Structured Review

Promega t4 rna ligase
T4 Rna Ligase, supplied by Promega, used in various techniques. Bioz Stars score: 94/100, based on 48 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 rna ligase/product/Promega
Average 94 stars, based on 48 article reviews
Price from $9.99 to $1999.99
t4 rna ligase - by Bioz Stars, 2020-01
94/100 stars

Images

Related Articles

Clone Assay:

Article Title: Complete Genome Sequence of Ikoma Lyssavirus
Article Snippet: Briefly, genomic RNA was subjected to ligation by T4 RNA ligase (Promega, Madison, WI) using the manufacturer's instructions. .. Amplicons were cloned using standard techniques and sequenced.

Article Title: Defective RNA of a Novel Mycovirus with High Transmissibility Detrimental to Biocontrol Properties of Trichoderma spp.
Article Snippet: .. The terminal sequences of the two dsRNAs were cloned through ligating the 3′-terminus for each strand of the two dsRNAs with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road Madison, WI 53711 USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ) according to our previous methods [ , ]. .. The cDNA strand was then used as a template for PCR-amplifying the 5′- and 3′-terminal sequence with the primer pairs RC110A/5SP and RC110A/3SP, respectively ( ).

Article Title: Two Novel Hypovirulence-Associated Mycoviruses in the Phytopathogenic Fungus Botrytis cinerea: Molecular Characterization and Suppression of Infection Cushion Formation
Article Snippet: .. The terminal sequences of each dsRNA were cloned through ligating the 3′-terminus for each strand of each dsRNA with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road, Madison, WI, USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ). .. The cDNA strands were then used as template for PCR amplification of the 5′- and 3′-terminal sequences with primer RC110A and corresponding sequence specific primer for each dsRNA segment ( ).

Article Title: Hypertension-associated mitochondrial DNA 4401A > G mutation caused the aberrant processing of tRNAMet, all 8 tRNAs and ND6 mRNA in the light-strand transcript
Article Snippet: Sequencing of 5′- and 3′-end proximal segments of tRNAMet and tRNAGln The 5′ and 3′ ends of tRNAMet and tRNAGln from the control cell line C19 and mutant cell line III-3 were sequenced after cDNA synthesis, PCR amplification, and cloning, as detailed elsewhere ( ). .. First, total mitochondrial tRNA was circularized by incubation in the presence of T4 RNA ligase (Promega) to ligate the 3′ and 5′ ends of tRNAs.

Amplification:

Article Title: Defective RNA of a Novel Mycovirus with High Transmissibility Detrimental to Biocontrol Properties of Trichoderma spp.
Article Snippet: The terminal sequences of the two dsRNAs were cloned through ligating the 3′-terminus for each strand of the two dsRNAs with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road Madison, WI 53711 USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ) according to our previous methods [ , ]. .. Three gaps among the cDNA contigs of 10.0 kb-dsRNA were amplified with primer pairs G1F/G1R, G2F/G2R, and G3F/G3R by reverse transcription (RT)-PCR.

Article Title: Two Novel Hypovirulence-Associated Mycoviruses in the Phytopathogenic Fungus Botrytis cinerea: Molecular Characterization and Suppression of Infection Cushion Formation
Article Snippet: The cDNA library of each dsRNA (dsRNA-A2, dsRNA-B, dsRNA-C, dsRNA-D and dsRNA-E) was produced using a random primer-mediated PCR amplification protocol [ ] and sequenced as previously described [ ]. .. The terminal sequences of each dsRNA were cloned through ligating the 3′-terminus for each strand of each dsRNA with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road, Madison, WI, USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ).

Article Title: Cedar Virus: A Novel Henipavirus Isolated from Australian Bats
Article Snippet: Briefly, approximately 100 ng of RNA was ligated with adaptor DT88 (see reference for sequence information) using T4 RNA ligase (Promega) followed by cDNA synthesis using the SuperScript III RT kit (Invitrogen) and an adaptor-specific primer, DT89. .. PCR amplification was then carried out using DT89 and one or more genome-specific primers.

Article Title: Complete Genome Characterization of Recent and Ancient Belgian Pig Group A Rotaviruses and Assessment of Their Evolutionary Relationship with Human Rotaviruses
Article Snippet: The 5′- and 3′-terminal sequences were obtained using a modified version of the single-primer amplification method ( ). .. Briefly, a modified amino-linked oligonucleotide (TGP-Linker; 5′-PO4 -TTCCTTATGCAGCTGATCACTCTGTGTCA-spacer-NH2 -3′) was linked to the 3′ end of both strands of denatured RNA by using T4 RNA ligase (Promega, Leiden, The Netherlands).

Article Title: Effect of young exosomes injected in aged mice
Article Snippet: The total RNA sample ligated RNA 3′ and 5′ adapter with T4 RNA ligase (Promega, Madison, WI, USA) in the ATP-free buffer. .. The cDNAs were amplified in 11 cycles of PCR, using Illumina’s Primer Set.

Article Title: Novel, Potentially Zoonotic Paramyxoviruses from the African Straw-Colored Fruit Bat Eidolon helvum
Article Snippet: Briefly, 5 ng of viral genomic RNA was incubated at 37°C for 1 h in RNA ligase buffer with 20 U of T4 RNA ligase (Promega). .. Primers for nested PCR amplification were designed ∼200 nucleotides (nt) (FWD1/REV1) and ∼150 nt (FWD2/REV2) from the 3′ (reverse complement) and 5′ (complement) ends, respectively (sequences are available on request).

Article Title: Hypertension-associated mitochondrial DNA 4401A > G mutation caused the aberrant processing of tRNAMet, all 8 tRNAs and ND6 mRNA in the light-strand transcript
Article Snippet: Sequencing of 5′- and 3′-end proximal segments of tRNAMet and tRNAGln The 5′ and 3′ ends of tRNAMet and tRNAGln from the control cell line C19 and mutant cell line III-3 were sequenced after cDNA synthesis, PCR amplification, and cloning, as detailed elsewhere ( ). .. First, total mitochondrial tRNA was circularized by incubation in the presence of T4 RNA ligase (Promega) to ligate the 3′ and 5′ ends of tRNAs.

High Throughput Screening Assay:

Article Title: Effect of young exosomes injected in aged mice
Article Snippet: Screening of aging-associated miRNAs in exosomes For high-throughput screening of DERs in exosomes of aged mice, next-generation sequencing (NGS) was performed with small RNAs isolated from the exosomes of 3-, 8-, and 12-month-old mice (n=3). .. The total RNA sample ligated RNA 3′ and 5′ adapter with T4 RNA ligase (Promega, Madison, WI, USA) in the ATP-free buffer.

Synthesized:

Article Title: Hypertension-associated mitochondrial DNA 4401A > G mutation caused the aberrant processing of tRNAMet, all 8 tRNAs and ND6 mRNA in the light-strand transcript
Article Snippet: First, total mitochondrial tRNA was circularized by incubation in the presence of T4 RNA ligase (Promega) to ligate the 3′ and 5′ ends of tRNAs. .. Then, complementary DNA chains of tRNAMet and tRNAGln were synthesized using reverse transcriptase after annealing the circular tRNA to the specific oligodeoxynucleotides MET1 (5′-TATGGGCCCGATAGCTTATTTAGCT-3′) and GLN1 (5′CAAAATTCTCCGTGCCACCTATCA-3′), respectively.

cDNA Library Assay:

Article Title: Defective RNA of a Novel Mycovirus with High Transmissibility Detrimental to Biocontrol Properties of Trichoderma spp.
Article Snippet: The cDNA library of the 10.0 kb-dsRNA was established through random primer-mediated PCR [ ] and sequenced as previously described [ ]. .. The terminal sequences of the two dsRNAs were cloned through ligating the 3′-terminus for each strand of the two dsRNAs with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road Madison, WI 53711 USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ) according to our previous methods [ , ].

Article Title: Two Novel Hypovirulence-Associated Mycoviruses in the Phytopathogenic Fungus Botrytis cinerea: Molecular Characterization and Suppression of Infection Cushion Formation
Article Snippet: The cDNA library of each dsRNA (dsRNA-A2, dsRNA-B, dsRNA-C, dsRNA-D and dsRNA-E) was produced using a random primer-mediated PCR amplification protocol [ ] and sequenced as previously described [ ]. .. The terminal sequences of each dsRNA were cloned through ligating the 3′-terminus for each strand of each dsRNA with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road, Madison, WI, USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ).

Incubation:

Article Title: Complete characterization of the edited transcriptome of the mitochondrion of Physarum polycephalum using deep sequencing of RNA
Article Snippet: .. tRNA circularization products A quantity of 10 μg total mitochondrial RNA was heated to 90°C for 5 min, cooled on ice and then incubated overnight at 37°C in 50 mM HEPES (pH 7.5)/15 mM MgCl2 /3.3 mM DTT/10% DMSO/0.01 μg/μl BSA/80 μM ATP in the presence of 15 U of T4 RNA ligase (Promega) in 20 μl. ..

Article Title: Novel, Potentially Zoonotic Paramyxoviruses from the African Straw-Colored Fruit Bat Eidolon helvum
Article Snippet: .. Briefly, 5 ng of viral genomic RNA was incubated at 37°C for 1 h in RNA ligase buffer with 20 U of T4 RNA ligase (Promega). .. Primers for nested PCR amplification were designed ∼200 nucleotides (nt) (FWD1/REV1) and ∼150 nt (FWD2/REV2) from the 3′ (reverse complement) and 5′ (complement) ends, respectively (sequences are available on request).

Article Title: Hypertension-associated mitochondrial DNA 4401A > G mutation caused the aberrant processing of tRNAMet, all 8 tRNAs and ND6 mRNA in the light-strand transcript
Article Snippet: .. First, total mitochondrial tRNA was circularized by incubation in the presence of T4 RNA ligase (Promega) to ligate the 3′ and 5′ ends of tRNAs. .. Then, complementary DNA chains of tRNAMet and tRNAGln were synthesized using reverse transcriptase after annealing the circular tRNA to the specific oligodeoxynucleotides MET1 (5′-TATGGGCCCGATAGCTTATTTAGCT-3′) and GLN1 (5′CAAAATTCTCCGTGCCACCTATCA-3′), respectively.

Expressing:

Article Title: Oncogenic B-Raf signaling in melanoma cells controls a network of microRNAs with combinatorial functions
Article Snippet: MicroRNAs were quantified using the Thermo Scientific Dharmacon microRNA expression profiling platform, which uses two-color high-density eight-plexed slides containing probes to 470 mature human miRNAs. .. Total RNA (500 ng) was combined with spike-in control to monitor labeling efficiency, then fluorescence dye-labeled with pCp-Cy5 using T4 RNA ligase (Promega).

Modification:

Article Title: Complete Genome Characterization of Recent and Ancient Belgian Pig Group A Rotaviruses and Assessment of Their Evolutionary Relationship with Human Rotaviruses
Article Snippet: .. Briefly, a modified amino-linked oligonucleotide (TGP-Linker; 5′-PO4 -TTCCTTATGCAGCTGATCACTCTGTGTCA-spacer-NH2 -3′) was linked to the 3′ end of both strands of denatured RNA by using T4 RNA ligase (Promega, Leiden, The Netherlands). .. Next, RT-PCR was performed using an internal gene-specific primer and primer TGP-3Out.

Derivative Assay:

Article Title: Cedar Virus: A Novel Henipavirus Isolated from Australian Bats
Article Snippet: To obtain an accurate CedPV genome sequence, 454 generated data (after removing low quality, ambiguous and adapter sequences) was analysed by both de novo assembly and read mapping of raw reads onto the CedPV draft genome sequence derived from Sanger sequencing. .. Briefly, approximately 100 ng of RNA was ligated with adaptor DT88 (see reference for sequence information) using T4 RNA ligase (Promega) followed by cDNA synthesis using the SuperScript III RT kit (Invitrogen) and an adaptor-specific primer, DT89.

Hybridization:

Article Title: Oncogenic B-Raf signaling in melanoma cells controls a network of microRNAs with combinatorial functions
Article Snippet: Total RNA (500 ng) was combined with spike-in control to monitor labeling efficiency, then fluorescence dye-labeled with pCp-Cy5 using T4 RNA ligase (Promega). .. The miRIDIAN Synthetic miRNA Reference Probe Set (Thermo Fisher Scientific), 2 × HI-RPM hybridization buffer (Agilent, Palo Alto, CA, USA) and 25 × fragmentation buffer were added to each sample and hybridized to eight 15 K custom miRNA microarrays (miRBase 9.0, probes in triplicate) (Agilent).

Ligation:

Article Title: Complete Genome Sequence of Ikoma Lyssavirus
Article Snippet: .. Briefly, genomic RNA was subjected to ligation by T4 RNA ligase (Promega, Madison, WI) using the manufacturer's instructions. .. The ligated RNA was subjected to nested PCR using primers located in the 5′ end of the L gene and 3′ end of the N gene.

Article Title: Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants A Viral Satellite RNA Induces Yellow Symptoms on Tobacco by Targeting a Gene Involved in Chlorophyll Biosynthesis using the RNA Silencing Machinery
Article Snippet: 5′ RACE Total RNA (2 µg) was ligated to a 24-nt RNA adaptor ( 5′ AACAGACGCGUGGUUACAGUCUUG 3′ ) using T4 RNA ligase (Promega) at room temperature for 2 hours in 50 mM HEPES pH 7.5, 0.1 mg/mL BSA, 8% glycerol, 2 units/µL RNasein RNase inhibitor (Promega) and 0.5 unit/µL T4 RNA ligase (Promega). .. The ligation was purified by phenol-chloroform extraction and ethanol precipitation.

Article Title: Novel, Potentially Zoonotic Paramyxoviruses from the African Straw-Colored Fruit Bat Eidolon helvum
Article Snippet: Paragraph title: (iii) Sequencing of genomic ends through end-to-end ligation of viral ends. ... Briefly, 5 ng of viral genomic RNA was incubated at 37°C for 1 h in RNA ligase buffer with 20 U of T4 RNA ligase (Promega).

Generated:

Article Title: Deep sequencing and genome-wide analysis reveals the expansion of MicroRNA genes in the gall midge Mayetiola destructor
Article Snippet: Small-RNA library construction A small-RNA library was generated according to Illumina’s sample preparation instructions (Illumina, San Diego, CA). .. Specifically, the SRA 5′ adapter was ligated to 50 ng of the aforementioned RNA fragments with T4 RNA ligase (Promega, Fitchburg, WI).

Article Title: Cedar Virus: A Novel Henipavirus Isolated from Australian Bats
Article Snippet: For 454 read mapping, SNPs and DIPs generated with the CLC software were manually assessed for accuracy by visualising the mapped raw reads (random PCR errors are obvious compared to real SNPs and DIPs especially when read coverage is deep). .. Briefly, approximately 100 ng of RNA was ligated with adaptor DT88 (see reference for sequence information) using T4 RNA ligase (Promega) followed by cDNA synthesis using the SuperScript III RT kit (Invitrogen) and an adaptor-specific primer, DT89.

Article Title: Oncogenic B-Raf signaling in melanoma cells controls a network of microRNAs with combinatorial functions
Article Snippet: Biological replicates were generated from different cell passages, each ⩾2 passages removed. .. Total RNA (500 ng) was combined with spike-in control to monitor labeling efficiency, then fluorescence dye-labeled with pCp-Cy5 using T4 RNA ligase (Promega).

Polymerase Chain Reaction:

Article Title: Defective RNA of a Novel Mycovirus with High Transmissibility Detrimental to Biocontrol Properties of Trichoderma spp.
Article Snippet: The cDNA library of the 10.0 kb-dsRNA was established through random primer-mediated PCR [ ] and sequenced as previously described [ ]. .. The terminal sequences of the two dsRNAs were cloned through ligating the 3′-terminus for each strand of the two dsRNAs with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road Madison, WI 53711 USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ) according to our previous methods [ , ].

Article Title: Two Novel Hypovirulence-Associated Mycoviruses in the Phytopathogenic Fungus Botrytis cinerea: Molecular Characterization and Suppression of Infection Cushion Formation
Article Snippet: The cDNA library of each dsRNA (dsRNA-A2, dsRNA-B, dsRNA-C, dsRNA-D and dsRNA-E) was produced using a random primer-mediated PCR amplification protocol [ ] and sequenced as previously described [ ]. .. The terminal sequences of each dsRNA were cloned through ligating the 3′-terminus for each strand of each dsRNA with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road, Madison, WI, USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ).

Article Title: Cedar Virus: A Novel Henipavirus Isolated from Australian Bats
Article Snippet: For 454 read mapping, SNPs and DIPs generated with the CLC software were manually assessed for accuracy by visualising the mapped raw reads (random PCR errors are obvious compared to real SNPs and DIPs especially when read coverage is deep). .. Briefly, approximately 100 ng of RNA was ligated with adaptor DT88 (see reference for sequence information) using T4 RNA ligase (Promega) followed by cDNA synthesis using the SuperScript III RT kit (Invitrogen) and an adaptor-specific primer, DT89.

Article Title: Complete Genome Characterization of Recent and Ancient Belgian Pig Group A Rotaviruses and Assessment of Their Evolutionary Relationship with Human Rotaviruses
Article Snippet: Five microliters of PCR-positive sample was treated with 1 μl of ExoSAP-IT For PCR Product Cleanup reagent (Affymetrix, Santa Clara, CA) and sequenced with an ABI Prism BigDye Terminator cycle sequencing reaction kit (ABI Prism 3130xl; Applied Biosystems), using forward and reverse primers. .. Briefly, a modified amino-linked oligonucleotide (TGP-Linker; 5′-PO4 -TTCCTTATGCAGCTGATCACTCTGTGTCA-spacer-NH2 -3′) was linked to the 3′ end of both strands of denatured RNA by using T4 RNA ligase (Promega, Leiden, The Netherlands).

Article Title: Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants A Viral Satellite RNA Induces Yellow Symptoms on Tobacco by Targeting a Gene Involved in Chlorophyll Biosynthesis using the RNA Silencing Machinery
Article Snippet: 5′ RACE Total RNA (2 µg) was ligated to a 24-nt RNA adaptor ( 5′ AACAGACGCGUGGUUACAGUCUUG 3′ ) using T4 RNA ligase (Promega) at room temperature for 2 hours in 50 mM HEPES pH 7.5, 0.1 mg/mL BSA, 8% glycerol, 2 units/µL RNasein RNase inhibitor (Promega) and 0.5 unit/µL T4 RNA ligase (Promega). .. Primary PCR was then performed using a forward primer matching the RNA adaptor ( 5′ AACAGACGCGTGGTTACAGTC 3′ ) and the CHLI reverse primer (as above).

Article Title: Novel, Potentially Zoonotic Paramyxoviruses from the African Straw-Colored Fruit Bat Eidolon helvum
Article Snippet: Briefly, 5 ng of viral genomic RNA was incubated at 37°C for 1 h in RNA ligase buffer with 20 U of T4 RNA ligase (Promega). .. Ligated RNA was reverse transcribed using the REV1 primer (Superscript III; Invitrogen), and nested PCR was performed (Expand High Fidelity PCR system; Roche) under the following conditions: 94°C for 2 min; 40 cycles of 94°C for 15 s, 49°C for 30 s, and 72°C for 1 min; and then 72°C for 5 min, hold 4°C.

Article Title: Hypertension-associated mitochondrial DNA 4401A > G mutation caused the aberrant processing of tRNAMet, all 8 tRNAs and ND6 mRNA in the light-strand transcript
Article Snippet: Sequencing of 5′- and 3′-end proximal segments of tRNAMet and tRNAGln The 5′ and 3′ ends of tRNAMet and tRNAGln from the control cell line C19 and mutant cell line III-3 were sequenced after cDNA synthesis, PCR amplification, and cloning, as detailed elsewhere ( ). .. First, total mitochondrial tRNA was circularized by incubation in the presence of T4 RNA ligase (Promega) to ligate the 3′ and 5′ ends of tRNAs.

Random Primed:

Article Title: Complete Genome Sequence of Ikoma Lyssavirus
Article Snippet: The RNA was fragmented, and two random-primed cDNA libraries were made and run concurrently using the Roche 454 GS FLX system. .. Briefly, genomic RNA was subjected to ligation by T4 RNA ligase (Promega, Madison, WI) using the manufacturer's instructions.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Defective RNA of a Novel Mycovirus with High Transmissibility Detrimental to Biocontrol Properties of Trichoderma spp.
Article Snippet: The terminal sequences of the two dsRNAs were cloned through ligating the 3′-terminus for each strand of the two dsRNAs with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road Madison, WI 53711 USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ) according to our previous methods [ , ]. .. Three gaps among the cDNA contigs of 10.0 kb-dsRNA were amplified with primer pairs G1F/G1R, G2F/G2R, and G3F/G3R by reverse transcription (RT)-PCR.

Article Title: Two Novel Hypovirulence-Associated Mycoviruses in the Phytopathogenic Fungus Botrytis cinerea: Molecular Characterization and Suppression of Infection Cushion Formation
Article Snippet: The terminal sequences of each dsRNA were cloned through ligating the 3′-terminus for each strand of each dsRNA with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road, Madison, WI, USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ). .. The gaps between the cDNA contigs among different dsRNAs were amplified by RT-PCR with sequence specific primer pairs ( ).

Article Title: Complete Genome Characterization of Recent and Ancient Belgian Pig Group A Rotaviruses and Assessment of Their Evolutionary Relationship with Human Rotaviruses
Article Snippet: Briefly, a modified amino-linked oligonucleotide (TGP-Linker; 5′-PO4 -TTCCTTATGCAGCTGATCACTCTGTGTCA-spacer-NH2 -3′) was linked to the 3′ end of both strands of denatured RNA by using T4 RNA ligase (Promega, Leiden, The Netherlands). .. Next, RT-PCR was performed using an internal gene-specific primer and primer TGP-3Out.

RNA Sequencing Assay:

Article Title: Effect of young exosomes injected in aged mice
Article Snippet: The isolated total RNA (50 ng) was processed for preparing a small RNA sequencing library using the TruSeq Small RNA Sample Preparation Kit (Illumina, San Diego, CA, USA) in accordance with the manufacturer’s instruction. .. The total RNA sample ligated RNA 3′ and 5′ adapter with T4 RNA ligase (Promega, Madison, WI, USA) in the ATP-free buffer.

Fluorescence:

Article Title: Oncogenic B-Raf signaling in melanoma cells controls a network of microRNAs with combinatorial functions
Article Snippet: .. Total RNA (500 ng) was combined with spike-in control to monitor labeling efficiency, then fluorescence dye-labeled with pCp-Cy5 using T4 RNA ligase (Promega). .. A control oligonucleotide was added to measure recovery, and the sample desalted through a P6 Biospin column (Bio-Rad, Hercules, CA, USA).

Mutagenesis:

Article Title: Hypertension-associated mitochondrial DNA 4401A > G mutation caused the aberrant processing of tRNAMet, all 8 tRNAs and ND6 mRNA in the light-strand transcript
Article Snippet: Sequencing of 5′- and 3′-end proximal segments of tRNAMet and tRNAGln The 5′ and 3′ ends of tRNAMet and tRNAGln from the control cell line C19 and mutant cell line III-3 were sequenced after cDNA synthesis, PCR amplification, and cloning, as detailed elsewhere ( ). .. First, total mitochondrial tRNA was circularized by incubation in the presence of T4 RNA ligase (Promega) to ligate the 3′ and 5′ ends of tRNAs.

Isolation:

Article Title: Effect of young exosomes injected in aged mice
Article Snippet: The isolated total RNA (50 ng) was processed for preparing a small RNA sequencing library using the TruSeq Small RNA Sample Preparation Kit (Illumina, San Diego, CA, USA) in accordance with the manufacturer’s instruction. .. The total RNA sample ligated RNA 3′ and 5′ adapter with T4 RNA ligase (Promega, Madison, WI, USA) in the ATP-free buffer.

Article Title: Genome-Wide Analysis of Small RNA and Novel MicroRNA Discovery in Human Acute Lymphoblastic Leukemia Based on Extensive Sequencing Approach
Article Snippet: Paragraph title: Total RNA isolation, small RNA library preparation, and nucleotide sequencing ... The small RNAs pools were then ligated sequentially to a 5′RNA adapter ( 5′-GUUCAGAGUUCUACAGUCCGACGAUC-3′ ) with T4 RNA ligase (Promega).

Labeling:

Article Title: Oncogenic B-Raf signaling in melanoma cells controls a network of microRNAs with combinatorial functions
Article Snippet: .. Total RNA (500 ng) was combined with spike-in control to monitor labeling efficiency, then fluorescence dye-labeled with pCp-Cy5 using T4 RNA ligase (Promega). .. A control oligonucleotide was added to measure recovery, and the sample desalted through a P6 Biospin column (Bio-Rad, Hercules, CA, USA).

Purification:

Article Title: Two Novel Hypovirulence-Associated Mycoviruses in the Phytopathogenic Fungus Botrytis cinerea: Molecular Characterization and Suppression of Infection Cushion Formation
Article Snippet: Each dsRNA band was excised and purified from the agarose gel using AxyPrepTM DNA Gel Extraction Kit (Axygen Scientific, Inc.; Union City, CA, USA). .. The terminal sequences of each dsRNA were cloned through ligating the 3′-terminus for each strand of each dsRNA with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road, Madison, WI, USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ).

Article Title: Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants A Viral Satellite RNA Induces Yellow Symptoms on Tobacco by Targeting a Gene Involved in Chlorophyll Biosynthesis using the RNA Silencing Machinery
Article Snippet: 5′ RACE Total RNA (2 µg) was ligated to a 24-nt RNA adaptor ( 5′ AACAGACGCGUGGUUACAGUCUUG 3′ ) using T4 RNA ligase (Promega) at room temperature for 2 hours in 50 mM HEPES pH 7.5, 0.1 mg/mL BSA, 8% glycerol, 2 units/µL RNasein RNase inhibitor (Promega) and 0.5 unit/µL T4 RNA ligase (Promega). .. The ligation was purified by phenol-chloroform extraction and ethanol precipitation.

Article Title: Oncogenic B-Raf signaling in melanoma cells controls a network of microRNAs with combinatorial functions
Article Snippet: Total RNA was purified using the RNeasy Plus kit (Qiagen) according to manufacturer's Supplementary Protocol 1. .. Total RNA (500 ng) was combined with spike-in control to monitor labeling efficiency, then fluorescence dye-labeled with pCp-Cy5 using T4 RNA ligase (Promega).

Sequencing:

Article Title: Defective RNA of a Novel Mycovirus with High Transmissibility Detrimental to Biocontrol Properties of Trichoderma spp.
Article Snippet: Paragraph title: 2.3. cDNA Cloning, Sequencing, and Sequence Analysis of ThHV1 and ThHV1-S ... The terminal sequences of the two dsRNAs were cloned through ligating the 3′-terminus for each strand of the two dsRNAs with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road Madison, WI 53711 USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ) according to our previous methods [ , ].

Article Title: Two Novel Hypovirulence-Associated Mycoviruses in the Phytopathogenic Fungus Botrytis cinerea: Molecular Characterization and Suppression of Infection Cushion Formation
Article Snippet: Paragraph title: 2.3. cDNA Cloning and Sequencing ... The terminal sequences of each dsRNA were cloned through ligating the 3′-terminus for each strand of each dsRNA with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road, Madison, WI, USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ).

Article Title: Cedar Virus: A Novel Henipavirus Isolated from Australian Bats
Article Snippet: .. Briefly, approximately 100 ng of RNA was ligated with adaptor DT88 (see reference for sequence information) using T4 RNA ligase (Promega) followed by cDNA synthesis using the SuperScript III RT kit (Invitrogen) and an adaptor-specific primer, DT89. .. PCR amplification was then carried out using DT89 and one or more genome-specific primers.

Article Title: Complete Genome Characterization of Recent and Ancient Belgian Pig Group A Rotaviruses and Assessment of Their Evolutionary Relationship with Human Rotaviruses
Article Snippet: Paragraph title: Sanger sequencing. ... Briefly, a modified amino-linked oligonucleotide (TGP-Linker; 5′-PO4 -TTCCTTATGCAGCTGATCACTCTGTGTCA-spacer-NH2 -3′) was linked to the 3′ end of both strands of denatured RNA by using T4 RNA ligase (Promega, Leiden, The Netherlands).

Article Title: Novel, Potentially Zoonotic Paramyxoviruses from the African Straw-Colored Fruit Bat Eidolon helvum
Article Snippet: Paragraph title: (iii) Sequencing of genomic ends through end-to-end ligation of viral ends. ... Briefly, 5 ng of viral genomic RNA was incubated at 37°C for 1 h in RNA ligase buffer with 20 U of T4 RNA ligase (Promega).

Article Title: Hypertension-associated mitochondrial DNA 4401A > G mutation caused the aberrant processing of tRNAMet, all 8 tRNAs and ND6 mRNA in the light-strand transcript
Article Snippet: Paragraph title: Sequencing of 5′- and 3′-end proximal segments of tRNAMet and tRNAGln ... First, total mitochondrial tRNA was circularized by incubation in the presence of T4 RNA ligase (Promega) to ligate the 3′ and 5′ ends of tRNAs.

Article Title: Genome-Wide Analysis of Small RNA and Novel MicroRNA Discovery in Human Acute Lymphoblastic Leukemia Based on Extensive Sequencing Approach
Article Snippet: Paragraph title: Total RNA isolation, small RNA library preparation, and nucleotide sequencing ... The small RNAs pools were then ligated sequentially to a 5′RNA adapter ( 5′-GUUCAGAGUUCUACAGUCCGACGAUC-3′ ) with T4 RNA ligase (Promega).

Polyacrylamide Gel Electrophoresis:

Article Title: Complete Genome Characterization of Recent and Ancient Belgian Pig Group A Rotaviruses and Assessment of Their Evolutionary Relationship with Human Rotaviruses
Article Snippet: Briefly, a modified amino-linked oligonucleotide (TGP-Linker; 5′-PO4 -TTCCTTATGCAGCTGATCACTCTGTGTCA-spacer-NH2 -3′) was linked to the 3′ end of both strands of denatured RNA by using T4 RNA ligase (Promega, Leiden, The Netherlands). .. First, reverse transcription was performed at 45°C for 30 min, followed by PCR activation at 95°C for 15 min. During a period of 45 min, the temperature was gradually lowered from 83°C to 60°C, the temperature was then held for 10 min at 72°C, and 40 cycles of amplification followed, with cycles of 94°C for 45 s, 45°C for 45 s, and 70°C for 1 min. A final extension was performed at 70°C for 7 min. Products were separated by polyacrylamide gel electrophoresis for 18 min at 200 V, followed by sequencing.

Nested PCR:

Article Title: Complete Genome Sequence of Ikoma Lyssavirus
Article Snippet: Briefly, genomic RNA was subjected to ligation by T4 RNA ligase (Promega, Madison, WI) using the manufacturer's instructions. .. The ligated RNA was subjected to nested PCR using primers located in the 5′ end of the L gene and 3′ end of the N gene.

Article Title: Novel, Potentially Zoonotic Paramyxoviruses from the African Straw-Colored Fruit Bat Eidolon helvum
Article Snippet: The 3′ and 5′ ends of the genomes were sequenced using an end-to-end ligation protocol similar to that described in reference , where genomic viral RNA was ligated end to end, and inverted nested PCR was used to amplify across the ligated ends. .. Briefly, 5 ng of viral genomic RNA was incubated at 37°C for 1 h in RNA ligase buffer with 20 U of T4 RNA ligase (Promega).

Sample Prep:

Article Title: Deep sequencing and genome-wide analysis reveals the expansion of MicroRNA genes in the gall midge Mayetiola destructor
Article Snippet: Small-RNA library construction A small-RNA library was generated according to Illumina’s sample preparation instructions (Illumina, San Diego, CA). .. Specifically, the SRA 5′ adapter was ligated to 50 ng of the aforementioned RNA fragments with T4 RNA ligase (Promega, Fitchburg, WI).

Article Title: Cedar Virus: A Novel Henipavirus Isolated from Australian Bats
Article Snippet: Sample preparation for Roche 454 sequencing (454 Life Sciences Branford, CT, USA) was according to their Titanium series manuals, Rapid Library Preparation and emPCR Lib-L SV. .. Briefly, approximately 100 ng of RNA was ligated with adaptor DT88 (see reference for sequence information) using T4 RNA ligase (Promega) followed by cDNA synthesis using the SuperScript III RT kit (Invitrogen) and an adaptor-specific primer, DT89.

Article Title: Effect of young exosomes injected in aged mice
Article Snippet: The isolated total RNA (50 ng) was processed for preparing a small RNA sequencing library using the TruSeq Small RNA Sample Preparation Kit (Illumina, San Diego, CA, USA) in accordance with the manufacturer’s instruction. .. The total RNA sample ligated RNA 3′ and 5′ adapter with T4 RNA ligase (Promega, Madison, WI, USA) in the ATP-free buffer.

Mouse Assay:

Article Title: Effect of young exosomes injected in aged mice
Article Snippet: Screening of aging-associated miRNAs in exosomes For high-throughput screening of DERs in exosomes of aged mice, next-generation sequencing (NGS) was performed with small RNAs isolated from the exosomes of 3-, 8-, and 12-month-old mice (n=3). .. The total RNA sample ligated RNA 3′ and 5′ adapter with T4 RNA ligase (Promega, Madison, WI, USA) in the ATP-free buffer.

Software:

Article Title: Complete Genome Sequence of Ikoma Lyssavirus
Article Snippet: The sequencing data were assembled in the GS de novo assembly software (Roche). .. Briefly, genomic RNA was subjected to ligation by T4 RNA ligase (Promega, Madison, WI) using the manufacturer's instructions.

Article Title: Cedar Virus: A Novel Henipavirus Isolated from Australian Bats
Article Snippet: For 454 read mapping, SNPs and DIPs generated with the CLC software were manually assessed for accuracy by visualising the mapped raw reads (random PCR errors are obvious compared to real SNPs and DIPs especially when read coverage is deep). .. Briefly, approximately 100 ng of RNA was ligated with adaptor DT88 (see reference for sequence information) using T4 RNA ligase (Promega) followed by cDNA synthesis using the SuperScript III RT kit (Invitrogen) and an adaptor-specific primer, DT89.

Article Title: Oncogenic B-Raf signaling in melanoma cells controls a network of microRNAs with combinatorial functions
Article Snippet: Total RNA (500 ng) was combined with spike-in control to monitor labeling efficiency, then fluorescence dye-labeled with pCp-Cy5 using T4 RNA ligase (Promega). .. Hybridizations were performed in a rotating incubator at 12 r.p.m. and 53 °C for 20 h. Slides were washed and scanned on an Agilent Microarray Scanner (Model G2505B), and data were extracted using Agilent Feature Extraction 9.5.1 software.

Agarose Gel Electrophoresis:

Article Title: Two Novel Hypovirulence-Associated Mycoviruses in the Phytopathogenic Fungus Botrytis cinerea: Molecular Characterization and Suppression of Infection Cushion Formation
Article Snippet: Each dsRNA band was excised and purified from the agarose gel using AxyPrepTM DNA Gel Extraction Kit (Axygen Scientific, Inc.; Union City, CA, USA). .. The terminal sequences of each dsRNA were cloned through ligating the 3′-terminus for each strand of each dsRNA with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road, Madison, WI, USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ).

Article Title: Novel, Potentially Zoonotic Paramyxoviruses from the African Straw-Colored Fruit Bat Eidolon helvum
Article Snippet: Briefly, 5 ng of viral genomic RNA was incubated at 37°C for 1 h in RNA ligase buffer with 20 U of T4 RNA ligase (Promega). .. PCR products were visualized using 1% agarose gel electrophoresis, extracted using a gel extraction kit (Qiagen), cloned (pGEM-T Easy; Promega), and sequenced.

Microarray:

Article Title: Oncogenic B-Raf signaling in melanoma cells controls a network of microRNAs with combinatorial functions
Article Snippet: Paragraph title: miRNA microarray profiling ... Total RNA (500 ng) was combined with spike-in control to monitor labeling efficiency, then fluorescence dye-labeled with pCp-Cy5 using T4 RNA ligase (Promega).

Ethanol Precipitation:

Article Title: Viral Small Interfering RNAs Target Host Genes to Mediate Disease Symptoms in Plants A Viral Satellite RNA Induces Yellow Symptoms on Tobacco by Targeting a Gene Involved in Chlorophyll Biosynthesis using the RNA Silencing Machinery
Article Snippet: 5′ RACE Total RNA (2 µg) was ligated to a 24-nt RNA adaptor ( 5′ AACAGACGCGUGGUUACAGUCUUG 3′ ) using T4 RNA ligase (Promega) at room temperature for 2 hours in 50 mM HEPES pH 7.5, 0.1 mg/mL BSA, 8% glycerol, 2 units/µL RNasein RNase inhibitor (Promega) and 0.5 unit/µL T4 RNA ligase (Promega). .. The ligation was purified by phenol-chloroform extraction and ethanol precipitation.

Article Title: Genome-Wide Analysis of Small RNA and Novel MicroRNA Discovery in Human Acute Lymphoblastic Leukemia Based on Extensive Sequencing Approach
Article Snippet: The RNA was dephosphorylated by alkaline phosphatase and recovered by ethanol precipitation. .. The small RNAs pools were then ligated sequentially to a 5′RNA adapter ( 5′-GUUCAGAGUUCUACAGUCCGACGAUC-3′ ) with T4 RNA ligase (Promega).

Next-Generation Sequencing:

Article Title: Effect of young exosomes injected in aged mice
Article Snippet: Screening of aging-associated miRNAs in exosomes For high-throughput screening of DERs in exosomes of aged mice, next-generation sequencing (NGS) was performed with small RNAs isolated from the exosomes of 3-, 8-, and 12-month-old mice (n=3). .. The total RNA sample ligated RNA 3′ and 5′ adapter with T4 RNA ligase (Promega, Madison, WI, USA) in the ATP-free buffer.

Chromosome Walking:

Article Title: Complete Genome Characterization of Recent and Ancient Belgian Pig Group A Rotaviruses and Assessment of Their Evolutionary Relationship with Human Rotaviruses
Article Snippet: Next, remaining parts of the coding regions were further covered by primer-walking sequencing. .. Briefly, a modified amino-linked oligonucleotide (TGP-Linker; 5′-PO4 -TTCCTTATGCAGCTGATCACTCTGTGTCA-spacer-NH2 -3′) was linked to the 3′ end of both strands of denatured RNA by using T4 RNA ligase (Promega, Leiden, The Netherlands).

Produced:

Article Title: Two Novel Hypovirulence-Associated Mycoviruses in the Phytopathogenic Fungus Botrytis cinerea: Molecular Characterization and Suppression of Infection Cushion Formation
Article Snippet: The cDNA library of each dsRNA (dsRNA-A2, dsRNA-B, dsRNA-C, dsRNA-D and dsRNA-E) was produced using a random primer-mediated PCR amplification protocol [ ] and sequenced as previously described [ ]. .. The terminal sequences of each dsRNA were cloned through ligating the 3′-terminus for each strand of each dsRNA with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road, Madison, WI, USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ).

Activation Assay:

Article Title: Complete Genome Characterization of Recent and Ancient Belgian Pig Group A Rotaviruses and Assessment of Their Evolutionary Relationship with Human Rotaviruses
Article Snippet: Briefly, a modified amino-linked oligonucleotide (TGP-Linker; 5′-PO4 -TTCCTTATGCAGCTGATCACTCTGTGTCA-spacer-NH2 -3′) was linked to the 3′ end of both strands of denatured RNA by using T4 RNA ligase (Promega, Leiden, The Netherlands). .. First, reverse transcription was performed at 45°C for 30 min, followed by PCR activation at 95°C for 15 min. During a period of 45 min, the temperature was gradually lowered from 83°C to 60°C, the temperature was then held for 10 min at 72°C, and 40 cycles of amplification followed, with cycles of 94°C for 45 s, 45°C for 45 s, and 70°C for 1 min. A final extension was performed at 70°C for 7 min. Products were separated by polyacrylamide gel electrophoresis for 18 min at 200 V, followed by sequencing.

Marker:

Article Title: Genome-Wide Analysis of Small RNA and Novel MicroRNA Discovery in Human Acute Lymphoblastic Leukemia Based on Extensive Sequencing Approach
Article Snippet: Briefly, total RNA was size fractionated on a 15% tris-borate-EDTA (TBE) urea polyacrylamide gel and a 15–30 nt fraction was excised, using 10 bp ladder (Invitrogen) as marker. .. The small RNAs pools were then ligated sequentially to a 5′RNA adapter ( 5′-GUUCAGAGUUCUACAGUCCGACGAUC-3′ ) with T4 RNA ligase (Promega).

Gel Extraction:

Article Title: Defective RNA of a Novel Mycovirus with High Transmissibility Detrimental to Biocontrol Properties of Trichoderma spp.
Article Snippet: 2.3. cDNA Cloning, Sequencing, and Sequence Analysis of ThHV1 and ThHV1-S Two dsRNAs of approximately 11.0 and 10.0 kb in length were extracted from the mycelia of isolate T-70D and then gel-purified using the AxyPrep DNA gel extraction kit (Axygen Scientific Inc., Union City, CA, USA). .. The terminal sequences of the two dsRNAs were cloned through ligating the 3′-terminus for each strand of the two dsRNAs with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road Madison, WI 53711 USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ) according to our previous methods [ , ].

Article Title: Two Novel Hypovirulence-Associated Mycoviruses in the Phytopathogenic Fungus Botrytis cinerea: Molecular Characterization and Suppression of Infection Cushion Formation
Article Snippet: Each dsRNA band was excised and purified from the agarose gel using AxyPrepTM DNA Gel Extraction Kit (Axygen Scientific, Inc.; Union City, CA, USA). .. The terminal sequences of each dsRNA were cloned through ligating the 3′-terminus for each strand of each dsRNA with the 5′-terminus of the 110A adaptor ( ) using T4 RNA ligase (Promega Corporation, 2800 Woods Hollow Road, Madison, WI, USA) at 16 °C for 18 h, and then reverse transcribed using primer RC110A ( ).

Article Title: Novel, Potentially Zoonotic Paramyxoviruses from the African Straw-Colored Fruit Bat Eidolon helvum
Article Snippet: Briefly, 5 ng of viral genomic RNA was incubated at 37°C for 1 h in RNA ligase buffer with 20 U of T4 RNA ligase (Promega). .. PCR products were visualized using 1% agarose gel electrophoresis, extracted using a gel extraction kit (Qiagen), cloned (pGEM-T Easy; Promega), and sequenced.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Promega t4 rna ligase
    Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) <t>T4</t> RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5 dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with E. coli poly (A) polymerase or Schizosaccharomyces pombe poly (U) polymerase.A total of 4000 dpm RNA (10 5 dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.
    T4 Rna Ligase, supplied by Promega, used in various techniques. Bioz Stars score: 94/100, based on 48 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase/product/Promega
    Average 94 stars, based on 48 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase - by Bioz Stars, 2020-01
    94/100 stars
      Buy from Supplier

    Image Search Results


    Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) T4 RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5 dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with E. coli poly (A) polymerase or Schizosaccharomyces pombe poly (U) polymerase.A total of 4000 dpm RNA (10 5 dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.

    Journal: Nucleic Acids Research

    Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation

    doi: 10.1093/nar/gkr822

    Figure Lengend Snippet: Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) T4 RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5 dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with E. coli poly (A) polymerase or Schizosaccharomyces pombe poly (U) polymerase.A total of 4000 dpm RNA (10 5 dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.

    Article Snippet: RNA ligase was used to treat cleavage product bands, either previously phosphatase treated or not, as follows: RNAs were incubated at 4°C for 4 days in a buffer containing 10 mM MgCl2 , 50 mM HEPES, pH 8.3, 5 mM DTT, 0.12 mM ATP, 4 U of T4 RNA ligase (Promega) and [5′-32 P]pCp (Perkin-Elmer) ( , ).

    Techniques: Produced, Purification, Incubation, De-Phosphorylation Assay, Labeling, Molecular Weight, Marker

    Characterization of UV-C cleavage of viral RNAs by fingerprinting and electrophoretic methods. ( a ) The RNA fingerprints of internally [α- 32 P] HCV (panels 1–3) and CSFV RNA (panels 4–6). Labeled SM, band B1 and band B2 were exhaustively digested with RNase T1 and the products subjected to 2D separation. ( 1 ) RNA fingerprint of HCV 1–249. A total of 500 000 dpm of HCV SM was fingerprinted. Spot 1: the HCV oligonucleotide 5′ 78 UCUAG 82 3′ within which cleavage takes place; Spot 2: this has the characteristic mobility of the 5′-terminal nucleotide 5′pppGp3′. ( 2 ) RNA fingerprint of HCV B1. A total of 300 000 dpm of RNA was fingerprinted as above. Spot 1 has disappeared, while the absence of the 5′-end (spot 2) shows that HCV B1 contains the 3′-portion of SM. ( 3 ) Fingerprint of HCV B2 (100 000 dpm). ‘1’ indicates the loss of spot 1, while the presence of the HCV 5′-end (‘2’) shows that HCV B2 contains the 5′-portion of SM. ( 4–6 ): RNA fingerprints of CSFV 1-218. SM (500 000 dpm), B1 (300 000 dpm) and B2 (100 000 dpm, transcribed with all four [α- 32 P]-labeled rNTPs. ‘1’: the CSFV oligonucleotide 5′ 38 AUACACUAAAUUUCG 52 3′, which is present in SM but absent from B1 and B2; ‘X’ (a new CSFV B1 oligonucleotide) and ‘Y’ (the other new CSFV oligonucleotide) arise from cleavage within spot 1 (see text) . ‘2’: the 5′-end of CSFV, present in SM and B2, but not B1. Numbering according to Wang et al. ( 62 ) for HCV genotype 1b and Gene Bank J04358 for CSFV Alfort Isolate. The sequence of the spot numbered as 1 was identified by secondary RNase analysis and high voltage electrophoresis on DEAE and Whatmann paper by Hugh D. Robertson (data not available), as well as by superposition with previously resolved HCV fingerprints using secondary analysis and on the basis of the rules for RNA oligonucleotide mobility during 2D TLC. Briefly, these rules are: the larger the oligonucleotide, the slower the migration of the corresponding spot to the bottom. As far as composition is concerned, Us displace the spot to the left, Cs to the right, and As cause a slight delay, thus meaning that several As in the same oligo may cause it to behave as an oligo containing one or even two additional bases ( 37 ). As far as sequence is concerned, as HCV RNA was transcribed in the presence of [α- 32 P]GTP here, those T1 oligonucleotides in the original sequence that are followed by a (pG) carry a double label. In the case of HCV RNA several RNase T1 oligonucelotides are indicated as mobility reference: a: UCCUUUCUUGp(G); b: UCUUCAGp(C) 61:68; c: CUCAAUGp(G) 211–217; d: AUUUGp(G) 225–229. Spot 1 locates in the border of the triangle that can be formed by spots i, f and g. In CSFV, spot 1 is the slow migrating spot, and thus corresponded to the largest RNase T1 oligonucleotide. In both HCV and CSFV, band B2 contains the original 5′-terminal nucleotide, pppGp, of the substrate RNA transcript (indicated by ‘2’). The disappearance of spot 1 from both product band fingerprints (see Figure 1 a, images 2, 3 and images 5, 6) suggests that self-cleavage occurs within this oligonucleotide and that this event is specific. Moreover, in the case of CSFV RNA two smaller oligomers (X and Y) that represent the fragment products of spot 1 are observed within the fingerprints of both product bands (B1 and B2) for CSFV. Indicated at the bottom is the sequence surrounding RNase T1 cleavage sites. ( b ) Electrophoresis analysis: Autoradiogram showing a parallel run of HCV RNA 1–130 and CSFV RNA 1–218 UV-cleavage reaction, with RNase T1 treated samples and control reactions for transcripts labeled at either the 5′-extreme with [γ- 32 P]GTP during transcription or the 3′-extreme with [5′- 32 P]pCp and T4 RNA ligase. HCV (lanes 1–6) and CSFV (lanes 1–9). HCV: Lanes 1 and 1′: RNAs incubated in standard buffer; lanes 2 and 2′: RNAs treated with RNase T1 under denaturing conditions; lanes 3 and 3′: RNA irradiated with UV-C light for 180 s. CSFV: Lanes 1 and 1′: RNAs incubated under standard conditions; lanes 2, 3 and 4′: RNA treated with RNase T1; lanes 4 and 3′: RNA irradiated with UV-C light: Lanes 5 and 2′ RNAs partially degraded with alkali. ‘G’ positions of a relevant size are indicated on either side of the gels. Lines indicate SM, and products B1 and B2.

    Journal: Nucleic Acids Research

    Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation

    doi: 10.1093/nar/gkr822

    Figure Lengend Snippet: Characterization of UV-C cleavage of viral RNAs by fingerprinting and electrophoretic methods. ( a ) The RNA fingerprints of internally [α- 32 P] HCV (panels 1–3) and CSFV RNA (panels 4–6). Labeled SM, band B1 and band B2 were exhaustively digested with RNase T1 and the products subjected to 2D separation. ( 1 ) RNA fingerprint of HCV 1–249. A total of 500 000 dpm of HCV SM was fingerprinted. Spot 1: the HCV oligonucleotide 5′ 78 UCUAG 82 3′ within which cleavage takes place; Spot 2: this has the characteristic mobility of the 5′-terminal nucleotide 5′pppGp3′. ( 2 ) RNA fingerprint of HCV B1. A total of 300 000 dpm of RNA was fingerprinted as above. Spot 1 has disappeared, while the absence of the 5′-end (spot 2) shows that HCV B1 contains the 3′-portion of SM. ( 3 ) Fingerprint of HCV B2 (100 000 dpm). ‘1’ indicates the loss of spot 1, while the presence of the HCV 5′-end (‘2’) shows that HCV B2 contains the 5′-portion of SM. ( 4–6 ): RNA fingerprints of CSFV 1-218. SM (500 000 dpm), B1 (300 000 dpm) and B2 (100 000 dpm, transcribed with all four [α- 32 P]-labeled rNTPs. ‘1’: the CSFV oligonucleotide 5′ 38 AUACACUAAAUUUCG 52 3′, which is present in SM but absent from B1 and B2; ‘X’ (a new CSFV B1 oligonucleotide) and ‘Y’ (the other new CSFV oligonucleotide) arise from cleavage within spot 1 (see text) . ‘2’: the 5′-end of CSFV, present in SM and B2, but not B1. Numbering according to Wang et al. ( 62 ) for HCV genotype 1b and Gene Bank J04358 for CSFV Alfort Isolate. The sequence of the spot numbered as 1 was identified by secondary RNase analysis and high voltage electrophoresis on DEAE and Whatmann paper by Hugh D. Robertson (data not available), as well as by superposition with previously resolved HCV fingerprints using secondary analysis and on the basis of the rules for RNA oligonucleotide mobility during 2D TLC. Briefly, these rules are: the larger the oligonucleotide, the slower the migration of the corresponding spot to the bottom. As far as composition is concerned, Us displace the spot to the left, Cs to the right, and As cause a slight delay, thus meaning that several As in the same oligo may cause it to behave as an oligo containing one or even two additional bases ( 37 ). As far as sequence is concerned, as HCV RNA was transcribed in the presence of [α- 32 P]GTP here, those T1 oligonucleotides in the original sequence that are followed by a (pG) carry a double label. In the case of HCV RNA several RNase T1 oligonucelotides are indicated as mobility reference: a: UCCUUUCUUGp(G); b: UCUUCAGp(C) 61:68; c: CUCAAUGp(G) 211–217; d: AUUUGp(G) 225–229. Spot 1 locates in the border of the triangle that can be formed by spots i, f and g. In CSFV, spot 1 is the slow migrating spot, and thus corresponded to the largest RNase T1 oligonucleotide. In both HCV and CSFV, band B2 contains the original 5′-terminal nucleotide, pppGp, of the substrate RNA transcript (indicated by ‘2’). The disappearance of spot 1 from both product band fingerprints (see Figure 1 a, images 2, 3 and images 5, 6) suggests that self-cleavage occurs within this oligonucleotide and that this event is specific. Moreover, in the case of CSFV RNA two smaller oligomers (X and Y) that represent the fragment products of spot 1 are observed within the fingerprints of both product bands (B1 and B2) for CSFV. Indicated at the bottom is the sequence surrounding RNase T1 cleavage sites. ( b ) Electrophoresis analysis: Autoradiogram showing a parallel run of HCV RNA 1–130 and CSFV RNA 1–218 UV-cleavage reaction, with RNase T1 treated samples and control reactions for transcripts labeled at either the 5′-extreme with [γ- 32 P]GTP during transcription or the 3′-extreme with [5′- 32 P]pCp and T4 RNA ligase. HCV (lanes 1–6) and CSFV (lanes 1–9). HCV: Lanes 1 and 1′: RNAs incubated in standard buffer; lanes 2 and 2′: RNAs treated with RNase T1 under denaturing conditions; lanes 3 and 3′: RNA irradiated with UV-C light for 180 s. CSFV: Lanes 1 and 1′: RNAs incubated under standard conditions; lanes 2, 3 and 4′: RNA treated with RNase T1; lanes 4 and 3′: RNA irradiated with UV-C light: Lanes 5 and 2′ RNAs partially degraded with alkali. ‘G’ positions of a relevant size are indicated on either side of the gels. Lines indicate SM, and products B1 and B2.

    Article Snippet: RNA ligase was used to treat cleavage product bands, either previously phosphatase treated or not, as follows: RNAs were incubated at 4°C for 4 days in a buffer containing 10 mM MgCl2 , 50 mM HEPES, pH 8.3, 5 mM DTT, 0.12 mM ATP, 4 U of T4 RNA ligase (Promega) and [5′-32 P]pCp (Perkin-Elmer) ( , ).

    Techniques: Labeling, Sequencing, Electrophoresis, Thin Layer Chromatography, Migration, Incubation, Irradiation

    Enzymatic determination of the new 5′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) Phosphatase-dependent 5′-terminal labeling of both HCV RNA 1–130 cleavage product (B1) (left panel) and CSFV RNA 1–218 cleavage product (B1) (right panel) by polynucleotide kinase. Aliquots (10 000 dpm) of product bands (10 5 dpm/µg) were treated with polynucleotide kinase and [γ- 32 P]ATP, after treatment with Artic Phosphatase (lane 2) or without phosphatase pre-treatment (lane 1). ( b ) Cyclization of HCV (left panel) and CSFV (right panel) RNA product bands B1 by T4 RNA ligase [with 10 000 dpm (10 5 dpm/µg) RNA]. Lanes 1: HCV and CSFV B1 bands incubated without T4 RNA ligase; lanes 2: complete reaction (cyclized RNA: upper band). ( c ) Phosphatase treatment of singly labeled CSFV. Calf alkaline phosphatase was used to treat CSFV band B1 aliquots (50 000 dpm of 107 dpm/µg), followed by high-voltage electrophoresis at pH 1.9 on Whatman DE81 DEAE paper ( 16 ). B1 RNA is at the bottom and free phosphate at the top. ‘U’, ‘A’, ‘C’ and ‘G’ indicate RNAs labeled with [α- 32 P]UTP, ATP, CTP or GTP, respectively, whereas ‘αGTP’ indicates a control containing 1000 dpm of pure [α- 32 P]GTP.

    Journal: Nucleic Acids Research

    Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation

    doi: 10.1093/nar/gkr822

    Figure Lengend Snippet: Enzymatic determination of the new 5′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) Phosphatase-dependent 5′-terminal labeling of both HCV RNA 1–130 cleavage product (B1) (left panel) and CSFV RNA 1–218 cleavage product (B1) (right panel) by polynucleotide kinase. Aliquots (10 000 dpm) of product bands (10 5 dpm/µg) were treated with polynucleotide kinase and [γ- 32 P]ATP, after treatment with Artic Phosphatase (lane 2) or without phosphatase pre-treatment (lane 1). ( b ) Cyclization of HCV (left panel) and CSFV (right panel) RNA product bands B1 by T4 RNA ligase [with 10 000 dpm (10 5 dpm/µg) RNA]. Lanes 1: HCV and CSFV B1 bands incubated without T4 RNA ligase; lanes 2: complete reaction (cyclized RNA: upper band). ( c ) Phosphatase treatment of singly labeled CSFV. Calf alkaline phosphatase was used to treat CSFV band B1 aliquots (50 000 dpm of 107 dpm/µg), followed by high-voltage electrophoresis at pH 1.9 on Whatman DE81 DEAE paper ( 16 ). B1 RNA is at the bottom and free phosphate at the top. ‘U’, ‘A’, ‘C’ and ‘G’ indicate RNAs labeled with [α- 32 P]UTP, ATP, CTP or GTP, respectively, whereas ‘αGTP’ indicates a control containing 1000 dpm of pure [α- 32 P]GTP.

    Article Snippet: RNA ligase was used to treat cleavage product bands, either previously phosphatase treated or not, as follows: RNAs were incubated at 4°C for 4 days in a buffer containing 10 mM MgCl2 , 50 mM HEPES, pH 8.3, 5 mM DTT, 0.12 mM ATP, 4 U of T4 RNA ligase (Promega) and [5′-32 P]pCp (Perkin-Elmer) ( , ).

    Techniques: Produced, Labeling, Incubation, Electrophoresis