t4 rna ligase 2 truncated k227q  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    T4 RNA Ligase 2 truncated K227Q
    Description:
    T4 RNA Ligase 2 truncated K227Q 10 000 units
    Catalog Number:
    m0351l
    Price:
    273
    Size:
    10 000 units
    Category:
    RNA Ligases
    Buy from Supplier


    Structured Review

    New England Biolabs t4 rna ligase 2 truncated k227q
    T4 RNA Ligase 2 truncated K227Q
    T4 RNA Ligase 2 truncated K227Q 10 000 units
    https://www.bioz.com/result/t4 rna ligase 2 truncated k227q/product/New England Biolabs
    Average 90 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 truncated k227q - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture"

    Article Title: Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0094619

    MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. T4 RNA Ligase 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated K227Q (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.
    Figure Legend Snippet: MicroRNA capture was performed with 4 different ligases using the vendor recommended protocols to compare capture efficiency across 20 different microRNA. The ligation products were analyzed by 15% denaturing urea-PAGE. Capture efficiency was determined by performing a Cy3 scan and comparing the intensities of the ∼40 nt captured microRNA band versus the ∼20 nt free microRNA band. T4 RNA Ligase 2 truncated (T4 Rnl2 T) had high average capture efficiency and low bias but many randomly sized background products. The point mutant enzymes T4 RNA Ligase 2 truncated K227Q (T4 Rnl2 TK) and T4 RNA Ligase 2 truncated KQ (T4 Rnl2 TKQ) had decreased side product formation but also lower average capture efficiency and higher bias. Thermostable 5′ App DNA/RNA Ligase (Mth Rnl), which was performed at 65°C instead of 25°C, had similar average capture efficiency and bias but with distinct ligation efficiency pattern.

    Techniques Used: Ligation, Polyacrylamide Gel Electrophoresis, Mutagenesis

    Schematic illustration of microRNA capture by 3′ adapter ligation. The 19 nt, enzymatically pre-adenlyated adapter is ligated to the 3′ OH of microRNA using T4 RNA ligase 2. The reaction is run at 25°C for 4 hours in the absence of ATP. In order to characterize capture efficiency, the microRNA is end labeled with Cy3. The 3′ end of the adapter is blocked by –ddC, a fluorophore, or other moiety to prevent the formation of concatemers and circularized products.
    Figure Legend Snippet: Schematic illustration of microRNA capture by 3′ adapter ligation. The 19 nt, enzymatically pre-adenlyated adapter is ligated to the 3′ OH of microRNA using T4 RNA ligase 2. The reaction is run at 25°C for 4 hours in the absence of ATP. In order to characterize capture efficiency, the microRNA is end labeled with Cy3. The 3′ end of the adapter is blocked by –ddC, a fluorophore, or other moiety to prevent the formation of concatemers and circularized products.

    Techniques Used: Ligation, Labeling

    2) Product Images from "T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis"

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    Journal: BMC Biotechnology

    doi: 10.1186/1472-6750-11-72

    Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    Figure Legend Snippet: Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Techniques Used: Activity Assay, Labeling, Ligation, Binding Assay

    Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.
    Figure Legend Snippet: Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Techniques Used: Activity Assay, Incubation, Staining, Electrophoretic Mobility Shift Assay, Binding Assay

    Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4 RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.
    Figure Legend Snippet: Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4 RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Techniques Used: Incubation, Staining, Ligation, Binding Assay

    Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.
    Figure Legend Snippet: Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Techniques Used: Ligation, Labeling, Incubation, Acrylamide Gel Assay, Nucleic Acid Electrophoresis, Binding Assay

    Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4 RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.
    Figure Legend Snippet: Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4 RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Techniques Used: Ligation, Incubation, Staining, Binding Assay

    Purification and activity of T4 RNA Ligase 2 truncated mutants . (A) Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left. (B) Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p
    Figure Legend Snippet: Purification and activity of T4 RNA Ligase 2 truncated mutants . (A) Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left. (B) Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Techniques Used: Purification, Activity Assay, Staining, Marker, Incubation, Labeling, Binding Assay

    Effect of pH on ligase intermolecular strand-joining activity . (A-D) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. (E-H) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    Figure Legend Snippet: Effect of pH on ligase intermolecular strand-joining activity . (A-D) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. (E-H) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Techniques Used: Activity Assay, Labeling, Ligation, Binding Assay

    Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    Figure Legend Snippet: Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Techniques Used: Labeling, Ligation, Binding Assay

    Related Articles

    Clone Assay:

    Article Title: Functional Analysis of Three Arabidopsis ARGONAUTES Using Slicer-Defective Mutants [W] ARGONAUTES Using Slicer-Defective Mutants [W] [OA]
    Article Snippet: Ten microliters (or 100%) of the immunoprecipitated RNA was mixed with 15 pmol of Cloning Linker 1 (IDT; see online) and incubated at 70°C for 2 min. .. The mixture was cooled on ice for 2 min before adding 1.5 μL of 10× T4 RNA ligase reaction buffer (NEB), 40 units of RNase OUT), and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB).

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Centrifugation:

    Article Title: A Novel Epigenetic Silencing Pathway Involving the Highly Conserved 5’-3’ Exoribonuclease Dhp1/Rat1/Xrn2 in Schizosaccharomyces pombe
    Article Snippet: The TEV eluates were collected by centrifugation and incubated with 10U of Turbo DNase (Ambion) for 8 min at 37°C followed by incubation with RNase Cocktail Enzyme Mix (Ambion; 0.005 U RnaseA, 0.2 U Rnase T1) for 2 min at 37°C. .. All washes, alkaline phosphatase treatment and 3’ linker ligation were carried out as described except that 40U T4 RNA ligase 2 truncated K227Q (NEB) was used instead of T4 RNA ligase.

    Amplification:

    Article Title: Analysis of genetically diverse macrophages reveals local and domain-wide mechanisms that control transcription factor binding and function
    Article Snippet: Afterwards, to ligate the 3′ Illumina TruSeq adapter 10 μl of 3′MM was added [1 μl 10x T4 RNA ligase buffer, 6 μl 50% PEG8000, 1.5 μl ddH2 O+T, 0.25 μl heat-denaturated Illumina TruSeq 3′Adapter, 0.25 μl SUPERase-In, 1 μl T4 RNA Ligase 2 truncated K227Q (200U; NEB)], mixed well by flicking and reactions incubated at 20°C for 1 hour. .. Samples were amplified for 14 cycles, size selected for 160–250 bp and sequenced on an Illumina NextSeq 500.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Kc167, a widely used Drosophila cell line, contains an active primary piRNA pathway
    Article Snippet: Radiolabeled piRNAs from Aub and Piwi immunoprecipitates were resolved and purified with 8 M Urea 15% PAGE. .. Ligation was performed in the presence of 25% PEG 8000 ( ) with T4 RNA Ligase 2 Truncated K227Q (NEB).

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Synthesized:

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: A 20-μL aliquot of the RNA was end-repaired and resuspended in 10.5 μL of water. cDNA was synthesized as described above in the section “Small RNA cDNA Library Preparation and Sequencing” with some modifications. .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of T4 RNA ligase 2-truncated K227Q (New England Biolabs) overnight at 16°C.

    Construct:

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: Two microliters of glycerol was added, the solution was incubated for another 10 min at room temperature in the dark, and RNAs were purified by ethanol precipitation. cDNA libraries of small RNAs were constructed as described ( ) with some modifications. .. RNA was recovered from the gel and ligated to a 5′-adenylated 3′ adapter oligonucleotide (5′-App-TCGTATGCCGTCTTCTGCTTG-L-3′, where L is the 3′OH-blocking group; IDT) by T4 RNA ligase 2-truncated or T4 RNA ligase 2-truncated K227Q (New England Biolabs).

    Incubation:

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of T4 RNA ligase 2-truncated K227Q (New England Biolabs) overnight at 16°C. .. The RNAs were enriched on anti-BrdU beads as above and resuspended in 10 μL of water.

    Article Title: Functional Analysis of Three Arabidopsis ARGONAUTES Using Slicer-Defective Mutants [W] ARGONAUTES Using Slicer-Defective Mutants [W] [OA]
    Article Snippet: Ten microliters (or 100%) of the immunoprecipitated RNA was mixed with 15 pmol of Cloning Linker 1 (IDT; see online) and incubated at 70°C for 2 min. .. The mixture was cooled on ice for 2 min before adding 1.5 μL of 10× T4 RNA ligase reaction buffer (NEB), 40 units of RNase OUT), and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB).

    Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses
    Article Snippet: Transcripts were then incubated with Shrimp Alkaline Phosphatase/rSAP (New England BioLabs) at 37°C for 45 min to dephosphorylate the 5′ end of RNAs and to hydrolyze remaining NTPs from the reaction. .. The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by T4 RNA Ligase 2 truncated K227Q (New England BioLabs) ( ).

    Article Title: Kinetic CRAC uncovers a role for Nab3 in determining gene expression profiles during stress
    Article Snippet: Beads were subsequently incubated with 80 µl of 1xPNK buffer containing eight units of TSAP alkaline phosphatase (Promega) and 80 units of recombinant RNasin (Promega) for 1 h at 37 °C. .. After one 500 µl wash with wash buffer I and three 500 µl washes with 1xPNK buffer, the beads were resuspended in 80 µl of 3′ linker ligation mix (1xPNK buffer, App-PE 3′ adapter (see Supplementary Table ; 0.6 µM final concentration), 10% PEG8000, 30 units of T4 RNA ligase 2 truncated K227Q (NEB), 60 units RNAsin (Promega)).

    Article Title: Analysis of genetically diverse macrophages reveals local and domain-wide mechanisms that control transcription factor binding and function
    Article Snippet: .. Afterwards, to ligate the 3′ Illumina TruSeq adapter 10 μl of 3′MM was added [1 μl 10x T4 RNA ligase buffer, 6 μl 50% PEG8000, 1.5 μl ddH2 O+T, 0.25 μl heat-denaturated Illumina TruSeq 3′Adapter, 0.25 μl SUPERase-In, 1 μl T4 RNA Ligase 2 truncated K227Q (200U; NEB)], mixed well by flicking and reactions incubated at 20°C for 1 hour. ..

    Article Title: A Novel Epigenetic Silencing Pathway Involving the Highly Conserved 5’-3’ Exoribonuclease Dhp1/Rat1/Xrn2 in Schizosaccharomyces pombe
    Article Snippet: Samples were incubated with 50 μl of nickel agarose beads (Macherey-Nagel) over night at 4°C. .. All washes, alkaline phosphatase treatment and 3’ linker ligation were carried out as described except that 40U T4 RNA ligase 2 truncated K227Q (NEB) was used instead of T4 RNA ligase.

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: Two microliters of glycerol was added, the solution was incubated for another 10 min at room temperature in the dark, and RNAs were purified by ethanol precipitation. cDNA libraries of small RNAs were constructed as described ( ) with some modifications. .. RNA was recovered from the gel and ligated to a 5′-adenylated 3′ adapter oligonucleotide (5′-App-TCGTATGCCGTCTTCTGCTTG-L-3′, where L is the 3′OH-blocking group; IDT) by T4 RNA ligase 2-truncated or T4 RNA ligase 2-truncated K227Q (New England Biolabs).

    Activity Assay:

    Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses
    Article Snippet: Afterward, phosphatase activity was eliminated by heat inactivation at 65°C for 5 min. .. The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by T4 RNA Ligase 2 truncated K227Q (New England BioLabs) ( ).

    Expressing:

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis
    Article Snippet: Paragraph title: Expression and purification of mutant T4 RNA ligase 2 truncated (Rnl2tr) proteins ... T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Modification:

    Article Title: Kc167, a widely used Drosophila cell line, contains an active primary piRNA pathway
    Article Snippet: Recovered RNA was ligated to a modified miRCat 3′ Linker-1 (IDT) containing eight extra random nucleotides at the 5′-end. .. Ligation was performed in the presence of 25% PEG 8000 ( ) with T4 RNA Ligase 2 Truncated K227Q (NEB).

    Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses
    Article Snippet: .. The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by T4 RNA Ligase 2 truncated K227Q (New England BioLabs) ( ). .. The 40 μl ligation reactions containing 20% (w/v) PEG 8000, 0.05 mg/ml bovine serum albumin, 50 mM NaCl and 2 μl of RNA Ligase 2 at 200 U μl−1 were incubated at 16°C overnight.

    Ligation:

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of T4 RNA ligase 2-truncated K227Q (New England Biolabs) overnight at 16°C. .. The RNAs were enriched on anti-BrdU beads as above and resuspended in 10 μL of water.

    Article Title: Kc167, a widely used Drosophila cell line, contains an active primary piRNA pathway
    Article Snippet: .. Ligation was performed in the presence of 25% PEG 8000 ( ) with T4 RNA Ligase 2 Truncated K227Q (NEB). .. Ligated RNA was PAGE purified and reverse transcribed by a 5′ phosphorylated RT primer containing 3′ and 5′ adaptor complementary sequences ( ).

    Article Title: Functional Analysis of Three Arabidopsis ARGONAUTES Using Slicer-Defective Mutants [W] ARGONAUTES Using Slicer-Defective Mutants [W] [OA]
    Article Snippet: The mixture was cooled on ice for 2 min before adding 1.5 μL of 10× T4 RNA ligase reaction buffer (NEB), 40 units of RNase OUT), and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB). .. Ligation reactions were incubated overnight at 16°C.

    Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses
    Article Snippet: The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by T4 RNA Ligase 2 truncated K227Q (New England BioLabs) ( ). .. The 40 μl ligation reactions containing 20% (w/v) PEG 8000, 0.05 mg/ml bovine serum albumin, 50 mM NaCl and 2 μl of RNA Ligase 2 at 200 U μl−1 were incubated at 16°C overnight.

    Article Title: Elimination of Ligation Dependent Artifacts in T4 RNA Ligase to Achieve High Efficiency and Low Bias MicroRNA Capture
    Article Snippet: .. Ligation Protocol Unless otherwise indicated, ligation was performed by mixing 1.25 µL of 2 µM adenylated adapter, 1 µL of T4 RNA Ligase buffer (New England Biolabs, Ipswich, MA), 5 µL of 50% PEG8000, 1 µL of synthetic target, 0.5 µL of total RNA, 1 µL of T4 RNA Ligase 2 truncated K227Q (New England Biolabs, Ipswich, MA) and water into a 20 µL reaction volume. .. In the experiments where different ligases were investigated, T4 RNA Ligase 2 truncated, T4 RNA Ligase 2 truncated R55K K227Q, and Thermostable 5′ App DNA/RNA Ligase were all obtained from New England Biolabs.

    Article Title: Kinetic CRAC uncovers a role for Nab3 in determining gene expression profiles during stress
    Article Snippet: .. After one 500 µl wash with wash buffer I and three 500 µl washes with 1xPNK buffer, the beads were resuspended in 80 µl of 3′ linker ligation mix (1xPNK buffer, App-PE 3′ adapter (see Supplementary Table ; 0.6 µM final concentration), 10% PEG8000, 30 units of T4 RNA ligase 2 truncated K227Q (NEB), 60 units RNAsin (Promega)). .. The samples were incubated at 25 °C for 4–6 h. Following one 500 µl wash buffer I wash and three 1xPNK buffer washes, the beads were incubated with 60 µl of 5′end labeling mix (1xPNK buffer, 30µCi 32 P-γATP (Perkin Elmer) and 30 units of T4 polynucleotide kinase (NEB)) for 40 min at 37 °C.

    Article Title: Analysis of genetically diverse macrophages reveals local and domain-wide mechanisms that control transcription factor binding and function
    Article Snippet: Here, prior to 3′Adapter ligation, samples were dissolved in 3.75 μl TET heated to 70°C for 2 minutes and placed on ice. .. Afterwards, to ligate the 3′ Illumina TruSeq adapter 10 μl of 3′MM was added [1 μl 10x T4 RNA ligase buffer, 6 μl 50% PEG8000, 1.5 μl ddH2 O+T, 0.25 μl heat-denaturated Illumina TruSeq 3′Adapter, 0.25 μl SUPERase-In, 1 μl T4 RNA Ligase 2 truncated K227Q (200U; NEB)], mixed well by flicking and reactions incubated at 20°C for 1 hour.

    Article Title: A Novel Epigenetic Silencing Pathway Involving the Highly Conserved 5’-3’ Exoribonuclease Dhp1/Rat1/Xrn2 in Schizosaccharomyces pombe
    Article Snippet: .. All washes, alkaline phosphatase treatment and 3’ linker ligation were carried out as described except that 40U T4 RNA ligase 2 truncated K227Q (NEB) was used instead of T4 RNA ligase. .. The beads were incubated in 80 μl phosphorylation mix (16 μl 5x PNK buffer (250 mM Tris-HCl (pH 7.8), 50 mM MgCl2 , 50 mM β-mercaptoethanol), 200 mM ATP (Sigma, A6559), 20U T4 polynucleotide kinase (NEB), 80U RNase Inhibitor) for 40 min at 37°C.

    Article Title: Efficient synthesis of stably adenylated DNA and RNA adapters for microRNA capture using T4 RNA ligase 1
    Article Snippet: .. Alternatively, adapter pre-adenylation was performed using the 5′ DNA Adenylation Kit (New England Biolabs, Ipswich, MA) according to the manufacturer protocol. microRNA-Adapter Ligation. microRNA was ligated to the pre-adenylated dA adapters using T4 RNA ligase 2 truncated K227Q (New England Biolabs, Ipswich, MA) according to the previously described protocol . .. Pancreatic total RNA was commercially purchased from Life Technologies.

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: RNA was recovered from the gel and ligated to a 5′-adenylated 3′ adapter oligonucleotide (5′-App-TCGTATGCCGTCTTCTGCTTG-L-3′, where L is the 3′OH-blocking group; IDT) by T4 RNA ligase 2-truncated or T4 RNA ligase 2-truncated K227Q (New England Biolabs). .. The gel-purified final ligation product was then reverse-transcribed with the Sol-rv primer (5′-CAAGCAGAAGACGGCATACGA-3′) and PCR-amplified with the Sol-rv primer and Sol-fw primer (5′-AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3′).

    Polymerase Chain Reaction:

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: RNA was recovered from the gel and ligated to a 5′-adenylated 3′ adapter oligonucleotide (5′-App-TCGTATGCCGTCTTCTGCTTG-L-3′, where L is the 3′OH-blocking group; IDT) by T4 RNA ligase 2-truncated or T4 RNA ligase 2-truncated K227Q (New England Biolabs). .. The gel-purified final ligation product was then reverse-transcribed with the Sol-rv primer (5′-CAAGCAGAAGACGGCATACGA-3′) and PCR-amplified with the Sol-rv primer and Sol-fw primer (5′-AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA-3′).

    Protein Concentration:

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis
    Article Snippet: Fractions containing protein of interest were pooled and protein concentration was determined by a Bio-Rad Dc protein assay (Bio-Rad, Hercules, CA) after overnight dialysis (100 mM NaCl, 10 mM Tris-HCl pH 7.5, 0.1 mM DTT, 0.1 mM EDTA, 50% glycerol). .. T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Sequencing:

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: A 20-μL aliquot of the RNA was end-repaired and resuspended in 10.5 μL of water. cDNA was synthesized as described above in the section “Small RNA cDNA Library Preparation and Sequencing” with some modifications. .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of T4 RNA ligase 2-truncated K227Q (New England Biolabs) overnight at 16°C.

    Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses
    Article Snippet: .. The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by T4 RNA Ligase 2 truncated K227Q (New England BioLabs) ( ). .. The 40 μl ligation reactions containing 20% (w/v) PEG 8000, 0.05 mg/ml bovine serum albumin, 50 mM NaCl and 2 μl of RNA Ligase 2 at 200 U μl−1 were incubated at 16°C overnight.

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: Paragraph title: Small RNA cDNA library preparation and sequencing ... RNA was recovered from the gel and ligated to a 5′-adenylated 3′ adapter oligonucleotide (5′-App-TCGTATGCCGTCTTCTGCTTG-L-3′, where L is the 3′OH-blocking group; IDT) by T4 RNA ligase 2-truncated or T4 RNA ligase 2-truncated K227Q (New England Biolabs).

    Recombinant:

    Article Title: Kinetic CRAC uncovers a role for Nab3 in determining gene expression profiles during stress
    Article Snippet: Beads were subsequently incubated with 80 µl of 1xPNK buffer containing eight units of TSAP alkaline phosphatase (Promega) and 80 units of recombinant RNasin (Promega) for 1 h at 37 °C. .. After one 500 µl wash with wash buffer I and three 500 µl washes with 1xPNK buffer, the beads were resuspended in 80 µl of 3′ linker ligation mix (1xPNK buffer, App-PE 3′ adapter (see Supplementary Table ; 0.6 µM final concentration), 10% PEG8000, 30 units of T4 RNA ligase 2 truncated K227Q (NEB), 60 units RNAsin (Promega)).

    DC Protein Assay:

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis
    Article Snippet: Fractions containing protein of interest were pooled and protein concentration was determined by a Bio-Rad Dc protein assay (Bio-Rad, Hercules, CA) after overnight dialysis (100 mM NaCl, 10 mM Tris-HCl pH 7.5, 0.1 mM DTT, 0.1 mM EDTA, 50% glycerol). .. T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    RNA Sequencing Assay:

    Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses
    Article Snippet: Paragraph title: Library preparation for RNA-Seq ... The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by T4 RNA Ligase 2 truncated K227Q (New England BioLabs) ( ).

    Magnetic Beads:

    Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses
    Article Snippet: .. The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by T4 RNA Ligase 2 truncated K227Q (New England BioLabs) ( ). .. The 40 μl ligation reactions containing 20% (w/v) PEG 8000, 0.05 mg/ml bovine serum albumin, 50 mM NaCl and 2 μl of RNA Ligase 2 at 200 U μl−1 were incubated at 16°C overnight.

    Mutagenesis:

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis
    Article Snippet: Paragraph title: Expression and purification of mutant T4 RNA ligase 2 truncated (Rnl2tr) proteins ... T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Isolation:

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: After DNase I treatment, the total RNA was isolated with TRIzol LS reagent (Invitrogen) and resuspended in 20 μL of water. .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of T4 RNA ligase 2-truncated K227Q (New England Biolabs) overnight at 16°C.

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: RNA was isolated from 2.5 × 106 mating cells at the indicated time points post-mixing with the mirVana miRNA isolation kit (Ambion) or TRIzol reagent (Invitrogen). .. RNA was recovered from the gel and ligated to a 5′-adenylated 3′ adapter oligonucleotide (5′-App-TCGTATGCCGTCTTCTGCTTG-L-3′, where L is the 3′OH-blocking group; IDT) by T4 RNA ligase 2-truncated or T4 RNA ligase 2-truncated K227Q (New England Biolabs).

    Labeling:

    Article Title: Kinetic CRAC uncovers a role for Nab3 in determining gene expression profiles during stress
    Article Snippet: After one 500 µl wash with wash buffer I and three 500 µl washes with 1xPNK buffer, the beads were resuspended in 80 µl of 3′ linker ligation mix (1xPNK buffer, App-PE 3′ adapter (see Supplementary Table ; 0.6 µM final concentration), 10% PEG8000, 30 units of T4 RNA ligase 2 truncated K227Q (NEB), 60 units RNAsin (Promega)). .. The samples were incubated at 25 °C for 4–6 h. Following one 500 µl wash buffer I wash and three 1xPNK buffer washes, the beads were incubated with 60 µl of 5′end labeling mix (1xPNK buffer, 30µCi 32 P-γATP (Perkin Elmer) and 30 units of T4 polynucleotide kinase (NEB)) for 40 min at 37 °C.

    Purification:

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: The RNAs were treated with DNase I again, and RNA was purified twice through P30 spin columns (Bio-Rad). .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of T4 RNA ligase 2-truncated K227Q (New England Biolabs) overnight at 16°C.

    Article Title: Kc167, a widely used Drosophila cell line, contains an active primary piRNA pathway
    Article Snippet: Radiolabeled piRNAs from Aub and Piwi immunoprecipitates were resolved and purified with 8 M Urea 15% PAGE. .. Ligation was performed in the presence of 25% PEG 8000 ( ) with T4 RNA Ligase 2 Truncated K227Q (NEB).

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis
    Article Snippet: Paragraph title: Expression and purification of mutant T4 RNA ligase 2 truncated (Rnl2tr) proteins ... T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Article Title: Optimization of ribosome profiling using low-input brain tissue from fragile X syndrome model mice
    Article Snippet: Briefly, rRNA was depleted from the purified monosomal RNA samples with RiboZero (Illumina, #MRZG12324). .. Recovered RNA was dephosphorylated with T4 Polynucleotide Kinase (NEB, #M0201S) and ligated with preadenylated adaptor in miRCat® -33 Conversion Oligos Pack (IDT) using T4RNL2Tr.K227Q ligase (NEB, #M0351L).

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: Two microliters of glycerol was added, the solution was incubated for another 10 min at room temperature in the dark, and RNAs were purified by ethanol precipitation. cDNA libraries of small RNAs were constructed as described ( ) with some modifications. .. RNA was recovered from the gel and ligated to a 5′-adenylated 3′ adapter oligonucleotide (5′-App-TCGTATGCCGTCTTCTGCTTG-L-3′, where L is the 3′OH-blocking group; IDT) by T4 RNA ligase 2-truncated or T4 RNA ligase 2-truncated K227Q (New England Biolabs).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: .. 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Immunoprecipitation:

    Article Title: Functional Analysis of Three Arabidopsis ARGONAUTES Using Slicer-Defective Mutants [W] ARGONAUTES Using Slicer-Defective Mutants [W] [OA]
    Article Snippet: Ten microliters (or 100%) of the immunoprecipitated RNA was mixed with 15 pmol of Cloning Linker 1 (IDT; see online) and incubated at 70°C for 2 min. .. The mixture was cooled on ice for 2 min before adding 1.5 μL of 10× T4 RNA ligase reaction buffer (NEB), 40 units of RNase OUT), and 10 units of T4 RNA Ligase 2 truncated K227Q (NEB).

    De-Phosphorylation Assay:

    Article Title: Analysis of genetically diverse macrophages reveals local and domain-wide mechanisms that control transcription factor binding and function
    Article Snippet: RNA pellets were dissolved in 10 μl TET and a second round of dephosphorylation and BrdU enrichment was performed. .. Afterwards, to ligate the 3′ Illumina TruSeq adapter 10 μl of 3′MM was added [1 μl 10x T4 RNA ligase buffer, 6 μl 50% PEG8000, 1.5 μl ddH2 O+T, 0.25 μl heat-denaturated Illumina TruSeq 3′Adapter, 0.25 μl SUPERase-In, 1 μl T4 RNA Ligase 2 truncated K227Q (200U; NEB)], mixed well by flicking and reactions incubated at 20°C for 1 hour.

    Staining:

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis
    Article Snippet: Successful purification was monitored by SDS-PAGE followed by Coomassie blue staining (Life Technologies, Carlsbad, CA). .. T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    cDNA Library Assay:

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: A 20-μL aliquot of the RNA was end-repaired and resuspended in 10.5 μL of water. cDNA was synthesized as described above in the section “Small RNA cDNA Library Preparation and Sequencing” with some modifications. .. For 3′ adapter ligation, 10 μL of the end-repaired RNAs was incubated with 1 μL of 50 μM 3′ adapter, 0.5 μL of Ribolock (Fermentas), 2.15 μL of ATP-free T4 RNA ligase buffer, 6 μL of 50% PEG-8000, and 2 μL of T4 RNA ligase 2-truncated K227Q (New England Biolabs) overnight at 16°C.

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: Paragraph title: Small RNA cDNA library preparation and sequencing ... RNA was recovered from the gel and ligated to a 5′-adenylated 3′ adapter oligonucleotide (5′-App-TCGTATGCCGTCTTCTGCTTG-L-3′, where L is the 3′OH-blocking group; IDT) by T4 RNA ligase 2-truncated or T4 RNA ligase 2-truncated K227Q (New England Biolabs).

    SDS Page:

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis
    Article Snippet: Successful purification was monitored by SDS-PAGE followed by Coomassie blue staining (Life Technologies, Carlsbad, CA). .. T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Selection:

    Article Title: Analysis of genetically diverse macrophages reveals local and domain-wide mechanisms that control transcription factor binding and function
    Article Snippet: Afterwards, to ligate the 3′ Illumina TruSeq adapter 10 μl of 3′MM was added [1 μl 10x T4 RNA ligase buffer, 6 μl 50% PEG8000, 1.5 μl ddH2 O+T, 0.25 μl heat-denaturated Illumina TruSeq 3′Adapter, 0.25 μl SUPERase-In, 1 μl T4 RNA Ligase 2 truncated K227Q (200U; NEB)], mixed well by flicking and reactions incubated at 20°C for 1 hour. .. 5′ adapter ligation, reverse transcription and library size selection were performed as described for GRO-seq.

    Agarose Gel Electrophoresis:

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: RNA was recovered from the gel and ligated to a 5′-adenylated 3′ adapter oligonucleotide (5′-App-TCGTATGCCGTCTTCTGCTTG-L-3′, where L is the 3′OH-blocking group; IDT) by T4 RNA ligase 2-truncated or T4 RNA ligase 2-truncated K227Q (New England Biolabs). .. After phenol–chloroform extraction followed by ethanol precipitation, the PCR product was digested with PmeI (to cut the size markers) and fractionated by agarose gel electrophoresis, and the undigested PCR product was purified from the gel.

    Ethanol Precipitation:

    Article Title: The use of duplex-specific nuclease in ribosome profiling and a user-friendly software package for Ribo-seq data analysis
    Article Snippet: .. The RNA was concentrated by ethanol precipitation, resuspended in 10 mM Tris–HCl pH 7.5 and ligated in a 20 µL reaction overnight at 14°C to a preadenylated 3′-adaptor (5′-rATGGAATTCTCGGGTGCCAAGG-3′) using T4 RNA Ligase 2 truncated K227Q (New England BioLabs). .. This 3′ adaptor was adenylated using a 5′ DNA adenylation kit (New England BioLabs) following the manufacturer's instructions.

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: Two microliters of glycerol was added, the solution was incubated for another 10 min at room temperature in the dark, and RNAs were purified by ethanol precipitation. cDNA libraries of small RNAs were constructed as described ( ) with some modifications. .. RNA was recovered from the gel and ligated to a 5′-adenylated 3′ adapter oligonucleotide (5′-App-TCGTATGCCGTCTTCTGCTTG-L-3′, where L is the 3′OH-blocking group; IDT) by T4 RNA ligase 2-truncated or T4 RNA ligase 2-truncated K227Q (New England Biolabs).

    Concentration Assay:

    Article Title: 3′ end additions by T7 RNA polymerase are RNA self-templated, distributive and diverse in character—RNA-Seq analyses
    Article Snippet: The 3′ ends of dephosphorylated RNAs were then ligated to 5′ pre-adenylated 3′ adapter with 3′ Biotin modification (the 3′ adapter sequence is shown in ), which was attached to Streptavidin Magnetic Beads (New England BioLabs) , by T4 RNA Ligase 2 truncated K227Q (New England BioLabs) ( ). .. The 5′ ends of ligated product were then phosphorylated by T4 polynucleotide kinase (New England BioLabs) in a 40 μl reaction containing 2 μl of T4 polynucleotide kinase at 10 U μl−1 and 2 mM final concentration of ATP.

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis
    Article Snippet: Elution was carried out by increasing the NaCl concentration by a gradient from 50 mM to 1 M over the course of 10 column volumes. .. T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Article Title: Kinetic CRAC uncovers a role for Nab3 in determining gene expression profiles during stress
    Article Snippet: .. After one 500 µl wash with wash buffer I and three 500 µl washes with 1xPNK buffer, the beads were resuspended in 80 µl of 3′ linker ligation mix (1xPNK buffer, App-PE 3′ adapter (see Supplementary Table ; 0.6 µM final concentration), 10% PEG8000, 30 units of T4 RNA ligase 2 truncated K227Q (NEB), 60 units RNAsin (Promega)). .. The samples were incubated at 25 °C for 4–6 h. Following one 500 µl wash buffer I wash and three 1xPNK buffer washes, the beads were incubated with 60 µl of 5′end labeling mix (1xPNK buffer, 30µCi 32 P-γATP (Perkin Elmer) and 30 units of T4 polynucleotide kinase (NEB)) for 40 min at 37 °C.

    Fractionation:

    Article Title: Biased transcription and selective degradation of small RNAs shape the pattern of DNA elimination in Tetrahymena
    Article Snippet: RNA was recovered from the gel and ligated to a 5′-adenylated 3′ adapter oligonucleotide (5′-App-TCGTATGCCGTCTTCTGCTTG-L-3′, where L is the 3′OH-blocking group; IDT) by T4 RNA ligase 2-truncated or T4 RNA ligase 2-truncated K227Q (New England Biolabs). .. After gel fractionation and purification as above, the product was ligated to the 5′ adapter oligoribonucleotide (5′-GUUCAGAGUUCUACAGUCCGACGAUC-3′) by T4 RNA ligase (Ambion).

    Marker:

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Lysis:

    Article Title: A Novel Epigenetic Silencing Pathway Involving the Highly Conserved 5’-3’ Exoribonuclease Dhp1/Rat1/Xrn2 in Schizosaccharomyces pombe
    Article Snippet: After two washes with TN1000 buffer (100 mM Tris-HCl (pH 7.8), 2 M NaCl, 0.2% NP-40) and two washes with TN150 lysis buffer, the beads were incubated with GST-TEV protease for 2h at 16°C. .. All washes, alkaline phosphatase treatment and 3’ linker ligation were carried out as described except that 40U T4 RNA ligase 2 truncated K227Q (NEB) was used instead of T4 RNA ligase.

    Clear Native PAGE:

    Article Title: Preparation of Multiplexed Small RNA Libraries From Plants
    Article Snippet: 8-Strip PCR thin-walled, 200 μl tubes (Corning Incorporated, Axygen® , catalog number: PCR-0208-CP-C) miRNA cloning linker 1 (/5′App/CTGTAGGCACCATCAAT/3′ddC/; 1 nm) (Integrated DNA Technologies, catalog number: 11-04-03-05) Truncated, K227Q mutation T4 RNA Ligase 2 (New England Biolabs, catalog number: M0351L) De-adenylase (New England Biolabs, catalog number: M0331S) Exonuclease VII (United State Biological, catalog number: 70082Z) RNA 5′ Adapter (GUUCAGAGUUCUACAGUCCGACGAUC) (Illumina RA5, catalog number: 15013205) dATP (Life Technologies, catalog number: 55082) T4 RNA Ligase I (Life Technologies, catalog number: AM2141) RT-PCR Primer (ATTGATGGTGCCTACAG; 25 nmol; de-salted) (Integrated DNA Technologies) SuperScript III (Life Technologies, catalog number: 18080051) Phusion High Fidelity II (Thermo Fisher Scientific, catalog number: F549L) 5′ PCR Primer (Illumina small RNA PCR primer 2: AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA) 3′ Indexed PCR Primer I1 – I12 (100 nmol; PAGE-purified) (Integrated DNA Technologies) Note: The barcodes below (underlined sequences) are reverse complemented in the final Illumina output sequence (see sequence in square brackets for each primer). .. I1 [CGATGT]: CAAGCAGAAGACGGCATACGA ACATCG ATTGATGGTGCCTACAG I2 [GATCAC]: CAAGCAGAAGACGGCATACGA GTGATC ATTGATGGTGCCTACAG I3 [CAGATG]: CAAGCAGAAGACGGCATACGA CATCTG ATTGATGGTGCCTACAG I4 [TACGTT]: CAAGCAGAAGACGGCATACGA AACGTA ATTGATGGTGCCTACAG I5 [TTACCA]: CAAGCAGAAGACGGCATACGA TGGTAA ATTGATGGTGCCTACAG I6 [ACTGTA]: CAAGCAGAAGACGGCATACGA TACAGT ATTGATGGTGCCTACAG I7 [ATCACG]: CAAGCAGAAGACGGCATACGA CGTGAT ATTGATGGTGCCTACAG I8 [ACTTGT]: CAAGCAGAAGACGGCATACGA ACAAGT ATTGATGGTGCCTACAG I9 [GCCAAT]: CAAGCAGAAGACGGCATACGA ATTGGC ATTGATGGTGCCTACAG I10 [TGCTAG]: CAAGCAGAAGACGGCATACGA CTAGCA ATTGATGGTGCCTACAG I11 [CTTGTA]: CAAGCAGAAGACGGCATACGA TACAAG ATTGATGGTGCCTACAG I12 [TCAGGC]: CAAGCAGAAGACGGCATACGA GCCTGA ATTGATGGTGCCTACAG QIAquick PCR Purification Kit (QIAGEN, catalog number: 28106) Diethylpyrocarbonate (DEPC)-H2 O/ RNase-free H2 O DNA size marker suitable for detecting a ~120 bp fragment (50 bp step ladder, Promega Corporation, catalog number: G4521; 25 bp step ladder, Promega Corporation, catalog number: G4511) 3 M sodium acetate (NaOAc) (pH 5.5) Reagents for 6% native PAGE 37.5: 1 polyacrylamide:bisacrylamide (see Recipes) TEMED (Life Technologies, catalog number: 15524-010) 10% Ammonium persulfate (Sigma, catalog number: A3678-100G) (See Recipes)

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs t4 rna ligase 2 truncated k227q
    T4 Rna Ligase 2 Truncated K227q, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2 truncated k227q/product/New England Biolabs
    Average 90 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 truncated k227q - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results