t4 rna ligase 2 truncated k227q (New England Biolabs)
New England Biolabs is a verified supplier 
99
|
Name:
T4 RNA Ligase 2 truncated K227Q
Description:
T4 RNA Ligase 2 truncated K227Q 10 000 units
Catalog Number:
M0351L
Price:
273
Size:
10 000 units
Category:
RNA Ligases
Score:
85
|
Buy from Supplier |
Structured Review
New England Biolabs
t4 rna ligase 2 truncated k227q
T4 RNA Ligase 2 truncated K227Q 10 000 units
https://www.bioz.com/result/t4 rna ligase 2 truncated k227q/product/New England Biolabs
Average 99 stars, based on 9 article reviews
Price from $9.99 to $1999.99
T4 RNA Ligase 2 truncated K227Q 10 000 units
https://www.bioz.com/result/t4 rna ligase 2 truncated k227q/product/New England Biolabs
Average 99 stars, based on 9 article reviews
Price from $9.99 to $1999.99
t4 rna ligase 2 truncated k227q - by Bioz Stars,
2019-12
99/100 stars
Related Products / Commonly Used Together
Images
1) Product Images from "T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis"
Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis
Journal: BMC Biotechnology
doi: 10.1186/1472-6750-11-72
Figure Legend Snippet: Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
Techniques Used: Activity Assay, Labeling, Ligation, Binding Assay
Figure Legend Snippet: Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.
Techniques Used: Activity Assay, Incubation, Staining, Electrophoretic Mobility Shift Assay, Binding Assay
Figure Legend Snippet: Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4 RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.
Techniques Used: Incubation, Staining, Ligation, Binding Assay
![Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.](https://storage.googleapis.com/bioz_article_images/PMC3149579/1472-6750-11-72-9.jpg "Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.")
Figure Legend Snippet: Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.
Techniques Used: Ligation, Labeling, Incubation, Acrylamide Gel Assay, Nucleic Acid Electrophoresis, Binding Assay
Figure Legend Snippet: Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4 RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.
Techniques Used: Ligation, Incubation, Staining, Binding Assay
Figure Legend Snippet: Purification and activity of T4 RNA Ligase 2 truncated mutants . (A) Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left. (B) Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p
Techniques Used: Purification, Activity Assay, Staining, Marker, Incubation, Labeling, Binding Assay
Figure Legend Snippet: Effect of pH on ligase intermolecular strand-joining activity . (A-D) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. (E-H) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
Techniques Used: Activity Assay, Labeling, Ligation, Binding Assay
Figure Legend Snippet: Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
Techniques Used: Labeling, Ligation, Binding Assay
2) Product Images from "Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture"
Article Title: Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture
Journal: PLoS ONE
doi: 10.1371/journal.pone.0094619
Figure Legend Snippet: MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. T4 RNA Ligase 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated K227Q (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.
Techniques Used: Ligation, Polyacrylamide Gel Electrophoresis, Mutagenesis
Figure Legend Snippet: Schematic illustration of microRNA capture by 3′ adapter ligation. The 19 nt, enzymatically pre-adenlyated adapter is ligated to the 3′ OH of microRNA using T4 RNA ligase 2. The reaction is run at 25°C for 4 hours in the absence of ATP. In order to characterize capture efficiency, the microRNA is end labeled with Cy3. The 3′ end of the adapter is blocked by –ddC, a fluorophore, or other moiety to prevent the formation of concatemers and circularized products.
Techniques Used: Ligation, Labeling
Related Articles
Clone Assay:Article Title: Preparation of Multiplexed Small RNA Libraries From Plants Article Snippet: Fiber glass (Corning Incorporated, catalog number: 988-10144) Extra thick blot paper (Bio-Rad Laboratories, catalog number: 170-3969) Whatman DE81 ion exchange cellulose chromatography paper (Thermo Fisher Scientific, catalog number: 05-717-1A) GlycoBlue coprecipitant (Life Technologies, catalog number: AM9516) 100% ethanol 75% ethanol EB buffer (QIAGEN, catalog number: 19086) Qubit RNA HS Assay Kit for quantification of purified small RNAs (Life Technologies, catalog number: ) Qubit dsDNA HS Assay Kit for quantification of DNA amplicon (Life Technologies, catalog number: ) Low salt buffer (see Recipes) High salt buffer (see Recipes) .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) Article Title: The Coding Regions of Germline mRNAs Confer Sensitivity to Argonaute Regulation in C. elegans Article Snippet: Paragraph title: Small RNA Cloning and Deep Sequencing ... Samples from wild-type and mutant were pretreated with a homemade 5′ polyphosphatase and were ligated to the 3′ adaptor linker 1 (5′ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3′, IDT) using Article Title: Evaluating bias-reducing protocols for RNA sequencing library preparation Article Snippet: For the CircLig libraries, 40 ng RNA pool (~6 pmol) and 100 ng Universal Cloning Linker (~18 pmol; NEB) were denatured at 80°C for 2 min then placed immediately on ice. .. Ligation with 200 U Article Title: The microRNAs in an Ancient Protist Repress the Variant-Specific Surface Protein Expression by Targeting the Entire Coding Sequence Article Snippet: For the addition of a sonication step to the procedure, the cells were resuspend in RIPA buffer as described previously and sonicated twice with five 1 second bursts at a 20% duty cycle. .. The purified small RNAs were ligated at the 3′-end to 5–10 µM gel purified miRNA Cloning Linker-1 (IDT) using T4 RNA ligase 2 and truncated with Article Title: Transgenerational function of Tetrahymena Piwi protein Twi8p at distinctive noncoding RNA loci Article Snippet: Size selection of purified sRNAs was performed by denaturing PAGE. sRNAs were prepared for Solexa sequencing as previously described ( ). .. Briefly, IDT miRNA cloning linker 1 (Modban) was ligated to the 3′ end of the purified sRNAs using T4 RNA ligase, truncated, Centrifugation:Article Title: A Novel Epigenetic Silencing Pathway Involving the Highly Conserved 5’-3’ Exoribonuclease Dhp1/Rat1/Xrn2 in Schizosaccharomyces pombe Article Snippet: The TEV eluates were collected by centrifugation and incubated with 10U of Turbo DNase (Ambion) for 8 min at 37°C followed by incubation with RNase Cocktail Enzyme Mix (Ambion; 0.005 U RnaseA, 0.2 U Rnase T1) for 2 min at 37°C. .. All washes, alkaline phosphatase treatment and 3’ linker ligation were carried out as described except that 40U Amplification:Article Title: The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan Article Snippet: Ligation of RNA 3′ adapter (RA3, part # 15013207, Illumina) was done using T4 RNA Ligase 2, truncated Article Title: The Coding Regions of Germline mRNAs Confer Sensitivity to Argonaute Regulation in C. elegans Article Snippet: Samples from wild-type and mutant were pretreated with a homemade 5′ polyphosphatase and were ligated to the 3′ adaptor linker 1 (5′ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3′, IDT) using Article Title: Substantial and robust changes in microRNA transcriptome support postnatal development of the hypothalamus in rat Article Snippet: Individual cDNA libraries were built following an Illumina-like protocol in which 3′- and 5′-adapters were sequentially ligated at the 3′ and 5′ ends of small RNAs, respectively, to allow for reverse transcription (RT) and amplification by polymerase chain reaction (PCR). .. To prevent secondary structures, mix were heated for 3 min at 70 °C, then kept on ice while adding [50%] PEG 8000 (2.4 ul), 80 U of truncated Article Title: The ribonuclease activity of SAMHD1 is required for HIV-1 restriction Article Snippet: 3′ adaptor (5′/rApp/TGGAATTCTCGGGTGCCAAGG/ddC/-3′, IDT) was ligated using Article Title: Single‐cell mRNA profiling reveals the hierarchical response of mi RNA targets to mi RNA induction Article Snippet: After another round of RNeasy MinElute Cleanup Kit (Qiagen, Inc.), a pre‐adenylated DNA adapter (5′‐TGGAATTCTCGGGTGCCAAGG‐3′) was ligated to the 3′ end of the mRNA fragments at 4°C overnight using the T4 RNA ligase 2, truncated Article Title: Histone gene replacement reveals a post-transcriptional role for H3K36 in maintaining metazoan transcriptome fidelity Article Snippet: For semi-quantitative PCR, PCR reactions were prepared in biological triplicate using 2x Red Master Mix (Apex Bioscience), and targets were amplified for 35 cycles of PCR with a 95°C denaturation step, a 60°C annealing step, and a 72°C elongation step. .. For LM-PAT, 1 µg total RNA was incubated with 5 pmol preadenylated lmPAT anchor primer (ppApCAGCTGTAGCTATGCGCACCGAGTCAGATCAG) (adenylated using 5’ DNA Adenylation Kit, NEB), and ligated with T4 RNA Ligase 2, truncated Polyacrylamide Gel Electrophoresis:Article Title: Preparation of Multiplexed Small RNA Libraries From Plants Article Snippet: Fiber glass (Corning Incorporated, catalog number: 988-10144) Extra thick blot paper (Bio-Rad Laboratories, catalog number: 170-3969) Whatman DE81 ion exchange cellulose chromatography paper (Thermo Fisher Scientific, catalog number: 05-717-1A) GlycoBlue coprecipitant (Life Technologies, catalog number: AM9516) 100% ethanol 75% ethanol EB buffer (QIAGEN, catalog number: 19086) Qubit RNA HS Assay Kit for quantification of purified small RNAs (Life Technologies, catalog number: ) Qubit dsDNA HS Assay Kit for quantification of DNA amplicon (Life Technologies, catalog number: ) Low salt buffer (see Recipes) High salt buffer (see Recipes) .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) Article Title: Transgenerational function of Tetrahymena Piwi protein Twi8p at distinctive noncoding RNA loci Article Snippet: Size selection of purified sRNAs was performed by denaturing PAGE. sRNAs were prepared for Solexa sequencing as previously described ( ). .. Briefly, IDT miRNA cloning linker 1 (Modban) was ligated to the 3′ end of the purified sRNAs using T4 RNA ligase, truncated, Synthesized:Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena Article Snippet: A 20-μL aliquot of the RNA was end-repaired and resuspended in 10.5 μL of water. cDNA was synthesized as described above in the section “Small RNA cDNA Library Preparation and Sequencing” with some modifications. .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of Article Title: The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan Article Snippet: Ligation of RNA 3′ adapter (RA3, part # 15013207, Illumina) was done using T4 RNA Ligase 2, truncated Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: 3′-OH RNA previously prepared by CIP treatment was ligated to a 3′ adaptor using T4 RNA Ligase 2, truncated Autoradiography:Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: 32 P-labeled RNA was identified by autoradiography, excised, and extracted following proteinase K (New England Biolabs (NEB)) digestion. .. 3′-OH RNA previously prepared by CIP treatment was ligated to a 3′ adaptor using T4 RNA Ligase 2, truncated Blocking Assay:Article Title: BioTAP-XL - crosslinking/tandem affinity purification to study DNA targets, RNA and protein components of chromatin associated complexes Article Snippet: CRAC-TN150 buffer (see recipe) CRAC-Wash buffer 1 (see recipe) 1 x CRAC-PNK buffer (see recipe) 5 x CRAC-PNK buffer (see recipe) TruSeq ChIP Sample Prep Kit for ChIP-Seq (Illumina, IP-202-1012) RNace-It Ribonuclease Cocktail 6000U (Agilent Technologies Inc, cat. no. 400720) TSAP Thermosensitive Alkaline Phosphatase (Promega, cat. no. M9910) RNasin Recombinant Ribonuclease Inhibitor (Promega, cat. no. N2515) 10mM dNTP Mix (Invitrogen, cat. no. 18427-088) SuperScript III First-Strand Synthesis kit (Invitrogen, cat. no. 18080-051) Phusion Hot Start II DNA Polymerase 2 U/μL (Thermo Scientific, cat. no. F-549S) T4 RNA ligase 2 truncated K227Q and 50% Concentration Assay:Article Title: Kinetic CRAC uncovers a role for Nab3 in determining gene expression profiles during stress Article Snippet: Beads were subsequently incubated with 80 µl of 1xPNK buffer containing eight units of TSAP alkaline phosphatase (Promega) and 80 units of recombinant RNasin (Promega) for 1 h at 37 °C. .. After one 500 µl wash with wash buffer I and three 500 µl washes with 1xPNK buffer, the beads were resuspended in 80 µl of 3′ linker ligation mix (1xPNK buffer, App-PE 3′ adapter (see Supplementary Table ; 0.6 µM final concentration), 10% PEG8000, 30 units of Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses Article Snippet: The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by Real-time Polymerase Chain Reaction:Article Title: Histone gene replacement reveals a post-transcriptional role for H3K36 in maintaining metazoan transcriptome fidelity Article Snippet: For RT-qPCR, reactions were prepared in biological triplicate using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific), and fluorescence was monitored across 40 cycles in 96 well plate format. .. For LM-PAT, 1 µg total RNA was incubated with 5 pmol preadenylated lmPAT anchor primer (ppApCAGCTGTAGCTATGCGCACCGAGTCAGATCAG) (adenylated using 5’ DNA Adenylation Kit, NEB), and ligated with T4 RNA Ligase 2, truncated cDNA Library Assay:Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena Article Snippet: A 20-μL aliquot of the RNA was end-repaired and resuspended in 10.5 μL of water. cDNA was synthesized as described above in the section “Small RNA cDNA Library Preparation and Sequencing” with some modifications. .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of Article Title: Substantial and robust changes in microRNA transcriptome support postnatal development of the hypothalamus in rat Article Snippet: Paragraph title: cDNA library construction ... To prevent secondary structures, mix were heated for 3 min at 70 °C, then kept on ice while adding [50%] PEG 8000 (2.4 ul), 80 U of truncated Incubation:Article Title: Kinetic CRAC uncovers a role for Nab3 in determining gene expression profiles during stress Article Snippet: Beads were subsequently incubated with 80 µl of 1xPNK buffer containing eight units of TSAP alkaline phosphatase (Promega) and 80 units of recombinant RNasin (Promega) for 1 h at 37 °C. .. After one 500 µl wash with wash buffer I and three 500 µl washes with 1xPNK buffer, the beads were resuspended in 80 µl of 3′ linker ligation mix (1xPNK buffer, App-PE 3′ adapter (see Supplementary Table ; 0.6 µM final concentration), 10% PEG8000, 30 units of Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena Article Snippet: A 20-μL aliquot of the RNA was end-repaired and resuspended in 10.5 μL of water. cDNA was synthesized as described above in the section “Small RNA cDNA Library Preparation and Sequencing” with some modifications. .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses Article Snippet: Transcripts were then incubated with Shrimp Alkaline Phosphatase/rSAP (New England BioLabs) at 37°C for 45 min to dephosphorylate the 5′ end of RNAs and to hydrolyze remaining NTPs from the reaction. .. The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by Article Title: A Novel Epigenetic Silencing Pathway Involving the Highly Conserved 5’-3’ Exoribonuclease Dhp1/Rat1/Xrn2 in Schizosaccharomyces pombe Article Snippet: Samples were incubated with 50 μl of nickel agarose beads (Macherey-Nagel) over night at 4°C. .. All washes, alkaline phosphatase treatment and 3’ linker ligation were carried out as described except that 40U Article Title: The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan Article Snippet: The fragmented mRNA was further incubated with ATP and T4 polynucleotide kinase (EK0032, Fermentas) at 37 °C for 1 h and subsequently purified. .. Ligation of RNA 3′ adapter (RA3, part # 15013207, Illumina) was done using T4 RNA Ligase 2, truncated Article Title: Substantial and robust changes in microRNA transcriptome support postnatal development of the hypothalamus in rat Article Snippet: 3′-Adaptor (25 pmoles) was adenylated as described using 1600 U of T4 DNA ligase (NEB) and the Quick Ligation reaction buffer (NEB) in a volume of 50 ul by overnight incubation at 37 °C. .. To prevent secondary structures, mix were heated for 3 min at 70 °C, then kept on ice while adding [50%] PEG 8000 (2.4 ul), 80 U of truncated Article Title: Global analysis of CPSF2-mediated alternative splicing: Integration of global iCLIP and transcriptome profiling data Article Snippet: Samples were then washed twice with high-salt wash buffer and once with 900 μl PNK wash buffer. .. To ligate linkers to the 3′ end of RNAs, 4.5 μl of purified RNA was mixed with 1 μl of 10 μM miRCat33 Adaptor (Integrated DNA Technologies), 1.5 μl of RNA Ligase buffer, 0.5 μl of T4 RNA Ligase 2, Truncated Article Title: Histone gene replacement reveals a post-transcriptional role for H3K36 in maintaining metazoan transcriptome fidelity Article Snippet: For RT-qPCR, reactions were prepared in biological triplicate using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific), and fluorescence was monitored across 40 cycles in 96 well plate format. .. For LM-PAT, 1 µg total RNA was incubated with 5 pmol preadenylated lmPAT anchor primer (ppApCAGCTGTAGCTATGCGCACCGAGTCAGATCAG) (adenylated using 5’ DNA Adenylation Kit, NEB), and ligated with T4 RNA Ligase 2, truncated Article Title: The microRNAs in an Ancient Protist Repress the Variant-Specific Surface Protein Expression by Targeting the Entire Coding Sequence Article Snippet: For the addition of a sonication step to the procedure, the cells were resuspend in RIPA buffer as described previously and sonicated twice with five 1 second bursts at a 20% duty cycle. .. The purified small RNAs were ligated at the 3′-end to 5–10 µM gel purified miRNA Cloning Linker-1 (IDT) using T4 RNA ligase 2 and truncated with Article Title: Transgenerational function of Tetrahymena Piwi protein Twi8p at distinctive noncoding RNA loci Article Snippet: Bound Twi8 RNPs were eluted by cleavage with Tobacco Etch Virus protease, and the eluate was incubated with Flag M2 antibody resin. .. Briefly, IDT miRNA cloning linker 1 (Modban) was ligated to the 3′ end of the purified sRNAs using T4 RNA ligase, truncated, Activity Assay:Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses Article Snippet: The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by T4 RNA Ligase 2 truncated K227Q (New England BioLabs) ( ). .. The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by Modification:Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses Article Snippet: Afterward, phosphatase activity was eliminated by heat inactivation at 65°C for 5 min. .. The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by Article Title: The microRNAs in an Ancient Protist Repress the Variant-Specific Surface Protein Expression by Targeting the Entire Coding Sequence Article Snippet: The NGS libraries of GlAgo associated small RNAs were constructed using a modified version of the Mello Lab protocol ( www.lsi.umich.edu/files/SmallRNACloning.pdf ). .. The purified small RNAs were ligated at the 3′-end to 5–10 µM gel purified miRNA Cloning Linker-1 (IDT) using T4 RNA ligase 2 and truncated with Western Blot:Article Title: The microRNAs in an Ancient Protist Repress the Variant-Specific Surface Protein Expression by Targeting the Entire Coding Sequence Article Snippet: Briefly, the GlAgo associated small RNAs were isolated from Giardia WB trophozoites as previously described and resuspended in 10 µl RNase-free diH2 O . .. The purified small RNAs were ligated at the 3′-end to 5–10 µM gel purified miRNA Cloning Linker-1 (IDT) using T4 RNA ligase 2 and truncated with Ligation:Article Title: Kinetic CRAC uncovers a role for Nab3 in determining gene expression profiles during stress Article Snippet: Beads were subsequently incubated with 80 µl of 1xPNK buffer containing eight units of TSAP alkaline phosphatase (Promega) and 80 units of recombinant RNasin (Promega) for 1 h at 37 °C. .. After one 500 µl wash with wash buffer I and three 500 µl washes with 1xPNK buffer, the beads were resuspended in 80 µl of 3′ linker ligation mix (1xPNK buffer, App-PE 3′ adapter (see Supplementary Table ; 0.6 µM final concentration), 10% PEG8000, 30 units of Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena Article Snippet: A 20-μL aliquot of the RNA was end-repaired and resuspended in 10.5 μL of water. cDNA was synthesized as described above in the section “Small RNA cDNA Library Preparation and Sequencing” with some modifications. .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses Article Snippet: The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by Article Title: A Novel Epigenetic Silencing Pathway Involving the Highly Conserved 5’-3’ Exoribonuclease Dhp1/Rat1/Xrn2 in Schizosaccharomyces pombe Article Snippet: Samples were incubated with 50 μl of nickel agarose beads (Macherey-Nagel) over night at 4°C. .. All washes, alkaline phosphatase treatment and 3’ linker ligation were carried out as described except that 40U Article Title: The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan Article Snippet: The fragmented mRNA was further incubated with ATP and T4 polynucleotide kinase (EK0032, Fermentas) at 37 °C for 1 h and subsequently purified. .. Ligation of RNA 3′ adapter (RA3, part # 15013207, Illumina) was done using T4 RNA Ligase 2, truncated Article Title: BioTAP-XL - crosslinking/tandem affinity purification to study DNA targets, RNA and protein components of chromatin associated complexes Article Snippet: CRAC-TN150 buffer (see recipe) CRAC-Wash buffer 1 (see recipe) 1 x CRAC-PNK buffer (see recipe) 5 x CRAC-PNK buffer (see recipe) TruSeq ChIP Sample Prep Kit for ChIP-Seq (Illumina, IP-202-1012) RNace-It Ribonuclease Cocktail 6000U (Agilent Technologies Inc, cat. no. 400720) TSAP Thermosensitive Alkaline Phosphatase (Promega, cat. no. M9910) RNasin Recombinant Ribonuclease Inhibitor (Promega, cat. no. N2515) 10mM dNTP Mix (Invitrogen, cat. no. 18427-088) SuperScript III First-Strand Synthesis kit (Invitrogen, cat. no. 18080-051) Phusion Hot Start II DNA Polymerase 2 U/μL (Thermo Scientific, cat. no. F-549S) T4 RNA ligase 2 truncated K227Q and 50% Article Title: Oligoadenylation of 3′ decay intermediates promotes cytoplasmic mRNA degradation in Drosophila cells Article Snippet: In the first data set, a control ligation in the absence of ATP was carried out with a preadenylated adaptor and T4 RNA ligase 1. .. In the second data set, truncated Article Title: Substantial and robust changes in microRNA transcriptome support postnatal development of the hypothalamus in rat Article Snippet: 3′-Adaptor (25 pmoles) was adenylated as described using 1600 U of T4 DNA ligase (NEB) and the Quick Ligation reaction buffer (NEB) in a volume of 50 ul by overnight incubation at 37 °C. .. To prevent secondary structures, mix were heated for 3 min at 70 °C, then kept on ice while adding [50%] PEG 8000 (2.4 ul), 80 U of truncated Article Title: Evaluating bias-reducing protocols for RNA sequencing library preparation Article Snippet: For the CircLig libraries, 40 ng RNA pool (~6 pmol) and 100 ng Universal Cloning Linker (~18 pmol; NEB) were denatured at 80°C for 2 min then placed immediately on ice. .. Ligation with 200 U Article Title: The ribonuclease activity of SAMHD1 is required for HIV-1 restriction Article Snippet: 35–60 nucleotide RNA was extracted in a polyacrylamide, 7 M urea, TBE gel. .. 3′ adaptor (5′/rApp/TGGAATTCTCGGGTGCCAAGG/ddC/-3′, IDT) was ligated using Article Title: Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture Article Snippet: Paragraph title: Ligation Protocol ... In the experiments where different ligases were investigated, T4 RNA Ligase 2 truncated, Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: To account for potential bias introduced during adaptor ligation and sequencing, we also generated RNA-seq libraries using RNA extracted from uncross-linked cell lysates of influenza infected 293T cells from which RNA was isolated by TRIzol (Invitrogen) extraction, then 10 μg RNA was fragmented by Mg2+ at 95 °C for 12 min (NEB, Magnesium RNA Fragmentation Module). .. 3′-OH RNA previously prepared by CIP treatment was ligated to a 3′ adaptor using T4 RNA Ligase 2, truncated Infection:Article Title: The ribonuclease activity of SAMHD1 is required for HIV-1 restriction Article Snippet: Total RNA was extracted from mock- and SAMHD1-expressing U937 cells uninfected or infected with HIV-1 using TRIzol reagent (Invitrogen) by manufacturer's instruction followed by addition of spike-in poly(A)-tailed RNA (GeneChip Eukaryotic Poly-A RNA control Kit, Affymetrix) to reduce background noise and allow comparison between samples. .. 3′ adaptor (5′/rApp/TGGAATTCTCGGGTGCCAAGG/ddC/-3′, IDT) was ligated using Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: To account for potential bias introduced during adaptor ligation and sequencing, we also generated RNA-seq libraries using RNA extracted from uncross-linked cell lysates of influenza infected 293T cells from which RNA was isolated by TRIzol (Invitrogen) extraction, then 10 μg RNA was fragmented by Mg2+ at 95 °C for 12 min (NEB, Magnesium RNA Fragmentation Module). .. 3′-OH RNA previously prepared by CIP treatment was ligated to a 3′ adaptor using T4 RNA Ligase 2, truncated Generated:Article Title: Oligoadenylation of 3′ decay intermediates promotes cytoplasmic mRNA degradation in Drosophila cells Article Snippet: In the second data set, truncated Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: To account for potential bias introduced during adaptor ligation and sequencing, we also generated RNA-seq libraries using RNA extracted from uncross-linked cell lysates of influenza infected 293T cells from which RNA was isolated by TRIzol (Invitrogen) extraction, then 10 μg RNA was fragmented by Mg2+ at 95 °C for 12 min (NEB, Magnesium RNA Fragmentation Module). .. 3′-OH RNA previously prepared by CIP treatment was ligated to a 3′ adaptor using T4 RNA Ligase 2, truncated Polymerase Chain Reaction:Article Title: The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan Article Snippet: Ligation of RNA 3′ adapter (RA3, part # 15013207, Illumina) was done using T4 RNA Ligase 2, truncated Article Title: Preparation of Multiplexed Small RNA Libraries From Plants Article Snippet: Fiber glass (Corning Incorporated, catalog number: 988-10144) Extra thick blot paper (Bio-Rad Laboratories, catalog number: 170-3969) Whatman DE81 ion exchange cellulose chromatography paper (Thermo Fisher Scientific, catalog number: 05-717-1A) GlycoBlue coprecipitant (Life Technologies, catalog number: AM9516) 100% ethanol 75% ethanol EB buffer (QIAGEN, catalog number: 19086) Qubit RNA HS Assay Kit for quantification of purified small RNAs (Life Technologies, catalog number: ) Qubit dsDNA HS Assay Kit for quantification of DNA amplicon (Life Technologies, catalog number: ) Low salt buffer (see Recipes) High salt buffer (see Recipes) .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) Article Title: The Coding Regions of Germline mRNAs Confer Sensitivity to Argonaute Regulation in C. elegans Article Snippet: Samples from wild-type and mutant were pretreated with a homemade 5′ polyphosphatase and were ligated to the 3′ adaptor linker 1 (5′ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3′, IDT) using Article Title: Oligoadenylation of 3′ decay intermediates promotes cytoplasmic mRNA degradation in Drosophila cells Article Snippet: In the second data set, truncated Article Title: Substantial and robust changes in microRNA transcriptome support postnatal development of the hypothalamus in rat Article Snippet: Individual cDNA libraries were built following an Illumina-like protocol in which 3′- and 5′-adapters were sequentially ligated at the 3′ and 5′ ends of small RNAs, respectively, to allow for reverse transcription (RT) and amplification by polymerase chain reaction (PCR). .. To prevent secondary structures, mix were heated for 3 min at 70 °C, then kept on ice while adding [50%] PEG 8000 (2.4 ul), 80 U of truncated Article Title: The ribonuclease activity of SAMHD1 is required for HIV-1 restriction Article Snippet: 3′ adaptor (5′/rApp/TGGAATTCTCGGGTGCCAAGG/ddC/-3′, IDT) was ligated using Article Title: Single‐cell mRNA profiling reveals the hierarchical response of mi RNA targets to mi RNA induction Article Snippet: After another round of RNeasy MinElute Cleanup Kit (Qiagen, Inc.), a pre‐adenylated DNA adapter (5′‐TGGAATTCTCGGGTGCCAAGG‐3′) was ligated to the 3′ end of the mRNA fragments at 4°C overnight using the T4 RNA ligase 2, truncated Article Title: Histone gene replacement reveals a post-transcriptional role for H3K36 in maintaining metazoan transcriptome fidelity Article Snippet: Paragraph title: Reverse transcription and PCR assays ... For LM-PAT, 1 µg total RNA was incubated with 5 pmol preadenylated lmPAT anchor primer (ppApCAGCTGTAGCTATGCGCACCGAGTCAGATCAG) (adenylated using 5’ DNA Adenylation Kit, NEB), and ligated with T4 RNA Ligase 2, truncated Article Title: Transgenerational function of Tetrahymena Piwi protein Twi8p at distinctive noncoding RNA loci Article Snippet: Briefly, IDT miRNA cloning linker 1 (Modban) was ligated to the 3′ end of the purified sRNAs using T4 RNA ligase, truncated, Imaging:Article Title: The ribonuclease activity of SAMHD1 is required for HIV-1 restriction Article Snippet: 3′ adaptor (5′/rApp/TGGAATTCTCGGGTGCCAAGG/ddC/-3′, IDT) was ligated using Reverse Transcription Polymerase Chain Reaction:Article Title: Preparation of Multiplexed Small RNA Libraries From Plants Article Snippet: Fiber glass (Corning Incorporated, catalog number: 988-10144) Extra thick blot paper (Bio-Rad Laboratories, catalog number: 170-3969) Whatman DE81 ion exchange cellulose chromatography paper (Thermo Fisher Scientific, catalog number: 05-717-1A) GlycoBlue coprecipitant (Life Technologies, catalog number: AM9516) 100% ethanol 75% ethanol EB buffer (QIAGEN, catalog number: 19086) Qubit RNA HS Assay Kit for quantification of purified small RNAs (Life Technologies, catalog number: ) Qubit dsDNA HS Assay Kit for quantification of DNA amplicon (Life Technologies, catalog number: ) Low salt buffer (see Recipes) High salt buffer (see Recipes) .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) Sonication:Article Title: The microRNAs in an Ancient Protist Repress the Variant-Specific Surface Protein Expression by Targeting the Entire Coding Sequence Article Snippet: For the addition of a sonication step to the procedure, the cells were resuspend in RIPA buffer as described previously and sonicated twice with five 1 second bursts at a 20% duty cycle. .. The purified small RNAs were ligated at the 3′-end to 5–10 µM gel purified miRNA Cloning Linker-1 (IDT) using T4 RNA ligase 2 and truncated with Affinity Purification:Article Title: Transgenerational function of Tetrahymena Piwi protein Twi8p at distinctive noncoding RNA loci Article Snippet: Paragraph title: RNP affinity purification, sRNA cloning, and bioinformatic analyses ... Briefly, IDT miRNA cloning linker 1 (Modban) was ligated to the 3′ end of the purified sRNAs using T4 RNA ligase, truncated, Recombinant:Article Title: Kinetic CRAC uncovers a role for Nab3 in determining gene expression profiles during stress Article Snippet: Beads were subsequently incubated with 80 µl of 1xPNK buffer containing eight units of TSAP alkaline phosphatase (Promega) and 80 units of recombinant RNasin (Promega) for 1 h at 37 °C. .. After one 500 µl wash with wash buffer I and three 500 µl washes with 1xPNK buffer, the beads were resuspended in 80 µl of 3′ linker ligation mix (1xPNK buffer, App-PE 3′ adapter (see Supplementary Table ; 0.6 µM final concentration), 10% PEG8000, 30 units of Article Title: BioTAP-XL - crosslinking/tandem affinity purification to study DNA targets, RNA and protein components of chromatin associated complexes Article Snippet: It allows ligation of Solexa 3′ and 5′ linkers directly to the RNA while still bound to the streptavidin-agarose beads as a part of the crosslinked RNA-protein-DNA complexes recovered from the BioTAP-XL tandem purification. .. CRAC-TN150 buffer (see recipe) CRAC-Wash buffer 1 (see recipe) 1 x CRAC-PNK buffer (see recipe) 5 x CRAC-PNK buffer (see recipe) TruSeq ChIP Sample Prep Kit for ChIP-Seq (Illumina, IP-202-1012) RNace-It Ribonuclease Cocktail 6000U (Agilent Technologies Inc, cat. no. 400720) TSAP Thermosensitive Alkaline Phosphatase (Promega, cat. no. M9910) RNasin Recombinant Ribonuclease Inhibitor (Promega, cat. no. N2515) 10mM dNTP Mix (Invitrogen, cat. no. 18427-088) SuperScript III First-Strand Synthesis kit (Invitrogen, cat. no. 18080-051) Phusion Hot Start II DNA Polymerase 2 U/μL (Thermo Scientific, cat. no. F-549S) T4 RNA ligase 2 truncated K227Q and 50% ChIP-sequencing:Article Title: BioTAP-XL - crosslinking/tandem affinity purification to study DNA targets, RNA and protein components of chromatin associated complexes Article Snippet: It allows ligation of Solexa 3′ and 5′ linkers directly to the RNA while still bound to the streptavidin-agarose beads as a part of the crosslinked RNA-protein-DNA complexes recovered from the BioTAP-XL tandem purification. .. CRAC-TN150 buffer (see recipe) CRAC-Wash buffer 1 (see recipe) 1 x CRAC-PNK buffer (see recipe) 5 x CRAC-PNK buffer (see recipe) TruSeq ChIP Sample Prep Kit for ChIP-Seq (Illumina, IP-202-1012) RNace-It Ribonuclease Cocktail 6000U (Agilent Technologies Inc, cat. no. 400720) TSAP Thermosensitive Alkaline Phosphatase (Promega, cat. no. M9910) RNasin Recombinant Ribonuclease Inhibitor (Promega, cat. no. N2515) 10mM dNTP Mix (Invitrogen, cat. no. 18427-088) SuperScript III First-Strand Synthesis kit (Invitrogen, cat. no. 18080-051) Phusion Hot Start II DNA Polymerase 2 U/μL (Thermo Scientific, cat. no. F-549S) T4 RNA ligase 2 truncated K227Q and 50% RNA Sequencing Assay:Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses Article Snippet: Paragraph title: Library preparation for RNA-Seq ... The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by Article Title: Evaluating bias-reducing protocols for RNA sequencing library preparation Article Snippet: For standard libraries, ligation of 10 ng of RNA pool was performed with the Ion Total RNA-Seq kit v2 (Life Technologies), following the manufacturer’s instructions. .. Ligation with 200 U Article Title: The ribonuclease activity of SAMHD1 is required for HIV-1 restriction Article Snippet: Paragraph title: RNA-Seq Analysis ... 3′ adaptor (5′/rApp/TGGAATTCTCGGGTGCCAAGG/ddC/-3′, IDT) was ligated using Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: Paragraph title: IAV nucleoprotein PAR-CLIP and RNA-seq library generation ... 3′-OH RNA previously prepared by CIP treatment was ligated to a 3′ adaptor using T4 RNA Ligase 2, truncated Fluorescence:Article Title: Histone gene replacement reveals a post-transcriptional role for H3K36 in maintaining metazoan transcriptome fidelity Article Snippet: For RT-qPCR, reactions were prepared in biological triplicate using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific), and fluorescence was monitored across 40 cycles in 96 well plate format. .. For LM-PAT, 1 µg total RNA was incubated with 5 pmol preadenylated lmPAT anchor primer (ppApCAGCTGTAGCTATGCGCACCGAGTCAGATCAG) (adenylated using 5’ DNA Adenylation Kit, NEB), and ligated with T4 RNA Ligase 2, truncated Magnetic Beads:Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses Article Snippet: Afterward, phosphatase activity was eliminated by heat inactivation at 65°C for 5 min. .. The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by Mutagenesis:Article Title: Preparation of Multiplexed Small RNA Libraries From Plants Article Snippet: Fiber glass (Corning Incorporated, catalog number: 988-10144) Extra thick blot paper (Bio-Rad Laboratories, catalog number: 170-3969) Whatman DE81 ion exchange cellulose chromatography paper (Thermo Fisher Scientific, catalog number: 05-717-1A) GlycoBlue coprecipitant (Life Technologies, catalog number: AM9516) 100% ethanol 75% ethanol EB buffer (QIAGEN, catalog number: 19086) Qubit RNA HS Assay Kit for quantification of purified small RNAs (Life Technologies, catalog number: ) Qubit dsDNA HS Assay Kit for quantification of DNA amplicon (Life Technologies, catalog number: ) Low salt buffer (see Recipes) High salt buffer (see Recipes) .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) Article Title: The Coding Regions of Germline mRNAs Confer Sensitivity to Argonaute Regulation in C. elegans Article Snippet: Small RNAs were further enriched using MirVana Kit (Thermo Fisher Scientific). .. Samples from wild-type and mutant were pretreated with a homemade 5′ polyphosphatase and were ligated to the 3′ adaptor linker 1 (5′ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3′, IDT) using Article Title: Evaluating bias-reducing protocols for RNA sequencing library preparation Article Snippet: For the CircLig libraries, 40 ng RNA pool (~6 pmol) and 100 ng Universal Cloning Linker (~18 pmol; NEB) were denatured at 80°C for 2 min then placed immediately on ice. .. Ligation with 200 U Isolation:Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena Article Snippet: After DNase I treatment, the total RNA was isolated with TRIzol LS reagent (Invitrogen) and resuspended in 20 μL of water. .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of Article Title: The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan Article Snippet: In brief, after isolation, 50 ng of mRNA was chemically fragmented by incubating the mRNA solution with twice the volume of alkaline hydrolysis buffer (50 mM sodium carbonate [NaHCO3 /Na2 CO3 ] pH 9.2, 1 mM EDTA) at 95 °C for 5 min to obtain fragments of ~200–300 bases. .. Ligation of RNA 3′ adapter (RA3, part # 15013207, Illumina) was done using T4 RNA Ligase 2, truncated Article Title: Global analysis of CPSF2-mediated alternative splicing: Integration of global iCLIP and transcriptome profiling data Article Snippet: To ligate linkers to the 3′ end of RNAs, 4.5 μl of purified RNA was mixed with 1 μl of 10 μM miRCat33 Adaptor (Integrated DNA Technologies), 1.5 μl of RNA Ligase buffer, 0.5 μl of T4 RNA Ligase 2, Truncated Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: To account for potential bias introduced during adaptor ligation and sequencing, we also generated RNA-seq libraries using RNA extracted from uncross-linked cell lysates of influenza infected 293T cells from which RNA was isolated by TRIzol (Invitrogen) extraction, then 10 μg RNA was fragmented by Mg2+ at 95 °C for 12 min (NEB, Magnesium RNA Fragmentation Module). .. 3′-OH RNA previously prepared by CIP treatment was ligated to a 3′ adaptor using T4 RNA Ligase 2, truncated Article Title: The microRNAs in an Ancient Protist Repress the Variant-Specific Surface Protein Expression by Targeting the Entire Coding Sequence Article Snippet: Briefly, the GlAgo associated small RNAs were isolated from Giardia WB trophozoites as previously described and resuspended in 10 µl RNase-free diH2 O . .. The purified small RNAs were ligated at the 3′-end to 5–10 µM gel purified miRNA Cloning Linker-1 (IDT) using T4 RNA ligase 2 and truncated with Purification:Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena Article Snippet: The RNAs were treated with DNase I again, and RNA was purified twice through P30 spin columns (Bio-Rad). .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of Article Title: The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan Article Snippet: The fragmented mRNA was further incubated with ATP and T4 polynucleotide kinase (EK0032, Fermentas) at 37 °C for 1 h and subsequently purified. .. Ligation of RNA 3′ adapter (RA3, part # 15013207, Illumina) was done using T4 RNA Ligase 2, truncated Article Title: Global analysis of CPSF2-mediated alternative splicing: Integration of global iCLIP and transcriptome profiling data Article Snippet: Samples were then washed twice with high-salt wash buffer and once with 900 μl PNK wash buffer. .. To ligate linkers to the 3′ end of RNAs, 4.5 μl of purified RNA was mixed with 1 μl of 10 μM miRCat33 Adaptor (Integrated DNA Technologies), 1.5 μl of RNA Ligase buffer, 0.5 μl of T4 RNA Ligase 2, Truncated Article Title: Single‐cell mRNA profiling reveals the hierarchical response of mi RNA targets to mi RNA induction Article Snippet: Purified mRNA fragments were dephosphorylated with FastAP (Life Technologies, Inc.) and 5′‐phosphorylated with PNK (Life Technologies, Inc.) following manufacturer's instructions for optimal conditions of the enzymatic reaction. .. After another round of RNeasy MinElute Cleanup Kit (Qiagen, Inc.), a pre‐adenylated DNA adapter (5′‐TGGAATTCTCGGGTGCCAAGG‐3′) was ligated to the 3′ end of the mRNA fragments at 4°C overnight using the T4 RNA ligase 2, truncated Article Title: The microRNAs in an Ancient Protist Repress the Variant-Specific Surface Protein Expression by Targeting the Entire Coding Sequence Article Snippet: For the addition of a sonication step to the procedure, the cells were resuspend in RIPA buffer as described previously and sonicated twice with five 1 second bursts at a 20% duty cycle. .. The purified small RNAs were ligated at the 3′-end to 5–10 µM gel purified miRNA Cloning Linker-1 (IDT) using T4 RNA ligase 2 and truncated with Article Title: Transgenerational function of Tetrahymena Piwi protein Twi8p at distinctive noncoding RNA loci Article Snippet: Size selection of purified sRNAs was performed by denaturing PAGE. sRNAs were prepared for Solexa sequencing as previously described ( ). .. Briefly, IDT miRNA cloning linker 1 (Modban) was ligated to the 3′ end of the purified sRNAs using T4 RNA ligase, truncated, Sequencing:Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena Article Snippet: A 20-μL aliquot of the RNA was end-repaired and resuspended in 10.5 μL of water. cDNA was synthesized as described above in the section “Small RNA cDNA Library Preparation and Sequencing” with some modifications. .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses Article Snippet: Afterward, phosphatase activity was eliminated by heat inactivation at 65°C for 5 min. .. The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by Article Title: The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan Article Snippet: Paragraph title: mRNA sequencing ... Ligation of RNA 3′ adapter (RA3, part # 15013207, Illumina) was done using T4 RNA Ligase 2, truncated Article Title: Preparation of Multiplexed Small RNA Libraries From Plants Article Snippet: Fiber glass (Corning Incorporated, catalog number: 988-10144) Extra thick blot paper (Bio-Rad Laboratories, catalog number: 170-3969) Whatman DE81 ion exchange cellulose chromatography paper (Thermo Fisher Scientific, catalog number: 05-717-1A) GlycoBlue coprecipitant (Life Technologies, catalog number: AM9516) 100% ethanol 75% ethanol EB buffer (QIAGEN, catalog number: 19086) Qubit RNA HS Assay Kit for quantification of purified small RNAs (Life Technologies, catalog number: ) Qubit dsDNA HS Assay Kit for quantification of DNA amplicon (Life Technologies, catalog number: ) Low salt buffer (see Recipes) High salt buffer (see Recipes) .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) Article Title: The Coding Regions of Germline mRNAs Confer Sensitivity to Argonaute Regulation in C. elegans Article Snippet: Paragraph title: Small RNA Cloning and Deep Sequencing ... Samples from wild-type and mutant were pretreated with a homemade 5′ polyphosphatase and were ligated to the 3′ adaptor linker 1 (5′ rAppAGATCGGAAGAGCACACGTCTGAACTCCAGTCA/3ddC/3′, IDT) using Article Title: Oligoadenylation of 3′ decay intermediates promotes cytoplasmic mRNA degradation in Drosophila cells Article Snippet: Paragraph title: Illumina sequencing ... In the second data set, truncated Article Title: The ribonuclease activity of SAMHD1 is required for HIV-1 restriction Article Snippet: 3′ adaptor (5′/rApp/TGGAATTCTCGGGTGCCAAGG/ddC/-3′, IDT) was ligated using Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: In both cases, total RNA was precipitated with ethanol, and used to prepare Illumina sequencing libraries. .. 3′-OH RNA previously prepared by CIP treatment was ligated to a 3′ adaptor using T4 RNA Ligase 2, truncated Article Title: Transgenerational function of Tetrahymena Piwi protein Twi8p at distinctive noncoding RNA loci Article Snippet: Size selection of purified sRNAs was performed by denaturing PAGE. sRNAs were prepared for Solexa sequencing as previously described ( ). .. Briefly, IDT miRNA cloning linker 1 (Modban) was ligated to the 3′ end of the purified sRNAs using T4 RNA ligase, truncated, Quantitative RT-PCR:Article Title: Histone gene replacement reveals a post-transcriptional role for H3K36 in maintaining metazoan transcriptome fidelity Article Snippet: For RT-qPCR, reactions were prepared in biological triplicate using Maxima SYBR Green/ROX qPCR Master Mix (Thermo Scientific), and fluorescence was monitored across 40 cycles in 96 well plate format. .. For LM-PAT, 1 µg total RNA was incubated with 5 pmol preadenylated lmPAT anchor primer (ppApCAGCTGTAGCTATGCGCACCGAGTCAGATCAG) (adenylated using 5’ DNA Adenylation Kit, NEB), and ligated with T4 RNA Ligase 2, truncated De-Phosphorylation Assay:Article Title: The ribonuclease activity of SAMHD1 is required for HIV-1 restriction Article Snippet: After dephosphorylation by Antarctic phosphatase (NEB), 5′ end of fragmented and dephosphorylated RNA was phospho-labeled using [γ-32 P]ATP and T4 polynucleotide kinase (TaKaRa). .. 3′ adaptor (5′/rApp/TGGAATTCTCGGGTGCCAAGG/ddC/-3′, IDT) was ligated using Nested PCR:Article Title: Oligoadenylation of 3′ decay intermediates promotes cytoplasmic mRNA degradation in Drosophila cells Article Snippet: In the second data set, truncated Sample Prep:Article Title: The Gcn4 transcription factor reduces protein synthesis capacity and extends yeast lifespan Article Snippet: Libraries for mRNA sequencing were prepared using the “directional mRNA-seq sample preparation” protocol from Illumina, with minor modifications. .. Ligation of RNA 3′ adapter (RA3, part # 15013207, Illumina) was done using T4 RNA Ligase 2, truncated Article Title: BioTAP-XL - crosslinking/tandem affinity purification to study DNA targets, RNA and protein components of chromatin associated complexes Article Snippet: It allows ligation of Solexa 3′ and 5′ linkers directly to the RNA while still bound to the streptavidin-agarose beads as a part of the crosslinked RNA-protein-DNA complexes recovered from the BioTAP-XL tandem purification. .. CRAC-TN150 buffer (see recipe) CRAC-Wash buffer 1 (see recipe) 1 x CRAC-PNK buffer (see recipe) 5 x CRAC-PNK buffer (see recipe) TruSeq ChIP Sample Prep Kit for ChIP-Seq (Illumina, IP-202-1012) RNace-It Ribonuclease Cocktail 6000U (Agilent Technologies Inc, cat. no. 400720) TSAP Thermosensitive Alkaline Phosphatase (Promega, cat. no. M9910) RNasin Recombinant Ribonuclease Inhibitor (Promega, cat. no. N2515) 10mM dNTP Mix (Invitrogen, cat. no. 18427-088) SuperScript III First-Strand Synthesis kit (Invitrogen, cat. no. 18080-051) Phusion Hot Start II DNA Polymerase 2 U/μL (Thermo Scientific, cat. no. F-549S) T4 RNA ligase 2 truncated K227Q and 50% Chromatin Immunoprecipitation:Article Title: BioTAP-XL - crosslinking/tandem affinity purification to study DNA targets, RNA and protein components of chromatin associated complexes Article Snippet: It allows ligation of Solexa 3′ and 5′ linkers directly to the RNA while still bound to the streptavidin-agarose beads as a part of the crosslinked RNA-protein-DNA complexes recovered from the BioTAP-XL tandem purification. .. CRAC-TN150 buffer (see recipe) CRAC-Wash buffer 1 (see recipe) 1 x CRAC-PNK buffer (see recipe) 5 x CRAC-PNK buffer (see recipe) TruSeq ChIP Sample Prep Kit for ChIP-Seq (Illumina, IP-202-1012) RNace-It Ribonuclease Cocktail 6000U (Agilent Technologies Inc, cat. no. 400720) TSAP Thermosensitive Alkaline Phosphatase (Promega, cat. no. M9910) RNasin Recombinant Ribonuclease Inhibitor (Promega, cat. no. N2515) 10mM dNTP Mix (Invitrogen, cat. no. 18427-088) SuperScript III First-Strand Synthesis kit (Invitrogen, cat. no. 18080-051) Phusion Hot Start II DNA Polymerase 2 U/μL (Thermo Scientific, cat. no. F-549S) T4 RNA ligase 2 truncated K227Q and 50% SDS Page:Article Title: Nucleotide resolution mapping of influenza A virus nucleoprotein-RNA interactions reveals RNA features required for replication Article Snippet: Briefly, protein–RNA complexes were separated on 4–12% SDS-PAGE gels and transferred to nitrocellulose membranes. .. 3′-OH RNA previously prepared by CIP treatment was ligated to a 3′ adaptor using T4 RNA Ligase 2, truncated Software:Article Title: The ribonuclease activity of SAMHD1 is required for HIV-1 restriction Article Snippet: 3′ adaptor (5′/rApp/TGGAATTCTCGGGTGCCAAGG/ddC/-3′, IDT) was ligated using Multiplex Assay:Article Title: Transgenerational function of Tetrahymena Piwi protein Twi8p at distinctive noncoding RNA loci Article Snippet: Briefly, IDT miRNA cloning linker 1 (Modban) was ligated to the 3′ end of the purified sRNAs using T4 RNA ligase, truncated, Selection:Article Title: Transgenerational function of Tetrahymena Piwi protein Twi8p at distinctive noncoding RNA loci Article Snippet: Size selection of purified sRNAs was performed by denaturing PAGE. sRNAs were prepared for Solexa sequencing as previously described ( ). .. Briefly, IDT miRNA cloning linker 1 (Modban) was ligated to the 3′ end of the purified sRNAs using T4 RNA ligase, truncated, Agarose Gel Electrophoresis:Article Title: Histone gene replacement reveals a post-transcriptional role for H3K36 in maintaining metazoan transcriptome fidelity Article Snippet: Reactions were run on a 2% agarose gel with EtBr for 30 min at 90 V, and bands were imaged on a UV transilluminator (GE Healthcare) and quantified using ImageJ. .. For LM-PAT, 1 µg total RNA was incubated with 5 pmol preadenylated lmPAT anchor primer (ppApCAGCTGTAGCTATGCGCACCGAGTCAGATCAG) (adenylated using 5’ DNA Adenylation Kit, NEB), and ligated with T4 RNA Ligase 2, truncated Ethanol Precipitation:Article Title: The use of duplex-specific nuclease in ribosome profiling and a user-friendly software package for Ribo-seq data analysis Article Snippet: The RNA samples from above were heated at 80°C for 2 min, cooled and the 3′ phosphate group removed using T4 polynucleotide kinase (T4 PNK, New England BioLabs) for 2 h at 37°C in a 20 µL reaction lacking ATP. .. The RNA was concentrated by ethanol precipitation, resuspended in 10 mM Tris–HCl pH 7.5 and ligated in a 20 µL reaction overnight at 14°C to a preadenylated 3′-adaptor (5′-rATGGAATTCTCGGGTGCCAAGG-3′) using Article Title: A Novel Epigenetic Silencing Pathway Involving the Highly Conserved 5’-3’ Exoribonuclease Dhp1/Rat1/Xrn2 in Schizosaccharomyces pombe Article Snippet: All washes, alkaline phosphatase treatment and 3’ linker ligation were carried out as described except that 40U Article Title: Transgenerational function of Tetrahymena Piwi protein Twi8p at distinctive noncoding RNA loci Article Snippet: Purified sRNAs were collected by phenol–choloroform extraction followed by ethanol precipitation. .. Briefly, IDT miRNA cloning linker 1 (Modban) was ligated to the 3′ end of the purified sRNAs using T4 RNA ligase, truncated, Next-Generation Sequencing:Article Title: The microRNAs in an Ancient Protist Repress the Variant-Specific Surface Protein Expression by Targeting the Entire Coding Sequence Article Snippet: Paragraph title: NGS library construction ... The purified small RNAs were ligated at the 3′-end to 5–10 µM gel purified miRNA Cloning Linker-1 (IDT) using T4 RNA ligase 2 and truncated with Immunoprecipitation:Article Title: Global analysis of CPSF2-mediated alternative splicing: Integration of global iCLIP and transcriptome profiling data Article Snippet: Paragraph title: Individual-nucleotide resolution UV cross-linking and immunoprecipitation (iCLIP) ... To ligate linkers to the 3′ end of RNAs, 4.5 μl of purified RNA was mixed with 1 μl of 10 μM miRCat33 Adaptor (Integrated DNA Technologies), 1.5 μl of RNA Ligase buffer, 0.5 μl of T4 RNA Ligase 2, Truncated Construct:Article Title: The microRNAs in an Ancient Protist Repress the Variant-Specific Surface Protein Expression by Targeting the Entire Coding Sequence Article Snippet: The NGS libraries of GlAgo associated small RNAs were constructed using a modified version of the Mello Lab protocol ( www.lsi.umich.edu/files/SmallRNACloning.pdf ). .. The purified small RNAs were ligated at the 3′-end to 5–10 µM gel purified miRNA Cloning Linker-1 (IDT) using T4 RNA ligase 2 and truncated with Marker:Article Title: Evaluating bias-reducing protocols for RNA sequencing library preparation Article Snippet: Ligation with 200 U Lysis:Article Title: A Novel Epigenetic Silencing Pathway Involving the Highly Conserved 5’-3’ Exoribonuclease Dhp1/Rat1/Xrn2 in Schizosaccharomyces pombe Article Snippet: After two washes with TN1000 buffer (100 mM Tris-HCl (pH 7.8), 2 M NaCl, 0.2% NP-40) and two washes with TN150 lysis buffer, the beads were incubated with GST-TEV protease for 2h at 16°C. .. All washes, alkaline phosphatase treatment and 3’ linker ligation were carried out as described except that 40U Article Title: Global analysis of CPSF2-mediated alternative splicing: Integration of global iCLIP and transcriptome profiling data Article Snippet: The beads were rotated at room temperature for 60 min, washed twice with lysis buffer, and added to the cross-linked lysate. .. To ligate linkers to the 3′ end of RNAs, 4.5 μl of purified RNA was mixed with 1 μl of 10 μM miRCat33 Adaptor (Integrated DNA Technologies), 1.5 μl of RNA Ligase buffer, 0.5 μl of T4 RNA Ligase 2, Truncated |