors that contain no added insertion or insertions of the viral 5′NCR or the viral IGR in the intergenic spacer region (see panel A), are displayed. The ratio of relative luciferase activity represents the Fluc/Rluc ratios in reference to the construct with no insert, whose Fluc/Rluc ratio was set to 1. The mean values from three independent experiments are shown. Error bars indicate standard deviations.

Techniques Used: Expressing, Cell Culture, Luciferase, Construct, Labeling, Transfection, Activity Assay

10) Product Images from "Plant tRNA ligases are multifunctional enzymes that have diverged in sequence and substrate specificity from RNA ligases of other phylogenetic origins"

Article Title: Plant tRNA ligases are multifunctional enzymes that have diverged in sequence and substrate specificity from RNA ligases of other phylogenetic origins

Journal: Nucleic Acids Research

doi: 10.1093/nar/gki174

RNA ligase activity of native and recombinant enzymes. ( A ) A chimeric pre-tRNA, containing most of the mature domain from the plant pre-tRNA Tyr as shown in Figure 2B , and the intron and anticodon of pre-tRNA Trp from M.jannaschii was used as a substrate for the archaeal splicing endonuclease to generate in vitro 3′ and 5′ tRNA halves and a linear intron. It was synthesized by T7 RNA polymerase in the presence of [α- 32 P]UTP. In an ATP-dependent complex reaction, yeast and plant tRNA ligases convert tRNA halves and the linear intron into spliced tRNA and circular intron molecules, containing a 2′-phosphomonoester, 3′,5′-phosphodiester bond at the splice junction ( 8 – 10 , 46 ). ( B ) Archeuka pre-tRNA-derived tRNA halves and linear intron molecules were incubated in 20 μl splicing buffer for 30 min at 37°C in the presence of RNA ligase of different origin. Lane a, undigested archeuka pre-tRNA. In lanes b–g, pre-tRNA after cleavage with splicing endonuclease was used as input RNA; lane b, incubation without protein; lane c, incubation with a protein fraction derived from the expression of a control vector (minus cDNA insert) in the RTS 100 wheat germ extract and subsequent Ni-NTA purification to test whether the observed ligase activities are in fact due to the recombinant tRNA ligases; lane d, incubation with a partially purified tRNA ligase (gel filtration fraction) from wheat germ; lane e, incubation with 50 ng recombinant Arabidopsis tRNA ligase; lane f, incubation with 50 ng recombinant yeast tRNA ligase; and lane g, incubation with a mixture of T4 RNA ligase and T4 polynucleotide kinase/3′-phosphatase. The reaction products were separated on a 12.5% polyacrylamide/8 M urea gel. Stars (*) indicate products that were examined in more detail. ( C ) Time course of inter- and intramolecular ligation reactions by plant and yeast recombinant tRNA ligases. Archeuka pre-tRNA (400 fmol) was cleaved with splicing endonuclease and the resulting tRNA halves and linear intron molecules were incubated either with 100 ng Arabidopsis (left panel) or with 100 ng yeast (right panel) recombinant tRNA ligase in 100 μl splicing buffer. At the times (min) indicated below, aliquots (10 μl) were removed and the RNA products were analysed on a 12.5% polyacrylamide/8 M urea gel.
Figure Legend Snippet: RNA ligase activity of native and recombinant enzymes. ( A ) A chimeric pre-tRNA, containing most of the mature domain from the plant pre-tRNA Tyr as shown in Figure 2B , and the intron and anticodon of pre-tRNA Trp from M.jannaschii was used as a substrate for the archaeal splicing endonuclease to generate in vitro 3′ and 5′ tRNA halves and a linear intron. It was synthesized by T7 RNA polymerase in the presence of [α- 32 P]UTP. In an ATP-dependent complex reaction, yeast and plant tRNA ligases convert tRNA halves and the linear intron into spliced tRNA and circular intron molecules, containing a 2′-phosphomonoester, 3′,5′-phosphodiester bond at the splice junction ( 8 – 10 , 46 ). ( B ) Archeuka pre-tRNA-derived tRNA halves and linear intron molecules were incubated in 20 μl splicing buffer for 30 min at 37°C in the presence of RNA ligase of different origin. Lane a, undigested archeuka pre-tRNA. In lanes b–g, pre-tRNA after cleavage with splicing endonuclease was used as input RNA; lane b, incubation without protein; lane c, incubation with a protein fraction derived from the expression of a control vector (minus cDNA insert) in the RTS 100 wheat germ extract and subsequent Ni-NTA purification to test whether the observed ligase activities are in fact due to the recombinant tRNA ligases; lane d, incubation with a partially purified tRNA ligase (gel filtration fraction) from wheat germ; lane e, incubation with 50 ng recombinant Arabidopsis tRNA ligase; lane f, incubation with 50 ng recombinant yeast tRNA ligase; and lane g, incubation with a mixture of T4 RNA ligase and T4 polynucleotide kinase/3′-phosphatase. The reaction products were separated on a 12.5% polyacrylamide/8 M urea gel. Stars (*) indicate products that were examined in more detail. ( C ) Time course of inter- and intramolecular ligation reactions by plant and yeast recombinant tRNA ligases. Archeuka pre-tRNA (400 fmol) was cleaved with splicing endonuclease and the resulting tRNA halves and linear intron molecules were incubated either with 100 ng Arabidopsis (left panel) or with 100 ng yeast (right panel) recombinant tRNA ligase in 100 μl splicing buffer. At the times (min) indicated below, aliquots (10 μl) were removed and the RNA products were analysed on a 12.5% polyacrylamide/8 M urea gel.

Techniques Used: Activity Assay, Recombinant, In Vitro, Synthesized, Derivative Assay, Incubation, Expressing, Plasmid Preparation, Purification, Filtration, Ligation

11) Product Images from "Reovirus reverse genetics: Incorporation of the CAT gene into the reovirus genome"

Article Title: Reovirus reverse genetics: Incorporation of the CAT gene into the reovirus genome

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.131203198

(Lane A) 32 P-labeled RNA transcribed by T7 RNA polymerase from the pS2-CAT13 template lacking the CAT gene insert, that is, authentic s2 RNA. (Lane B) Cleavage products after hybridization to the ODRN complementary to residues 937–949 and digestion with RNaseH. Electrophoresis was carried out in an SDS/PAGE.
Figure Legend Snippet: (Lane A) 32 P-labeled RNA transcribed by T7 RNA polymerase from the pS2-CAT13 template lacking the CAT gene insert, that is, authentic s2 RNA. (Lane B) Cleavage products after hybridization to the ODRN complementary to residues 937–949 and digestion with RNaseH. Electrophoresis was carried out in an SDS/PAGE.

Techniques Used: Labeling, Hybridization, Electrophoresis, SDS Page

12) Product Images from "Mitochondrial RNA Import in Leishmania tropica: Aptamers Homologous to Multiple tRNA Domains That Interact Cooperatively or Antagonistically at the Inner Membrane"

Article Title: Mitochondrial RNA Import in Leishmania tropica: Aptamers Homologous to Multiple tRNA Domains That Interact Cooperatively or Antagonistically at the Inner Membrane

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.22.12.4372-4382.2002

Intramitochondrial sorting of pool P4 RNA. (A) P4 RNA (100 fmol) was incubated with intact mitochondria (100 μg), and after RNase treatment, the outer membrane was solubilized with digitonin and the mitoplasts were separated into inner membrane (IM) and matrix (MX) fractions by freeze-thaw lysis. RNA associated with each fraction was recovered, reverse transcribed, and amplified by PCR. Each DNA pool was then transcribed with T7 RNA polymerase in the presence of radiolabeled UTP to yield pools P4 (IM) and P4 (MX), respectively. These pools were individually incubated with mitochondria, and their intramitochondrial distributions were quantified by fractionation as described above. The percentages of total internalized RNA associated with the inner membrane or matrix for the parental pool P4 and the sorted pools P4 (IM) and P4 (MX) are shown. (B) Fractionation-amplification of C1. C1 RNA was incubated with mitochondria, the inner membrane and matrix fractions were isolated, and RNA from each fraction was amplified by RT-PCR to yield inner membrane and matrix DNA, respectively. RNA was prepared from each PCR product and incubated with mitochondria, and the intramitochondrial location determined. The panels show fractionation experiments with the parental RNA (left) and the two sorted RNAs (middle and right).
Figure Legend Snippet: Intramitochondrial sorting of pool P4 RNA. (A) P4 RNA (100 fmol) was incubated with intact mitochondria (100 μg), and after RNase treatment, the outer membrane was solubilized with digitonin and the mitoplasts were separated into inner membrane (IM) and matrix (MX) fractions by freeze-thaw lysis. RNA associated with each fraction was recovered, reverse transcribed, and amplified by PCR. Each DNA pool was then transcribed with T7 RNA polymerase in the presence of radiolabeled UTP to yield pools P4 (IM) and P4 (MX), respectively. These pools were individually incubated with mitochondria, and their intramitochondrial distributions were quantified by fractionation as described above. The percentages of total internalized RNA associated with the inner membrane or matrix for the parental pool P4 and the sorted pools P4 (IM) and P4 (MX) are shown. (B) Fractionation-amplification of C1. C1 RNA was incubated with mitochondria, the inner membrane and matrix fractions were isolated, and RNA from each fraction was amplified by RT-PCR to yield inner membrane and matrix DNA, respectively. RNA was prepared from each PCR product and incubated with mitochondria, and the intramitochondrial location determined. The panels show fractionation experiments with the parental RNA (left) and the two sorted RNAs (middle and right).

Techniques Used: Incubation, Lysis, Amplification, Polymerase Chain Reaction, Fractionation, Isolation, Reverse Transcription Polymerase Chain Reaction

13) Product Images from "The Crucial Role of Divalent Metal Ions in the DNA-Acting Efficacy and Inhibition of the Transcription of Dimeric Chromomycin A3"

Article Title: The Crucial Role of Divalent Metal Ions in the DNA-Acting Efficacy and Inhibition of the Transcription of Dimeric Chromomycin A3

Journal: PLoS ONE

doi: 10.1371/journal.pone.0043792

Inhibition of in vitro transcription by Fe(II)-, Co(II)-, and Ni(II)-containing dimeric Chro complexes. ( A ) The effects of Co II (Chro) 2 , Fe II (Chro) 2 , and Ni II (Chro) 2 at various concentrations on T7 RNA polymerase activity. ( B ) Quantification of the percentage of RNA polymerase activity on drug inhibition at various concentrations relative to the control (no drug treatment). The data represent the mean values ±SDs from three separate experiments.
Figure Legend Snippet: Inhibition of in vitro transcription by Fe(II)-, Co(II)-, and Ni(II)-containing dimeric Chro complexes. ( A ) The effects of Co II (Chro) 2 , Fe II (Chro) 2 , and Ni II (Chro) 2 at various concentrations on T7 RNA polymerase activity. ( B ) Quantification of the percentage of RNA polymerase activity on drug inhibition at various concentrations relative to the control (no drug treatment). The data represent the mean values ±SDs from three separate experiments.

Techniques Used: Inhibition, In Vitro, Activity Assay

14) Product Images from "Betanodavirus B2 Is an RNA Interference Antagonist That Facilitates Intracellular Viral RNA Accumulation"

Article Title: Betanodavirus B2 Is an RNA Interference Antagonist That Facilitates Intracellular Viral RNA Accumulation

Journal:

doi: 10.1128/JVI.80.1.85-94.2006

Addition of 5′ nonviral G residues enhances T7 RNA polymerase transcription of GGNNV RNA1 transcripts in vitro and in vivo. (A) Agarose gel electrophoresis of T7 RNA polymerase in vitro transcription products with pGGNNV1(0,0), pGGNNV1(1,0), and
Figure Legend Snippet: Addition of 5′ nonviral G residues enhances T7 RNA polymerase transcription of GGNNV RNA1 transcripts in vitro and in vivo. (A) Agarose gel electrophoresis of T7 RNA polymerase in vitro transcription products with pGGNNV1(0,0), pGGNNV1(1,0), and

Techniques Used: In Vitro, In Vivo, Agarose Gel Electrophoresis

Related Articles

Clone Assay:

Article Title: Naturally Occurring Dicistronic Cricket Paralysis Virus RNA Is Regulated by Two Internal Ribosome Entry Sites
Article Snippet: For transcription in vitro, dicistronic luciferase constructs were digested with Bam HI and linear DNA was transcribed with T7 RNA polymerase using the RiboMAX protocol (Promega) as described previously ( ). .. First, a Bgl II- Pst I restriction fragment corresponding to nucleotides 5919 to 8571 of the CrPV genome (i.e., IGR-ORF2) was cloned into pGEM3 (Promega), which was digested with Bam HI and Pst I.

Centrifugation:

Article Title: Rescue of Mumps Virus from cDNA
Article Snippet: In vitro transcriptions were carried out with 4 μg of pMUVCAT as template for T7 RNA polymerase in a 20-μl final volume as specified by the manufacturer (Promega, Madison, Wis.); template DNA was then destroyed by digestion with RQ-1 DNase for 15 min at 37°C. .. At 48 hpi, cells were scraped into suspension, collected by centrifugation, resuspended in 100 μl of 0.25 M Tris buffer (pH 7.8), and subjected to three rounds of freeze-thaw.

Luciferase:

Article Title: Efficiency of a programmed -1 ribosomal frameshift in the different subtypes of the human immunodeficiency virus type 1 group M
Article Snippet: HIV-LUC mRNA was generated by run-off transcription with T7 RNA polymerase, and 0.2 μg of this mRNA was translated at 30°C for 15 min in 25 μL of RRL (Promega). .. Luciferase activity was monitored with 2.5 μL of the translation mixture, as described in the “transient transfections and luciferase assays” section.

Article Title: Naturally Occurring Dicistronic Cricket Paralysis Virus RNA Is Regulated by Two Internal Ribosome Entry Sites
Article Snippet: .. For transcription in vitro, dicistronic luciferase constructs were digested with Bam HI and linear DNA was transcribed with T7 RNA polymerase using the RiboMAX protocol (Promega) as described previously ( ). .. Dicistronic vectors containing the IGR linked to its natural coding region were constructed as follows.

Mass Spectrometry:

Article Title: Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase *Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase * S⃞
Article Snippet: T7 RNA polymerase was purchased from Promega, and ultrapure NTP was purchased from Amersham Biosciences. .. Mass Spectrometry Analysis —Approximately 20 μg of purified AID were reduced with 5 m m dithiothreitol in the presence of 1% SDS and subsequently alkylated with 20 m m iodoacetamide.

Autoradiography:

Article Title: Influence of translation efficiency of homologous viral proteins on the endogenous presentation of CD8+ T cell epitopes
Article Snippet: EBNA1 and EBNA1ΔGA cDNA in pcDNA3.1 were transcribed and translated in vitro with T7 RNA polymerase using a coupled transcription/translation reticulocyte lysate system (Promega) supplemented with 250 μCi of 35 [S]-methionine (GE Healthcare). .. Gels were fixed, incubated with Amplify (GE Healthcare), dried, and subjected to autoradiography.

Construct:

Article Title: Naturally Occurring Dicistronic Cricket Paralysis Virus RNA Is Regulated by Two Internal Ribosome Entry Sites
Article Snippet: .. For transcription in vitro, dicistronic luciferase constructs were digested with Bam HI and linear DNA was transcribed with T7 RNA polymerase using the RiboMAX protocol (Promega) as described previously ( ). .. Dicistronic vectors containing the IGR linked to its natural coding region were constructed as follows.

Article Title: Reovirus reverse genetics: Incorporation of the CAT gene into the reovirus genome
Article Snippet: .. The pS2CAT13 construct was transcribed in vitro by using T7 RNA polymerase, and the transcript was capped using (m)7 GpppG (Promega) to yield s2-CAT mRNA. .. It was translated in vitro by using a rabbit reticulocyte lysate system (Promega), and the lysate was found to contain CAT activity [chloramphenicol transacetylase (CAT-ELISA), Roche Molecular Biochemicals] (Table ).

Article Title: Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase *Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase * S⃞
Article Snippet: Enzymes and Substrates —Mutant AID proteins (S38A, S38D, S41A, S41D, S43A, and S43P) were constructed by site-directed mutagenesis (QuikChange site-directed mutagenesis kit, Stratagene) using the pAcG2T-AID vector ( , ) as the template. .. T7 RNA polymerase was purchased from Promega, and ultrapure NTP was purchased from Amersham Biosciences.

Article Title: Effects of Mutations of the Initiation Nucleotides on Hepatitis C Virus RNA Replication in the Cell
Article Snippet: .. Subgenomic HCV replicon RNAs were transcribed in vitro by a T7 RNA polymerase from the above-described DNA constructs linearized by restriction enzyme digestion by using large-scale RNA production kits (Promega) (Fig. ). .. Restriction enzymes used for linearization of the DNA constructs are indicated on the right side of Fig. .

Incubation:

Article Title: Induced-fit recognition of DNA by organometallic complexes with dynamic stereogenic centers
Article Snippet: CD spectra of DNA modified by 3 were recorded at 298 K on a Jasco (Tokyo) J-720 spectropolarimeter, after samples had been incubated for 24 h at 310 K and then dialyzed for 2 days at 277 K in 10 mM NaClO4 . .. Transcription of the ( Nde I/ Hpa I) restriction fragment of pSP73KB DNA with SP6 or T7 RNA polymerase and electrophoretic analysis of transcripts were performed according to the protocols recommended by Promega as described ( ).

Article Title: Influence of translation efficiency of homologous viral proteins on the endogenous presentation of CD8+ T cell epitopes
Article Snippet: EBNA1 and EBNA1ΔGA cDNA in pcDNA3.1 were transcribed and translated in vitro with T7 RNA polymerase using a coupled transcription/translation reticulocyte lysate system (Promega) supplemented with 250 μCi of 35 [S]-methionine (GE Healthcare). .. Lysates (5 μl) were incubated for 5 min at 95°C with Laemmli sample buffer (20 μl) and subjected to SDS-PAGE.

Article Title: Mitochondrial RNA Import in Leishmania tropica: Aptamers Homologous to Multiple tRNA Domains That Interact Cooperatively or Antagonistically at the Inner Membrane
Article Snippet: .. Transcription was performed with 10-μl reaction mixtures containing 40 mM Tris-HCl, pH 7.5, 6 mM MgCl2 , 1 mM spermidine, 1 mM dithiothreitol (DTT), 0.5 mM concentrations (each) of CTP, ATP, and GTP, 0.25 mM UTP, 1 μCi of [α-32 P]UTP, and 10 U of T7 RNA polymerase at 37°C for 90 min. Then, 1 U of RQ1 DNase (Promega) was added and the reaction mixture was further incubated at 37°C for 15 min. RNA was recovered by phenol-chloroform extraction and ethanol precipitation. .. Random-sequence RNA (pool 0; 1 pmol), prepared as described above, was incubated with 1 mg of mitochondria in a 200-μl reaction mixture containing 10 mM Tris-HCl, pH 7.5, 10 mM MgCl2 , 1 mM DTT, and 4 mM ATP at 37°C for 15 min, and then RNases A and T1 were added to final concentrations of 2.5 μg/ml and 50 U/ml, respectively, and RNase digestion continued at 37°C for 15 min.

Article Title: The Crucial Role of Divalent Metal Ions in the DNA-Acting Efficacy and Inhibition of the Transcription of Dimeric Chromomycin A3
Article Snippet: RNA polymerase assays During in vitro transcription, T7 RNA polymerase was used for the RNA polymerase assay (Promega). .. The enzyme and NTP reaction solution were micropipetted into the DNA-drug complex solution, which was then incubated at 37°C for 10 min.

Article Title: In Vitro Import of a Nuclearly Encoded tRNA into the Mitochondrion of Trypanosoma brucei
Article Snippet: .. All three substrates were incubated with T7 RNA polymerase and [α-32 P]UTP according to protocols from Promega to produce uniformly labeled transcripts. ..

Amplification:

Article Title: Mitochondrial RNA Import in Leishmania tropica: Aptamers Homologous to Multiple tRNA Domains That Interact Cooperatively or Antagonistically at the Inner Membrane
Article Snippet: The 5′ and 3′ anchors for the amplification of selected RNAs included sequences flanking the D domain of Leishmania tRNATyr (GUA) ( ). .. Transcription was performed with 10-μl reaction mixtures containing 40 mM Tris-HCl, pH 7.5, 6 mM MgCl2 , 1 mM spermidine, 1 mM dithiothreitol (DTT), 0.5 mM concentrations (each) of CTP, ATP, and GTP, 0.25 mM UTP, 1 μCi of [α-32 P]UTP, and 10 U of T7 RNA polymerase at 37°C for 90 min. Then, 1 U of RQ1 DNase (Promega) was added and the reaction mixture was further incubated at 37°C for 15 min. RNA was recovered by phenol-chloroform extraction and ethanol precipitation.

Activity Assay:

Article Title: Efficiency of a programmed -1 ribosomal frameshift in the different subtypes of the human immunodeficiency virus type 1 group M
Article Snippet: HIV-LUC mRNA was generated by run-off transcription with T7 RNA polymerase, and 0.2 μg of this mRNA was translated at 30°C for 15 min in 25 μL of RRL (Promega). .. Luciferase activity was monitored with 2.5 μL of the translation mixture, as described in the “transient transfections and luciferase assays” section.

Article Title: Rescue of Mumps Virus from cDNA
Article Snippet: Paragraph title: Rescue of CAT activity from transfected cells. ... In vitro transcriptions were carried out with 4 μg of pMUVCAT as template for T7 RNA polymerase in a 20-μl final volume as specified by the manufacturer (Promega, Madison, Wis.); template DNA was then destroyed by digestion with RQ-1 DNase for 15 min at 37°C.

Article Title: Nonstructural Protein 5A (NS5A) and Human Replication Protein A Increase the Processivity of Hepatitis C Virus NS5B Polymerase Activity In Vitro
Article Snippet: Labeled nucleotides, [35 S]methionine (1,000 Ci/mmol), and [32 P]UTP (specific activity, 5,000 cpm/pmol) were obtained from PerkinElmer (Waltham, MA); unlabeled nucleotides and T4 gene 32 protein (gp32) were obtained from Amersham Pharmacia Biotech (GE Healthcare Biosciences, Pittsburgh, PA). .. T7 RNA polymerase and RNasin were obtained from Promega (Madison, WI).

Article Title: Reovirus reverse genetics: Incorporation of the CAT gene into the reovirus genome
Article Snippet: The pS2CAT13 construct was transcribed in vitro by using T7 RNA polymerase, and the transcript was capped using (m)7 GpppG (Promega) to yield s2-CAT mRNA. .. It was translated in vitro by using a rabbit reticulocyte lysate system (Promega), and the lysate was found to contain CAT activity [chloramphenicol transacetylase (CAT-ELISA), Roche Molecular Biochemicals] (Table ).

Expressing:

Article Title: Rescue of Mumps Virus from cDNA
Article Snippet: For rescue of CAT activity, cells were either infected with MUV and transfected with in vitro-transcribed MUVCAT minireplicon RNA or infected with MVA-T7 and transfected with pMUVCAT along with expression plasmids pMUVNP, pMUVP, and pMUVL. .. In vitro transcriptions were carried out with 4 μg of pMUVCAT as template for T7 RNA polymerase in a 20-μl final volume as specified by the manufacturer (Promega, Madison, Wis.); template DNA was then destroyed by digestion with RQ-1 DNase for 15 min at 37°C.

Modification:

Article Title: Induced-fit recognition of DNA by organometallic complexes with dynamic stereogenic centers
Article Snippet: CD spectra of DNA modified by 3 were recorded at 298 K on a Jasco (Tokyo) J-720 spectropolarimeter, after samples had been incubated for 24 h at 310 K and then dialyzed for 2 days at 277 K in 10 mM NaClO4 . .. Transcription of the ( Nde I/ Hpa I) restriction fragment of pSP73KB DNA with SP6 or T7 RNA polymerase and electrophoretic analysis of transcripts were performed according to the protocols recommended by Promega as described ( ).

Recombinase Polymerase Amplification:

Article Title: Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase *Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase * S⃞
Article Snippet: E. coli single-stranded binding protein and recombinant human RPA were overexpressed in E. coli and purified according to published protocols ( , ). .. T7 RNA polymerase was purchased from Promega, and ultrapure NTP was purchased from Amersham Biosciences.

Derivative Assay:

Article Title: Plant tRNA ligases are multifunctional enzymes that have diverged in sequence and substrate specificity from RNA ligases of other phylogenetic origins
Article Snippet: The archeuka tRNA gene is derived from this clone by Ex-site mutagenesis (according to the protocol of Stratagene, Heidelberg, Germany). .. Intron-containing pre-tRNAs were transcribed by T7 RNA polymerase using the RiboMax T7 transcription kit (Promega, Mannheim, Germany).

Article Title: Naturally Occurring Dicistronic Cricket Paralysis Virus RNA Is Regulated by Two Internal Ribosome Entry Sites
Article Snippet: For transcription in vitro, dicistronic luciferase constructs were digested with Bam HI and linear DNA was transcribed with T7 RNA polymerase using the RiboMAX protocol (Promega) as described previously ( ). .. Subsequently, an Eco RI- Xba I restriction fragment derived from a dicistronic luciferase construct containing the wild-type encephalomyocarditis virus (EMCV) IRES fused in frame to Fluc, or an Xho I- Xba I restriction fragment containing the ΔEMCV sequences upstream of Fluc, was cloned into the Sma I site of pGEM3 upstream of the inserted IGR-CrPV sequences to yield plasmids T7 EMCV/Fluc-IGR/CrPVORF2 and T7 ΔEMCV/Fluc-IGR/CrPVORF2, respectively.

Transfection:

Article Title: Efficiency of a programmed -1 ribosomal frameshift in the different subtypes of the human immunodeficiency virus type 1 group M
Article Snippet: HIV-LUC mRNA was generated by run-off transcription with T7 RNA polymerase, and 0.2 μg of this mRNA was translated at 30°C for 15 min in 25 μL of RRL (Promega). .. Luciferase activity was monitored with 2.5 μL of the translation mixture, as described in the “transient transfections and luciferase assays” section.

Article Title: Rescue of Mumps Virus from cDNA
Article Snippet: Paragraph title: Rescue of CAT activity from transfected cells. ... In vitro transcriptions were carried out with 4 μg of pMUVCAT as template for T7 RNA polymerase in a 20-μl final volume as specified by the manufacturer (Promega, Madison, Wis.); template DNA was then destroyed by digestion with RQ-1 DNase for 15 min at 37°C.

Concentration Assay:

Article Title: Efficiency of a programmed -1 ribosomal frameshift in the different subtypes of the human immunodeficiency virus type 1 group M
Article Snippet: HIV-LUC mRNA was generated by run-off transcription with T7 RNA polymerase, and 0.2 μg of this mRNA was translated at 30°C for 15 min in 25 μL of RRL (Promega). .. The reaction was stopped by addition of EDTA to a final concentration of 6 mM.

Infection:

Article Title: Rescue of Mumps Virus from cDNA
Article Snippet: For rescue of CAT activity, cells were either infected with MUV and transfected with in vitro-transcribed MUVCAT minireplicon RNA or infected with MVA-T7 and transfected with pMUVCAT along with expression plasmids pMUVNP, pMUVP, and pMUVL. .. In vitro transcriptions were carried out with 4 μg of pMUVCAT as template for T7 RNA polymerase in a 20-μl final volume as specified by the manufacturer (Promega, Madison, Wis.); template DNA was then destroyed by digestion with RQ-1 DNase for 15 min at 37°C.

Generated:

Article Title: Efficiency of a programmed -1 ribosomal frameshift in the different subtypes of the human immunodeficiency virus type 1 group M
Article Snippet: .. HIV-LUC mRNA was generated by run-off transcription with T7 RNA polymerase, and 0.2 μg of this mRNA was translated at 30°C for 15 min in 25 μL of RRL (Promega). .. The reaction was stopped by addition of EDTA to a final concentration of 6 mM.

Article Title: Betanodavirus B2 Is an RNA Interference Antagonist That Facilitates Intracellular Viral RNA Accumulation
Article Snippet: .. PCR target copy numbers in test reactions were determined by comparison with known amounts of RNA1 and 18S rRNA transcripts generated in vitro using T7 RNA polymerase and pBluescript-SK(+) or pcDNA3.1(+) containing the relevant PCR amplicons ligated at the SmaI site. ..

Article Title: Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase *Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase * S⃞
Article Snippet: Recombinant baculoviruses encoding WT and mutant AID were generated according to the recommended protocol (BD Bioscience). .. T7 RNA polymerase was purchased from Promega, and ultrapure NTP was purchased from Amersham Biosciences.

Sequencing:

Article Title: Efficiency of a programmed -1 ribosomal frameshift in the different subtypes of the human immunodeficiency virus type 1 group M
Article Snippet: For in vitro studies, plasmids were linearized at the Stu I site located 3′ of the luc coding sequence. .. HIV-LUC mRNA was generated by run-off transcription with T7 RNA polymerase, and 0.2 μg of this mRNA was translated at 30°C for 15 min in 25 μL of RRL (Promega).

Article Title: Mitochondrial RNA Import in Leishmania tropica: Aptamers Homologous to Multiple tRNA Domains That Interact Cooperatively or Antagonistically at the Inner Membrane
Article Snippet: The two primers used for the PCR were O-59(GGAATTCTAATACGACGACTCACTATAGGGACGCAGGGACTGTA,containing an Eco RI linker, the T7 RNA polymerase promoter, and five 3′-terminal bases identical to the D arm flanking sequence) and O-60 (GCCCAAGCTTCCGCTACAGTCACAT, complementary to the 3′ end sequence of O-58 and containing a Hin dIII linker). .. Transcription was performed with 10-μl reaction mixtures containing 40 mM Tris-HCl, pH 7.5, 6 mM MgCl2 , 1 mM spermidine, 1 mM dithiothreitol (DTT), 0.5 mM concentrations (each) of CTP, ATP, and GTP, 0.25 mM UTP, 1 μCi of [α-32 P]UTP, and 10 U of T7 RNA polymerase at 37°C for 90 min. Then, 1 U of RQ1 DNase (Promega) was added and the reaction mixture was further incubated at 37°C for 15 min. RNA was recovered by phenol-chloroform extraction and ethanol precipitation.

Article Title: Reovirus reverse genetics: Incorporation of the CAT gene into the reovirus genome
Article Snippet: Recloning and subsequent sequencing and cleavage analysis confirmed the authenticity of the 5′- and 3′-terminal sequences. .. The pS2CAT13 construct was transcribed in vitro by using T7 RNA polymerase, and the transcript was capped using (m)7 GpppG (Promega) to yield s2-CAT mRNA.

Recombinant:

Article Title: Plant tRNA ligases are multifunctional enzymes that have diverged in sequence and substrate specificity from RNA ligases of other phylogenetic origins
Article Snippet: Intron-containing pre-tRNAs were transcribed by T7 RNA polymerase using the RiboMax T7 transcription kit (Promega, Mannheim, Germany). .. Purified archeuka pre-tRNA was cleaved with M.jannaschii splicing endonuclease in a 20 μl reaction mixture, containing 10 mM Tris–HCl, pH 7.6, 100 mM KCl, 10 mM MgCl2 , 1 mM DTT, 40 μM spermine and 2 μl of 1 μg recombinant enzyme.

Article Title: Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase *Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase * S⃞
Article Snippet: E. coli single-stranded binding protein and recombinant human RPA were overexpressed in E. coli and purified according to published protocols ( , ). .. T7 RNA polymerase was purchased from Promega, and ultrapure NTP was purchased from Amersham Biosciences.

Molecular Weight:

Article Title: PATE, a gene expressed in prostate cancer, normal prostate, and testis, identified by a functional genomic approach
Article Snippet: The in vitro transcription and translation of the PATE cDNA was carried out by using T7 RNA polymerase and wheat germ extract (TNT; Promega) and following the manufacturer's instructions. .. The reaction mixture was heated at 95°C in reducing sample buffer and then analyzed under reducing conditions on a polyacrylamide gel (18% PAGE/Tris–glycine; Bio-Rad) together with a prestained protein molecular weight marker (Bio-Rad).

Radioactivity:

Article Title: Induced-fit recognition of DNA by organometallic complexes with dynamic stereogenic centers
Article Snippet: Transcription of the ( Nde I/ Hpa I) restriction fragment of pSP73KB DNA with SP6 or T7 RNA polymerase and electrophoretic analysis of transcripts were performed according to the protocols recommended by Promega as described ( ). .. Before aliquots containing the transcripts were loaded on the polyacrylamide gel, the radioactivity associated with these samples was adjusted so that equal amounts of radioactivity were loaded into each well.

Mutagenesis:

Article Title: Plant tRNA ligases are multifunctional enzymes that have diverged in sequence and substrate specificity from RNA ligases of other phylogenetic origins
Article Snippet: The archeuka tRNA gene is derived from this clone by Ex-site mutagenesis (according to the protocol of Stratagene, Heidelberg, Germany). .. Intron-containing pre-tRNAs were transcribed by T7 RNA polymerase using the RiboMax T7 transcription kit (Promega, Mannheim, Germany).

Article Title: Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase *Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase * S⃞
Article Snippet: WT and mutant GST-AID proteins were expressed and purified as described previously ( , ), with an additional of Halt phosphatase inhibitor mixture (Pierce) in the lysis buffer. .. T7 RNA polymerase was purchased from Promega, and ultrapure NTP was purchased from Amersham Biosciences.

Labeling:

Article Title: Nonstructural Protein 5A (NS5A) and Human Replication Protein A Increase the Processivity of Hepatitis C Virus NS5B Polymerase Activity In Vitro
Article Snippet: Labeled nucleotides, [35 S]methionine (1,000 Ci/mmol), and [32 P]UTP (specific activity, 5,000 cpm/pmol) were obtained from PerkinElmer (Waltham, MA); unlabeled nucleotides and T4 gene 32 protein (gp32) were obtained from Amersham Pharmacia Biotech (GE Healthcare Biosciences, Pittsburgh, PA). .. T7 RNA polymerase and RNasin were obtained from Promega (Madison, WI).

Article Title: In Vitro Import of a Nuclearly Encoded tRNA into the Mitochondrion of Trypanosoma brucei
Article Snippet: .. All three substrates were incubated with T7 RNA polymerase and [α-32 P]UTP according to protocols from Promega to produce uniformly labeled transcripts. ..

Purification:

Article Title: Plant tRNA ligases are multifunctional enzymes that have diverged in sequence and substrate specificity from RNA ligases of other phylogenetic origins
Article Snippet: Intron-containing pre-tRNAs were transcribed by T7 RNA polymerase using the RiboMax T7 transcription kit (Promega, Mannheim, Germany). .. The T7-transcripts were purified on an 8% polyacrylamide/8 M urea gel.

Article Title: Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase *Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase * S⃞
Article Snippet: E. coli single-stranded binding protein and recombinant human RPA were overexpressed in E. coli and purified according to published protocols ( , ). .. T7 RNA polymerase was purchased from Promega, and ultrapure NTP was purchased from Amersham Biosciences.

Article Title: In Vitro Import of a Nuclearly Encoded tRNA into the Mitochondrion of Trypanosoma brucei
Article Snippet: Paragraph title: Transcription and purification of RNA. ... All three substrates were incubated with T7 RNA polymerase and [α-32 P]UTP according to protocols from Promega to produce uniformly labeled transcripts.

Polymerase Chain Reaction:

Article Title: Mitochondrial RNA Import in Leishmania tropica: Aptamers Homologous to Multiple tRNA Domains That Interact Cooperatively or Antagonistically at the Inner Membrane
Article Snippet: After heat activation of the enzyme at 90°C for 10 min, amplifications were carried out for 30 cycles of 90°C for 30 s, 60°C for 30 s, and 72°C for 30 s. PCR products were gel eluted after nondenaturing 6% polyacrylamide gel electrophoresis and used for the preparation of substrate RNA. .. Transcription was performed with 10-μl reaction mixtures containing 40 mM Tris-HCl, pH 7.5, 6 mM MgCl2 , 1 mM spermidine, 1 mM dithiothreitol (DTT), 0.5 mM concentrations (each) of CTP, ATP, and GTP, 0.25 mM UTP, 1 μCi of [α-32 P]UTP, and 10 U of T7 RNA polymerase at 37°C for 90 min. Then, 1 U of RQ1 DNase (Promega) was added and the reaction mixture was further incubated at 37°C for 15 min. RNA was recovered by phenol-chloroform extraction and ethanol precipitation.

Article Title: Betanodavirus B2 Is an RNA Interference Antagonist That Facilitates Intracellular Viral RNA Accumulation
Article Snippet: .. PCR target copy numbers in test reactions were determined by comparison with known amounts of RNA1 and 18S rRNA transcripts generated in vitro using T7 RNA polymerase and pBluescript-SK(+) or pcDNA3.1(+) containing the relevant PCR amplicons ligated at the SmaI site. ..

Polyacrylamide Gel Electrophoresis:

Article Title: PATE, a gene expressed in prostate cancer, normal prostate, and testis, identified by a functional genomic approach
Article Snippet: The in vitro transcription and translation of the PATE cDNA was carried out by using T7 RNA polymerase and wheat germ extract (TNT; Promega) and following the manufacturer's instructions. .. The reaction mixture was heated at 95°C in reducing sample buffer and then analyzed under reducing conditions on a polyacrylamide gel (18% PAGE/Tris–glycine; Bio-Rad) together with a prestained protein molecular weight marker (Bio-Rad).

Article Title: Mitochondrial RNA Import in Leishmania tropica: Aptamers Homologous to Multiple tRNA Domains That Interact Cooperatively or Antagonistically at the Inner Membrane
Article Snippet: After heat activation of the enzyme at 90°C for 10 min, amplifications were carried out for 30 cycles of 90°C for 30 s, 60°C for 30 s, and 72°C for 30 s. PCR products were gel eluted after nondenaturing 6% polyacrylamide gel electrophoresis and used for the preparation of substrate RNA. .. Transcription was performed with 10-μl reaction mixtures containing 40 mM Tris-HCl, pH 7.5, 6 mM MgCl2 , 1 mM spermidine, 1 mM dithiothreitol (DTT), 0.5 mM concentrations (each) of CTP, ATP, and GTP, 0.25 mM UTP, 1 μCi of [α-32 P]UTP, and 10 U of T7 RNA polymerase at 37°C for 90 min. Then, 1 U of RQ1 DNase (Promega) was added and the reaction mixture was further incubated at 37°C for 15 min. RNA was recovered by phenol-chloroform extraction and ethanol precipitation.

Chloramphenicol Acetyltransferase Assay:

Article Title: Rescue of Mumps Virus from cDNA
Article Snippet: Paragraph title: Rescue of CAT activity from transfected cells. ... In vitro transcriptions were carried out with 4 μg of pMUVCAT as template for T7 RNA polymerase in a 20-μl final volume as specified by the manufacturer (Promega, Madison, Wis.); template DNA was then destroyed by digestion with RQ-1 DNase for 15 min at 37°C.

Article Title: Reovirus reverse genetics: Incorporation of the CAT gene into the reovirus genome
Article Snippet: Transcription of this construction yielded an RNA that contained the 198 5′ nucleotides of the s2 ssRNA genome segment fused in-frame to the CAT mRNA sequence followed by the 284 3′-terminal nucleotides of s2 RNA. .. The pS2CAT13 construct was transcribed in vitro by using T7 RNA polymerase, and the transcript was capped using (m)7 GpppG (Promega) to yield s2-CAT mRNA.

SDS Page:

Article Title: Influence of translation efficiency of homologous viral proteins on the endogenous presentation of CD8+ T cell epitopes
Article Snippet: EBNA1 and EBNA1ΔGA cDNA in pcDNA3.1 were transcribed and translated in vitro with T7 RNA polymerase using a coupled transcription/translation reticulocyte lysate system (Promega) supplemented with 250 μCi of 35 [S]-methionine (GE Healthcare). .. Lysates (5 μl) were incubated for 5 min at 95°C with Laemmli sample buffer (20 μl) and subjected to SDS-PAGE.

Plasmid Preparation:

Article Title: Induced-fit recognition of DNA by organometallic complexes with dynamic stereogenic centers
Article Snippet: Calf thymus (CT) DNA and plasmid DNAs were incubated with metal complexes in 10 mM NaClO4 at 310 K for 48 h in the dark, unless stated otherwise. .. Transcription of the ( Nde I/ Hpa I) restriction fragment of pSP73KB DNA with SP6 or T7 RNA polymerase and electrophoretic analysis of transcripts were performed according to the protocols recommended by Promega as described ( ).

Article Title: Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase *Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase * S⃞
Article Snippet: Enzymes and Substrates —Mutant AID proteins (S38A, S38D, S41A, S41D, S43A, and S43P) were constructed by site-directed mutagenesis (QuikChange site-directed mutagenesis kit, Stratagene) using the pAcG2T-AID vector ( , ) as the template. .. T7 RNA polymerase was purchased from Promega, and ultrapure NTP was purchased from Amersham Biosciences.

Binding Assay:

Article Title: Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase *Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase * S⃞
Article Snippet: E. coli single-stranded binding protein and recombinant human RPA were overexpressed in E. coli and purified according to published protocols ( , ). .. T7 RNA polymerase was purchased from Promega, and ultrapure NTP was purchased from Amersham Biosciences.

In Vitro:

Article Title: PATE, a gene expressed in prostate cancer, normal prostate, and testis, identified by a functional genomic approach
Article Snippet: .. The in vitro transcription and translation of the PATE cDNA was carried out by using T7 RNA polymerase and wheat germ extract (TNT; Promega) and following the manufacturer's instructions. ..

Article Title: Efficiency of a programmed -1 ribosomal frameshift in the different subtypes of the human immunodeficiency virus type 1 group M
Article Snippet: Paragraph title: In vitro transcription and translation ... HIV-LUC mRNA was generated by run-off transcription with T7 RNA polymerase, and 0.2 μg of this mRNA was translated at 30°C for 15 min in 25 μL of RRL (Promega).

Article Title: Rescue of Mumps Virus from cDNA
Article Snippet: .. In vitro transcriptions were carried out with 4 μg of pMUVCAT as template for T7 RNA polymerase in a 20-μl final volume as specified by the manufacturer (Promega, Madison, Wis.); template DNA was then destroyed by digestion with RQ-1 DNase for 15 min at 37°C. .. Overnight cultures of 293 cells grown to ∼80% confluence in six-well dishes were infected with MUV at a multiplicity of infection (MOI) of 1 to 2; at 1 h postinfection (hpi), a mixture containing 5 to 10 μl of in vitro transcription reaction (approximately 5 to 10 μg of RNA) and 10 to 12 μl of LipofectACE (GibcoBRL) was added to each well according to the supplier's protocol.

Article Title: Induced-fit recognition of DNA by organometallic complexes with dynamic stereogenic centers
Article Snippet: DNA Transcription by RNA Polymerase in Vitro. .. Transcription of the ( Nde I/ Hpa I) restriction fragment of pSP73KB DNA with SP6 or T7 RNA polymerase and electrophoretic analysis of transcripts were performed according to the protocols recommended by Promega as described ( ).

Article Title: Influence of translation efficiency of homologous viral proteins on the endogenous presentation of CD8+ T cell epitopes
Article Snippet: .. EBNA1 and EBNA1ΔGA cDNA in pcDNA3.1 were transcribed and translated in vitro with T7 RNA polymerase using a coupled transcription/translation reticulocyte lysate system (Promega) supplemented with 250 μCi of 35 [S]-methionine (GE Healthcare). .. Lysates (5 μl) were incubated for 5 min at 95°C with Laemmli sample buffer (20 μl) and subjected to SDS-PAGE.

Article Title: Naturally Occurring Dicistronic Cricket Paralysis Virus RNA Is Regulated by Two Internal Ribosome Entry Sites
Article Snippet: .. For transcription in vitro, dicistronic luciferase constructs were digested with Bam HI and linear DNA was transcribed with T7 RNA polymerase using the RiboMAX protocol (Promega) as described previously ( ). .. Dicistronic vectors containing the IGR linked to its natural coding region were constructed as follows.

Article Title: The Crucial Role of Divalent Metal Ions in the DNA-Acting Efficacy and Inhibition of the Transcription of Dimeric Chromomycin A3
Article Snippet: .. RNA polymerase assays During in vitro transcription, T7 RNA polymerase was used for the RNA polymerase assay (Promega). ..

Article Title: Effects of Mutations of the Initiation Nucleotides on Hepatitis C Virus RNA Replication in the Cell
Article Snippet: .. Subgenomic HCV replicon RNAs were transcribed in vitro by a T7 RNA polymerase from the above-described DNA constructs linearized by restriction enzyme digestion by using large-scale RNA production kits (Promega) (Fig. ). .. Restriction enzymes used for linearization of the DNA constructs are indicated on the right side of Fig. .

Ethanol Precipitation:

Article Title: Mitochondrial RNA Import in Leishmania tropica: Aptamers Homologous to Multiple tRNA Domains That Interact Cooperatively or Antagonistically at the Inner Membrane
Article Snippet: .. Transcription was performed with 10-μl reaction mixtures containing 40 mM Tris-HCl, pH 7.5, 6 mM MgCl2 , 1 mM spermidine, 1 mM dithiothreitol (DTT), 0.5 mM concentrations (each) of CTP, ATP, and GTP, 0.25 mM UTP, 1 μCi of [α-32 P]UTP, and 10 U of T7 RNA polymerase at 37°C for 90 min. Then, 1 U of RQ1 DNase (Promega) was added and the reaction mixture was further incubated at 37°C for 15 min. RNA was recovered by phenol-chloroform extraction and ethanol precipitation. .. Random-sequence RNA (pool 0; 1 pmol), prepared as described above, was incubated with 1 mg of mitochondria in a 200-μl reaction mixture containing 10 mM Tris-HCl, pH 7.5, 10 mM MgCl2 , 1 mM DTT, and 4 mM ATP at 37°C for 15 min, and then RNases A and T1 were added to final concentrations of 2.5 μg/ml and 50 U/ml, respectively, and RNase digestion continued at 37°C for 15 min.

Spectrophotometry:

Article Title: Induced-fit recognition of DNA by organometallic complexes with dynamic stereogenic centers
Article Snippet: The molar ratios of bound metal complex to nucleotide phosphate ( r b ) were determined by flameless atomic absorption spectrophotometry. .. Transcription of the ( Nde I/ Hpa I) restriction fragment of pSP73KB DNA with SP6 or T7 RNA polymerase and electrophoretic analysis of transcripts were performed according to the protocols recommended by Promega as described ( ).

Produced:

Article Title: Effects of Mutations of the Initiation Nucleotides on Hepatitis C Virus RNA Replication in the Cell
Article Snippet: Subgenomic HCV replicon RNAs were transcribed in vitro by a T7 RNA polymerase from the above-described DNA constructs linearized by restriction enzyme digestion by using large-scale RNA production kits (Promega) (Fig. ). .. Digestion of DNAs with restriction enzymes ScaI and AfeI resulted in blunt ends, whereas cleavage by FseI and NsiI produced an overhang at the 3′ end of the DNA constructs.

Activation Assay:

Article Title: Mitochondrial RNA Import in Leishmania tropica: Aptamers Homologous to Multiple tRNA Domains That Interact Cooperatively or Antagonistically at the Inner Membrane
Article Snippet: After heat activation of the enzyme at 90°C for 10 min, amplifications were carried out for 30 cycles of 90°C for 30 s, 60°C for 30 s, and 72°C for 30 s. PCR products were gel eluted after nondenaturing 6% polyacrylamide gel electrophoresis and used for the preparation of substrate RNA. .. Transcription was performed with 10-μl reaction mixtures containing 40 mM Tris-HCl, pH 7.5, 6 mM MgCl2 , 1 mM spermidine, 1 mM dithiothreitol (DTT), 0.5 mM concentrations (each) of CTP, ATP, and GTP, 0.25 mM UTP, 1 μCi of [α-32 P]UTP, and 10 U of T7 RNA polymerase at 37°C for 90 min. Then, 1 U of RQ1 DNase (Promega) was added and the reaction mixture was further incubated at 37°C for 15 min. RNA was recovered by phenol-chloroform extraction and ethanol precipitation.

Thin Layer Chromatography:

Article Title: Rescue of Mumps Virus from cDNA
Article Snippet: In vitro transcriptions were carried out with 4 μg of pMUVCAT as template for T7 RNA polymerase in a 20-μl final volume as specified by the manufacturer (Promega, Madison, Wis.); template DNA was then destroyed by digestion with RQ-1 DNase for 15 min at 37°C. .. The clarified cell extracts were then assayed for CAT activity using either C-14-labeled chloramphenicol or fluorescein-labeled chloramphenicol (Molecular Probes, Eugene, Oreg.), followed by analysis of reaction products by thin-layer chromatography.

Marker:

Article Title: PATE, a gene expressed in prostate cancer, normal prostate, and testis, identified by a functional genomic approach
Article Snippet: The in vitro transcription and translation of the PATE cDNA was carried out by using T7 RNA polymerase and wheat germ extract (TNT; Promega) and following the manufacturer's instructions. .. The reaction mixture was heated at 95°C in reducing sample buffer and then analyzed under reducing conditions on a polyacrylamide gel (18% PAGE/Tris–glycine; Bio-Rad) together with a prestained protein molecular weight marker (Bio-Rad).

Lysis:

Article Title: Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase *Impact of Phosphorylation and Phosphorylation-null Mutants on the Activity and Deamination Specificity of Activation-induced Cytidine Deaminase * S⃞
Article Snippet: WT and mutant GST-AID proteins were expressed and purified as described previously ( , ), with an additional of Halt phosphatase inhibitor mixture (Pierce) in the lysis buffer. .. T7 RNA polymerase was purchased from Promega, and ultrapure NTP was purchased from Amersham Biosciences.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Promega t7 promoter carrying 16s rrna genes
    Counts of microbial species isolated and identified by species-specific PCR or <t>16S</t> <t>rRNA</t> sequencing PCR. Forty-four different species were isolated and identified in some or all the samples analyzed (meconium (·), 1 st week (··), 2 nd week (···) and 3 rd week (····) fecal samples). Concentrations of the identified species are represented in a grey scale from non detected (nd) in white to 8–10 log 10 CFU/mL in black.
    T7 Promoter Carrying 16s Rrna Genes, supplied by Promega, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 promoter carrying 16s rrna genes/product/Promega
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    t7 promoter carrying 16s rrna genes - by Bioz Stars, 2020-02
    85/100 stars
      Buy from Supplier

    99
    Promega t7 rna polymerase
    RNase T 1 interferes with R-loop formation on a linearized switch substrate containing four repeats of murine Sγ3. The substrate, pDR3, was linearized with ApaL1 and then transcribed with <t>T7</t> RNA polymerase in the presence of [α- 32 P]UTP.
    T7 Rna Polymerase, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 346 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t7 rna polymerase/product/Promega
    Average 99 stars, based on 346 article reviews
    Price from $9.99 to $1999.99
    t7 rna polymerase - by Bioz Stars, 2020-02
    99/100 stars
      Buy from Supplier

    Image Search Results


    Counts of microbial species isolated and identified by species-specific PCR or 16S rRNA sequencing PCR. Forty-four different species were isolated and identified in some or all the samples analyzed (meconium (·), 1 st week (··), 2 nd week (···) and 3 rd week (····) fecal samples). Concentrations of the identified species are represented in a grey scale from non detected (nd) in white to 8–10 log 10 CFU/mL in black.

    Journal: PLoS ONE

    Article Title: Bacterial Diversity in Meconium of Preterm Neonates and Evolution of Their Fecal Microbiota during the First Month of Life

    doi: 10.1371/journal.pone.0066986

    Figure Lengend Snippet: Counts of microbial species isolated and identified by species-specific PCR or 16S rRNA sequencing PCR. Forty-four different species were isolated and identified in some or all the samples analyzed (meconium (·), 1 st week (··), 2 nd week (···) and 3 rd week (····) fecal samples). Concentrations of the identified species are represented in a grey scale from non detected (nd) in white to 8–10 log 10 CFU/mL in black.

    Article Snippet: In vitro transcription of the T7 promoter-carrying 16S rRNA genes was performed using the Riboprobe System (Promega, Madison, WI, USA) while amino-allyl-modified nucleotides were coupled with CyDye using the Post-Labeling Reactive Dye (Amersham Biosciences, Little Chalfont, UK).

    Techniques: Isolation, Polymerase Chain Reaction, Sequencing

    RNase T 1 interferes with R-loop formation on a linearized switch substrate containing four repeats of murine Sγ3. The substrate, pDR3, was linearized with ApaL1 and then transcribed with T7 RNA polymerase in the presence of [α- 32 P]UTP.

    Journal:

    Article Title: Mechanism of R-Loop Formation at Immunoglobulin Class Switch Sequences ▿Mechanism of R-Loop Formation at Immunoglobulin Class Switch Sequences ▿ †

    doi: 10.1128/MCB.01251-07

    Figure Lengend Snippet: RNase T 1 interferes with R-loop formation on a linearized switch substrate containing four repeats of murine Sγ3. The substrate, pDR3, was linearized with ApaL1 and then transcribed with T7 RNA polymerase in the presence of [α- 32 P]UTP.

    Article Snippet: Moreover, the amount of R-loop formation is similar or higher for all of our buffers containing Li+ , Na+ , K+ , or Cs+ (Fig. , lanes 4 to 7 and lanes 12 to 15 and data not shown) relative to the manufacturer's buffer for T7 RNA polymerase (Fig. , lanes 2 and 10), which is prepared using Na+ (and has the same composition as our Na+ -based transcription buffer).

    Techniques:

    Setting up an in vitro HCV rolling-circle replication system. (A) Purification of HCV proteins and RPA. HCV proteins NS3-4A, NS3 helicase, NS5A (S25-C447) , NS5A (S25-K215) , NS5BΔ21 polymerase and the native human RPA were purified as described in Materials and Methods and analyzed using SDS-polyacrylamide gel electrophoresis and Coomassie blue staining. The arrowheads indicate the bands corresponding to individual proteins or protein subunits in the case of NS3-4A and RPA. (B) Design of the rolling-circle RNA template. Two RNA oligonucleotides (74 nt and 106 nt) were synthesized with T7 RNA polymerase on the primed DNA templates with T7 promoter sequence primers as described in Materials and Methods. The 74-nt RNA oligonucleotide was hybridized with the DNA oligonucleotide “bridge” and ligated with DNA ligase to create a RNA circle. The rolling-circle RNA template was constructed by hybridization of the RNA circle and the 106-nt RNA oligonucleotide to complete the formation of the rolling-circle RNA template.

    Journal: Journal of Virology

    Article Title: Nonstructural Protein 5A (NS5A) and Human Replication Protein A Increase the Processivity of Hepatitis C Virus NS5B Polymerase Activity In Vitro

    doi: 10.1128/JVI.01677-14

    Figure Lengend Snippet: Setting up an in vitro HCV rolling-circle replication system. (A) Purification of HCV proteins and RPA. HCV proteins NS3-4A, NS3 helicase, NS5A (S25-C447) , NS5A (S25-K215) , NS5BΔ21 polymerase and the native human RPA were purified as described in Materials and Methods and analyzed using SDS-polyacrylamide gel electrophoresis and Coomassie blue staining. The arrowheads indicate the bands corresponding to individual proteins or protein subunits in the case of NS3-4A and RPA. (B) Design of the rolling-circle RNA template. Two RNA oligonucleotides (74 nt and 106 nt) were synthesized with T7 RNA polymerase on the primed DNA templates with T7 promoter sequence primers as described in Materials and Methods. The 74-nt RNA oligonucleotide was hybridized with the DNA oligonucleotide “bridge” and ligated with DNA ligase to create a RNA circle. The rolling-circle RNA template was constructed by hybridization of the RNA circle and the 106-nt RNA oligonucleotide to complete the formation of the rolling-circle RNA template.

    Article Snippet: T7 RNA polymerase and RNasin were obtained from Promega (Madison, WI).

    Techniques: In Vitro, Purification, Recombinase Polymerase Amplification, Polyacrylamide Gel Electrophoresis, Staining, Synthesized, Sequencing, Construct, Hybridization

    A codon-modified GAr sequence influences EBNA1 synthesis. ( A ) IVT assay of pcDNA3 expression constructs encoding EBNA1 (E1) (lane 1), E1ΔGA (lane 2), E1-GAr(100N) (lane 3), E1-GAr(100M) (lane 4), E1-GAr(200N) (lane 5), E1-GAr(200M) (lane 6), E1-GAr(300N) (lane 7), E1-GAr(300M) (lane 8), E1-GAr(400N) (lane 9), E1-GAr(400M) (lane 10), E1-GAr(500N) (lane 11), or E1-GAr(500M) (lane 12). The constructs were transcribed and translated in vitro with T7 RNA polymerase by using a coupled transcription/translation reticulocyte lysate system. 35 S-methionine-labeled proteins were visualized by autoradiography. ( B and C ) Band intensities from the IVT assay were quantified by densitometric analysis using Imagequant software (Molecular Dynamics) and graphed to demonstrate absolute intensities ( B ) or relative fold increase of EBNA1 encoded by codon-modified GAr domains compared with EBNA1 encoded by native GAr domains ( C ). ( D ) Western blot of EBV-negative HEK293 cells transfected with expression constructs encoding E1-GFP (lane 1), E1ΔGA-GFP (lane 2), E1-GAr(100N)-GFP (lane 3), E1-GAr(100M)-GFP (lane 4), E1-GAr(200N)-GFP (lane 5), E1-GAr(200M)-GFP (lane 6), E1-GAr(300N)-GFP (lane 7), E1-GAr(300M)-GFP (lane 8), E1-GAr(400N)-GFP (lane 9), E1-GAr(400M)-GFP (lane 10), E1-GAr(500N)-GFP (lane 11), or E1-GAr(500M)-GFP (lane 12) with a GFP antibody ( Upper ) or a monoclonal actin antibody ( Lower ). Molecular weight markers M r (kDa) are indicated on the left. ( E ) Band intensities after immunoblotting were quantified as described for B . Representative data from one of four experiments are presented here.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: Regulation of protein translation through mRNA structure influences MHC class I loading and T cell recognition

    doi: 10.1073/pnas.0801968105

    Figure Lengend Snippet: A codon-modified GAr sequence influences EBNA1 synthesis. ( A ) IVT assay of pcDNA3 expression constructs encoding EBNA1 (E1) (lane 1), E1ΔGA (lane 2), E1-GAr(100N) (lane 3), E1-GAr(100M) (lane 4), E1-GAr(200N) (lane 5), E1-GAr(200M) (lane 6), E1-GAr(300N) (lane 7), E1-GAr(300M) (lane 8), E1-GAr(400N) (lane 9), E1-GAr(400M) (lane 10), E1-GAr(500N) (lane 11), or E1-GAr(500M) (lane 12). The constructs were transcribed and translated in vitro with T7 RNA polymerase by using a coupled transcription/translation reticulocyte lysate system. 35 S-methionine-labeled proteins were visualized by autoradiography. ( B and C ) Band intensities from the IVT assay were quantified by densitometric analysis using Imagequant software (Molecular Dynamics) and graphed to demonstrate absolute intensities ( B ) or relative fold increase of EBNA1 encoded by codon-modified GAr domains compared with EBNA1 encoded by native GAr domains ( C ). ( D ) Western blot of EBV-negative HEK293 cells transfected with expression constructs encoding E1-GFP (lane 1), E1ΔGA-GFP (lane 2), E1-GAr(100N)-GFP (lane 3), E1-GAr(100M)-GFP (lane 4), E1-GAr(200N)-GFP (lane 5), E1-GAr(200M)-GFP (lane 6), E1-GAr(300N)-GFP (lane 7), E1-GAr(300M)-GFP (lane 8), E1-GAr(400N)-GFP (lane 9), E1-GAr(400M)-GFP (lane 10), E1-GAr(500N)-GFP (lane 11), or E1-GAr(500M)-GFP (lane 12) with a GFP antibody ( Upper ) or a monoclonal actin antibody ( Lower ). Molecular weight markers M r (kDa) are indicated on the left. ( E ) Band intensities after immunoblotting were quantified as described for B . Representative data from one of four experiments are presented here.

    Article Snippet: EBNA1/pcDNA3 expression constructs were linearized with XbaI and 1 μg of template transcribed with T7 RNA polymerase by using a Riboprobe in vitro transcription system (Promega) supplemented with 50 μCi [α-32 P]UTP (Amersham Biosciences).

    Techniques: Modification, Sequencing, Expressing, Construct, In Vitro, Labeling, Autoradiography, Software, Western Blot, Transfection, Molecular Weight