Structured Review

Promega t4 rna ligase
Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) <t>T4</t> RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5 dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with E. coli poly (A) polymerase or Schizosaccharomyces pombe poly (U) polymerase.A total of 4000 dpm RNA (10 5 dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.
T4 Rna Ligase, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 rna ligase/product/Promega
Average 93 stars, based on 4 article reviews
Price from $9.99 to $1999.99
t4 rna ligase - by Bioz Stars, 2020-05
93/100 stars

Images

1) Product Images from "RNA self-cleavage activated by ultraviolet light-induced oxidation"

Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkr822

Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) T4 RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5 dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with E. coli poly (A) polymerase or Schizosaccharomyces pombe poly (U) polymerase.A total of 4000 dpm RNA (10 5 dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.
Figure Legend Snippet: Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) T4 RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5 dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with E. coli poly (A) polymerase or Schizosaccharomyces pombe poly (U) polymerase.A total of 4000 dpm RNA (10 5 dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.

Techniques Used: Produced, Purification, Incubation, De-Phosphorylation Assay, Labeling, Molecular Weight, Marker

Characterization of UV-C cleavage of viral RNAs by fingerprinting and electrophoretic methods. ( a ) The RNA fingerprints of internally [α- 32 P] HCV (panels 1–3) and CSFV RNA (panels 4–6). Labeled SM, band B1 and band B2 were exhaustively digested with RNase T1 and the products subjected to 2D separation. ( 1 ) RNA fingerprint of HCV 1–249. A total of 500 000 dpm of HCV SM was fingerprinted. Spot 1: the HCV oligonucleotide 5′ 78 UCUAG 82 3′ within which cleavage takes place; Spot 2: this has the characteristic mobility of the 5′-terminal nucleotide 5′pppGp3′. ( 2 ) RNA fingerprint of HCV B1. A total of 300 000 dpm of RNA was fingerprinted as above. Spot 1 has disappeared, while the absence of the 5′-end (spot 2) shows that HCV B1 contains the 3′-portion of SM. ( 3 ) Fingerprint of HCV B2 (100 000 dpm). ‘1’ indicates the loss of spot 1, while the presence of the HCV 5′-end (‘2’) shows that HCV B2 contains the 5′-portion of SM. ( 4–6 ): RNA fingerprints of CSFV 1-218. SM (500 000 dpm), B1 (300 000 dpm) and B2 (100 000 dpm, transcribed with all four [α- 32 P]-labeled rNTPs. ‘1’: the CSFV oligonucleotide 5′ 38 AUACACUAAAUUUCG 52 3′, which is present in SM but absent from B1 and B2; ‘X’ (a new CSFV B1 oligonucleotide) and ‘Y’ (the other new CSFV oligonucleotide) arise from cleavage within spot 1 (see text) . ‘2’: the 5′-end of CSFV, present in SM and B2, but not B1. Numbering according to Wang et al. ( 62 ) for HCV genotype 1b and Gene Bank J04358 for CSFV Alfort Isolate. The sequence of the spot numbered as 1 was identified by secondary RNase analysis and high voltage electrophoresis on DEAE and Whatmann paper by Hugh D. Robertson (data not available), as well as by superposition with previously resolved HCV fingerprints using secondary analysis and on the basis of the rules for RNA oligonucleotide mobility during 2D TLC. Briefly, these rules are: the larger the oligonucleotide, the slower the migration of the corresponding spot to the bottom. As far as composition is concerned, Us displace the spot to the left, Cs to the right, and As cause a slight delay, thus meaning that several As in the same oligo may cause it to behave as an oligo containing one or even two additional bases ( 37 ). As far as sequence is concerned, as HCV RNA was transcribed in the presence of [α- 32 P]GTP here, those T1 oligonucleotides in the original sequence that are followed by a (pG) carry a double label. In the case of HCV RNA several RNase T1 oligonucelotides are indicated as mobility reference: a: UCCUUUCUUGp(G); b: UCUUCAGp(C) 61:68; c: CUCAAUGp(G) 211–217; d: AUUUGp(G) 225–229. Spot 1 locates in the border of the triangle that can be formed by spots i, f and g. In CSFV, spot 1 is the slow migrating spot, and thus corresponded to the largest RNase T1 oligonucleotide. In both HCV and CSFV, band B2 contains the original 5′-terminal nucleotide, pppGp, of the substrate RNA transcript (indicated by ‘2’). The disappearance of spot 1 from both product band fingerprints (see Figure 1 a, images 2, 3 and images 5, 6) suggests that self-cleavage occurs within this oligonucleotide and that this event is specific. Moreover, in the case of CSFV RNA two smaller oligomers (X and Y) that represent the fragment products of spot 1 are observed within the fingerprints of both product bands (B1 and B2) for CSFV. Indicated at the bottom is the sequence surrounding RNase T1 cleavage sites. ( b ) Electrophoresis analysis: Autoradiogram showing a parallel run of HCV RNA 1–130 and CSFV RNA 1–218 UV-cleavage reaction, with RNase T1 treated samples and control reactions for transcripts labeled at either the 5′-extreme with [γ- 32 P]GTP during transcription or the 3′-extreme with [5′- 32 P]pCp and T4 RNA ligase. HCV (lanes 1–6) and CSFV (lanes 1–9). HCV: Lanes 1 and 1′: RNAs incubated in standard buffer; lanes 2 and 2′: RNAs treated with RNase T1 under denaturing conditions; lanes 3 and 3′: RNA irradiated with UV-C light for 180 s. CSFV: Lanes 1 and 1′: RNAs incubated under standard conditions; lanes 2, 3 and 4′: RNA treated with RNase T1; lanes 4 and 3′: RNA irradiated with UV-C light: Lanes 5 and 2′ RNAs partially degraded with alkali. ‘G’ positions of a relevant size are indicated on either side of the gels. Lines indicate SM, and products B1 and B2.
Figure Legend Snippet: Characterization of UV-C cleavage of viral RNAs by fingerprinting and electrophoretic methods. ( a ) The RNA fingerprints of internally [α- 32 P] HCV (panels 1–3) and CSFV RNA (panels 4–6). Labeled SM, band B1 and band B2 were exhaustively digested with RNase T1 and the products subjected to 2D separation. ( 1 ) RNA fingerprint of HCV 1–249. A total of 500 000 dpm of HCV SM was fingerprinted. Spot 1: the HCV oligonucleotide 5′ 78 UCUAG 82 3′ within which cleavage takes place; Spot 2: this has the characteristic mobility of the 5′-terminal nucleotide 5′pppGp3′. ( 2 ) RNA fingerprint of HCV B1. A total of 300 000 dpm of RNA was fingerprinted as above. Spot 1 has disappeared, while the absence of the 5′-end (spot 2) shows that HCV B1 contains the 3′-portion of SM. ( 3 ) Fingerprint of HCV B2 (100 000 dpm). ‘1’ indicates the loss of spot 1, while the presence of the HCV 5′-end (‘2’) shows that HCV B2 contains the 5′-portion of SM. ( 4–6 ): RNA fingerprints of CSFV 1-218. SM (500 000 dpm), B1 (300 000 dpm) and B2 (100 000 dpm, transcribed with all four [α- 32 P]-labeled rNTPs. ‘1’: the CSFV oligonucleotide 5′ 38 AUACACUAAAUUUCG 52 3′, which is present in SM but absent from B1 and B2; ‘X’ (a new CSFV B1 oligonucleotide) and ‘Y’ (the other new CSFV oligonucleotide) arise from cleavage within spot 1 (see text) . ‘2’: the 5′-end of CSFV, present in SM and B2, but not B1. Numbering according to Wang et al. ( 62 ) for HCV genotype 1b and Gene Bank J04358 for CSFV Alfort Isolate. The sequence of the spot numbered as 1 was identified by secondary RNase analysis and high voltage electrophoresis on DEAE and Whatmann paper by Hugh D. Robertson (data not available), as well as by superposition with previously resolved HCV fingerprints using secondary analysis and on the basis of the rules for RNA oligonucleotide mobility during 2D TLC. Briefly, these rules are: the larger the oligonucleotide, the slower the migration of the corresponding spot to the bottom. As far as composition is concerned, Us displace the spot to the left, Cs to the right, and As cause a slight delay, thus meaning that several As in the same oligo may cause it to behave as an oligo containing one or even two additional bases ( 37 ). As far as sequence is concerned, as HCV RNA was transcribed in the presence of [α- 32 P]GTP here, those T1 oligonucleotides in the original sequence that are followed by a (pG) carry a double label. In the case of HCV RNA several RNase T1 oligonucelotides are indicated as mobility reference: a: UCCUUUCUUGp(G); b: UCUUCAGp(C) 61:68; c: CUCAAUGp(G) 211–217; d: AUUUGp(G) 225–229. Spot 1 locates in the border of the triangle that can be formed by spots i, f and g. In CSFV, spot 1 is the slow migrating spot, and thus corresponded to the largest RNase T1 oligonucleotide. In both HCV and CSFV, band B2 contains the original 5′-terminal nucleotide, pppGp, of the substrate RNA transcript (indicated by ‘2’). The disappearance of spot 1 from both product band fingerprints (see Figure 1 a, images 2, 3 and images 5, 6) suggests that self-cleavage occurs within this oligonucleotide and that this event is specific. Moreover, in the case of CSFV RNA two smaller oligomers (X and Y) that represent the fragment products of spot 1 are observed within the fingerprints of both product bands (B1 and B2) for CSFV. Indicated at the bottom is the sequence surrounding RNase T1 cleavage sites. ( b ) Electrophoresis analysis: Autoradiogram showing a parallel run of HCV RNA 1–130 and CSFV RNA 1–218 UV-cleavage reaction, with RNase T1 treated samples and control reactions for transcripts labeled at either the 5′-extreme with [γ- 32 P]GTP during transcription or the 3′-extreme with [5′- 32 P]pCp and T4 RNA ligase. HCV (lanes 1–6) and CSFV (lanes 1–9). HCV: Lanes 1 and 1′: RNAs incubated in standard buffer; lanes 2 and 2′: RNAs treated with RNase T1 under denaturing conditions; lanes 3 and 3′: RNA irradiated with UV-C light for 180 s. CSFV: Lanes 1 and 1′: RNAs incubated under standard conditions; lanes 2, 3 and 4′: RNA treated with RNase T1; lanes 4 and 3′: RNA irradiated with UV-C light: Lanes 5 and 2′ RNAs partially degraded with alkali. ‘G’ positions of a relevant size are indicated on either side of the gels. Lines indicate SM, and products B1 and B2.

Techniques Used: Labeling, Sequencing, Electrophoresis, Thin Layer Chromatography, Migration, Incubation, Irradiation

Enzymatic determination of the new 5′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) Phosphatase-dependent 5′-terminal labeling of both HCV RNA 1–130 cleavage product (B1) (left panel) and CSFV RNA 1–218 cleavage product (B1) (right panel) by polynucleotide kinase. Aliquots (10 000 dpm) of product bands (10 5 dpm/µg) were treated with polynucleotide kinase and [γ- 32 P]ATP, after treatment with Artic Phosphatase (lane 2) or without phosphatase pre-treatment (lane 1). ( b ) Cyclization of HCV (left panel) and CSFV (right panel) RNA product bands B1 by T4 RNA ligase [with 10 000 dpm (10 5 dpm/µg) RNA]. Lanes 1: HCV and CSFV B1 bands incubated without T4 RNA ligase; lanes 2: complete reaction (cyclized RNA: upper band). ( c ) Phosphatase treatment of singly labeled CSFV. Calf alkaline phosphatase was used to treat CSFV band B1 aliquots (50 000 dpm of 107 dpm/µg), followed by high-voltage electrophoresis at pH 1.9 on Whatman DE81 DEAE paper ( 16 ). B1 RNA is at the bottom and free phosphate at the top. ‘U’, ‘A’, ‘C’ and ‘G’ indicate RNAs labeled with [α- 32 P]UTP, ATP, CTP or GTP, respectively, whereas ‘αGTP’ indicates a control containing 1000 dpm of pure [α- 32 P]GTP.
Figure Legend Snippet: Enzymatic determination of the new 5′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) Phosphatase-dependent 5′-terminal labeling of both HCV RNA 1–130 cleavage product (B1) (left panel) and CSFV RNA 1–218 cleavage product (B1) (right panel) by polynucleotide kinase. Aliquots (10 000 dpm) of product bands (10 5 dpm/µg) were treated with polynucleotide kinase and [γ- 32 P]ATP, after treatment with Artic Phosphatase (lane 2) or without phosphatase pre-treatment (lane 1). ( b ) Cyclization of HCV (left panel) and CSFV (right panel) RNA product bands B1 by T4 RNA ligase [with 10 000 dpm (10 5 dpm/µg) RNA]. Lanes 1: HCV and CSFV B1 bands incubated without T4 RNA ligase; lanes 2: complete reaction (cyclized RNA: upper band). ( c ) Phosphatase treatment of singly labeled CSFV. Calf alkaline phosphatase was used to treat CSFV band B1 aliquots (50 000 dpm of 107 dpm/µg), followed by high-voltage electrophoresis at pH 1.9 on Whatman DE81 DEAE paper ( 16 ). B1 RNA is at the bottom and free phosphate at the top. ‘U’, ‘A’, ‘C’ and ‘G’ indicate RNAs labeled with [α- 32 P]UTP, ATP, CTP or GTP, respectively, whereas ‘αGTP’ indicates a control containing 1000 dpm of pure [α- 32 P]GTP.

Techniques Used: Produced, Labeling, Incubation, Electrophoresis

2) Product Images from "Human Box H/ACA Pseudouridylation Guide RNA Machinery †"

Article Title: Human Box H/ACA Pseudouridylation Guide RNA Machinery †

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.24.13.5797-5807.2004

Schematic structure of box H/ACA RNAs and cDNA construction. (A) Selection of pseudouridylation sites by box H/ACA guide RNAs. For details, see the text. (B) Construction of a cDNA library of human box H/ACA RNAs. HeLa cell RNAs immunoprecipitated by an anti-GAR1 antibody were incubated with a phosphorylated oligoribonucleotide in the presence of T4 RNA ligase. RNA sequences tagged at both termini were converted into double-stranded DNA by a reverse transcription-PCR amplification approach. The amplified DNA was cloned into a plasmid vector, and individual clones were characterized by sequence analysis.
Figure Legend Snippet: Schematic structure of box H/ACA RNAs and cDNA construction. (A) Selection of pseudouridylation sites by box H/ACA guide RNAs. For details, see the text. (B) Construction of a cDNA library of human box H/ACA RNAs. HeLa cell RNAs immunoprecipitated by an anti-GAR1 antibody were incubated with a phosphorylated oligoribonucleotide in the presence of T4 RNA ligase. RNA sequences tagged at both termini were converted into double-stranded DNA by a reverse transcription-PCR amplification approach. The amplified DNA was cloned into a plasmid vector, and individual clones were characterized by sequence analysis.

Techniques Used: Selection, cDNA Library Assay, Immunoprecipitation, Incubation, Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Sequencing

3) Product Images from "RNA self-cleavage activated by ultraviolet light-induced oxidation"

Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation

Journal: Nucleic Acids Research

doi: 10.1093/nar/gkr822

Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) T4 RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5 dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with E. coli poly (A) polymerase or Schizosaccharomyces pombe poly (U) polymerase.A total of 4000 dpm RNA (10 5 dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.
Figure Legend Snippet: Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) T4 RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5 dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with E. coli poly (A) polymerase or Schizosaccharomyces pombe poly (U) polymerase.A total of 4000 dpm RNA (10 5 dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.

Techniques Used: Produced, Purification, Incubation, De-Phosphorylation Assay, Labeling, Molecular Weight, Marker

Characterization of UV-C cleavage of viral RNAs by fingerprinting and electrophoretic methods. ( a ) The RNA fingerprints of internally [α- 32 P] HCV (panels 1–3) and CSFV RNA (panels 4–6). Labeled SM, band B1 and band B2 were exhaustively digested with RNase T1 and the products subjected to 2D separation. ( 1 ) RNA fingerprint of HCV 1–249. A total of 500 000 dpm of HCV SM was fingerprinted. Spot 1: the HCV oligonucleotide 5′ 78 UCUAG 82 3′ within which cleavage takes place; Spot 2: this has the characteristic mobility of the 5′-terminal nucleotide 5′pppGp3′. ( 2 ) RNA fingerprint of HCV B1. A total of 300 000 dpm of RNA was fingerprinted as above. Spot 1 has disappeared, while the absence of the 5′-end (spot 2) shows that HCV B1 contains the 3′-portion of SM. ( 3 ) Fingerprint of HCV B2 (100 000 dpm). ‘1’ indicates the loss of spot 1, while the presence of the HCV 5′-end (‘2’) shows that HCV B2 contains the 5′-portion of SM. ( 4–6 ): RNA fingerprints of CSFV 1-218. SM (500 000 dpm), B1 (300 000 dpm) and B2 (100 000 dpm, transcribed with all four [α- 32 P]-labeled rNTPs. ‘1’: the CSFV oligonucleotide 5′ 38 AUACACUAAAUUUCG 52 3′, which is present in SM but absent from B1 and B2; ‘X’ (a new CSFV B1 oligonucleotide) and ‘Y’ (the other new CSFV oligonucleotide) arise from cleavage within spot 1 (see text) . ‘2’: the 5′-end of CSFV, present in SM and B2, but not B1. Numbering according to Wang et al. ( 62 ) for HCV genotype 1b and Gene Bank J04358 for CSFV Alfort Isolate. The sequence of the spot numbered as 1 was identified by secondary RNase analysis and high voltage electrophoresis on DEAE and Whatmann paper by Hugh D. Robertson (data not available), as well as by superposition with previously resolved HCV fingerprints using secondary analysis and on the basis of the rules for RNA oligonucleotide mobility during 2D TLC. Briefly, these rules are: the larger the oligonucleotide, the slower the migration of the corresponding spot to the bottom. As far as composition is concerned, Us displace the spot to the left, Cs to the right, and As cause a slight delay, thus meaning that several As in the same oligo may cause it to behave as an oligo containing one or even two additional bases ( 37 ). As far as sequence is concerned, as HCV RNA was transcribed in the presence of [α- 32 P]GTP here, those T1 oligonucleotides in the original sequence that are followed by a (pG) carry a double label. In the case of HCV RNA several RNase T1 oligonucelotides are indicated as mobility reference: a: UCCUUUCUUGp(G); b: UCUUCAGp(C) 61:68; c: CUCAAUGp(G) 211–217; d: AUUUGp(G) 225–229. Spot 1 locates in the border of the triangle that can be formed by spots i, f and g. In CSFV, spot 1 is the slow migrating spot, and thus corresponded to the largest RNase T1 oligonucleotide. In both HCV and CSFV, band B2 contains the original 5′-terminal nucleotide, pppGp, of the substrate RNA transcript (indicated by ‘2’). The disappearance of spot 1 from both product band fingerprints (see Figure 1 a, images 2, 3 and images 5, 6) suggests that self-cleavage occurs within this oligonucleotide and that this event is specific. Moreover, in the case of CSFV RNA two smaller oligomers (X and Y) that represent the fragment products of spot 1 are observed within the fingerprints of both product bands (B1 and B2) for CSFV. Indicated at the bottom is the sequence surrounding RNase T1 cleavage sites. ( b ) Electrophoresis analysis: Autoradiogram showing a parallel run of HCV RNA 1–130 and CSFV RNA 1–218 UV-cleavage reaction, with RNase T1 treated samples and control reactions for transcripts labeled at either the 5′-extreme with [γ- 32 P]GTP during transcription or the 3′-extreme with [5′- 32 P]pCp and T4 RNA ligase. HCV (lanes 1–6) and CSFV (lanes 1–9). HCV: Lanes 1 and 1′: RNAs incubated in standard buffer; lanes 2 and 2′: RNAs treated with RNase T1 under denaturing conditions; lanes 3 and 3′: RNA irradiated with UV-C light for 180 s. CSFV: Lanes 1 and 1′: RNAs incubated under standard conditions; lanes 2, 3 and 4′: RNA treated with RNase T1; lanes 4 and 3′: RNA irradiated with UV-C light: Lanes 5 and 2′ RNAs partially degraded with alkali. ‘G’ positions of a relevant size are indicated on either side of the gels. Lines indicate SM, and products B1 and B2.
Figure Legend Snippet: Characterization of UV-C cleavage of viral RNAs by fingerprinting and electrophoretic methods. ( a ) The RNA fingerprints of internally [α- 32 P] HCV (panels 1–3) and CSFV RNA (panels 4–6). Labeled SM, band B1 and band B2 were exhaustively digested with RNase T1 and the products subjected to 2D separation. ( 1 ) RNA fingerprint of HCV 1–249. A total of 500 000 dpm of HCV SM was fingerprinted. Spot 1: the HCV oligonucleotide 5′ 78 UCUAG 82 3′ within which cleavage takes place; Spot 2: this has the characteristic mobility of the 5′-terminal nucleotide 5′pppGp3′. ( 2 ) RNA fingerprint of HCV B1. A total of 300 000 dpm of RNA was fingerprinted as above. Spot 1 has disappeared, while the absence of the 5′-end (spot 2) shows that HCV B1 contains the 3′-portion of SM. ( 3 ) Fingerprint of HCV B2 (100 000 dpm). ‘1’ indicates the loss of spot 1, while the presence of the HCV 5′-end (‘2’) shows that HCV B2 contains the 5′-portion of SM. ( 4–6 ): RNA fingerprints of CSFV 1-218. SM (500 000 dpm), B1 (300 000 dpm) and B2 (100 000 dpm, transcribed with all four [α- 32 P]-labeled rNTPs. ‘1’: the CSFV oligonucleotide 5′ 38 AUACACUAAAUUUCG 52 3′, which is present in SM but absent from B1 and B2; ‘X’ (a new CSFV B1 oligonucleotide) and ‘Y’ (the other new CSFV oligonucleotide) arise from cleavage within spot 1 (see text) . ‘2’: the 5′-end of CSFV, present in SM and B2, but not B1. Numbering according to Wang et al. ( 62 ) for HCV genotype 1b and Gene Bank J04358 for CSFV Alfort Isolate. The sequence of the spot numbered as 1 was identified by secondary RNase analysis and high voltage electrophoresis on DEAE and Whatmann paper by Hugh D. Robertson (data not available), as well as by superposition with previously resolved HCV fingerprints using secondary analysis and on the basis of the rules for RNA oligonucleotide mobility during 2D TLC. Briefly, these rules are: the larger the oligonucleotide, the slower the migration of the corresponding spot to the bottom. As far as composition is concerned, Us displace the spot to the left, Cs to the right, and As cause a slight delay, thus meaning that several As in the same oligo may cause it to behave as an oligo containing one or even two additional bases ( 37 ). As far as sequence is concerned, as HCV RNA was transcribed in the presence of [α- 32 P]GTP here, those T1 oligonucleotides in the original sequence that are followed by a (pG) carry a double label. In the case of HCV RNA several RNase T1 oligonucelotides are indicated as mobility reference: a: UCCUUUCUUGp(G); b: UCUUCAGp(C) 61:68; c: CUCAAUGp(G) 211–217; d: AUUUGp(G) 225–229. Spot 1 locates in the border of the triangle that can be formed by spots i, f and g. In CSFV, spot 1 is the slow migrating spot, and thus corresponded to the largest RNase T1 oligonucleotide. In both HCV and CSFV, band B2 contains the original 5′-terminal nucleotide, pppGp, of the substrate RNA transcript (indicated by ‘2’). The disappearance of spot 1 from both product band fingerprints (see Figure 1 a, images 2, 3 and images 5, 6) suggests that self-cleavage occurs within this oligonucleotide and that this event is specific. Moreover, in the case of CSFV RNA two smaller oligomers (X and Y) that represent the fragment products of spot 1 are observed within the fingerprints of both product bands (B1 and B2) for CSFV. Indicated at the bottom is the sequence surrounding RNase T1 cleavage sites. ( b ) Electrophoresis analysis: Autoradiogram showing a parallel run of HCV RNA 1–130 and CSFV RNA 1–218 UV-cleavage reaction, with RNase T1 treated samples and control reactions for transcripts labeled at either the 5′-extreme with [γ- 32 P]GTP during transcription or the 3′-extreme with [5′- 32 P]pCp and T4 RNA ligase. HCV (lanes 1–6) and CSFV (lanes 1–9). HCV: Lanes 1 and 1′: RNAs incubated in standard buffer; lanes 2 and 2′: RNAs treated with RNase T1 under denaturing conditions; lanes 3 and 3′: RNA irradiated with UV-C light for 180 s. CSFV: Lanes 1 and 1′: RNAs incubated under standard conditions; lanes 2, 3 and 4′: RNA treated with RNase T1; lanes 4 and 3′: RNA irradiated with UV-C light: Lanes 5 and 2′ RNAs partially degraded with alkali. ‘G’ positions of a relevant size are indicated on either side of the gels. Lines indicate SM, and products B1 and B2.

Techniques Used: Labeling, Sequencing, Electrophoresis, Thin Layer Chromatography, Migration, Incubation, Irradiation

Enzymatic determination of the new 5′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) Phosphatase-dependent 5′-terminal labeling of both HCV RNA 1–130 cleavage product (B1) (left panel) and CSFV RNA 1–218 cleavage product (B1) (right panel) by polynucleotide kinase. Aliquots (10 000 dpm) of product bands (10 5 dpm/µg) were treated with polynucleotide kinase and [γ- 32 P]ATP, after treatment with Artic Phosphatase (lane 2) or without phosphatase pre-treatment (lane 1). ( b ) Cyclization of HCV (left panel) and CSFV (right panel) RNA product bands B1 by T4 RNA ligase [with 10 000 dpm (10 5 dpm/µg) RNA]. Lanes 1: HCV and CSFV B1 bands incubated without T4 RNA ligase; lanes 2: complete reaction (cyclized RNA: upper band). ( c ) Phosphatase treatment of singly labeled CSFV. Calf alkaline phosphatase was used to treat CSFV band B1 aliquots (50 000 dpm of 107 dpm/µg), followed by high-voltage electrophoresis at pH 1.9 on Whatman DE81 DEAE paper ( 16 ). B1 RNA is at the bottom and free phosphate at the top. ‘U’, ‘A’, ‘C’ and ‘G’ indicate RNAs labeled with [α- 32 P]UTP, ATP, CTP or GTP, respectively, whereas ‘αGTP’ indicates a control containing 1000 dpm of pure [α- 32 P]GTP.
Figure Legend Snippet: Enzymatic determination of the new 5′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) Phosphatase-dependent 5′-terminal labeling of both HCV RNA 1–130 cleavage product (B1) (left panel) and CSFV RNA 1–218 cleavage product (B1) (right panel) by polynucleotide kinase. Aliquots (10 000 dpm) of product bands (10 5 dpm/µg) were treated with polynucleotide kinase and [γ- 32 P]ATP, after treatment with Artic Phosphatase (lane 2) or without phosphatase pre-treatment (lane 1). ( b ) Cyclization of HCV (left panel) and CSFV (right panel) RNA product bands B1 by T4 RNA ligase [with 10 000 dpm (10 5 dpm/µg) RNA]. Lanes 1: HCV and CSFV B1 bands incubated without T4 RNA ligase; lanes 2: complete reaction (cyclized RNA: upper band). ( c ) Phosphatase treatment of singly labeled CSFV. Calf alkaline phosphatase was used to treat CSFV band B1 aliquots (50 000 dpm of 107 dpm/µg), followed by high-voltage electrophoresis at pH 1.9 on Whatman DE81 DEAE paper ( 16 ). B1 RNA is at the bottom and free phosphate at the top. ‘U’, ‘A’, ‘C’ and ‘G’ indicate RNAs labeled with [α- 32 P]UTP, ATP, CTP or GTP, respectively, whereas ‘αGTP’ indicates a control containing 1000 dpm of pure [α- 32 P]GTP.

Techniques Used: Produced, Labeling, Incubation, Electrophoresis

4) Product Images from "Human Box H/ACA Pseudouridylation Guide RNA Machinery †"

Article Title: Human Box H/ACA Pseudouridylation Guide RNA Machinery †

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.24.13.5797-5807.2004

Schematic structure of box H/ACA RNAs and cDNA construction. (A) Selection of pseudouridylation sites by box H/ACA guide RNAs. For details, see the text. (B) Construction of a cDNA library of human box H/ACA RNAs. HeLa cell RNAs immunoprecipitated by an anti-GAR1 antibody were incubated with a phosphorylated oligoribonucleotide in the presence of T4 RNA ligase. RNA sequences tagged at both termini were converted into double-stranded DNA by a reverse transcription-PCR amplification approach. The amplified DNA was cloned into a plasmid vector, and individual clones were characterized by sequence analysis.
Figure Legend Snippet: Schematic structure of box H/ACA RNAs and cDNA construction. (A) Selection of pseudouridylation sites by box H/ACA guide RNAs. For details, see the text. (B) Construction of a cDNA library of human box H/ACA RNAs. HeLa cell RNAs immunoprecipitated by an anti-GAR1 antibody were incubated with a phosphorylated oligoribonucleotide in the presence of T4 RNA ligase. RNA sequences tagged at both termini were converted into double-stranded DNA by a reverse transcription-PCR amplification approach. The amplified DNA was cloned into a plasmid vector, and individual clones were characterized by sequence analysis.

Techniques Used: Selection, cDNA Library Assay, Immunoprecipitation, Incubation, Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Sequencing

5) Product Images from "Human Box H/ACA Pseudouridylation Guide RNA Machinery †"

Article Title: Human Box H/ACA Pseudouridylation Guide RNA Machinery †

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.24.13.5797-5807.2004

Schematic structure of box H/ACA RNAs and cDNA construction. (A) Selection of pseudouridylation sites by box H/ACA guide RNAs. For details, see the text. (B) Construction of a cDNA library of human box H/ACA RNAs. HeLa cell RNAs immunoprecipitated by an anti-GAR1 antibody were incubated with a phosphorylated oligoribonucleotide in the presence of T4 RNA ligase. RNA sequences tagged at both termini were converted into double-stranded DNA by a reverse transcription-PCR amplification approach. The amplified DNA was cloned into a plasmid vector, and individual clones were characterized by sequence analysis.
Figure Legend Snippet: Schematic structure of box H/ACA RNAs and cDNA construction. (A) Selection of pseudouridylation sites by box H/ACA guide RNAs. For details, see the text. (B) Construction of a cDNA library of human box H/ACA RNAs. HeLa cell RNAs immunoprecipitated by an anti-GAR1 antibody were incubated with a phosphorylated oligoribonucleotide in the presence of T4 RNA ligase. RNA sequences tagged at both termini were converted into double-stranded DNA by a reverse transcription-PCR amplification approach. The amplified DNA was cloned into a plasmid vector, and individual clones were characterized by sequence analysis.

Techniques Used: Selection, cDNA Library Assay, Immunoprecipitation, Incubation, Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Sequencing

Related Articles

Blocking Assay:

Article Title: Exponential growth by cross-catalytic cleavage of deoxyribozymogens
Article Snippet: .. Primer binding sites were ligated to the 3′ or 5′ end of a portion of the purified, radiolabeled pool by using T4 RNA ligase (L3, p- UUU CTGAGACGTAGACAGCACGAT-c3; L5, TCGTACTACTAGCATCGTTATGG AAA ; the underlined residues are RNA; p, a 5′ phosphate; and c3, a three-carbon alkyl blocking group). .. The ligated products were purified on denaturing (7 M urea) 8% acrylamide gels and amplified by using primers specific for either C.E1 or C.E2 (for C.E1, P5.E1 CGTTATGGA A ATCGGACAGGC and P3.E1 ATCGTGCTGTCTACGTCTCAG; for C.E2, P5.E2 CGTACTACTAGCATCGTTATGG and P3.E2 TGAGTGACTCGTTGTAGC).

Purification:

Article Title: Exponential growth by cross-catalytic cleavage of deoxyribozymogens
Article Snippet: .. Primer binding sites were ligated to the 3′ or 5′ end of a portion of the purified, radiolabeled pool by using T4 RNA ligase (L3, p- UUU CTGAGACGTAGACAGCACGAT-c3; L5, TCGTACTACTAGCATCGTTATGG AAA ; the underlined residues are RNA; p, a 5′ phosphate; and c3, a three-carbon alkyl blocking group). .. The ligated products were purified on denaturing (7 M urea) 8% acrylamide gels and amplified by using primers specific for either C.E1 or C.E2 (for C.E1, P5.E1 CGTTATGGA A ATCGGACAGGC and P3.E1 ATCGTGCTGTCTACGTCTCAG; for C.E2, P5.E2 CGTACTACTAGCATCGTTATGG and P3.E2 TGAGTGACTCGTTGTAGC).

Article Title: A Novel Partitivirus in the Hypovirulent Isolate QT5-19 of the Plant Pathogenic Fungus Botrytis cinerea
Article Snippet: .. The pure dsRNAs were ligated with the adaptor 110a ( ) at the 3′-terminus using T4 RNA ligase (Promega, Madison, WI, USA) at 16 °C for 12 h. The adaptor-ligated dsRNAs were purified using AxyPrepTM PCR cleanup kit (Axygen Scientific Inc., Union City, CA, USA). ..

Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation
Article Snippet: .. The results for the 3′-end indicated that the two purified bands (B2.1) and (B2.2) were labeled with the T4 RNA ligase without phosphatase pretreatment with a yield of 33.9% and 21.5% of the previously treated sample, respectively, thus indicating that both B2.1 and B2.2 contained products with 3′-P and, to a lesser degree, 3′-OH. .. Mass spectrometry A synthetic oligonucleotide corresponding to positions 68–100 of HCV RNA was employed. show the base peak chromatograms of HCV RNA 68–100 before and after irradiation with UV-C light or of bands B1 and B2 after purification by electrophoresis.

Immunoprecipitation:

Article Title: Human Box H/ACA Pseudouridylation Guide RNA Machinery †
Article Snippet: .. About 0.3 μg of RNA recovered by immunoprecipitation with the anti-hGAR1 antibody was mixed with 40 pmol of 5′-end-phosphorylated oligoribonucleotide (pAAUAAAGCGGCCGCGGAUCCAA) and incubated with 15 U of T4 RNA ligase (Promega) and 10 U of RNase inhibitor (Promega) as described previously ( ). .. After phenol-chloroform extraction, the ligation products were recovered by ethanol precipitation, annealed with 40 pmol of oligodeoxynucleotide P1 (TTGGATCCGCGGCCGCTTTAT), and used as a template for cDNA synthesis with avian myeloblastosis virus reverse transcriptase (Promega).

Incubation:

Article Title: Human Box H/ACA Pseudouridylation Guide RNA Machinery †
Article Snippet: .. About 0.3 μg of RNA recovered by immunoprecipitation with the anti-hGAR1 antibody was mixed with 40 pmol of 5′-end-phosphorylated oligoribonucleotide (pAAUAAAGCGGCCGCGGAUCCAA) and incubated with 15 U of T4 RNA ligase (Promega) and 10 U of RNase inhibitor (Promega) as described previously ( ). .. After phenol-chloroform extraction, the ligation products were recovered by ethanol precipitation, annealed with 40 pmol of oligodeoxynucleotide P1 (TTGGATCCGCGGCCGCTTTAT), and used as a template for cDNA synthesis with avian myeloblastosis virus reverse transcriptase (Promega).

Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation
Article Snippet: .. RNA ligase was used to treat cleavage product bands, either previously phosphatase treated or not, as follows: RNAs were incubated at 4°C for 4 days in a buffer containing 10 mM MgCl2 , 50 mM HEPES, pH 8.3, 5 mM DTT, 0.12 mM ATP, 4 U of T4 RNA ligase (Promega) and [5′-32 P]pCp (Perkin-Elmer) ( , ). .. Poly (A) polymerase (NEB) and Poly (U) polymerase (NEB) reaction was performed in the buffer provided by NEB and recommended conditions in the presence of [α-32 P]ATP or [α-32 P]UTP.

other:

Article Title: Deep sequencing and genome-wide analysis reveals the expansion of MicroRNA genes in the gall midge Mayetiola destructor
Article Snippet: Then an oligonucleotide adapter was added to the 3′ end of sample (3′ OH containing) RNA sequences using T4 RNA ligase.

Article Title: Human Box H/ACA Pseudouridylation Guide RNA Machinery †
Article Snippet: To facilitate the synthesis of full-length cDNAs, the 5′ and 3′ termini of the immunoselected box H/ACA RNAs were extended by the addition of a phosphorylated oligoribonucleotide with the help of T4 RNA ligase (Fig. ).

Labeling:

Article Title: Human Box H/ACA Pseudouridylation Guide RNA Machinery †
Article Snippet: .. Specific labeling of 3′ termini of RNA with T4 RNA ligase. ..

Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation
Article Snippet: .. The results for the 3′-end indicated that the two purified bands (B2.1) and (B2.2) were labeled with the T4 RNA ligase without phosphatase pretreatment with a yield of 33.9% and 21.5% of the previously treated sample, respectively, thus indicating that both B2.1 and B2.2 contained products with 3′-P and, to a lesser degree, 3′-OH. .. Mass spectrometry A synthetic oligonucleotide corresponding to positions 68–100 of HCV RNA was employed. show the base peak chromatograms of HCV RNA 68–100 before and after irradiation with UV-C light or of bands B1 and B2 after purification by electrophoresis.

Polymerase Chain Reaction:

Article Title: A Novel Partitivirus in the Hypovirulent Isolate QT5-19 of the Plant Pathogenic Fungus Botrytis cinerea
Article Snippet: .. The pure dsRNAs were ligated with the adaptor 110a ( ) at the 3′-terminus using T4 RNA ligase (Promega, Madison, WI, USA) at 16 °C for 12 h. The adaptor-ligated dsRNAs were purified using AxyPrepTM PCR cleanup kit (Axygen Scientific Inc., Union City, CA, USA). ..

Binding Assay:

Article Title: Exponential growth by cross-catalytic cleavage of deoxyribozymogens
Article Snippet: .. Primer binding sites were ligated to the 3′ or 5′ end of a portion of the purified, radiolabeled pool by using T4 RNA ligase (L3, p- UUU CTGAGACGTAGACAGCACGAT-c3; L5, TCGTACTACTAGCATCGTTATGG AAA ; the underlined residues are RNA; p, a 5′ phosphate; and c3, a three-carbon alkyl blocking group). .. The ligated products were purified on denaturing (7 M urea) 8% acrylamide gels and amplified by using primers specific for either C.E1 or C.E2 (for C.E1, P5.E1 CGTTATGGA A ATCGGACAGGC and P3.E1 ATCGTGCTGTCTACGTCTCAG; for C.E2, P5.E2 CGTACTACTAGCATCGTTATGG and P3.E2 TGAGTGACTCGTTGTAGC).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Promega t4 rna ligase
    Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) <t>T4</t> RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5 dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with E. coli poly (A) polymerase or Schizosaccharomyces pombe poly (U) polymerase.A total of 4000 dpm RNA (10 5 dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.
    T4 Rna Ligase, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase/product/Promega
    Average 93 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase - by Bioz Stars, 2020-05
    93/100 stars
      Buy from Supplier

    Image Search Results


    Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) T4 RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5 dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with E. coli poly (A) polymerase or Schizosaccharomyces pombe poly (U) polymerase.A total of 4000 dpm RNA (10 5 dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.

    Journal: Nucleic Acids Research

    Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation

    doi: 10.1093/nar/gkr822

    Figure Lengend Snippet: Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) T4 RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5 dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with E. coli poly (A) polymerase or Schizosaccharomyces pombe poly (U) polymerase.A total of 4000 dpm RNA (10 5 dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.

    Article Snippet: RNA ligase was used to treat cleavage product bands, either previously phosphatase treated or not, as follows: RNAs were incubated at 4°C for 4 days in a buffer containing 10 mM MgCl2 , 50 mM HEPES, pH 8.3, 5 mM DTT, 0.12 mM ATP, 4 U of T4 RNA ligase (Promega) and [5′-32 P]pCp (Perkin-Elmer) ( , ).

    Techniques: Produced, Purification, Incubation, De-Phosphorylation Assay, Labeling, Molecular Weight, Marker

    Characterization of UV-C cleavage of viral RNAs by fingerprinting and electrophoretic methods. ( a ) The RNA fingerprints of internally [α- 32 P] HCV (panels 1–3) and CSFV RNA (panels 4–6). Labeled SM, band B1 and band B2 were exhaustively digested with RNase T1 and the products subjected to 2D separation. ( 1 ) RNA fingerprint of HCV 1–249. A total of 500 000 dpm of HCV SM was fingerprinted. Spot 1: the HCV oligonucleotide 5′ 78 UCUAG 82 3′ within which cleavage takes place; Spot 2: this has the characteristic mobility of the 5′-terminal nucleotide 5′pppGp3′. ( 2 ) RNA fingerprint of HCV B1. A total of 300 000 dpm of RNA was fingerprinted as above. Spot 1 has disappeared, while the absence of the 5′-end (spot 2) shows that HCV B1 contains the 3′-portion of SM. ( 3 ) Fingerprint of HCV B2 (100 000 dpm). ‘1’ indicates the loss of spot 1, while the presence of the HCV 5′-end (‘2’) shows that HCV B2 contains the 5′-portion of SM. ( 4–6 ): RNA fingerprints of CSFV 1-218. SM (500 000 dpm), B1 (300 000 dpm) and B2 (100 000 dpm, transcribed with all four [α- 32 P]-labeled rNTPs. ‘1’: the CSFV oligonucleotide 5′ 38 AUACACUAAAUUUCG 52 3′, which is present in SM but absent from B1 and B2; ‘X’ (a new CSFV B1 oligonucleotide) and ‘Y’ (the other new CSFV oligonucleotide) arise from cleavage within spot 1 (see text) . ‘2’: the 5′-end of CSFV, present in SM and B2, but not B1. Numbering according to Wang et al. ( 62 ) for HCV genotype 1b and Gene Bank J04358 for CSFV Alfort Isolate. The sequence of the spot numbered as 1 was identified by secondary RNase analysis and high voltage electrophoresis on DEAE and Whatmann paper by Hugh D. Robertson (data not available), as well as by superposition with previously resolved HCV fingerprints using secondary analysis and on the basis of the rules for RNA oligonucleotide mobility during 2D TLC. Briefly, these rules are: the larger the oligonucleotide, the slower the migration of the corresponding spot to the bottom. As far as composition is concerned, Us displace the spot to the left, Cs to the right, and As cause a slight delay, thus meaning that several As in the same oligo may cause it to behave as an oligo containing one or even two additional bases ( 37 ). As far as sequence is concerned, as HCV RNA was transcribed in the presence of [α- 32 P]GTP here, those T1 oligonucleotides in the original sequence that are followed by a (pG) carry a double label. In the case of HCV RNA several RNase T1 oligonucelotides are indicated as mobility reference: a: UCCUUUCUUGp(G); b: UCUUCAGp(C) 61:68; c: CUCAAUGp(G) 211–217; d: AUUUGp(G) 225–229. Spot 1 locates in the border of the triangle that can be formed by spots i, f and g. In CSFV, spot 1 is the slow migrating spot, and thus corresponded to the largest RNase T1 oligonucleotide. In both HCV and CSFV, band B2 contains the original 5′-terminal nucleotide, pppGp, of the substrate RNA transcript (indicated by ‘2’). The disappearance of spot 1 from both product band fingerprints (see Figure 1 a, images 2, 3 and images 5, 6) suggests that self-cleavage occurs within this oligonucleotide and that this event is specific. Moreover, in the case of CSFV RNA two smaller oligomers (X and Y) that represent the fragment products of spot 1 are observed within the fingerprints of both product bands (B1 and B2) for CSFV. Indicated at the bottom is the sequence surrounding RNase T1 cleavage sites. ( b ) Electrophoresis analysis: Autoradiogram showing a parallel run of HCV RNA 1–130 and CSFV RNA 1–218 UV-cleavage reaction, with RNase T1 treated samples and control reactions for transcripts labeled at either the 5′-extreme with [γ- 32 P]GTP during transcription or the 3′-extreme with [5′- 32 P]pCp and T4 RNA ligase. HCV (lanes 1–6) and CSFV (lanes 1–9). HCV: Lanes 1 and 1′: RNAs incubated in standard buffer; lanes 2 and 2′: RNAs treated with RNase T1 under denaturing conditions; lanes 3 and 3′: RNA irradiated with UV-C light for 180 s. CSFV: Lanes 1 and 1′: RNAs incubated under standard conditions; lanes 2, 3 and 4′: RNA treated with RNase T1; lanes 4 and 3′: RNA irradiated with UV-C light: Lanes 5 and 2′ RNAs partially degraded with alkali. ‘G’ positions of a relevant size are indicated on either side of the gels. Lines indicate SM, and products B1 and B2.

    Journal: Nucleic Acids Research

    Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation

    doi: 10.1093/nar/gkr822

    Figure Lengend Snippet: Characterization of UV-C cleavage of viral RNAs by fingerprinting and electrophoretic methods. ( a ) The RNA fingerprints of internally [α- 32 P] HCV (panels 1–3) and CSFV RNA (panels 4–6). Labeled SM, band B1 and band B2 were exhaustively digested with RNase T1 and the products subjected to 2D separation. ( 1 ) RNA fingerprint of HCV 1–249. A total of 500 000 dpm of HCV SM was fingerprinted. Spot 1: the HCV oligonucleotide 5′ 78 UCUAG 82 3′ within which cleavage takes place; Spot 2: this has the characteristic mobility of the 5′-terminal nucleotide 5′pppGp3′. ( 2 ) RNA fingerprint of HCV B1. A total of 300 000 dpm of RNA was fingerprinted as above. Spot 1 has disappeared, while the absence of the 5′-end (spot 2) shows that HCV B1 contains the 3′-portion of SM. ( 3 ) Fingerprint of HCV B2 (100 000 dpm). ‘1’ indicates the loss of spot 1, while the presence of the HCV 5′-end (‘2’) shows that HCV B2 contains the 5′-portion of SM. ( 4–6 ): RNA fingerprints of CSFV 1-218. SM (500 000 dpm), B1 (300 000 dpm) and B2 (100 000 dpm, transcribed with all four [α- 32 P]-labeled rNTPs. ‘1’: the CSFV oligonucleotide 5′ 38 AUACACUAAAUUUCG 52 3′, which is present in SM but absent from B1 and B2; ‘X’ (a new CSFV B1 oligonucleotide) and ‘Y’ (the other new CSFV oligonucleotide) arise from cleavage within spot 1 (see text) . ‘2’: the 5′-end of CSFV, present in SM and B2, but not B1. Numbering according to Wang et al. ( 62 ) for HCV genotype 1b and Gene Bank J04358 for CSFV Alfort Isolate. The sequence of the spot numbered as 1 was identified by secondary RNase analysis and high voltage electrophoresis on DEAE and Whatmann paper by Hugh D. Robertson (data not available), as well as by superposition with previously resolved HCV fingerprints using secondary analysis and on the basis of the rules for RNA oligonucleotide mobility during 2D TLC. Briefly, these rules are: the larger the oligonucleotide, the slower the migration of the corresponding spot to the bottom. As far as composition is concerned, Us displace the spot to the left, Cs to the right, and As cause a slight delay, thus meaning that several As in the same oligo may cause it to behave as an oligo containing one or even two additional bases ( 37 ). As far as sequence is concerned, as HCV RNA was transcribed in the presence of [α- 32 P]GTP here, those T1 oligonucleotides in the original sequence that are followed by a (pG) carry a double label. In the case of HCV RNA several RNase T1 oligonucelotides are indicated as mobility reference: a: UCCUUUCUUGp(G); b: UCUUCAGp(C) 61:68; c: CUCAAUGp(G) 211–217; d: AUUUGp(G) 225–229. Spot 1 locates in the border of the triangle that can be formed by spots i, f and g. In CSFV, spot 1 is the slow migrating spot, and thus corresponded to the largest RNase T1 oligonucleotide. In both HCV and CSFV, band B2 contains the original 5′-terminal nucleotide, pppGp, of the substrate RNA transcript (indicated by ‘2’). The disappearance of spot 1 from both product band fingerprints (see Figure 1 a, images 2, 3 and images 5, 6) suggests that self-cleavage occurs within this oligonucleotide and that this event is specific. Moreover, in the case of CSFV RNA two smaller oligomers (X and Y) that represent the fragment products of spot 1 are observed within the fingerprints of both product bands (B1 and B2) for CSFV. Indicated at the bottom is the sequence surrounding RNase T1 cleavage sites. ( b ) Electrophoresis analysis: Autoradiogram showing a parallel run of HCV RNA 1–130 and CSFV RNA 1–218 UV-cleavage reaction, with RNase T1 treated samples and control reactions for transcripts labeled at either the 5′-extreme with [γ- 32 P]GTP during transcription or the 3′-extreme with [5′- 32 P]pCp and T4 RNA ligase. HCV (lanes 1–6) and CSFV (lanes 1–9). HCV: Lanes 1 and 1′: RNAs incubated in standard buffer; lanes 2 and 2′: RNAs treated with RNase T1 under denaturing conditions; lanes 3 and 3′: RNA irradiated with UV-C light for 180 s. CSFV: Lanes 1 and 1′: RNAs incubated under standard conditions; lanes 2, 3 and 4′: RNA treated with RNase T1; lanes 4 and 3′: RNA irradiated with UV-C light: Lanes 5 and 2′ RNAs partially degraded with alkali. ‘G’ positions of a relevant size are indicated on either side of the gels. Lines indicate SM, and products B1 and B2.

    Article Snippet: RNA ligase was used to treat cleavage product bands, either previously phosphatase treated or not, as follows: RNAs were incubated at 4°C for 4 days in a buffer containing 10 mM MgCl2 , 50 mM HEPES, pH 8.3, 5 mM DTT, 0.12 mM ATP, 4 U of T4 RNA ligase (Promega) and [5′-32 P]pCp (Perkin-Elmer) ( , ).

    Techniques: Labeling, Sequencing, Electrophoresis, Thin Layer Chromatography, Migration, Incubation, Irradiation

    Enzymatic determination of the new 5′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) Phosphatase-dependent 5′-terminal labeling of both HCV RNA 1–130 cleavage product (B1) (left panel) and CSFV RNA 1–218 cleavage product (B1) (right panel) by polynucleotide kinase. Aliquots (10 000 dpm) of product bands (10 5 dpm/µg) were treated with polynucleotide kinase and [γ- 32 P]ATP, after treatment with Artic Phosphatase (lane 2) or without phosphatase pre-treatment (lane 1). ( b ) Cyclization of HCV (left panel) and CSFV (right panel) RNA product bands B1 by T4 RNA ligase [with 10 000 dpm (10 5 dpm/µg) RNA]. Lanes 1: HCV and CSFV B1 bands incubated without T4 RNA ligase; lanes 2: complete reaction (cyclized RNA: upper band). ( c ) Phosphatase treatment of singly labeled CSFV. Calf alkaline phosphatase was used to treat CSFV band B1 aliquots (50 000 dpm of 107 dpm/µg), followed by high-voltage electrophoresis at pH 1.9 on Whatman DE81 DEAE paper ( 16 ). B1 RNA is at the bottom and free phosphate at the top. ‘U’, ‘A’, ‘C’ and ‘G’ indicate RNAs labeled with [α- 32 P]UTP, ATP, CTP or GTP, respectively, whereas ‘αGTP’ indicates a control containing 1000 dpm of pure [α- 32 P]GTP.

    Journal: Nucleic Acids Research

    Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation

    doi: 10.1093/nar/gkr822

    Figure Lengend Snippet: Enzymatic determination of the new 5′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) Phosphatase-dependent 5′-terminal labeling of both HCV RNA 1–130 cleavage product (B1) (left panel) and CSFV RNA 1–218 cleavage product (B1) (right panel) by polynucleotide kinase. Aliquots (10 000 dpm) of product bands (10 5 dpm/µg) were treated with polynucleotide kinase and [γ- 32 P]ATP, after treatment with Artic Phosphatase (lane 2) or without phosphatase pre-treatment (lane 1). ( b ) Cyclization of HCV (left panel) and CSFV (right panel) RNA product bands B1 by T4 RNA ligase [with 10 000 dpm (10 5 dpm/µg) RNA]. Lanes 1: HCV and CSFV B1 bands incubated without T4 RNA ligase; lanes 2: complete reaction (cyclized RNA: upper band). ( c ) Phosphatase treatment of singly labeled CSFV. Calf alkaline phosphatase was used to treat CSFV band B1 aliquots (50 000 dpm of 107 dpm/µg), followed by high-voltage electrophoresis at pH 1.9 on Whatman DE81 DEAE paper ( 16 ). B1 RNA is at the bottom and free phosphate at the top. ‘U’, ‘A’, ‘C’ and ‘G’ indicate RNAs labeled with [α- 32 P]UTP, ATP, CTP or GTP, respectively, whereas ‘αGTP’ indicates a control containing 1000 dpm of pure [α- 32 P]GTP.

    Article Snippet: RNA ligase was used to treat cleavage product bands, either previously phosphatase treated or not, as follows: RNAs were incubated at 4°C for 4 days in a buffer containing 10 mM MgCl2 , 50 mM HEPES, pH 8.3, 5 mM DTT, 0.12 mM ATP, 4 U of T4 RNA ligase (Promega) and [5′-32 P]pCp (Perkin-Elmer) ( , ).

    Techniques: Produced, Labeling, Incubation, Electrophoresis

    Schematic structure of box H/ACA RNAs and cDNA construction. (A) Selection of pseudouridylation sites by box H/ACA guide RNAs. For details, see the text. (B) Construction of a cDNA library of human box H/ACA RNAs. HeLa cell RNAs immunoprecipitated by an anti-GAR1 antibody were incubated with a phosphorylated oligoribonucleotide in the presence of T4 RNA ligase. RNA sequences tagged at both termini were converted into double-stranded DNA by a reverse transcription-PCR amplification approach. The amplified DNA was cloned into a plasmid vector, and individual clones were characterized by sequence analysis.

    Journal: Molecular and Cellular Biology

    Article Title: Human Box H/ACA Pseudouridylation Guide RNA Machinery †

    doi: 10.1128/MCB.24.13.5797-5807.2004

    Figure Lengend Snippet: Schematic structure of box H/ACA RNAs and cDNA construction. (A) Selection of pseudouridylation sites by box H/ACA guide RNAs. For details, see the text. (B) Construction of a cDNA library of human box H/ACA RNAs. HeLa cell RNAs immunoprecipitated by an anti-GAR1 antibody were incubated with a phosphorylated oligoribonucleotide in the presence of T4 RNA ligase. RNA sequences tagged at both termini were converted into double-stranded DNA by a reverse transcription-PCR amplification approach. The amplified DNA was cloned into a plasmid vector, and individual clones were characterized by sequence analysis.

    Article Snippet: About 0.3 μg of RNA recovered by immunoprecipitation with the anti-hGAR1 antibody was mixed with 40 pmol of 5′-end-phosphorylated oligoribonucleotide (pAAUAAAGCGGCCGCGGAUCCAA) and incubated with 15 U of T4 RNA ligase (Promega) and 10 U of RNase inhibitor (Promega) as described previously ( ).

    Techniques: Selection, cDNA Library Assay, Immunoprecipitation, Incubation, Polymerase Chain Reaction, Amplification, Clone Assay, Plasmid Preparation, Sequencing