t4 rna ligase 2 truncated kq  (New England Biolabs)

Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    T4 RNA Ligase 2 truncated KQ
    T4 RNA Ligase 2 truncated KQ 10 000 units
    Catalog Number:
    10 000 units
    RNA Ligases
    Buy from Supplier

    Structured Review

    New England Biolabs t4 rna ligase 2 truncated kq
    T4 RNA Ligase 2 truncated KQ
    T4 RNA Ligase 2 truncated KQ 10 000 units
    https://www.bioz.com/result/t4 rna ligase 2 truncated kq/product/New England Biolabs
    Average 98 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 truncated kq - by Bioz Stars, 2020-07
    98/100 stars


    1) Product Images from "Small RNA Library Preparation Method for Next-Generation Sequencing Using Chemical Modifications to Prevent Adapter Dimer Formation"

    Article Title: Small RNA Library Preparation Method for Next-Generation Sequencing Using Chemical Modifications to Prevent Adapter Dimer Formation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0167009

    Optimization of the 3´ adapter ligation step. Synthetic Let-7d-5p (NNN) miRNA was ligated to the 3´ adapter using the same ligation conditions as the CleanTag library prep workflow step 1. A) Yield increase with addition of PEG 8000 using T4 RNA Ligase 2, truncated KQ and modified 3´ adapter (MP (n-1)). B) Specificity comparison between ligases used in 3´ ligation step: 1) T4 RNA Ligase 2, truncated; 2) T4 RNA Ligase 2, truncated KQ; 3) T4 RNA Ligase 1; 4) No Ligase. Both unmodified and modified (MP (n-1)) 3´ adapters were tested. Side products indicated with red arrows.
    Figure Legend Snippet: Optimization of the 3´ adapter ligation step. Synthetic Let-7d-5p (NNN) miRNA was ligated to the 3´ adapter using the same ligation conditions as the CleanTag library prep workflow step 1. A) Yield increase with addition of PEG 8000 using T4 RNA Ligase 2, truncated KQ and modified 3´ adapter (MP (n-1)). B) Specificity comparison between ligases used in 3´ ligation step: 1) T4 RNA Ligase 2, truncated; 2) T4 RNA Ligase 2, truncated KQ; 3) T4 RNA Ligase 1; 4) No Ligase. Both unmodified and modified (MP (n-1)) 3´ adapters were tested. Side products indicated with red arrows.

    Techniques Used: Ligation, Modification

    Related Articles

    Clone Assay:

    Article Title: Dis3l2-Mediated Decay Is a Quality Control Pathway for Noncoding RNAs
    Article Snippet: .. After RNA isolation of FLAG-mutant Dis3l2 IP samples, 100 ng RNAs were ligated overnight at 25 °C to 2 μM Universal miRNA Cloning Linker (NEB) using 200 units of T4 RNA ligase 2 truncated KQ (NEB) at the presence of 25% PEG 8000, and RNaseOUT. .. Ligated RNAs were purified using RNA Clean & Concentrator-25 columns (Zymo Research) and reverse transcribed by SuperScript III (see RNA extraction and qRT-PCR section) and universal RT+linker primer ( ). cDNAs were diluted and 100 ng cDNA was used for PCR reaction using U1 and U2 gene-specific forward primers ( ) and universal RT+linker reverse primer.

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: .. 3′ RACE Total cellular RNA was isolated from a Δrnr ΔrimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The reaction products were annealed with primer CJ1341 (5′ CCGTGATTGATGGTGCCTACAG 3′), which is complementary to the cloning linker, and reverse-transcribed.

    High Throughput Screening Assay:

    Article Title: RNA-dependent chromatin association of transcription elongation factors and Pol II CTD kinases
    Article Snippet: .. PAR-CLIP library preparation and high-throughput sequencing For 3′ adaptor ligation, beads were resuspended in 1 × T4 RNA ligase buffer (NEB) containing 10 U/µL T4 RNA ligase 2 (KQ) (NEB, M0373), 10 μM 3′ adaptor (5′ 5rApp-TGGAATTCTCGGGTGCCAAGG-3ddC 3′ (IDT, Inc., Coralville, IA )) , 1 U/µL RNase OUT, and 15% (w/v) PEG 8000. ..


    Article Title: Systematic evaluation and optimization of the experimental steps in RNA G-quadruplex structure sequencing
    Article Snippet: .. 3′-adapter ligation reaction The reaction mixture consisted of 1 μl of 1 μM N40 -3′OH RNA (0.1 μM final), 1 μl of 1, 2.5, 5 or 10 μM of 3′-adapter (0.1, 0.25, 0.5 or 1 μM final), 0 or 3.5 μl of 50% polyethylene glycol (PEG) 8000 (0% or 17.5% final), 1 μl of 10X reaction buffer that gave final working concentration of 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2 , 1 mM dithiothreitol (DTT), and 200 U T4 RNA ligase 2, truncated KQ ligase (NEB, M0373S). .. To investigate the effect of PEG concentration on the ligation efficiency, 1 μl of 1 μM N40 -3′OH RNA (0.1 μM final) was reacted with 1 μl of 10 μM of 3′-adapter (1 μM final), under different percentage of PEG 8000.

    Article Title: RNA-dependent chromatin association of transcription elongation factors and Pol II CTD kinases
    Article Snippet: .. PAR-CLIP library preparation and high-throughput sequencing For 3′ adaptor ligation, beads were resuspended in 1 × T4 RNA ligase buffer (NEB) containing 10 U/µL T4 RNA ligase 2 (KQ) (NEB, M0373), 10 μM 3′ adaptor (5′ 5rApp-TGGAATTCTCGGGTGCCAAGG-3ddC 3′ (IDT, Inc., Coralville, IA )) , 1 U/µL RNase OUT, and 15% (w/v) PEG 8000. ..

    Article Title: Methodology for ribosome profiling of key stages of the Caulobacter crescentus cell cycle
    Article Snippet: .. Library generation is performed as described in ( ) but using the T4 RNA ligase KQ mutant (NEB) due to higher efficiency of ligation. ..

    Article Title: Small RNA Library Preparation Method for Next-Generation Sequencing Using Chemical Modifications to Prevent Adapter Dimer Formation
    Article Snippet: .. Ligation Step 1: 1X Buffer 1 (50 mM Tris(hydroxymethyl)aminomethane HCl pH 7.5, 10 mM MgCl2 , 1 mM dithiothreital, ~20% polyethylene glycol (PEG) 8000) (TriLink Biotechnologies), 0.5 μM CleanTag 3΄ Adapter (TriLink Biotechnologies, LLC.), 40 Units murine RNase Inhibitor (New England Biolabs), 200 Units of T4 RNA Ligase 2 truncated KQ (New England Biolabs), RNA input (1 μg), 10 μL total volume. ..


    Article Title: Methodology for ribosome profiling of key stages of the Caulobacter crescentus cell cycle
    Article Snippet: .. Library generation is performed as described in ( ) but using the T4 RNA ligase KQ mutant (NEB) due to higher efficiency of ligation. ..


    Article Title: Dis3l2-Mediated Decay Is a Quality Control Pathway for Noncoding RNAs
    Article Snippet: .. After RNA isolation of FLAG-mutant Dis3l2 IP samples, 100 ng RNAs were ligated overnight at 25 °C to 2 μM Universal miRNA Cloning Linker (NEB) using 200 units of T4 RNA ligase 2 truncated KQ (NEB) at the presence of 25% PEG 8000, and RNaseOUT. .. Ligated RNAs were purified using RNA Clean & Concentrator-25 columns (Zymo Research) and reverse transcribed by SuperScript III (see RNA extraction and qRT-PCR section) and universal RT+linker primer ( ). cDNAs were diluted and 100 ng cDNA was used for PCR reaction using U1 and U2 gene-specific forward primers ( ) and universal RT+linker reverse primer.

    Article Title: Role of ribosome assembly in Escherichia coli ribosomal RNA degradation
    Article Snippet: .. 3′ RACE Total cellular RNA was isolated from a Δrnr ΔrimM strain and ligated to a pre-adenylated universal miRNA cloning linker (NEB cat #S1315S) using T4 RNA ligase 2 truncated KQ (NEB cat #S0373S). .. The reaction products were annealed with primer CJ1341 (5′ CCGTGATTGATGGTGCCTACAG 3′), which is complementary to the cloning linker, and reverse-transcribed.


    Article Title: Bias-minimized quantification of microRNA reveals widespread alternative processing and 3′ end modification
    Article Snippet: .. Small RNA libraries were constructed using either the TruSeq small RNA library preparation kit (Illumina) according to manufacturer's instructions or AQ-seq as follows: miRNA-enriched RNA was ligated to 0.25 μM 3′ randomized adapter using 20 units/μl of T4 RNA ligase 2 truncated KQ (NEB) in 1X T4 RNA ligase reaction buffer (NEB) supplemented with 20% PEG 8000 (NEB) at 25°C for at least 3 h. The ligated RNA was gel-purified on a 15% urea–polyacrylamide gel using two markers (40 nt and 55 nt) to remove the free 3′ adapter and eluted in 0.3 M NaCl. .. The purified RNA was ligated to 0.18 μM 5′ randomized adapter using 1 unit/μl of T4 RNA ligase 1 (NEB) in 1X T4 RNA ligase reaction buffer supplemented with 1 mM ATP and 20% PEG 8000 (NEB) at 37°C for 1 h. The products were reverse-transcribed using 10 units/μl of SuperScript III reverse transcriptase (Invitrogen) in 1X first-strand buffer (Invitrogen) with 0.2 μM RT primer (RTP, TruSeq kit; Illumina), 0.5 mM dNTP (TruSeq kit; Illumina), and 5 mM DTT (Invitrogen) at 50°C for 1 h. The cDNA was amplified using 0.02 unit/μl of Phusion High-Fidelity DNA Polymerase (Thermo Scientific) in 1X Phusion HF buffer (Thermo Scientific) with 0.5 μM primers (RP1 forward primer and RPIX reverse primer, TruSeq kit; Illumina) and 0.2 mM dNTP (TAKARA).

    Concentration Assay:

    Article Title: Systematic evaluation and optimization of the experimental steps in RNA G-quadruplex structure sequencing
    Article Snippet: .. 3′-adapter ligation reaction The reaction mixture consisted of 1 μl of 1 μM N40 -3′OH RNA (0.1 μM final), 1 μl of 1, 2.5, 5 or 10 μM of 3′-adapter (0.1, 0.25, 0.5 or 1 μM final), 0 or 3.5 μl of 50% polyethylene glycol (PEG) 8000 (0% or 17.5% final), 1 μl of 10X reaction buffer that gave final working concentration of 50 mM Tris-HCl (pH 7.5), 10 mM MgCl2 , 1 mM dithiothreitol (DTT), and 200 U T4 RNA ligase 2, truncated KQ ligase (NEB, M0373S). .. To investigate the effect of PEG concentration on the ligation efficiency, 1 μl of 1 μM N40 -3′OH RNA (0.1 μM final) was reacted with 1 μl of 10 μM of 3′-adapter (1 μM final), under different percentage of PEG 8000.


    Article Title: RNA-dependent chromatin association of transcription elongation factors and Pol II CTD kinases
    Article Snippet: .. PAR-CLIP library preparation and high-throughput sequencing For 3′ adaptor ligation, beads were resuspended in 1 × T4 RNA ligase buffer (NEB) containing 10 U/µL T4 RNA ligase 2 (KQ) (NEB, M0373), 10 μM 3′ adaptor (5′ 5rApp-TGGAATTCTCGGGTGCCAAGG-3ddC 3′ (IDT, Inc., Coralville, IA )) , 1 U/µL RNase OUT, and 15% (w/v) PEG 8000. ..


    Article Title: RNA-dependent chromatin association of transcription elongation factors and Pol II CTD kinases
    Article Snippet: .. PAR-CLIP library preparation and high-throughput sequencing For 3′ adaptor ligation, beads were resuspended in 1 × T4 RNA ligase buffer (NEB) containing 10 U/µL T4 RNA ligase 2 (KQ) (NEB, M0373), 10 μM 3′ adaptor (5′ 5rApp-TGGAATTCTCGGGTGCCAAGG-3ddC 3′ (IDT, Inc., Coralville, IA )) , 1 U/µL RNase OUT, and 15% (w/v) PEG 8000. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 98
    New England Biolabs t4 rna ligase 2 truncated kq
    Optimization of the 3´ adapter ligation step. Synthetic Let-7d-5p (NNN) miRNA was ligated to the 3´ adapter using the same ligation conditions as the CleanTag library prep workflow step 1. A) Yield increase with addition of PEG 8000 using <t>T4</t> RNA Ligase 2, truncated KQ and modified 3´ adapter (MP (n-1)). B) Specificity comparison between ligases used in 3´ ligation step: 1) T4 RNA Ligase 2, truncated; 2) T4 RNA Ligase 2, truncated KQ; 3) T4 RNA Ligase 1; 4) No Ligase. Both unmodified and modified (MP (n-1)) 3´ adapters were tested. Side products indicated with red arrows.
    T4 Rna Ligase 2 Truncated Kq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 98/100, based on 16 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2 truncated kq/product/New England Biolabs
    Average 98 stars, based on 16 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 truncated kq - by Bioz Stars, 2020-07
    98/100 stars
      Buy from Supplier

    New England Biolabs t4 rna ligase 2
    Optimization of the 3´ adapter ligation step. Synthetic Let-7d-5p (NNN) miRNA was ligated to the 3´ adapter using the same ligation conditions as the CleanTag library prep workflow step 1. A) Yield increase with addition of PEG 8000 using <t>T4</t> RNA Ligase 2, truncated KQ and modified 3´ adapter (MP (n-1)). B) Specificity comparison between ligases used in 3´ ligation step: 1) T4 RNA Ligase 2, truncated; 2) T4 RNA Ligase 2, truncated KQ; 3) T4 RNA Ligase 1; 4) No Ligase. Both unmodified and modified (MP (n-1)) 3´ adapters were tested. Side products indicated with red arrows.
    T4 Rna Ligase 2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 205 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2/product/New England Biolabs
    Average 99 stars, based on 205 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    New England Biolabs t4 rna ligase 2 kq
    Optimization of the 3´ adapter ligation step. Synthetic Let-7d-5p (NNN) miRNA was ligated to the 3´ adapter using the same ligation conditions as the CleanTag library prep workflow step 1. A) Yield increase with addition of PEG 8000 using <t>T4</t> RNA Ligase 2, truncated KQ and modified 3´ adapter (MP (n-1)). B) Specificity comparison between ligases used in 3´ ligation step: 1) T4 RNA Ligase 2, truncated; 2) T4 RNA Ligase 2, truncated KQ; 3) T4 RNA Ligase 1; 4) No Ligase. Both unmodified and modified (MP (n-1)) 3´ adapters were tested. Side products indicated with red arrows.
    T4 Rna Ligase 2 Kq, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2 kq/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 kq - by Bioz Stars, 2020-07
    99/100 stars
      Buy from Supplier

    Image Search Results

    Optimization of the 3´ adapter ligation step. Synthetic Let-7d-5p (NNN) miRNA was ligated to the 3´ adapter using the same ligation conditions as the CleanTag library prep workflow step 1. A) Yield increase with addition of PEG 8000 using T4 RNA Ligase 2, truncated KQ and modified 3´ adapter (MP (n-1)). B) Specificity comparison between ligases used in 3´ ligation step: 1) T4 RNA Ligase 2, truncated; 2) T4 RNA Ligase 2, truncated KQ; 3) T4 RNA Ligase 1; 4) No Ligase. Both unmodified and modified (MP (n-1)) 3´ adapters were tested. Side products indicated with red arrows.

    Journal: PLoS ONE

    Article Title: Small RNA Library Preparation Method for Next-Generation Sequencing Using Chemical Modifications to Prevent Adapter Dimer Formation

    doi: 10.1371/journal.pone.0167009

    Figure Lengend Snippet: Optimization of the 3´ adapter ligation step. Synthetic Let-7d-5p (NNN) miRNA was ligated to the 3´ adapter using the same ligation conditions as the CleanTag library prep workflow step 1. A) Yield increase with addition of PEG 8000 using T4 RNA Ligase 2, truncated KQ and modified 3´ adapter (MP (n-1)). B) Specificity comparison between ligases used in 3´ ligation step: 1) T4 RNA Ligase 2, truncated; 2) T4 RNA Ligase 2, truncated KQ; 3) T4 RNA Ligase 1; 4) No Ligase. Both unmodified and modified (MP (n-1)) 3´ adapters were tested. Side products indicated with red arrows.

    Article Snippet: Ligation Step 1: 1X Buffer 1 (50 mM Tris(hydroxymethyl)aminomethane HCl pH 7.5, 10 mM MgCl2 , 1 mM dithiothreital, ~20% polyethylene glycol (PEG) 8000) (TriLink Biotechnologies), 0.5 μM CleanTag 3΄ Adapter (TriLink Biotechnologies, LLC.), 40 Units murine RNase Inhibitor (New England Biolabs), 200 Units of T4 RNA Ligase 2 truncated KQ (New England Biolabs), RNA input (1 μg), 10 μL total volume.

    Techniques: Ligation, Modification