t4 rna ligase buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    T4 RNA Ligase Reaction Buffer
    Description:
    T4 RNA Ligase Reaction Buffer 3 0 ml
    Catalog Number:
    b0216l
    Price:
    46
    Size:
    3 0 ml
    Category:
    Buffers
    Buy from Supplier


    Structured Review

    New England Biolabs t4 rna ligase buffer
    T4 RNA Ligase Reaction Buffer
    T4 RNA Ligase Reaction Buffer 3 0 ml
    https://www.bioz.com/result/t4 rna ligase buffer/product/New England Biolabs
    Average 95 stars, based on 35 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase buffer - by Bioz Stars, 2020-02
    95/100 stars

    Images

    1) Product Images from "Strand-specific deep sequencing of the transcriptome"

    Article Title: Strand-specific deep sequencing of the transcriptome

    Journal: Genome Research

    doi: 10.1101/gr.094318.109

    DSSS protocol workflow. ( A ) Fragmentation. RNA is fragmented to sizes in the range of 60–200 nt. ( B ) Dephosphorylation. 5′ phosphates are removed from RNA by treatment with alkaline phosphatase. ( C ) 3′ adapter ligation. Dephosphorylated 200-nt-long RNA fragments are selected by urea-PAGE. The 3′ adapter is ligated to the 3′ ends using T4 RNA ligase I. ( D ) Rephosphorylation. Fragments are rephosphorylated by treatment with T4 polynucleotide kinase as preparation for the next ligation step. ( E ) 5′ adapter ligation, preceded by removal of the nonligated 3′adapter by urea-PAGE size selection. ( F ) Reverse transcription (RT) and amplification of library. Molecules with 5′ and 3′ adapters were selected by urea-PAGE. First strand cDNA synthesis and PCR amplification were carried out with the indicated primers. ( G ) Sequencing.
    Figure Legend Snippet: DSSS protocol workflow. ( A ) Fragmentation. RNA is fragmented to sizes in the range of 60–200 nt. ( B ) Dephosphorylation. 5′ phosphates are removed from RNA by treatment with alkaline phosphatase. ( C ) 3′ adapter ligation. Dephosphorylated 200-nt-long RNA fragments are selected by urea-PAGE. The 3′ adapter is ligated to the 3′ ends using T4 RNA ligase I. ( D ) Rephosphorylation. Fragments are rephosphorylated by treatment with T4 polynucleotide kinase as preparation for the next ligation step. ( E ) 5′ adapter ligation, preceded by removal of the nonligated 3′adapter by urea-PAGE size selection. ( F ) Reverse transcription (RT) and amplification of library. Molecules with 5′ and 3′ adapters were selected by urea-PAGE. First strand cDNA synthesis and PCR amplification were carried out with the indicated primers. ( G ) Sequencing.

    Techniques Used: De-Phosphorylation Assay, Ligation, Polyacrylamide Gel Electrophoresis, Selection, Amplification, Polymerase Chain Reaction, Sequencing

    2) Product Images from "Late steps of ribosome assembly in E. coli are sensitive to a severe heat stress but are assisted by the HSP70 chaperone machine †"

    Article Title: Late steps of ribosome assembly in E. coli are sensitive to a severe heat stress but are assisted by the HSP70 chaperone machine †

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkq1049

    ( A ) Schematic processing of the p1 16S rRNA. The extra-sequences of 115 nt and 33 nt, flanking the m 16S rRNA at its 5′ and 3′ ends, respectively, are shown on a grey background. RA and FA are the primers used for 3′5′ RACE analysis. The site of annealing of RA to m 16S rRNA, and that of FA to the reverse complement of the m 16S rRNA, are indicated by arrows. Figure not drawn to scale. ( B ) Expected sizes in bp of the RT-PCR products (amplicons) obtained from the different species of 16S rRNA ( p1 , p2 , p3 and m ) by 3′5′ RACE. ( C–F ) Agarose gel electrophoresis of RT-PCR products obtained by 3′5′ RACE from total RNA isolated from MC4100 bacteria grown at 30°C (C), or 44°C (D), or 45°C (E) or 46°C (F). Each RNA sample was thermo-denatured (lanes b), or not (lanes a) prior to the 3′5′ ligation. The sizes (in bp) of the molecular weight markers are indicated to the left of each gel (M). ( G ) The thermodenaturation step dissociates the complementary sequences present at the 3′ and 5′ends of the p1 16S rRNA, and therefore offers to all the 16S rRNA species an equal chance to access to the T4 RNA ligase.
    Figure Legend Snippet: ( A ) Schematic processing of the p1 16S rRNA. The extra-sequences of 115 nt and 33 nt, flanking the m 16S rRNA at its 5′ and 3′ ends, respectively, are shown on a grey background. RA and FA are the primers used for 3′5′ RACE analysis. The site of annealing of RA to m 16S rRNA, and that of FA to the reverse complement of the m 16S rRNA, are indicated by arrows. Figure not drawn to scale. ( B ) Expected sizes in bp of the RT-PCR products (amplicons) obtained from the different species of 16S rRNA ( p1 , p2 , p3 and m ) by 3′5′ RACE. ( C–F ) Agarose gel electrophoresis of RT-PCR products obtained by 3′5′ RACE from total RNA isolated from MC4100 bacteria grown at 30°C (C), or 44°C (D), or 45°C (E) or 46°C (F). Each RNA sample was thermo-denatured (lanes b), or not (lanes a) prior to the 3′5′ ligation. The sizes (in bp) of the molecular weight markers are indicated to the left of each gel (M). ( G ) The thermodenaturation step dissociates the complementary sequences present at the 3′ and 5′ends of the p1 16S rRNA, and therefore offers to all the 16S rRNA species an equal chance to access to the T4 RNA ligase.

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Agarose Gel Electrophoresis, Isolation, Ligation, Molecular Weight

    3) Product Images from "Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts"

    Article Title: Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts

    Journal: eLife

    doi: 10.7554/eLife.27024

    In vitro optimization of RNA-to-DNA ligation conditions. Upper panel , Ten pmols of 17-nt adenylated ssDNA oligonucleotide (Universal App DNA, CTGTAGGCACCATCAAT) was incubated with 5 pmols of a 17nt ssRNA test probe (TTTCGTTGGAAGCGGGA) in 1x NEB T4 RNA Ligase Buffer with the indicated ligase (NEB Thermostable 5’ AppDNA/RNA ligase (Therm 5' Ligase), NEB T4 Rnl2tr K227Q Ligase (trT4K) or NEB T4 Rnl2tr R55K, K227Q ligase (trT4KQ)) and/or supplements (PEG, BSA, ATP, RNaseOUT). Products were then analyzed using denaturing polyacrylamide gel electrophoresis using a combination of NEB microRNA and low range ssRNA ladders and stained with SYBR-gold. Bands were quantified and the percent product was calculated using (shifted / (total * 0.66)) to account for the molar excess of DNA over RNA. No adjustment was made to account for preferential staining of ssDNA over ssRNA. Residual signal is expected in the lower band owing to the molar excess of DNA over RNA. A high molecular weight band is visible in the Therm 5’ Ligase lane, which most likely consists of high molecular weight concatemers of the AppDNA substrate caused by incomplete 3’ blocking of these oligos or removal of the 3’ block by the Therm 5’ Ligase. This experiment was performed once.
    Figure Legend Snippet: In vitro optimization of RNA-to-DNA ligation conditions. Upper panel , Ten pmols of 17-nt adenylated ssDNA oligonucleotide (Universal App DNA, CTGTAGGCACCATCAAT) was incubated with 5 pmols of a 17nt ssRNA test probe (TTTCGTTGGAAGCGGGA) in 1x NEB T4 RNA Ligase Buffer with the indicated ligase (NEB Thermostable 5’ AppDNA/RNA ligase (Therm 5' Ligase), NEB T4 Rnl2tr K227Q Ligase (trT4K) or NEB T4 Rnl2tr R55K, K227Q ligase (trT4KQ)) and/or supplements (PEG, BSA, ATP, RNaseOUT). Products were then analyzed using denaturing polyacrylamide gel electrophoresis using a combination of NEB microRNA and low range ssRNA ladders and stained with SYBR-gold. Bands were quantified and the percent product was calculated using (shifted / (total * 0.66)) to account for the molar excess of DNA over RNA. No adjustment was made to account for preferential staining of ssDNA over ssRNA. Residual signal is expected in the lower band owing to the molar excess of DNA over RNA. A high molecular weight band is visible in the Therm 5’ Ligase lane, which most likely consists of high molecular weight concatemers of the AppDNA substrate caused by incomplete 3’ blocking of these oligos or removal of the 3’ block by the Therm 5’ Ligase. This experiment was performed once.

    Techniques Used: In Vitro, DNA Ligation, Incubation, Polyacrylamide Gel Electrophoresis, Staining, Molecular Weight, Blocking Assay

    4) Product Images from "Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture"

    Article Title: Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0094619

    MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. T4 RNA Ligase 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated K227Q (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.
    Figure Legend Snippet: MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. T4 RNA Ligase 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated K227Q (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.

    Techniques Used: Ligation, Polyacrylamide Gel Electrophoresis, Mutagenesis

    Schematic illustration of microRNA capture by 3′ adapter ligation. The 19 nt, enzymatically pre-adenlyated adapter is ligated to the 3′ OH of microRNA using T4 RNA ligase 2. The reaction is run at 25°C for 4 hours in the absence of ATP. In order to characterize capture efficiency, the microRNA is end labeled with Cy3. The 3′ end of the adapter is blocked by –ddC, a fluorophore, or other moiety to prevent the formation of concatemers and circularized products.
    Figure Legend Snippet: Schematic illustration of microRNA capture by 3′ adapter ligation. The 19 nt, enzymatically pre-adenlyated adapter is ligated to the 3′ OH of microRNA using T4 RNA ligase 2. The reaction is run at 25°C for 4 hours in the absence of ATP. In order to characterize capture efficiency, the microRNA is end labeled with Cy3. The 3′ end of the adapter is blocked by –ddC, a fluorophore, or other moiety to prevent the formation of concatemers and circularized products.

    Techniques Used: Ligation, Labeling

    Related Articles

    Clone Assay:

    Article Title: Functional Analysis of Three Arabidopsis ARGONAUTES Using Slicer-Defective Mutants [W] ARGONAUTES Using Slicer-Defective Mutants [W] [OA]
    Article Snippet: Ten microliters (or 100%) of the immunoprecipitated RNA was mixed with 15 pmol of Cloning Linker 1 (IDT; see online) and incubated at 70°C for 2 min. .. The mixture was cooled on ice for 2 min before adding 1.5 μL of 10× T4 RNA ligase reaction buffer (NEB), 40 units of RNase OUT), and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB).

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: Dephosphorylated RNA was dissolved in 8.5 μl of 10 mM Tris-HCl (pH8.0) and 1.5 μl of Universal miRNA Cloning Linker (NEB) was added to the RNA. .. The mixture was ligated in 20 μl volume with 2 μl of 10 × T4 RNA Ligase Reaction Buffer (NEB), 6 μl of PEG 8000 (50%, w/v) and 1 μl of T4 RNA Ligase 2, truncated (200 U μl−1 , NEB).

    Amplification:

    Article Title: A Novel Type of Influenza A Virus-Derived Defective Interfering Particle with Nucleotide Substitutions in Its Genome
    Article Snippet: The subsequent amplification of the junction region (containing the vRNA ends) was performed by RT-PCR. .. Circularization was performed by mixing 11.5 μl of the RNA sample with 4 μl (40 U) of T4 RNA ligase 1, 2 μl of 10× T4 RNA ligase reaction buffer, 2 μl of a 10 mM ATP solution (all reagents from New England BioLabs), and 0.5 μl (20 U) of RiboLock RNase inhibitor (Thermo Scientific).

    Article Title: Multiplex transcriptional characterizations across diverse bacterial species using cell‐free systems
    Article Snippet: RNA was then extracted using RNAsnap (Stead et al , ), and cells were lysed using prepGEM bacteria kit (MicroGEM) for amplification of input DNA library sequences. .. The following were then added to the reaction: 2 μl T4 RNA ligase buffer 0.8 μl DMSO 0.2 μl 100 mM ATP 8.5 μl 50% PEG8000 1.5 μl T4 RNA ligase (New England Biolabs) Reactions were incubated overnight at 22°C and purified using Zymo DNA Clean and Concentrator‐5 kit.

    Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
    Article Snippet: Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA). .. Ligation was followed by hemi-nested PCR amplification using a Superscript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), then an Expand High Fidelity PCR System (Roche, Basel, Switzerland).

    De-Phosphorylation Assay:

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: The dephosphorylation reaction was carried out as follows: samples were denatured for 90 s at 80 °C; after this step, the samples were equilibrated to 37 °C and incubated for 1 h at 37 °C with 5 μl of 10 × T4 PNK buffer (NEB), 1 μl of SUPERase·In (20 U μl−1 ) and 1 μl of T4 PNK (10 U μl−1 , NEB). .. The mixture was ligated in 20 μl volume with 2 μl of 10 × T4 RNA Ligase Reaction Buffer (NEB), 6 μl of PEG 8000 (50%, w/v) and 1 μl of T4 RNA Ligase 2, truncated (200 U μl−1 , NEB).

    Polymerase Chain Reaction:

    Article Title: A Novel Type of Influenza A Virus-Derived Defective Interfering Particle with Nucleotide Substitutions in Its Genome
    Article Snippet: In subsequent PCR (primers are listed in ), we used a segment-specific primer in combination with a second primer that was designed across the junction of the 3′ and 5′ vRNA ends. .. Circularization was performed by mixing 11.5 μl of the RNA sample with 4 μl (40 U) of T4 RNA ligase 1, 2 μl of 10× T4 RNA ligase reaction buffer, 2 μl of a 10 mM ATP solution (all reagents from New England BioLabs), and 0.5 μl (20 U) of RiboLock RNase inhibitor (Thermo Scientific).

    Article Title: Multiplex transcriptional characterizations across diverse bacterial species using cell‐free systems
    Article Snippet: The following were then added to the reaction: 2 μl T4 RNA ligase buffer 0.8 μl DMSO 0.2 μl 100 mM ATP 8.5 μl 50% PEG8000 1.5 μl T4 RNA ligase (New England Biolabs) Reactions were incubated overnight at 22°C and purified using Zymo DNA Clean and Concentrator‐5 kit. .. Amplifications were performed using the following PCR mixture and cycling: 10 μl Q5 hot start high‐fidelity 2× master mix (New England Biolabs) 0.2 μl 10× SYBR Green I (Invitrogen) 1 μl Forward primer (10 μM) 1 μl Reverse primer (10 μM) 1 μl 1:10 dilution of library DNA template 6.8 μl Nuclease‐free water (Ambion) 5 min 98°C Initial denaturation 10 s 98°C Denaturation 20 s 62°C Annealing 30 s 72°C Extension Go to step 2 Until end of exponential amplification 2 min 72°C Final extension PCR was performed using a CFX96 Touch Real‐Time PCR machine (Bio‐Rad).

    Article Title: Evolution of Sequence-Defined Highly Functionalized Nucleic Acid Polymers
    Article Snippet: .. Synthesis of HFNAP by templated translation via DNA ligase-mediated polymerization DNA template [up to 10 pmol, either in solution or immobilized on MyOne Streptavidin C1 magnetic beads (ThermoFisher Scientific)], polymerization initiation and termination primers (1.5 equivalents each relative to template), functionalized trinucleotide building blocks (10 equivalents relative to template for each occurrence of the corresponding codon) and 10x T4 RNA ligase reaction buffer (New England Biolabs; 1 μL) were mixed in a total volume of 8 μL in a PCR tube. .. The mixture was subjected to the following temperature program on a thermocycler: 95 °C for 10 sec; 65 °C for 4 min; a ramp from 65 °C to 4 °C at 0.1 °C per 10 s. To the PCR tube were added 1 μL of 10 mM ATP and 1 μL of T3 DNA ligase (New England Biolabs).

    Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
    Article Snippet: Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA). .. Ligation was followed by hemi-nested PCR amplification using a Superscript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), then an Expand High Fidelity PCR System (Roche, Basel, Switzerland).

    Article Title: Protein Interaction Profile Sequencing (PIP-seq)
    Article Snippet: .. Protein interaction profile RNA (Basic Protocol 2) 10× Fragmentation Reagent (Life Technologies, cat. no. AM8740) Fragmentation Stop Solution (Life Technologies, cat. no. AM8740) DEPC-treated H2 O 5 mg/ml Glycogen, ultrapure (Life Technologies, cat. no. AM9510) 3 M NaOAc (pH = 5.5) (Life Technologies, cat. no. AM9740) 100% EtOH (Decon Labs, cat. no. 2716) 80% EtOH Ice T4 DNA ligase buffer (NEB, cat. no. B0202S) T4 polynucleotide kinase (NEB, cat. no. M0201S) 10 mM ATP (Life Technologies, cat. no. AM8110G) 10× TBE (Bio-Rad, 161-0733) Gel loading buffer II (Life Technologies, cat. no. AM8546G) 10-bp DNA ladder (Life Technologies, cat. no. 10821-015) 10 mg/ml Ethidium Bromide (Life Technologies, cat. no. 15585-011) 0.3 M NaCl 5 μM 3′ Adapter (RA3) (TGGAATTCTCGGGTGCCAAGG) RNA Ligase Buffer (NEB, cat. no. B0216L) RNaseOUT (Life Technologies, cat. no. 10777019) 200 U/μl Epicenter T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) 25 μM 5′ Adapter (RA5) (GUUCAGAGUUCUACAGUCCGACGAUC) T4 RNA Ligase 1 (NEB, cat. no. M0204S) RNA RT Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 5× First-Strand Buffer (Life Technologies, cat. no. 18064-014) 50 mM dNTPs 100 mM DTT (Life Technologies, cat. no. 18064-014) SuperScript II Reverse Transcriptase (Life Technologies, cat. no. 18064-014) 2× Phusion Mix (NEB, cat. no. M0531S) 5 mM Betaine (MP Biomedicals, cat. no. 215046180) 10 μM RNA PCR Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 10 μM RNA PCR Primer Index Nuclease-free water 25-bp DNA ladder (Life Technologies, cat. no. 10597-011) DSN Hybridization buffer (see recipe) 10× DSN Master Mix (Evrogen, cat. no. EA001) DSN Enzyme (Evrogen, cat. no. EA001) DSN STOP solution (Evrogen, cat. no. EA001) 1.7-ml tubes 70°C heat block Centrifuge 37°C heat block 1.0-mm, 10-well 15% TBE-Urea gels (Life Technologies, cat. no. EC6885BOX) Gel box for running prepoured gels (Life, Technologies, cat. no. EI0001) 18-G needles Razor blades Gel Breaker Tubes (IST Engineering, cat. no. 388-100) 2-ml tubes End-over-end rotator Spin-X columns (Costar, cat. no. 8160) 200-μl PCR tubes Thermal cycler 6% TBE gels 1.0 mm, 10 well (Invitrogen, cat. no. EC6265BOX) ..

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: .. Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). ..

    Autoradiography:

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: .. Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). ..

    TA Cloning:

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). .. TOPO TA Cloning® Kit for Sequencing, with One Shot® TOP10 Chemically Competent E. coli (Life Technologies, K4575-40) Phenol (Sigma-Aldrich, P4557, used without Equilibration Buffer) CAUTION Phenol is toxic on inhalation, on contact with skin or if swallowed, causes severe skin burns and eye damage.

    Blocking Assay:

    Article Title: Protein Interaction Profile Sequencing (PIP-seq)
    Article Snippet: .. Protein interaction profile RNA (Basic Protocol 2) 10× Fragmentation Reagent (Life Technologies, cat. no. AM8740) Fragmentation Stop Solution (Life Technologies, cat. no. AM8740) DEPC-treated H2 O 5 mg/ml Glycogen, ultrapure (Life Technologies, cat. no. AM9510) 3 M NaOAc (pH = 5.5) (Life Technologies, cat. no. AM9740) 100% EtOH (Decon Labs, cat. no. 2716) 80% EtOH Ice T4 DNA ligase buffer (NEB, cat. no. B0202S) T4 polynucleotide kinase (NEB, cat. no. M0201S) 10 mM ATP (Life Technologies, cat. no. AM8110G) 10× TBE (Bio-Rad, 161-0733) Gel loading buffer II (Life Technologies, cat. no. AM8546G) 10-bp DNA ladder (Life Technologies, cat. no. 10821-015) 10 mg/ml Ethidium Bromide (Life Technologies, cat. no. 15585-011) 0.3 M NaCl 5 μM 3′ Adapter (RA3) (TGGAATTCTCGGGTGCCAAGG) RNA Ligase Buffer (NEB, cat. no. B0216L) RNaseOUT (Life Technologies, cat. no. 10777019) 200 U/μl Epicenter T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) 25 μM 5′ Adapter (RA5) (GUUCAGAGUUCUACAGUCCGACGAUC) T4 RNA Ligase 1 (NEB, cat. no. M0204S) RNA RT Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 5× First-Strand Buffer (Life Technologies, cat. no. 18064-014) 50 mM dNTPs 100 mM DTT (Life Technologies, cat. no. 18064-014) SuperScript II Reverse Transcriptase (Life Technologies, cat. no. 18064-014) 2× Phusion Mix (NEB, cat. no. M0531S) 5 mM Betaine (MP Biomedicals, cat. no. 215046180) 10 μM RNA PCR Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 10 μM RNA PCR Primer Index Nuclease-free water 25-bp DNA ladder (Life Technologies, cat. no. 10597-011) DSN Hybridization buffer (see recipe) 10× DSN Master Mix (Evrogen, cat. no. EA001) DSN Enzyme (Evrogen, cat. no. EA001) DSN STOP solution (Evrogen, cat. no. EA001) 1.7-ml tubes 70°C heat block Centrifuge 37°C heat block 1.0-mm, 10-well 15% TBE-Urea gels (Life Technologies, cat. no. EC6885BOX) Gel box for running prepoured gels (Life, Technologies, cat. no. EI0001) 18-G needles Razor blades Gel Breaker Tubes (IST Engineering, cat. no. 388-100) 2-ml tubes End-over-end rotator Spin-X columns (Costar, cat. no. 8160) 200-μl PCR tubes Thermal cycler 6% TBE gels 1.0 mm, 10 well (Invitrogen, cat. no. EC6265BOX) ..

    SYBR Green Assay:

    Article Title: Multiplex transcriptional characterizations across diverse bacterial species using cell‐free systems
    Article Snippet: The following were then added to the reaction: 2 μl T4 RNA ligase buffer 0.8 μl DMSO 0.2 μl 100 mM ATP 8.5 μl 50% PEG8000 1.5 μl T4 RNA ligase (New England Biolabs) Reactions were incubated overnight at 22°C and purified using Zymo DNA Clean and Concentrator‐5 kit. .. Amplifications were performed using the following PCR mixture and cycling: 10 μl Q5 hot start high‐fidelity 2× master mix (New England Biolabs) 0.2 μl 10× SYBR Green I (Invitrogen) 1 μl Forward primer (10 μM) 1 μl Reverse primer (10 μM) 1 μl 1:10 dilution of library DNA template 6.8 μl Nuclease‐free water (Ambion) 5 min 98°C Initial denaturation 10 s 98°C Denaturation 20 s 62°C Annealing 30 s 72°C Extension Go to step 2 Until end of exponential amplification 2 min 72°C Final extension PCR was performed using a CFX96 Touch Real‐Time PCR machine (Bio‐Rad).

    Incubation:

    Article Title: A Novel Type of Influenza A Virus-Derived Defective Interfering Particle with Nucleotide Substitutions in Its Genome
    Article Snippet: Circularization was performed by mixing 11.5 μl of the RNA sample with 4 μl (40 U) of T4 RNA ligase 1, 2 μl of 10× T4 RNA ligase reaction buffer, 2 μl of a 10 mM ATP solution (all reagents from New England BioLabs), and 0.5 μl (20 U) of RiboLock RNase inhibitor (Thermo Scientific). .. The mixture was incubated for 1 h at 37°C, followed by heat inactivation at 65°C for 15 min. We immediately reverse transcribed the circularized RNA.

    Article Title: Multiplex transcriptional characterizations across diverse bacterial species using cell‐free systems
    Article Snippet: .. The following were then added to the reaction: 2 μl T4 RNA ligase buffer 0.8 μl DMSO 0.2 μl 100 mM ATP 8.5 μl 50% PEG8000 1.5 μl T4 RNA ligase (New England Biolabs) Reactions were incubated overnight at 22°C and purified using Zymo DNA Clean and Concentrator‐5 kit. .. Illumina indexes and adaptors were added to both cDNA and input library DNA using a two‐step amplification process.

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. Preparation of small RNA cDNA libraries for deep sequencing 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: Functional Analysis of Three Arabidopsis ARGONAUTES Using Slicer-Defective Mutants [W] ARGONAUTES Using Slicer-Defective Mutants [W] [OA]
    Article Snippet: Ten microliters (or 100%) of the immunoprecipitated RNA was mixed with 15 pmol of Cloning Linker 1 (IDT; see online) and incubated at 70°C for 2 min. .. The mixture was cooled on ice for 2 min before adding 1.5 μL of 10× T4 RNA ligase reaction buffer (NEB), 40 units of RNase OUT), and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB).

    Article Title: Biochemical and structural bioinformatics studies of fungal CutA nucleotidyltransferases explain their unusual specificity toward CTP and increased tendency for cytidine incorporation at the 3′-terminal positions of synthesized tails
    Article Snippet: Of note, 10.7 µL of purified RNA was mixed with 2 µL of T4 RNA Ligase Reaction buffer (New England Biolabs), 1 µL of 30 µM RA3 adapter, 4.8 µL of 50% PEG 8000 (New England Biolabs) and 0.5 µL of RiboLock RNase Inhibitor (40 U/µL; Thermo Fisher Scientific). .. After 2 min of incubation at 70°C, the tube was placed on ice, and 1 µL of T4 RNA Ligase 2, Truncated (200 U/µL; New England Biolabs) was added.

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: The dephosphorylation reaction was carried out as follows: samples were denatured for 90 s at 80 °C; after this step, the samples were equilibrated to 37 °C and incubated for 1 h at 37 °C with 5 μl of 10 × T4 PNK buffer (NEB), 1 μl of SUPERase·In (20 U μl−1 ) and 1 μl of T4 PNK (10 U μl−1 , NEB). .. The mixture was ligated in 20 μl volume with 2 μl of 10 × T4 RNA Ligase Reaction Buffer (NEB), 6 μl of PEG 8000 (50%, w/v) and 1 μl of T4 RNA Ligase 2, truncated (200 U μl−1 , NEB).

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: Genome-Wide Mapping of Yeast RNA Polymerase II Termination
    Article Snippet: .. The beads were resuspended in 50 ul of T4 RNA Ligase reaction solution (5 uM 5′ Adaptor [ GUUCAGAGUUCUACAGUCCGACGAUC , IDT], 1.2 U/µl RNase Inhibitor, 1 mM ATP, 0.5 U/µl T4 RNA Ligase [NEB], 1 mM DTT in RNA Ligase Buffer) and incubated at 16°C overnight. ..

    Mass Spectrometry:

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: .. Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). ..

    Hybridization:

    Article Title: Protein Interaction Profile Sequencing (PIP-seq)
    Article Snippet: .. Protein interaction profile RNA (Basic Protocol 2) 10× Fragmentation Reagent (Life Technologies, cat. no. AM8740) Fragmentation Stop Solution (Life Technologies, cat. no. AM8740) DEPC-treated H2 O 5 mg/ml Glycogen, ultrapure (Life Technologies, cat. no. AM9510) 3 M NaOAc (pH = 5.5) (Life Technologies, cat. no. AM9740) 100% EtOH (Decon Labs, cat. no. 2716) 80% EtOH Ice T4 DNA ligase buffer (NEB, cat. no. B0202S) T4 polynucleotide kinase (NEB, cat. no. M0201S) 10 mM ATP (Life Technologies, cat. no. AM8110G) 10× TBE (Bio-Rad, 161-0733) Gel loading buffer II (Life Technologies, cat. no. AM8546G) 10-bp DNA ladder (Life Technologies, cat. no. 10821-015) 10 mg/ml Ethidium Bromide (Life Technologies, cat. no. 15585-011) 0.3 M NaCl 5 μM 3′ Adapter (RA3) (TGGAATTCTCGGGTGCCAAGG) RNA Ligase Buffer (NEB, cat. no. B0216L) RNaseOUT (Life Technologies, cat. no. 10777019) 200 U/μl Epicenter T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) 25 μM 5′ Adapter (RA5) (GUUCAGAGUUCUACAGUCCGACGAUC) T4 RNA Ligase 1 (NEB, cat. no. M0204S) RNA RT Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 5× First-Strand Buffer (Life Technologies, cat. no. 18064-014) 50 mM dNTPs 100 mM DTT (Life Technologies, cat. no. 18064-014) SuperScript II Reverse Transcriptase (Life Technologies, cat. no. 18064-014) 2× Phusion Mix (NEB, cat. no. M0531S) 5 mM Betaine (MP Biomedicals, cat. no. 215046180) 10 μM RNA PCR Primer (RTP) (GCCTTGGCACCCGAGAATTCCA) 10 μM RNA PCR Primer Index Nuclease-free water 25-bp DNA ladder (Life Technologies, cat. no. 10597-011) DSN Hybridization buffer (see recipe) 10× DSN Master Mix (Evrogen, cat. no. EA001) DSN Enzyme (Evrogen, cat. no. EA001) DSN STOP solution (Evrogen, cat. no. EA001) 1.7-ml tubes 70°C heat block Centrifuge 37°C heat block 1.0-mm, 10-well 15% TBE-Urea gels (Life Technologies, cat. no. EC6885BOX) Gel box for running prepoured gels (Life, Technologies, cat. no. EI0001) 18-G needles Razor blades Gel Breaker Tubes (IST Engineering, cat. no. 388-100) 2-ml tubes End-over-end rotator Spin-X columns (Costar, cat. no. 8160) 200-μl PCR tubes Thermal cycler 6% TBE gels 1.0 mm, 10 well (Invitrogen, cat. no. EC6265BOX) ..

    Ligation:

    Article Title: Multiplex transcriptional characterizations across diverse bacterial species using cell‐free systems
    Article Snippet: The following were then added to the reaction: 4 μl 5× RT buffer 0.5 μl RNase inhibitor (RiboLock, Thermo Scientific) 1 μl Maxima reverse transcriptase (Thermo Scientific) The reverse transcription reaction was carried out as follows on a 96‐well thermocycler (Bio‐Rad): 42°C for 90 min 50°C for 2 min 42°C for 2 min Repeat the two steps above for 9 cycles 85°C for 5 min 4°C hold The completed reaction was incubated with 1 μl RNase H at 37°C for 30 min. Then, the reaction was purified using Zymo DNA Clean and Concentrator‐5 kit, and the common adaptor ligation was carried out as follows: 5 μl cDNA 2 μl Adaptor (40 μM) Components were incubated at 65°C for 5 min and chilled on ice for 1 min. .. The following were then added to the reaction: 2 μl T4 RNA ligase buffer 0.8 μl DMSO 0.2 μl 100 mM ATP 8.5 μl 50% PEG8000 1.5 μl T4 RNA ligase (New England Biolabs) Reactions were incubated overnight at 22°C and purified using Zymo DNA Clean and Concentrator‐5 kit.

    Article Title: Functional Analysis of Three Arabidopsis ARGONAUTES Using Slicer-Defective Mutants [W] ARGONAUTES Using Slicer-Defective Mutants [W] [OA]
    Article Snippet: The mixture was cooled on ice for 2 min before adding 1.5 μL of 10× T4 RNA ligase reaction buffer (NEB), 40 units of RNase OUT), and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB). .. Ligation reactions were incubated overnight at 16°C.

    Article Title: Biochemical and structural bioinformatics studies of fungal CutA nucleotidyltransferases explain their unusual specificity toward CTP and increased tendency for cytidine incorporation at the 3′-terminal positions of synthesized tails
    Article Snippet: Paragraph title: Adapter ligation ... Of note, 10.7 µL of purified RNA was mixed with 2 µL of T4 RNA Ligase Reaction buffer (New England Biolabs), 1 µL of 30 µM RA3 adapter, 4.8 µL of 50% PEG 8000 (New England Biolabs) and 0.5 µL of RiboLock RNase Inhibitor (40 U/µL; Thermo Fisher Scientific).

    Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
    Article Snippet: Confirmation of Genome Termini Ligation of genome ends was used to enable sequencing of the 3′ terminus, adapted from a protocol previously developed for influenza virus sequencing [ ]. .. Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: A Novel Type of Influenza A Virus-Derived Defective Interfering Particle with Nucleotide Substitutions in Its Genome
    Article Snippet: The subsequent amplification of the junction region (containing the vRNA ends) was performed by RT-PCR. .. Circularization was performed by mixing 11.5 μl of the RNA sample with 4 μl (40 U) of T4 RNA ligase 1, 2 μl of 10× T4 RNA ligase reaction buffer, 2 μl of a 10 mM ATP solution (all reagents from New England BioLabs), and 0.5 μl (20 U) of RiboLock RNase inhibitor (Thermo Scientific).

    Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
    Article Snippet: Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA). .. Ligation was followed by hemi-nested PCR amplification using a Superscript III One-Step RT-PCR System with Platinum Taq DNA Polymerase (Invitrogen, Carlsbad, CA, USA), then an Expand High Fidelity PCR System (Roche, Basel, Switzerland).

    In Vivo:

    Article Title: Multiplex transcriptional characterizations across diverse bacterial species using cell‐free systems
    Article Snippet: For in vivo measurements, library cultures of all bacterial species were grown in rich media ( ) until mid‐exponential phase (OD600 ~0.2). .. The following were then added to the reaction: 2 μl T4 RNA ligase buffer 0.8 μl DMSO 0.2 μl 100 mM ATP 8.5 μl 50% PEG8000 1.5 μl T4 RNA ligase (New England Biolabs) Reactions were incubated overnight at 22°C and purified using Zymo DNA Clean and Concentrator‐5 kit.

    RNA Sequencing Assay:

    Article Title: Multiplex transcriptional characterizations across diverse bacterial species using cell‐free systems
    Article Snippet: Unless otherwise stated, RNA sequencing library was prepared by reverse transcription and common adaptor ligation at 3′‐end of the cDNA. .. The following were then added to the reaction: 2 μl T4 RNA ligase buffer 0.8 μl DMSO 0.2 μl 100 mM ATP 8.5 μl 50% PEG8000 1.5 μl T4 RNA ligase (New England Biolabs) Reactions were incubated overnight at 22°C and purified using Zymo DNA Clean and Concentrator‐5 kit.

    Magnetic Beads:

    Article Title: Evolution of Sequence-Defined Highly Functionalized Nucleic Acid Polymers
    Article Snippet: .. Synthesis of HFNAP by templated translation via DNA ligase-mediated polymerization DNA template [up to 10 pmol, either in solution or immobilized on MyOne Streptavidin C1 magnetic beads (ThermoFisher Scientific)], polymerization initiation and termination primers (1.5 equivalents each relative to template), functionalized trinucleotide building blocks (10 equivalents relative to template for each occurrence of the corresponding codon) and 10x T4 RNA ligase reaction buffer (New England Biolabs; 1 μL) were mixed in a total volume of 8 μL in a PCR tube. .. The mixture was subjected to the following temperature program on a thermocycler: 95 °C for 10 sec; 65 °C for 4 min; a ramp from 65 °C to 4 °C at 0.1 °C per 10 s. To the PCR tube were added 1 μL of 10 mM ATP and 1 μL of T3 DNA ligase (New England Biolabs).

    Article Title: Evolution of Sequence-Defined Highly Functionalized Nucleic Acid Polymers
    Article Snippet: .. Biotinylated species was captured on streptavidin magnetic beads, which were then washed three times with 20 mM NaOH and then twice with 1x T4 RNA ligase reaction buffer. ..

    Mutagenesis:

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. Preparation of small RNA cDNA libraries for deep sequencing 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Size-exclusion Chromatography:

    Article Title: Evolution of Sequence-Defined Highly Functionalized Nucleic Acid Polymers
    Article Snippet: Synthesis of HFNAP by templated translation via DNA ligase-mediated polymerization DNA template [up to 10 pmol, either in solution or immobilized on MyOne Streptavidin C1 magnetic beads (ThermoFisher Scientific)], polymerization initiation and termination primers (1.5 equivalents each relative to template), functionalized trinucleotide building blocks (10 equivalents relative to template for each occurrence of the corresponding codon) and 10x T4 RNA ligase reaction buffer (New England Biolabs; 1 μL) were mixed in a total volume of 8 μL in a PCR tube. .. The mixture was subjected to the following temperature program on a thermocycler: 95 °C for 10 sec; 65 °C for 4 min; a ramp from 65 °C to 4 °C at 0.1 °C per 10 s. To the PCR tube were added 1 μL of 10 mM ATP and 1 μL of T3 DNA ligase (New England Biolabs).

    Purification:

    Article Title: Multiplex transcriptional characterizations across diverse bacterial species using cell‐free systems
    Article Snippet: .. The following were then added to the reaction: 2 μl T4 RNA ligase buffer 0.8 μl DMSO 0.2 μl 100 mM ATP 8.5 μl 50% PEG8000 1.5 μl T4 RNA ligase (New England Biolabs) Reactions were incubated overnight at 22°C and purified using Zymo DNA Clean and Concentrator‐5 kit. .. Illumina indexes and adaptors were added to both cDNA and input library DNA using a two‐step amplification process.

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. Preparation of small RNA cDNA libraries for deep sequencing 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: Biochemical and structural bioinformatics studies of fungal CutA nucleotidyltransferases explain their unusual specificity toward CTP and increased tendency for cytidine incorporation at the 3′-terminal positions of synthesized tails
    Article Snippet: .. Of note, 10.7 µL of purified RNA was mixed with 2 µL of T4 RNA Ligase Reaction buffer (New England Biolabs), 1 µL of 30 µM RA3 adapter, 4.8 µL of 50% PEG 8000 (New England Biolabs) and 0.5 µL of RiboLock RNase Inhibitor (40 U/µL; Thermo Fisher Scientific). .. After 2 min of incubation at 70°C, the tube was placed on ice, and 1 µL of T4 RNA Ligase 2, Truncated (200 U/µL; New England Biolabs) was added.

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: Thereafter, the enzyme inactivation was performed for 10 min at 70 °C and RNA was purified by ethanol precipitation. .. The mixture was ligated in 20 μl volume with 2 μl of 10 × T4 RNA Ligase Reaction Buffer (NEB), 6 μl of PEG 8000 (50%, w/v) and 1 μl of T4 RNA Ligase 2, truncated (200 U μl−1 , NEB).

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: .. Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). ..

    Sequencing:

    Article Title: Multiplex transcriptional characterizations across diverse bacterial species using cell‐free systems
    Article Snippet: Paragraph title: Transcription assay and sequencing library generation ... The following were then added to the reaction: 2 μl T4 RNA ligase buffer 0.8 μl DMSO 0.2 μl 100 mM ATP 8.5 μl 50% PEG8000 1.5 μl T4 RNA ligase (New England Biolabs) Reactions were incubated overnight at 22°C and purified using Zymo DNA Clean and Concentrator‐5 kit.

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. Preparation of small RNA cDNA libraries for deep sequencing 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
    Article Snippet: Confirmation of Genome Termini Ligation of genome ends was used to enable sequencing of the 3′ terminus, adapted from a protocol previously developed for influenza virus sequencing [ ]. .. Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA).

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: Paragraph title: Preparation of small RNA cDNA libraries for deep sequencing ... 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight.

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). .. TOPO TA Cloning® Kit for Sequencing, with One Shot® TOP10 Chemically Competent E. coli (Life Technologies, K4575-40) Phenol (Sigma-Aldrich, P4557, used without Equilibration Buffer) CAUTION Phenol is toxic on inhalation, on contact with skin or if swallowed, causes severe skin burns and eye damage.

    Polyacrylamide Gel Electrophoresis:

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: Preparation of small RNA cDNA libraries for deep sequencing 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. The 3’-adapter-ligated RNA tags were purified by PAGE using 10% TBE-urea gels.

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. The 3’-adapter-ligated RNA tags were purified by PAGE using 10% TBE-urea gels.

    cDNA Library Assay:

    Article Title: Genome-Wide Mapping of Yeast RNA Polymerase II Termination
    Article Snippet: Paragraph title: cDNA library preparation ... The beads were resuspended in 50 ul of T4 RNA Ligase reaction solution (5 uM 5′ Adaptor [ GUUCAGAGUUCUACAGUCCGACGAUC , IDT], 1.2 U/µl RNase Inhibitor, 1 mM ATP, 0.5 U/µl T4 RNA Ligase [NEB], 1 mM DTT in RNA Ligase Buffer) and incubated at 16°C overnight.

    Rapid Amplification of cDNA Ends:

    Article Title: Alston Virus, a Novel Paramyxovirus Isolated from Bats Causes Upper Respiratory Tract Infection in Experimentally Challenged Ferrets
    Article Snippet: Genome ends were ligated overnight at 16 °C using 20 U T4 RNA Ligase, 20 U RNasin, 50 μM ATP, 10% PEG8000 and T4 RNA ligase reaction buffer (NEB, Ipswich, MA, USA). .. The rapid amplification of cDNA ends (RACE) [ ] was required to determine the 5′ terminus, with some adaptations made to the original method.

    Chromatin Immunoprecipitation:

    Article Title: Mitochondrial Ribosome (Mitoribosome) Profiling for Monitoring Mitochondrial Translation in vivo
    Article Snippet: .. Solutions and reagents: Mitoribosome-associated RNA (from Basic Protocol 1) and/or fragmented and size-selected mRNA (from Support Protocol) 2X urea RNA loading buffer (see recipe) 10-bp DNA ladder 15%, 10% TBE-urea, 8% TBE polyacrylamide gels SYBR gold (10,000X concentrate) RNase-free water 3 M sodium acetate, pH 5.5 (RNase-free) 25 mg/ml linear polyacrylamide (LPA) Isopropanol 70% (v/v) ethanol 10X T4 polynucleotide kinase (PNK) buffer 10 U/μl T4 PNK Oligonucleotide linker and primers (see Table) 50% (w/v) PEG 8000 (RNase-free) 10X T4 RNA ligase reaction buffer (NEB, B0216L) 200 U/μl T4 RNA ligase 2, truncated (NEB) 10 mM Tris, pH 8.0 (RNase-free) 5X First-strand (FS) RT reaction buffer (Invitrogen, 18080-993) 10 mM dNTPs 0.1 M DTT 20 U/μl SUPERase-In 200 U/μl Superscript III 1 N sodium hydroxide 3 M sodium chloride 10X CircLigase reaction buffer (Epicentre, CL4111K) 1 mM ATP 50 mM manganese chloride 100 U/μl CircLigase ssDNA ligase 5X Phusion HF reaction buffer (NEB, M0530S) 2 U/μl Phusion HF DNA polymerase 10X DNA loading buffer (see recipe) 100-bp DNA ladder DNA gel extraction buffer (see recipe) 10 mM Tris, pH 8.5 Qubit dsDNA HS Assay kit Special equipment: Heat blocks: 80°C, 70°C, 37°C, 25°C Typhoon fluorescent/phosphorescent image scanner, or UV transilluminator with camera Blue light transilluminator (or UV transilluminator) box End over end rotator Costar Spin-X centrifuge tube filter (0.45-um cellulose acetate in 2-ml tube; Corning) Qubit Fluorometer Bioanalyzer DNA high sensitivity chip and reagents Other equipment: Polyacrylamide electrophoresis apparatus and power source 0.5-ml and 1.5-ml RNase-free non-stick microcentrifuge tubes Plastic sheet protector Razor blades or scalpels Thermocycler Plastic sheet protector .. 1 Combine 10 μl RNA from large scale mitoribosome purification with 10 μl 2X urea RNA loading buffer.

    Real-time Polymerase Chain Reaction:

    Article Title: Multiplex transcriptional characterizations across diverse bacterial species using cell‐free systems
    Article Snippet: The following were then added to the reaction: 2 μl T4 RNA ligase buffer 0.8 μl DMSO 0.2 μl 100 mM ATP 8.5 μl 50% PEG8000 1.5 μl T4 RNA ligase (New England Biolabs) Reactions were incubated overnight at 22°C and purified using Zymo DNA Clean and Concentrator‐5 kit. .. Amplifications were performed using the following PCR mixture and cycling: 10 μl Q5 hot start high‐fidelity 2× master mix (New England Biolabs) 0.2 μl 10× SYBR Green I (Invitrogen) 1 μl Forward primer (10 μM) 1 μl Reverse primer (10 μM) 1 μl 1:10 dilution of library DNA template 6.8 μl Nuclease‐free water (Ambion) 5 min 98°C Initial denaturation 10 s 98°C Denaturation 20 s 62°C Annealing 30 s 72°C Extension Go to step 2 Until end of exponential amplification 2 min 72°C Final extension PCR was performed using a CFX96 Touch Real‐Time PCR machine (Bio‐Rad).

    Sample Prep:

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. Preparation of small RNA cDNA libraries for deep sequencing 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Article Title: The unfolded protein response and endoplasmic reticulum protein targeting machineries converge on the stress sensor IRE1
    Article Snippet: .. 1 μL of RA3 RNA 3’ adapter (5’-TGGAATTCTCGGGTGCCAAGG-3’) from the TruSeq RNA small Sample Prep Kit (Illumina) was added to each of the purified RNA samples above, and the mixture was placed at 80°C for 2 min, then placed immediately on ice for another 2 min. 1.5 μL of 10× T4 RNA ligase reaction buffer (500 mM Tris pH 7.5, 100 mM MgCl2 , 10 mM DTT; New England Biolabs) and 4.5 μL 50% PEG 8,000 (New England Biolabs), 1 μL RNase inhibitor (Illumina), and 1 μL (200 units) T4 RNA ligase 2, truncated R55K, K227Q (KQ) mutant (New England Biolabs) were added to each sample and the reactions were incubated at 16°C overnight. .. 12–16 hr later, 0.5 μL of 10× T4 RNA ligase reaction buffer, 1.5 μL of 50% PEG 8,000, 2 μL of RNase-free water and 1 μL (200 units) T4 RNA ligase 2 truncated KQ were added to each sample and the reactions were incubated an additional 2 hr at 25°C.

    Electrophoresis:

    Article Title: Mitochondrial Ribosome (Mitoribosome) Profiling for Monitoring Mitochondrial Translation in vivo
    Article Snippet: .. Solutions and reagents: Mitoribosome-associated RNA (from Basic Protocol 1) and/or fragmented and size-selected mRNA (from Support Protocol) 2X urea RNA loading buffer (see recipe) 10-bp DNA ladder 15%, 10% TBE-urea, 8% TBE polyacrylamide gels SYBR gold (10,000X concentrate) RNase-free water 3 M sodium acetate, pH 5.5 (RNase-free) 25 mg/ml linear polyacrylamide (LPA) Isopropanol 70% (v/v) ethanol 10X T4 polynucleotide kinase (PNK) buffer 10 U/μl T4 PNK Oligonucleotide linker and primers (see Table) 50% (w/v) PEG 8000 (RNase-free) 10X T4 RNA ligase reaction buffer (NEB, B0216L) 200 U/μl T4 RNA ligase 2, truncated (NEB) 10 mM Tris, pH 8.0 (RNase-free) 5X First-strand (FS) RT reaction buffer (Invitrogen, 18080-993) 10 mM dNTPs 0.1 M DTT 20 U/μl SUPERase-In 200 U/μl Superscript III 1 N sodium hydroxide 3 M sodium chloride 10X CircLigase reaction buffer (Epicentre, CL4111K) 1 mM ATP 50 mM manganese chloride 100 U/μl CircLigase ssDNA ligase 5X Phusion HF reaction buffer (NEB, M0530S) 2 U/μl Phusion HF DNA polymerase 10X DNA loading buffer (see recipe) 100-bp DNA ladder DNA gel extraction buffer (see recipe) 10 mM Tris, pH 8.5 Qubit dsDNA HS Assay kit Special equipment: Heat blocks: 80°C, 70°C, 37°C, 25°C Typhoon fluorescent/phosphorescent image scanner, or UV transilluminator with camera Blue light transilluminator (or UV transilluminator) box End over end rotator Costar Spin-X centrifuge tube filter (0.45-um cellulose acetate in 2-ml tube; Corning) Qubit Fluorometer Bioanalyzer DNA high sensitivity chip and reagents Other equipment: Polyacrylamide electrophoresis apparatus and power source 0.5-ml and 1.5-ml RNase-free non-stick microcentrifuge tubes Plastic sheet protector Razor blades or scalpels Thermocycler Plastic sheet protector .. 1 Combine 10 μl RNA from large scale mitoribosome purification with 10 μl 2X urea RNA loading buffer.

    Ethanol Precipitation:

    Article Title: The dynamic transcriptional and translational landscape of the model antibiotic producer Streptomyces coelicolor A3(2)
    Article Snippet: Thereafter, the enzyme inactivation was performed for 10 min at 70 °C and RNA was purified by ethanol precipitation. .. The mixture was ligated in 20 μl volume with 2 μl of 10 × T4 RNA Ligase Reaction Buffer (NEB), 6 μl of PEG 8000 (50%, w/v) and 1 μl of T4 RNA Ligase 2, truncated (200 U μl−1 , NEB).

    Random Hexamer Labeling:

    Article Title: A Novel Type of Influenza A Virus-Derived Defective Interfering Particle with Nucleotide Substitutions in Its Genome
    Article Snippet: For RT, a random hexamer primer was used. .. Circularization was performed by mixing 11.5 μl of the RNA sample with 4 μl (40 U) of T4 RNA ligase 1, 2 μl of 10× T4 RNA ligase reaction buffer, 2 μl of a 10 mM ATP solution (all reagents from New England BioLabs), and 0.5 μl (20 U) of RiboLock RNase inhibitor (Thermo Scientific).

    Immunoprecipitation:

    Article Title: Functional Analysis of Three Arabidopsis ARGONAUTES Using Slicer-Defective Mutants [W] ARGONAUTES Using Slicer-Defective Mutants [W] [OA]
    Article Snippet: Ten microliters (or 100%) of the immunoprecipitated RNA was mixed with 15 pmol of Cloning Linker 1 (IDT; see online) and incubated at 70°C for 2 min. .. The mixture was cooled on ice for 2 min before adding 1.5 μL of 10× T4 RNA ligase reaction buffer (NEB), 40 units of RNase OUT), and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB).

    Gel Extraction:

    Article Title: Mitochondrial Ribosome (Mitoribosome) Profiling for Monitoring Mitochondrial Translation in vivo
    Article Snippet: .. Solutions and reagents: Mitoribosome-associated RNA (from Basic Protocol 1) and/or fragmented and size-selected mRNA (from Support Protocol) 2X urea RNA loading buffer (see recipe) 10-bp DNA ladder 15%, 10% TBE-urea, 8% TBE polyacrylamide gels SYBR gold (10,000X concentrate) RNase-free water 3 M sodium acetate, pH 5.5 (RNase-free) 25 mg/ml linear polyacrylamide (LPA) Isopropanol 70% (v/v) ethanol 10X T4 polynucleotide kinase (PNK) buffer 10 U/μl T4 PNK Oligonucleotide linker and primers (see Table) 50% (w/v) PEG 8000 (RNase-free) 10X T4 RNA ligase reaction buffer (NEB, B0216L) 200 U/μl T4 RNA ligase 2, truncated (NEB) 10 mM Tris, pH 8.0 (RNase-free) 5X First-strand (FS) RT reaction buffer (Invitrogen, 18080-993) 10 mM dNTPs 0.1 M DTT 20 U/μl SUPERase-In 200 U/μl Superscript III 1 N sodium hydroxide 3 M sodium chloride 10X CircLigase reaction buffer (Epicentre, CL4111K) 1 mM ATP 50 mM manganese chloride 100 U/μl CircLigase ssDNA ligase 5X Phusion HF reaction buffer (NEB, M0530S) 2 U/μl Phusion HF DNA polymerase 10X DNA loading buffer (see recipe) 100-bp DNA ladder DNA gel extraction buffer (see recipe) 10 mM Tris, pH 8.5 Qubit dsDNA HS Assay kit Special equipment: Heat blocks: 80°C, 70°C, 37°C, 25°C Typhoon fluorescent/phosphorescent image scanner, or UV transilluminator with camera Blue light transilluminator (or UV transilluminator) box End over end rotator Costar Spin-X centrifuge tube filter (0.45-um cellulose acetate in 2-ml tube; Corning) Qubit Fluorometer Bioanalyzer DNA high sensitivity chip and reagents Other equipment: Polyacrylamide electrophoresis apparatus and power source 0.5-ml and 1.5-ml RNase-free non-stick microcentrifuge tubes Plastic sheet protector Razor blades or scalpels Thermocycler Plastic sheet protector .. 1 Combine 10 μl RNA from large scale mitoribosome purification with 10 μl 2X urea RNA loading buffer.

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: .. Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). ..

    Hood:

    Article Title: Mapping the miRNA interactome by cross linking ligation and sequencing of hybrids (CLASH)
    Article Snippet: Hybond-C Extra membrane (GE Healthcare, RPN303E) Kodak BioMax MS Autoradiography Film (#8222648) MetaPhor agarose (Lonza, #50180) SYBRSafe (Life Technologies, S33102) cOmplete Protease inhibitors, EDTA-free (Roche Applied Science, #11873580001) RNace-IT (Agilent, #400720) diluted 1:20 with water, store at 4°C for at least 2 years SeeBlue Plus2 Pre-Stained Standard (Life Technologies, LC5925) NuPAGE LDS Sample Buffer 4X (Life Technologies, N0007) NuPAGE 4-12% polyacrylamide Bis-Tris gels (Life Technologies, NP0335) NuPAGE SDS MOPS running buffer (Life Technologies, NP0001) NuPage Transfer Buffer (Life Technologies, NP00061) GlycoBlue (Life Technologies, AM9515) MinElute PCR purification kit (QIAGEN, #28004) MinElute Gel extraction kit (QIAGEN, #28604) GeneRuler 50 bp DNA ladder (Thermo Scientific, SM0371) Qubit dsDNA HS Assay Kit (Life Technologies, ) 6 x DNA Loading dye (Thermo Scientific, R0611) T4 PNK, T4 Polynucleotide Kinase (New England BioLabs, M0201L) T4 RNA ligase 1 (New England BioLabs, M0204L) T4 RNA ligase reaction buffer, 10× (supplied with T4 RNA ligase 1) T4 RNA ligase 2 truncated, K227Q (New England BioLabs, M0351L) TSAP, Thermosensitive Alkaline Phosphatase (Promega, M9910) Proteinase K (Roche Applied Science, #03115836001) SuperScript III Reverse Transcriptase (Life Technologies, #18080-044) 5 x First strand buffer (supplied with SuperScript III Reverse Transcriptase) 0.1M DTT (supplied with SuperScript III Reverse Transcriptase) RNase H (New England BioLabs, M0297L) TaKaRa LA Taq (Clontech, RR002M) 10X LA PCR Buffer ll (Mg2+ plus) supplied with TaKaRa LA Taq dNTPs 2.5mM (supplied with TaKaRa LA Taq). .. Use a hood, protective clothing, eyes protection and gloves.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    New England Biolabs t4 rna ligase buffer
    DSSS protocol workflow. ( A ) Fragmentation. RNA is fragmented to sizes in the range of 60–200 nt. ( B ) Dephosphorylation. 5′ phosphates are removed from RNA by treatment with alkaline phosphatase. ( C ) 3′ adapter ligation. Dephosphorylated 200-nt-long RNA fragments are selected by urea-PAGE. The 3′ adapter is ligated to the 3′ ends using <t>T4</t> RNA ligase I. ( D ) Rephosphorylation. Fragments are rephosphorylated by treatment with T4 polynucleotide kinase as preparation for the next ligation step. ( E ) 5′ adapter ligation, preceded by removal of the nonligated 3′adapter by urea-PAGE size selection. ( F ) Reverse transcription (RT) and amplification of library. Molecules with 5′ and 3′ adapters were selected by urea-PAGE. First strand cDNA synthesis and PCR amplification were carried out with the indicated primers. ( G ) Sequencing.
    T4 Rna Ligase Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 95/100, based on 36 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase buffer/product/New England Biolabs
    Average 95 stars, based on 36 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase buffer - by Bioz Stars, 2020-02
    95/100 stars
      Buy from Supplier

    Image Search Results


    DSSS protocol workflow. ( A ) Fragmentation. RNA is fragmented to sizes in the range of 60–200 nt. ( B ) Dephosphorylation. 5′ phosphates are removed from RNA by treatment with alkaline phosphatase. ( C ) 3′ adapter ligation. Dephosphorylated 200-nt-long RNA fragments are selected by urea-PAGE. The 3′ adapter is ligated to the 3′ ends using T4 RNA ligase I. ( D ) Rephosphorylation. Fragments are rephosphorylated by treatment with T4 polynucleotide kinase as preparation for the next ligation step. ( E ) 5′ adapter ligation, preceded by removal of the nonligated 3′adapter by urea-PAGE size selection. ( F ) Reverse transcription (RT) and amplification of library. Molecules with 5′ and 3′ adapters were selected by urea-PAGE. First strand cDNA synthesis and PCR amplification were carried out with the indicated primers. ( G ) Sequencing.

    Journal: Genome Research

    Article Title: Strand-specific deep sequencing of the transcriptome

    doi: 10.1101/gr.094318.109

    Figure Lengend Snippet: DSSS protocol workflow. ( A ) Fragmentation. RNA is fragmented to sizes in the range of 60–200 nt. ( B ) Dephosphorylation. 5′ phosphates are removed from RNA by treatment with alkaline phosphatase. ( C ) 3′ adapter ligation. Dephosphorylated 200-nt-long RNA fragments are selected by urea-PAGE. The 3′ adapter is ligated to the 3′ ends using T4 RNA ligase I. ( D ) Rephosphorylation. Fragments are rephosphorylated by treatment with T4 polynucleotide kinase as preparation for the next ligation step. ( E ) 5′ adapter ligation, preceded by removal of the nonligated 3′adapter by urea-PAGE size selection. ( F ) Reverse transcription (RT) and amplification of library. Molecules with 5′ and 3′ adapters were selected by urea-PAGE. First strand cDNA synthesis and PCR amplification were carried out with the indicated primers. ( G ) Sequencing.

    Article Snippet: We incubated the following reaction mixture for 30 min at 37°C: 10 μL of sample, 1 μL of 10× T4 RNA ligase buffer (as fresh ATP supply), 10 U of polynucleotide kinase (New England BioLabs), 3 μL of RNase free water.

    Techniques: De-Phosphorylation Assay, Ligation, Polyacrylamide Gel Electrophoresis, Selection, Amplification, Polymerase Chain Reaction, Sequencing

    Scheme of the splinted-ligation method in bRNA construction. In this method, a 2΄-5΄ linked ribo-guanosine (G)-nucleoside in an RNA strand containing the 5΄-segment and 2΄-arm (precursor 1) is transformed into a branchpoint nucleotide by ligation to an RNA strand representing the 3΄-arm (precursor 2). To do so, the two precursors are hybridized partially to a complementary RNA bridge. In this way, the 5΄-phosphate of precursor 2 is brought close to the free 3΄-hydroxyl of the 2΄-5΄ linked nucleoside of precursor 1. The two oligonucleotides are then joined by T4 RNA Ligase 2. Red, blue, and pink symbols ‘w’ represent RNA; the black line represents DNA. The 2΄-5΄ linked ribo-G-nucleoside in precursor 1 at nucleotide (nt) position 37 is highlighted. Nucleic acids downstream of a 2΄-5΄ linkage are plotted vertically in linear and branched oligonucleotides.

    Journal: Nucleic Acids Research

    Article Title: Arm-specific cleavage and mutation during reverse transcription of 2΄,5΄-branched RNA by Moloney murine leukemia virus reverse transcriptase

    doi: 10.1093/nar/gkx073

    Figure Lengend Snippet: Scheme of the splinted-ligation method in bRNA construction. In this method, a 2΄-5΄ linked ribo-guanosine (G)-nucleoside in an RNA strand containing the 5΄-segment and 2΄-arm (precursor 1) is transformed into a branchpoint nucleotide by ligation to an RNA strand representing the 3΄-arm (precursor 2). To do so, the two precursors are hybridized partially to a complementary RNA bridge. In this way, the 5΄-phosphate of precursor 2 is brought close to the free 3΄-hydroxyl of the 2΄-5΄ linked nucleoside of precursor 1. The two oligonucleotides are then joined by T4 RNA Ligase 2. Red, blue, and pink symbols ‘w’ represent RNA; the black line represents DNA. The 2΄-5΄ linked ribo-G-nucleoside in precursor 1 at nucleotide (nt) position 37 is highlighted. Nucleic acids downstream of a 2΄-5΄ linkage are plotted vertically in linear and branched oligonucleotides.

    Article Snippet: The ligation reaction was performed in 20 μl containing 1× T4 Rnl2 reaction buffer (NEB), 12.5% (w/v) polyethylene glycol (PEG) 8000 or PEG 4000 and 5 units of T4 RNA Ligase 2 (NEB).

    Techniques: Ligation, Transformation Assay

    In vitro optimization of RNA-to-DNA ligation conditions. Upper panel , Ten pmols of 17-nt adenylated ssDNA oligonucleotide (Universal App DNA, CTGTAGGCACCATCAAT) was incubated with 5 pmols of a 17nt ssRNA test probe (TTTCGTTGGAAGCGGGA) in 1x NEB T4 RNA Ligase Buffer with the indicated ligase (NEB Thermostable 5’ AppDNA/RNA ligase (Therm 5' Ligase), NEB T4 Rnl2tr K227Q Ligase (trT4K) or NEB T4 Rnl2tr R55K, K227Q ligase (trT4KQ)) and/or supplements (PEG, BSA, ATP, RNaseOUT). Products were then analyzed using denaturing polyacrylamide gel electrophoresis using a combination of NEB microRNA and low range ssRNA ladders and stained with SYBR-gold. Bands were quantified and the percent product was calculated using (shifted / (total * 0.66)) to account for the molar excess of DNA over RNA. No adjustment was made to account for preferential staining of ssDNA over ssRNA. Residual signal is expected in the lower band owing to the molar excess of DNA over RNA. A high molecular weight band is visible in the Therm 5’ Ligase lane, which most likely consists of high molecular weight concatemers of the AppDNA substrate caused by incomplete 3’ blocking of these oligos or removal of the 3’ block by the Therm 5’ Ligase. This experiment was performed once.

    Journal: eLife

    Article Title: Chromatin-associated RNA sequencing (ChAR-seq) maps genome-wide RNA-to-DNA contacts

    doi: 10.7554/eLife.27024

    Figure Lengend Snippet: In vitro optimization of RNA-to-DNA ligation conditions. Upper panel , Ten pmols of 17-nt adenylated ssDNA oligonucleotide (Universal App DNA, CTGTAGGCACCATCAAT) was incubated with 5 pmols of a 17nt ssRNA test probe (TTTCGTTGGAAGCGGGA) in 1x NEB T4 RNA Ligase Buffer with the indicated ligase (NEB Thermostable 5’ AppDNA/RNA ligase (Therm 5' Ligase), NEB T4 Rnl2tr K227Q Ligase (trT4K) or NEB T4 Rnl2tr R55K, K227Q ligase (trT4KQ)) and/or supplements (PEG, BSA, ATP, RNaseOUT). Products were then analyzed using denaturing polyacrylamide gel electrophoresis using a combination of NEB microRNA and low range ssRNA ladders and stained with SYBR-gold. Bands were quantified and the percent product was calculated using (shifted / (total * 0.66)) to account for the molar excess of DNA over RNA. No adjustment was made to account for preferential staining of ssDNA over ssRNA. Residual signal is expected in the lower band owing to the molar excess of DNA over RNA. A high molecular weight band is visible in the Therm 5’ Ligase lane, which most likely consists of high molecular weight concatemers of the AppDNA substrate caused by incomplete 3’ blocking of these oligos or removal of the 3’ block by the Therm 5’ Ligase. This experiment was performed once.

    Article Snippet: Step 4B ( Optional additional step B ): RNase control Pre-mix and resuspend the pellet in the following 160 µL water 20 µL 10x T4 RNA ligase buffer 10 µL 10 mg/mL RNaseA 10 µL RNaseH (NEB) Incubate at 37C for 4 hr Centrifuge at 2.5 k x g for 2 min, discard supernatant Add 1000 µL DEPC-treated PBS, mix gently Centrifuge at 2.5 k x g for 2 min, discard supernatant Immediately proceed to the next step, with pre-mixed reaction buffer already prepared

    Techniques: In Vitro, DNA Ligation, Incubation, Polyacrylamide Gel Electrophoresis, Staining, Molecular Weight, Blocking Assay