t4 rna ligase 2 truncated k227q  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
    Name:
    T4 RNA Ligase 2 truncated K227Q
    Description:
    T4 RNA Ligase 2 truncated K227Q 10 000 units
    Catalog Number:
    m0351l
    Price:
    278
    Size:
    10 000 units
    Category:
    RNA Ligases
    		Buy from Supplier

    Structured Review

    New England Biolabs t4 rna ligase 2 truncated k227q
    T4 RNA Ligase 2 truncated K227Q
    T4 RNA Ligase 2 truncated K227Q 10 000 units
    https://www.bioz.com/result/t4 rna ligase 2 truncated k227q/product/New England Biolabs
    Average 99 stars, based on 21 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 truncated k227q - by Bioz Stars, 2020-07
    99/100 stars

    Related Products / Commonly Used Together

    atp [γ-32p]
    novex
    rna
    t4 rna ligase 2
    t4 polynucleotide kinase
    t4 rna ligase 1
    superscript iii reverse transcriptase
    peg8000
    glycoblue
    t4
    takara la taq
    dna gel loading
    tris
    tbe-urea gel
    ′ illumina truseq adapter

    Images

    1) Product Images from "Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture"

    Article Title: Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0094619

    MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. T4 RNA Ligase 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated K227Q (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.
    Figure Legend Snippet: MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. T4 RNA Ligase 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated K227Q (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.

    Techniques Used: Ligation, Polyacrylamide Gel Electrophoresis, Mutagenesis

    Schematic illustration of microRNA capture by 3′ adapter ligation. The 19 nt, enzymatically pre-adenlyated adapter is ligated to the 3′ OH of microRNA using T4 RNA ligase 2. The reaction is run at 25°C for 4 hours in the absence of ATP. In order to characterize capture efficiency, the microRNA is end labeled with Cy3. The 3′ end of the adapter is blocked by –ddC, a fluorophore, or other moiety to prevent the formation of concatemers and circularized products.
    Figure Legend Snippet: Schematic illustration of microRNA capture by 3′ adapter ligation. The 19 nt, enzymatically pre-adenlyated adapter is ligated to the 3′ OH of microRNA using T4 RNA ligase 2. The reaction is run at 25°C for 4 hours in the absence of ATP. In order to characterize capture efficiency, the microRNA is end labeled with Cy3. The 3′ end of the adapter is blocked by –ddC, a fluorophore, or other moiety to prevent the formation of concatemers and circularized products.

    Techniques Used: Ligation, Labeling

    2) Product Images from "T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis"

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-11-72

    Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    Figure Legend Snippet: Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Techniques Used: Activity Assay, Labeling, Ligation, Binding Assay

    Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.
    Figure Legend Snippet: Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Techniques Used: Activity Assay, Incubation, Staining, Electrophoretic Mobility Shift Assay, Binding Assay

    Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4 RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.
    Figure Legend Snippet: Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4 RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Techniques Used: Incubation, Staining, Ligation, Binding Assay

    Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.
    Figure Legend Snippet: Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Techniques Used: Ligation, Labeling, Incubation, Acrylamide Gel Assay, Nucleic Acid Electrophoresis, Binding Assay

    Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4 RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.
    Figure Legend Snippet: Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4 RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Techniques Used: Ligation, Incubation, Staining, Binding Assay

    Purification and activity of T4 RNA Ligase 2 truncated mutants . (A) Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left. (B) Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p
    Figure Legend Snippet: Purification and activity of T4 RNA Ligase 2 truncated mutants . (A) Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left. (B) Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Techniques Used: Purification, Activity Assay, Staining, Marker, Incubation, Labeling, Binding Assay

    Effect of pH on ligase intermolecular strand-joining activity . (A-D) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. (E-H) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    Figure Legend Snippet: Effect of pH on ligase intermolecular strand-joining activity . (A-D) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. (E-H) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Techniques Used: Activity Assay, Labeling, Ligation, Binding Assay

    Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    Figure Legend Snippet: Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Techniques Used: Labeling, Ligation, Binding Assay

    Related Articles

    Ligation:

    Article Title: Kc167, a widely used Drosophila cell line, contains an active primary piRNA pathway
    Article Snippet: .. Ligation was performed in the presence of 25% PEG 8000 ( ) with T4 RNA Ligase 2 Truncated K227Q (NEB). .. Ligated RNA was PAGE purified and reverse transcribed by a 5′ phosphorylated RT primer containing 3′ and 5′ adaptor complementary sequences ( ).

    Article Title: Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture
    Article Snippet: .. Ligation Protocol Unless otherwise indicated, ligation was performed by mixing 1.25 µL of 2 µM adenylated adapter, 1 µL of T4 RNA Ligase buffer (New England Biolabs, Ipswich, MA), 5 µL of 50% PEG8000, 1 µL of synthetic target, 0.5 µL of total RNA, 1 µL of T4 RNA Ligase 2 truncated K227Q (New England Biolabs, Ipswich, MA) and water into a 20 µL reaction volume. .. In the experiments where different ligases were investigated, T4 RNA Ligase 2 truncated, T4 RNA Ligase 2 truncated R55K K227Q, and Thermostable 5′ App DNA/RNA Ligase were all obtained from New England Biolabs.

    Article Title: The ribonuclease activity of SAMHD1 is required for HIV-1 restriction
    Article Snippet: .. 3′ adaptor (5′/rApp/TGGAATTCTCGGGTGCCAAGG/ddC/-3′, IDT) was ligated using T4 RNA ligase truncated K227Q (NEB) followed by ligation of 5′ adaptor (5′ Solexa linker, 100-M; 5′rGrUrUrCrArGrArGrUrUrCrUrArCrArGrUrCrCrGrArCrGrA rUrC-3′, IDT) using T4 RNA ligase (TaKaRa). .. The 5′ and 3′ adaptor-ligated RNA was reverse transcribed using RNA RT Primer (RTP; 5′GCCTTGGCACCCGAGAATTCCA-3′, IDT) and SuperScript™ III reverse transcriptase (Invitrogen).

    Isolation:

    Article Title: Control of nitrogen fixation in bacteria that associate with cereals.
    Article Snippet: .. Legumes obtain nitrogen from air through rhizobia residing in root nodules. .. Legumes obtain nitrogen from air through rhizobia residing in root nodules.

    Magnetic Beads:

    Article Title: Transcriptome-wide mapping of m6A and m6Am at single-nucleotide resolution using miCLIP
    Article Snippet: .. TRIzol reagent (Invitrogen 15596018) Oligo d(T)25 magnetic beads (Thermo Scientific 61005 or NEB S1419S) DNase I, RNase-free (Thermo Scientific EN0525) RNA Clean & Concentrator kit (Zymo R1013) 5–20 μg of DNase-treated, poly(A)-selected RNA in 20 μl of water RNA fragmentation reagent, including stop solution (Ambion AM9740) Binding/low-salt buffer (see recipe) Anti-m6 A antibody (such as Abcam ab151230; see Critical Parameters) Protein A/G magnetic beads (Thermo Scientific 88802) High salt buffer (see recipe) PNK wash buffer (see recipe) 5X PNK pH 6.5 buffer (see recipe) T4 polynucleotide kinase (10 U/μl, NEB M0201S) Ribonuclease inhibitor (Promega N2515 or Invitrogen 10777–019) T4 RNA ligase 2, truncated K227Q (200 U/μl, NEB M0351S) L3 linker oligo (20 μM)(see below) PEG-8000 [γ−32 P]ATP, 3000 Ci/mmol (Perkin Elmer BLU002250UC) (see Critical Parameters) 4X LDS sample buffer (Invitrogen NP0008) 1M DTT (Sigma 646563) NuPage Novex 4–12 % bis-tris protein gels (Invitrogen NP0321BOX) MES SDS running buffer (Thermo Scientific NP0002) Prestained protein standard (such as BioRad 161–0373) Bis-Tris transfer buffer (Invitrogen NP0006) Nitrocellulose membrane (0.45 μm pore such as BioRad 1620115) Autoradiography film (such as Carestream Kodak BioMax MS films, Sigma Z363006) SDS Proteinase K (PK) buffer (see recipe) Proteinase K (20 mg/ml, Invitrogen 25530–049) Phase-lock gel heavy tubes (5PRIME 2302830) Acidic phenol:chloroform:ioamyl alcohol (25:24:1, pH 6.5) Nucleic acid co-precipitant (such as GlycoBlue, Ambion AM9516) 2 M sodium chloride 100% ethanol Barcoded reverse transcription (RT) primers (0.5 μM; see below) dNTP mix (10 mM each dNTP) SuperScript III reverse transcriptase (Invitrogen Invitrogen 18080044) 3 M sodium acetate, pH 5.5 2X TBE-urea sample buffer (Invitrogen LC6876) Novex 6% TBE-urea gel (Invitrogen EC6865BOX) Low molecular weight DNA ladder (NEB N3233S) 1X TBE running buffer SYBR Gold Nucleic Acid Stain (Invitrogen S11494) Gel Breaker tubes (IST Engineering 3388–100) 1X Tris-EDTA (TE) buffer CoStar Spin-X columns (0.22 μm pore size, Corning CLS8160) CircLigase II ssDNA ligase (Lucigen CL9025K) FastDigest BamHI (Thermo Scientific FD0054) Cut oligo (10 μM; see below) P3 and P5 PCR primers (10 μM; see below) AccuPrime SuperMix I (Invitrogen 12342010) Novex 6% TBE gel (Invitrogen EC6265BOX) AMPure XP magnetic beads (Beckman Coulter A63880) .. NOTE: All oligonucleotides can be purified using the supplier’s standard method unless otherwise indicated.

    Autoradiography:

    Article Title: Transcriptome-wide mapping of m6A and m6Am at single-nucleotide resolution using miCLIP
    Article Snippet: .. TRIzol reagent (Invitrogen 15596018) Oligo d(T)25 magnetic beads (Thermo Scientific 61005 or NEB S1419S) DNase I, RNase-free (Thermo Scientific EN0525) RNA Clean & Concentrator kit (Zymo R1013) 5–20 μg of DNase-treated, poly(A)-selected RNA in 20 μl of water RNA fragmentation reagent, including stop solution (Ambion AM9740) Binding/low-salt buffer (see recipe) Anti-m6 A antibody (such as Abcam ab151230; see Critical Parameters) Protein A/G magnetic beads (Thermo Scientific 88802) High salt buffer (see recipe) PNK wash buffer (see recipe) 5X PNK pH 6.5 buffer (see recipe) T4 polynucleotide kinase (10 U/μl, NEB M0201S) Ribonuclease inhibitor (Promega N2515 or Invitrogen 10777–019) T4 RNA ligase 2, truncated K227Q (200 U/μl, NEB M0351S) L3 linker oligo (20 μM)(see below) PEG-8000 [γ−32 P]ATP, 3000 Ci/mmol (Perkin Elmer BLU002250UC) (see Critical Parameters) 4X LDS sample buffer (Invitrogen NP0008) 1M DTT (Sigma 646563) NuPage Novex 4–12 % bis-tris protein gels (Invitrogen NP0321BOX) MES SDS running buffer (Thermo Scientific NP0002) Prestained protein standard (such as BioRad 161–0373) Bis-Tris transfer buffer (Invitrogen NP0006) Nitrocellulose membrane (0.45 μm pore such as BioRad 1620115) Autoradiography film (such as Carestream Kodak BioMax MS films, Sigma Z363006) SDS Proteinase K (PK) buffer (see recipe) Proteinase K (20 mg/ml, Invitrogen 25530–049) Phase-lock gel heavy tubes (5PRIME 2302830) Acidic phenol:chloroform:ioamyl alcohol (25:24:1, pH 6.5) Nucleic acid co-precipitant (such as GlycoBlue, Ambion AM9516) 2 M sodium chloride 100% ethanol Barcoded reverse transcription (RT) primers (0.5 μM; see below) dNTP mix (10 mM each dNTP) SuperScript III reverse transcriptase (Invitrogen Invitrogen 18080044) 3 M sodium acetate, pH 5.5 2X TBE-urea sample buffer (Invitrogen LC6876) Novex 6% TBE-urea gel (Invitrogen EC6865BOX) Low molecular weight DNA ladder (NEB N3233S) 1X TBE running buffer SYBR Gold Nucleic Acid Stain (Invitrogen S11494) Gel Breaker tubes (IST Engineering 3388–100) 1X Tris-EDTA (TE) buffer CoStar Spin-X columns (0.22 μm pore size, Corning CLS8160) CircLigase II ssDNA ligase (Lucigen CL9025K) FastDigest BamHI (Thermo Scientific FD0054) Cut oligo (10 μM; see below) P3 and P5 PCR primers (10 μM; see below) AccuPrime SuperMix I (Invitrogen 12342010) Novex 6% TBE gel (Invitrogen EC6265BOX) AMPure XP magnetic beads (Beckman Coulter A63880) .. NOTE: All oligonucleotides can be purified using the supplier’s standard method unless otherwise indicated.

    Incubation:

    Article Title: Control of nitrogen fixation in bacteria that associate with cereals.
    Article Snippet: .. Legumes obtain nitrogen from air through rhizobia residing in root nodules. .. Legumes obtain nitrogen from air through rhizobia residing in root nodules.

    Polymerase Chain Reaction:

    Article Title: Transcriptome-wide mapping of m6A and m6Am at single-nucleotide resolution using miCLIP
    Article Snippet: .. TRIzol reagent (Invitrogen 15596018) Oligo d(T)25 magnetic beads (Thermo Scientific 61005 or NEB S1419S) DNase I, RNase-free (Thermo Scientific EN0525) RNA Clean & Concentrator kit (Zymo R1013) 5–20 μg of DNase-treated, poly(A)-selected RNA in 20 μl of water RNA fragmentation reagent, including stop solution (Ambion AM9740) Binding/low-salt buffer (see recipe) Anti-m6 A antibody (such as Abcam ab151230; see Critical Parameters) Protein A/G magnetic beads (Thermo Scientific 88802) High salt buffer (see recipe) PNK wash buffer (see recipe) 5X PNK pH 6.5 buffer (see recipe) T4 polynucleotide kinase (10 U/μl, NEB M0201S) Ribonuclease inhibitor (Promega N2515 or Invitrogen 10777–019) T4 RNA ligase 2, truncated K227Q (200 U/μl, NEB M0351S) L3 linker oligo (20 μM)(see below) PEG-8000 [γ−32 P]ATP, 3000 Ci/mmol (Perkin Elmer BLU002250UC) (see Critical Parameters) 4X LDS sample buffer (Invitrogen NP0008) 1M DTT (Sigma 646563) NuPage Novex 4–12 % bis-tris protein gels (Invitrogen NP0321BOX) MES SDS running buffer (Thermo Scientific NP0002) Prestained protein standard (such as BioRad 161–0373) Bis-Tris transfer buffer (Invitrogen NP0006) Nitrocellulose membrane (0.45 μm pore such as BioRad 1620115) Autoradiography film (such as Carestream Kodak BioMax MS films, Sigma Z363006) SDS Proteinase K (PK) buffer (see recipe) Proteinase K (20 mg/ml, Invitrogen 25530–049) Phase-lock gel heavy tubes (5PRIME 2302830) Acidic phenol:chloroform:ioamyl alcohol (25:24:1, pH 6.5) Nucleic acid co-precipitant (such as GlycoBlue, Ambion AM9516) 2 M sodium chloride 100% ethanol Barcoded reverse transcription (RT) primers (0.5 μM; see below) dNTP mix (10 mM each dNTP) SuperScript III reverse transcriptase (Invitrogen Invitrogen 18080044) 3 M sodium acetate, pH 5.5 2X TBE-urea sample buffer (Invitrogen LC6876) Novex 6% TBE-urea gel (Invitrogen EC6865BOX) Low molecular weight DNA ladder (NEB N3233S) 1X TBE running buffer SYBR Gold Nucleic Acid Stain (Invitrogen S11494) Gel Breaker tubes (IST Engineering 3388–100) 1X Tris-EDTA (TE) buffer CoStar Spin-X columns (0.22 μm pore size, Corning CLS8160) CircLigase II ssDNA ligase (Lucigen CL9025K) FastDigest BamHI (Thermo Scientific FD0054) Cut oligo (10 μM; see below) P3 and P5 PCR primers (10 μM; see below) AccuPrime SuperMix I (Invitrogen 12342010) Novex 6% TBE gel (Invitrogen EC6265BOX) AMPure XP magnetic beads (Beckman Coulter A63880) .. NOTE: All oligonucleotides can be purified using the supplier’s standard method unless otherwise indicated.

    Staining:

    Article Title: Transcriptome-wide mapping of m6A and m6Am at single-nucleotide resolution using miCLIP
    Article Snippet: .. TRIzol reagent (Invitrogen 15596018) Oligo d(T)25 magnetic beads (Thermo Scientific 61005 or NEB S1419S) DNase I, RNase-free (Thermo Scientific EN0525) RNA Clean & Concentrator kit (Zymo R1013) 5–20 μg of DNase-treated, poly(A)-selected RNA in 20 μl of water RNA fragmentation reagent, including stop solution (Ambion AM9740) Binding/low-salt buffer (see recipe) Anti-m6 A antibody (such as Abcam ab151230; see Critical Parameters) Protein A/G magnetic beads (Thermo Scientific 88802) High salt buffer (see recipe) PNK wash buffer (see recipe) 5X PNK pH 6.5 buffer (see recipe) T4 polynucleotide kinase (10 U/μl, NEB M0201S) Ribonuclease inhibitor (Promega N2515 or Invitrogen 10777–019) T4 RNA ligase 2, truncated K227Q (200 U/μl, NEB M0351S) L3 linker oligo (20 μM)(see below) PEG-8000 [γ−32 P]ATP, 3000 Ci/mmol (Perkin Elmer BLU002250UC) (see Critical Parameters) 4X LDS sample buffer (Invitrogen NP0008) 1M DTT (Sigma 646563) NuPage Novex 4–12 % bis-tris protein gels (Invitrogen NP0321BOX) MES SDS running buffer (Thermo Scientific NP0002) Prestained protein standard (such as BioRad 161–0373) Bis-Tris transfer buffer (Invitrogen NP0006) Nitrocellulose membrane (0.45 μm pore such as BioRad 1620115) Autoradiography film (such as Carestream Kodak BioMax MS films, Sigma Z363006) SDS Proteinase K (PK) buffer (see recipe) Proteinase K (20 mg/ml, Invitrogen 25530–049) Phase-lock gel heavy tubes (5PRIME 2302830) Acidic phenol:chloroform:ioamyl alcohol (25:24:1, pH 6.5) Nucleic acid co-precipitant (such as GlycoBlue, Ambion AM9516) 2 M sodium chloride 100% ethanol Barcoded reverse transcription (RT) primers (0.5 μM; see below) dNTP mix (10 mM each dNTP) SuperScript III reverse transcriptase (Invitrogen Invitrogen 18080044) 3 M sodium acetate, pH 5.5 2X TBE-urea sample buffer (Invitrogen LC6876) Novex 6% TBE-urea gel (Invitrogen EC6865BOX) Low molecular weight DNA ladder (NEB N3233S) 1X TBE running buffer SYBR Gold Nucleic Acid Stain (Invitrogen S11494) Gel Breaker tubes (IST Engineering 3388–100) 1X Tris-EDTA (TE) buffer CoStar Spin-X columns (0.22 μm pore size, Corning CLS8160) CircLigase II ssDNA ligase (Lucigen CL9025K) FastDigest BamHI (Thermo Scientific FD0054) Cut oligo (10 μM; see below) P3 and P5 PCR primers (10 μM; see below) AccuPrime SuperMix I (Invitrogen 12342010) Novex 6% TBE gel (Invitrogen EC6265BOX) AMPure XP magnetic beads (Beckman Coulter A63880) .. NOTE: All oligonucleotides can be purified using the supplier’s standard method unless otherwise indicated.

    Binding Assay:

    Article Title: Transcriptome-wide mapping of m6A and m6Am at single-nucleotide resolution using miCLIP
    Article Snippet: .. TRIzol reagent (Invitrogen 15596018) Oligo d(T)25 magnetic beads (Thermo Scientific 61005 or NEB S1419S) DNase I, RNase-free (Thermo Scientific EN0525) RNA Clean & Concentrator kit (Zymo R1013) 5–20 μg of DNase-treated, poly(A)-selected RNA in 20 μl of water RNA fragmentation reagent, including stop solution (Ambion AM9740) Binding/low-salt buffer (see recipe) Anti-m6 A antibody (such as Abcam ab151230; see Critical Parameters) Protein A/G magnetic beads (Thermo Scientific 88802) High salt buffer (see recipe) PNK wash buffer (see recipe) 5X PNK pH 6.5 buffer (see recipe) T4 polynucleotide kinase (10 U/μl, NEB M0201S) Ribonuclease inhibitor (Promega N2515 or Invitrogen 10777–019) T4 RNA ligase 2, truncated K227Q (200 U/μl, NEB M0351S) L3 linker oligo (20 μM)(see below) PEG-8000 [γ−32 P]ATP, 3000 Ci/mmol (Perkin Elmer BLU002250UC) (see Critical Parameters) 4X LDS sample buffer (Invitrogen NP0008) 1M DTT (Sigma 646563) NuPage Novex 4–12 % bis-tris protein gels (Invitrogen NP0321BOX) MES SDS running buffer (Thermo Scientific NP0002) Prestained protein standard (such as BioRad 161–0373) Bis-Tris transfer buffer (Invitrogen NP0006) Nitrocellulose membrane (0.45 μm pore such as BioRad 1620115) Autoradiography film (such as Carestream Kodak BioMax MS films, Sigma Z363006) SDS Proteinase K (PK) buffer (see recipe) Proteinase K (20 mg/ml, Invitrogen 25530–049) Phase-lock gel heavy tubes (5PRIME 2302830) Acidic phenol:chloroform:ioamyl alcohol (25:24:1, pH 6.5) Nucleic acid co-precipitant (such as GlycoBlue, Ambion AM9516) 2 M sodium chloride 100% ethanol Barcoded reverse transcription (RT) primers (0.5 μM; see below) dNTP mix (10 mM each dNTP) SuperScript III reverse transcriptase (Invitrogen Invitrogen 18080044) 3 M sodium acetate, pH 5.5 2X TBE-urea sample buffer (Invitrogen LC6876) Novex 6% TBE-urea gel (Invitrogen EC6865BOX) Low molecular weight DNA ladder (NEB N3233S) 1X TBE running buffer SYBR Gold Nucleic Acid Stain (Invitrogen S11494) Gel Breaker tubes (IST Engineering 3388–100) 1X Tris-EDTA (TE) buffer CoStar Spin-X columns (0.22 μm pore size, Corning CLS8160) CircLigase II ssDNA ligase (Lucigen CL9025K) FastDigest BamHI (Thermo Scientific FD0054) Cut oligo (10 μM; see below) P3 and P5 PCR primers (10 μM; see below) AccuPrime SuperMix I (Invitrogen 12342010) Novex 6% TBE gel (Invitrogen EC6265BOX) AMPure XP magnetic beads (Beckman Coulter A63880) .. NOTE: All oligonucleotides can be purified using the supplier’s standard method unless otherwise indicated.

    Molecular Weight:

    Article Title: Transcriptome-wide mapping of m6A and m6Am at single-nucleotide resolution using miCLIP
    Article Snippet: .. TRIzol reagent (Invitrogen 15596018) Oligo d(T)25 magnetic beads (Thermo Scientific 61005 or NEB S1419S) DNase I, RNase-free (Thermo Scientific EN0525) RNA Clean & Concentrator kit (Zymo R1013) 5–20 μg of DNase-treated, poly(A)-selected RNA in 20 μl of water RNA fragmentation reagent, including stop solution (Ambion AM9740) Binding/low-salt buffer (see recipe) Anti-m6 A antibody (such as Abcam ab151230; see Critical Parameters) Protein A/G magnetic beads (Thermo Scientific 88802) High salt buffer (see recipe) PNK wash buffer (see recipe) 5X PNK pH 6.5 buffer (see recipe) T4 polynucleotide kinase (10 U/μl, NEB M0201S) Ribonuclease inhibitor (Promega N2515 or Invitrogen 10777–019) T4 RNA ligase 2, truncated K227Q (200 U/μl, NEB M0351S) L3 linker oligo (20 μM)(see below) PEG-8000 [γ−32 P]ATP, 3000 Ci/mmol (Perkin Elmer BLU002250UC) (see Critical Parameters) 4X LDS sample buffer (Invitrogen NP0008) 1M DTT (Sigma 646563) NuPage Novex 4–12 % bis-tris protein gels (Invitrogen NP0321BOX) MES SDS running buffer (Thermo Scientific NP0002) Prestained protein standard (such as BioRad 161–0373) Bis-Tris transfer buffer (Invitrogen NP0006) Nitrocellulose membrane (0.45 μm pore such as BioRad 1620115) Autoradiography film (such as Carestream Kodak BioMax MS films, Sigma Z363006) SDS Proteinase K (PK) buffer (see recipe) Proteinase K (20 mg/ml, Invitrogen 25530–049) Phase-lock gel heavy tubes (5PRIME 2302830) Acidic phenol:chloroform:ioamyl alcohol (25:24:1, pH 6.5) Nucleic acid co-precipitant (such as GlycoBlue, Ambion AM9516) 2 M sodium chloride 100% ethanol Barcoded reverse transcription (RT) primers (0.5 μM; see below) dNTP mix (10 mM each dNTP) SuperScript III reverse transcriptase (Invitrogen Invitrogen 18080044) 3 M sodium acetate, pH 5.5 2X TBE-urea sample buffer (Invitrogen LC6876) Novex 6% TBE-urea gel (Invitrogen EC6865BOX) Low molecular weight DNA ladder (NEB N3233S) 1X TBE running buffer SYBR Gold Nucleic Acid Stain (Invitrogen S11494) Gel Breaker tubes (IST Engineering 3388–100) 1X Tris-EDTA (TE) buffer CoStar Spin-X columns (0.22 μm pore size, Corning CLS8160) CircLigase II ssDNA ligase (Lucigen CL9025K) FastDigest BamHI (Thermo Scientific FD0054) Cut oligo (10 μM; see below) P3 and P5 PCR primers (10 μM; see below) AccuPrime SuperMix I (Invitrogen 12342010) Novex 6% TBE gel (Invitrogen EC6265BOX) AMPure XP magnetic beads (Beckman Coulter A63880) .. NOTE: All oligonucleotides can be purified using the supplier’s standard method unless otherwise indicated.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • t4 rna ligase 2 truncated r55k k227q  (New England Biolabs)
    99
    New England Biolabs t4 rna ligase 2 truncated r55k k227q
    MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. <t>T4</t> RNA <t>Ligase</t> 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated <t>K227Q</t> (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.
    T4 Rna Ligase 2 Truncated R55k K227q, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2 truncated r55k k227q/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 truncated r55k k227q - by Bioz Stars, 2020-07
    99/100 stars
    		  Buy from Supplier
    t4 rna ligase 2 truncated k227q  (New England Biolabs)
    99
    New England Biolabs t4 rna ligase 2 truncated k227q
    MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. <t>T4</t> RNA <t>Ligase</t> 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated <t>K227Q</t> (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.
    T4 Rna Ligase 2 Truncated K227q, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2 truncated k227q/product/New England Biolabs
    Average 99 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 truncated k227q - by Bioz Stars, 2020-07
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. T4 RNA Ligase 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated K227Q (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.

    Journal: PLoS ONE

    Article Title: Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture

    doi: 10.1371/journal.pone.0094619

    Figure Lengend Snippet: MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. T4 RNA Ligase 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated K227Q (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.

    Article Snippet: In the experiments where different ligases were investigated, T4 RNA Ligase 2 truncated, T4 RNA Ligase 2 truncated R55K K227Q, and Thermostable 5′ App DNA/RNA Ligase were all obtained from New England Biolabs.

    Techniques: Ligation, Polyacrylamide Gel Electrophoresis, Mutagenesis

    MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. T4 RNA Ligase 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated K227Q (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.

    Journal: PLoS ONE

    Article Title: Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture

    doi: 10.1371/journal.pone.0094619

    Figure Lengend Snippet: MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. T4 RNA Ligase 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated K227Q (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.

    Article Snippet: Ligation Protocol Unless otherwise indicated, ligation was performed by mixing 1.25 µL of 2 µM adenylated adapter, 1 µL of T4 RNA Ligase buffer (New England Biolabs, Ipswich, MA), 5 µL of 50% PEG8000, 1 µL of synthetic target, 0.5 µL of total RNA, 1 µL of T4 RNA Ligase 2 truncated K227Q (New England Biolabs, Ipswich, MA) and water into a 20 µL reaction volume.

    Techniques: Ligation, Polyacrylamide Gel Electrophoresis, Mutagenesis

    Schematic illustration of microRNA capture by 3′ adapter ligation. The 19 nt, enzymatically pre-adenlyated adapter is ligated to the 3′ OH of microRNA using T4 RNA ligase 2. The reaction is run at 25°C for 4 hours in the absence of ATP. In order to characterize capture efficiency, the microRNA is end labeled with Cy3. The 3′ end of the adapter is blocked by –ddC, a fluorophore, or other moiety to prevent the formation of concatemers and circularized products.

    Journal: PLoS ONE

    Article Title: Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture

    doi: 10.1371/journal.pone.0094619

    Figure Lengend Snippet: Schematic illustration of microRNA capture by 3′ adapter ligation. The 19 nt, enzymatically pre-adenlyated adapter is ligated to the 3′ OH of microRNA using T4 RNA ligase 2. The reaction is run at 25°C for 4 hours in the absence of ATP. In order to characterize capture efficiency, the microRNA is end labeled with Cy3. The 3′ end of the adapter is blocked by –ddC, a fluorophore, or other moiety to prevent the formation of concatemers and circularized products.

    Article Snippet: Ligation Protocol Unless otherwise indicated, ligation was performed by mixing 1.25 µL of 2 µM adenylated adapter, 1 µL of T4 RNA Ligase buffer (New England Biolabs, Ipswich, MA), 5 µL of 50% PEG8000, 1 µL of synthetic target, 0.5 µL of total RNA, 1 µL of T4 RNA Ligase 2 truncated K227Q (New England Biolabs, Ipswich, MA) and water into a 20 µL reaction volume.

    Techniques: Ligation, Labeling

    Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Labeling, Ligation, Binding Assay

    Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Incubation, Staining, Electrophoretic Mobility Shift Assay, Binding Assay

    Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4 RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4 RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Incubation, Staining, Ligation, Binding Assay

    Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Ligation, Labeling, Incubation, Acrylamide Gel Assay, Nucleic Acid Electrophoresis, Binding Assay

    Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4 RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4 RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Ligation, Incubation, Staining, Binding Assay

    Purification and activity of T4 RNA Ligase 2 truncated mutants . (A) Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left. (B) Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Purification and activity of T4 RNA Ligase 2 truncated mutants . (A) Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left. (B) Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Purification, Activity Assay, Staining, Marker, Incubation, Labeling, Binding Assay

    Effect of pH on ligase intermolecular strand-joining activity . (A-D) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. (E-H) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Effect of pH on ligase intermolecular strand-joining activity . (A-D) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. (E-H) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Labeling, Ligation, Binding Assay

    Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Labeling, Ligation, Binding Assay