t4 polynucleotide kinase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher t4 polynucleotide kinase
    T4 Polynucleotide Kinase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 580 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 polynucleotide kinase/product/Thermo Fisher
    Average 99 stars, based on 580 article reviews
    Price from $9.99 to $1999.99
    t4 polynucleotide kinase - by Bioz Stars, 2020-02
    99/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
    Article Snippet: After a three-fold phenol deproteinization, the DNA duplex was precipitated with 2.5 volumes of ethanol, with the addition of a 1/10 volume of 3 M NaOAc (pH 5.5) by keeping for 2 hours at -20° C. The pellet was precipitated by centrifugation at 14000 rpm for 10 minutes, washed with 70% ethanol, dried in vacuum, and dissolved in 20 ≤l of water. .. To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour.

    Synthesized:

    Article Title: Pausing during Reverse Transcription Increases the Rate of Retroviral Recombination
    Article Snippet: T4 polynucleotide kinase and proteinase K were purchased from Invitrogen. .. DNA oligonucleotides were synthesized by Operon or QIAGEN.

    Article Title: An Endonuclease Switching Mechanism in the Virion RNA and cRNA Promoters of Thogoto Orthomyxovirus
    Article Snippet: T7 RNA transcripts were synthesized with T7 RNA polymerase (Promega) in the presence of 0.5 μM DNA duplex, 40 mM Tris-HCl (pH 7.9), 10 mM NaCl, 6 mM MgCl2 , 2 mM spermidine, 10 mM dithiothreitol, 0.5 mM each nucleoside triphosphate, and 20 U of RNasin (Promega) for 2 h at 37°C. .. To estimate concentration the RNA was dephosphorylated with alkaline phosphatase (Boehringer Mannheim) and end labeled with T4 polynucleotide kinase (Gibco BRL) in the presence of [α-32 P]ATP, followed by electrophoresis through a 22% polyacrylamide–7 M urea gel alongside a similarly labeled DNA primer of known concentration.

    Autoradiography:

    Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
    Article Snippet: To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour. .. The area containing primer III with the radioactive label was visualised using autoradiography and excised.

    Construct:

    Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
    Article Snippet: For the electromobility shift assay, the homeodomain of Pros was purified from BL21 cells transfected with the construct pGex-prosL that was kindly provided by Tiffany Cook (Department of Pediatric Ophthalmology, Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, Cincinnati, OH). .. Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg.

    Electrophoresis:

    Article Title: An Endonuclease Switching Mechanism in the Virion RNA and cRNA Promoters of Thogoto Orthomyxovirus
    Article Snippet: .. To estimate concentration the RNA was dephosphorylated with alkaline phosphatase (Boehringer Mannheim) and end labeled with T4 polynucleotide kinase (Gibco BRL) in the presence of [α-32 P]ATP, followed by electrophoresis through a 22% polyacrylamide–7 M urea gel alongside a similarly labeled DNA primer of known concentration. ..

    Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
    Article Snippet: To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour. .. The enzyme was heat-inactivated for 15 minutes at 75° C. The 32 P-labeled primer III was purified by electrophoresis in denaturing 12% PAAG.

    Electro Mobility Shift Assay:

    Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
    Article Snippet: Paragraph title: Electromobility shift assay. ... Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg.

    Stripping Membranes:

    Article Title: Small RNA Bidirectional Crosstalk During the Interaction Between Wheat and Zymoseptoria tritici
    Article Snippet: Oligonucleotides were end-labeled by incubation with T4 PNK (Thermo Scientific) in the presence of [γ-32P] dATP. .. Multiple small RNAs were hybridized on individual membranes by stripping twice with boiling 0.1% SDS and re-probing.

    Activity Assay:

    Article Title: Prokaryotic silencing (psi)RNAs in Pyrococcus furiosus
    Article Snippet: .. Deoxyribonucleotide probes (MWG) (20 pmol) were 5′ end-labeled with T4 Polynucleotide Kinase (Ambion) and γ-[32 P]-ATP (specific activity > 7000 Ci/mmol, MP Biomedicals) using standard protocols. .. Labeled probes were added to the prehybridization buffer, followed by hybridization overnight at 42°C.

    Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
    Article Snippet: .. To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour. .. The enzyme was heat-inactivated for 15 minutes at 75° C. The 32 P-labeled primer III was purified by electrophoresis in denaturing 12% PAAG.

    Modification:

    Article Title: The VSV Polymerase can initiate at mRNA start sites located either up or downstream of a transcription termination signal but size of the intervening intergenic region affects efficiency of initiation
    Article Snippet: Briefly, PAGE-purified oligonucleotides (Operon, Valencia, CA) were end-labeled in the presence of γ33 P ATP using T4 polynucleotide kinase (Invitrogen, Carlsbad, CA), and purified from unincorporated label using a QIAquick nucleotide removal column. .. Sequence ladders to act as size markers were generated using Sequenase modified T7 DNA polymerase (Sequenase 2.0, US.

    Hybridization:

    Article Title: Prokaryotic silencing (psi)RNAs in Pyrococcus furiosus
    Article Snippet: Prehybridization and hybridization was performed in either Oligo-UltraHyb (Ambion) buffer or hybridization buffer containing 5× SSC, 7% SDS, 20 mM sodium phosphate (pH 7.0), and 1× Denhardt's solution. .. Deoxyribonucleotide probes (MWG) (20 pmol) were 5′ end-labeled with T4 Polynucleotide Kinase (Ambion) and γ-[32 P]-ATP (specific activity > 7000 Ci/mmol, MP Biomedicals) using standard protocols.

    Countercurrent Chromatography:

    Article Title: Inhibition of Rho kinase modulates radiation induced fibrogenic phenotype in intestinal smooth muscle cells through alteration of the cytoskeleton and connective tissue growth factor expression
    Article Snippet: .. PAGE purified double stranded oligodeoxynucleotides containing nuclear factor κB (NFκB) binding elements (5′-GAG GAA TGT CCC TGT TTG-3′) were 5′ end labelled with [γ-32 P]ATP using T4 polynucleotide kinase (Life Technology, Cergy Pontoise, France). .. End labelled probes were purified using a G-50 column (Pharmacia, Saclay, France) and 1×105 cpm were incubated with 2–5 µg nuclear extract for 30 minutes at room temperature in a final volume of 20 µl containing 25 mM Tris HCl, pH 8, 50 mM KCl, 6.25 mM MgCl2 , 0.5 mM EDTA, 0.5 mM DTT, 10% glycerol, and 1 µg/µl poly(dI-dC).

    Transfection:

    Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
    Article Snippet: For the electromobility shift assay, the homeodomain of Pros was purified from BL21 cells transfected with the construct pGex-prosL that was kindly provided by Tiffany Cook (Department of Pediatric Ophthalmology, Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, Cincinnati, OH). .. Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg.

    Chromatography:

    Article Title: Hsp72 Induces Inflammation and Regulates Cytokine Production in Airway Epithelium through a TLR4- and NF-κB-Dependent Mechanism 1
    Article Snippet: .. An oligonucleotide probe encoding the consensus sequence of NF- κ B was purchased from Santa Cruz Biotechnology, was labeled with [ γ -32 P]ATP using T4 polynucleotide kinase (Invitrogen) and purified in MicroBiospin chromatography column. .. In some instances, Abs against p65 (RelA) or p50 (NF- κ B1; Santa Cruz Biotechnology) were added (10 min at room temperature).

    Northern Blot:

    Article Title: Prokaryotic silencing (psi)RNAs in Pyrococcus furiosus
    Article Snippet: Paragraph title: Northern analysis ... Deoxyribonucleotide probes (MWG) (20 pmol) were 5′ end-labeled with T4 Polynucleotide Kinase (Ambion) and γ-[32 P]-ATP (specific activity > 7000 Ci/mmol, MP Biomedicals) using standard protocols.

    Article Title: Small RNA Bidirectional Crosstalk During the Interaction Between Wheat and Zymoseptoria tritici
    Article Snippet: Paragraph title: Northern Blot Analysis ... Oligonucleotides were end-labeled by incubation with T4 PNK (Thermo Scientific) in the presence of [γ-32P] dATP.

    Infection:

    Article Title: Tomato Chlorotic Mottle Virus Is a Target of RNA Silencing but the Presence of Specific Short Interfering RNAs Does Not Guarantee Resistance in Transgenic Plants ▿
    Article Snippet: For purification of small RNAs from infected and healthy N. benthamiana and tomato plants, about 30 μg of low-molecular-mass RNAs was fractionated in a 15% denaturing polyacrylamide gel containing 8 M urea. .. The small RNAs (approximately 1 μg) were dephosphorylated with alkaline phosphatase and labeled with 32 P by T4 polynucleotide kinase using [γ-32 P]ATP according to the manufacturer's instructions (Invitrogen).

    Article Title: Small RNA Bidirectional Crosstalk During the Interaction Between Wheat and Zymoseptoria tritici
    Article Snippet: Northern Blot Analysis Total RNA from wheat leaves infected by Z. tritici at 12 dpi and uninfected wheat leaves at the same time point were used for Northern blot. .. Oligonucleotides were end-labeled by incubation with T4 PNK (Thermo Scientific) in the presence of [γ-32P] dATP.

    Generated:

    Article Title: The VSV Polymerase can initiate at mRNA start sites located either up or downstream of a transcription termination signal but size of the intervening intergenic region affects efficiency of initiation
    Article Snippet: Briefly, PAGE-purified oligonucleotides (Operon, Valencia, CA) were end-labeled in the presence of γ33 P ATP using T4 polynucleotide kinase (Invitrogen, Carlsbad, CA), and purified from unincorporated label using a QIAquick nucleotide removal column. .. Sequence ladders to act as size markers were generated using Sequenase modified T7 DNA polymerase (Sequenase 2.0, US.

    Thin Layer Chromatography:

    Article Title: MTA Is an Arabidopsis Messenger RNA Adenosine Methylase and Interacts with a Homolog of a Sex-Specific Splicing Factor [W] Messenger RNA Adenosine Methylase and Interacts with a Homolog of a Sex-Specific Splicing Factor [W] [OA]
    Article Snippet: Paragraph title: mRNA Purification, Labeling, and TLC Analysis ... The 5′ end of the digested mRNA fragments were then labeled using 10 units of T4 polynucleotide kinase (Fermentas) in the presence of 1 μL of [γ-32 P]ATP (6000 Ci/mmol; Perkin-Elmer).

    Polymerase Chain Reaction:

    Article Title: Phosphate-Controlled Regulator for the Biosynthesis of the Dalbavancin Precursor A40926 ▿Phosphate-Controlled Regulator for the Biosynthesis of the Dalbavancin Precursor A40926 ▿ †
    Article Snippet: DNA fragments of 352, 171, 351, 158, and 232 bp, containing the dbv4 , dbv14 , dbv30 , bbr , and oxyA upstream regions, respectively, were prepared by PCR in the presence of [α-32 P]CTP, using the primers reported in Table S1 in the supplemental material. .. The annealed products were recovered from nondenaturing 20% polyacrylamide gels by the crush-soak method ( ) and labeled with T4 polynucleotide kinase (Invitrogen) according to the supplier's protocol.

    Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
    Article Snippet: Formation of DNA-duplex I/II proceeded on a PCR thermal cycler by keeping 20 ≤l of the reaction mixture containing 500 pmol of oligonucleotide I and 550 pmol of oligonucleotide II at 95° C for 3 minutes and then cooling the thermostat from 95 to 35° C at a speed of 0.5°/min and from 35 to 20° C at a speed of 0.25°/min. .. To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour.

    Binding Assay:

    Article Title: p53 promotes the fidelity of DNA end-joining activity by, in part, enhancing the expression of heterogeneous nuclear ribonucleoprotein G
    Article Snippet: To analyze DNA end protection, the EcoRV-linearized plasmid was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Invitrogen). .. The end-labeled DNA was incubated with the extracts for 30 min at 37°C in a 10 μl reaction mixture containing the indicated amount of extracts and 1X binding buffer.

    Article Title: Inhibition of Rho kinase modulates radiation induced fibrogenic phenotype in intestinal smooth muscle cells through alteration of the cytoskeleton and connective tissue growth factor expression
    Article Snippet: .. PAGE purified double stranded oligodeoxynucleotides containing nuclear factor κB (NFκB) binding elements (5′-GAG GAA TGT CCC TGT TTG-3′) were 5′ end labelled with [γ-32 P]ATP using T4 polynucleotide kinase (Life Technology, Cergy Pontoise, France). .. End labelled probes were purified using a G-50 column (Pharmacia, Saclay, France) and 1×105 cpm were incubated with 2–5 µg nuclear extract for 30 minutes at room temperature in a final volume of 20 µl containing 25 mM Tris HCl, pH 8, 50 mM KCl, 6.25 mM MgCl2 , 0.5 mM EDTA, 0.5 mM DTT, 10% glycerol, and 1 µg/µl poly(dI-dC).

    Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
    Article Snippet: .. Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg. .. The labeled oligos were mixed with the purified proteins in binding buffer (20 m m HEPES, pH 7.5, 100 m m NaCl, 1 m m DTT, 5 m m MgCl2 ) and incubated for 20 min at RT.

    Article Title: Hsp72 Induces Inflammation and Regulates Cytokine Production in Airway Epithelium through a TLR4- and NF-κB-Dependent Mechanism 1
    Article Snippet: The lysates were centrifuged (15,000 × g , 30 min, 4°C), and the supernatant (nuclear extract) was collected for evaluation of DNA binding of NF- κ B. .. An oligonucleotide probe encoding the consensus sequence of NF- κ B was purchased from Santa Cruz Biotechnology, was labeled with [ γ -32 P]ATP using T4 polynucleotide kinase (Invitrogen) and purified in MicroBiospin chromatography column.

    Methylation:

    Article Title: MTA Is an Arabidopsis Messenger RNA Adenosine Methylase and Interacts with a Homolog of a Sex-Specific Splicing Factor [W] Messenger RNA Adenosine Methylase and Interacts with a Homolog of a Sex-Specific Splicing Factor [W] [OA]
    Article Snippet: The 5′ end of the digested mRNA fragments were then labeled using 10 units of T4 polynucleotide kinase (Fermentas) in the presence of 1 μL of [γ-32 P]ATP (6000 Ci/mmol; Perkin-Elmer). .. The identification of labeled nucleotide spots was carried out using synthetic methylated and nonmethylated RNAs and by comparison with the published reference map of nucleotides for this solvent system ( ).

    Mutagenesis:

    Article Title: Pausing during Reverse Transcription Increases the Rate of Retroviral Recombination
    Article Snippet: T4 polynucleotide kinase and proteinase K were purchased from Invitrogen. .. Plasmid mutagenesis was performed using the QuikChange site-directed mutagenesis kit from Stratagene.

    Isolation:

    Article Title: MTA Is an Arabidopsis Messenger RNA Adenosine Methylase and Interacts with a Homolog of a Sex-Specific Splicing Factor [W] Messenger RNA Adenosine Methylase and Interacts with a Homolog of a Sex-Specific Splicing Factor [W] [OA]
    Article Snippet: Briefly, 100 μg of total RNA was extracted from Arabidopsis tissue samples using the Plant RNeasy Mini kit (Qiagen), and the poly(A) fraction was purified using the PolyAttract mRNA isolation kit (Promega). .. The 5′ end of the digested mRNA fragments were then labeled using 10 units of T4 polynucleotide kinase (Fermentas) in the presence of 1 μL of [γ-32 P]ATP (6000 Ci/mmol; Perkin-Elmer).

    Electrophoretic Mobility Shift Assay:

    Article Title: p53 promotes the fidelity of DNA end-joining activity by, in part, enhancing the expression of heterogeneous nuclear ribonucleoprotein G
    Article Snippet: Paragraph title: 2.7. DNA end protection gel shift assay ... To analyze DNA end protection, the EcoRV-linearized plasmid was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Invitrogen).

    Article Title: Inhibition of Rho kinase modulates radiation induced fibrogenic phenotype in intestinal smooth muscle cells through alteration of the cytoskeleton and connective tissue growth factor expression
    Article Snippet: Paragraph title: Electrophoretic mobility shift assay (EMSA) ... PAGE purified double stranded oligodeoxynucleotides containing nuclear factor κB (NFκB) binding elements (5′-GAG GAA TGT CCC TGT TTG-3′) were 5′ end labelled with [γ-32 P]ATP using T4 polynucleotide kinase (Life Technology, Cergy Pontoise, France).

    Purification:

    Article Title: Inhibition of Rho kinase modulates radiation induced fibrogenic phenotype in intestinal smooth muscle cells through alteration of the cytoskeleton and connective tissue growth factor expression
    Article Snippet: .. PAGE purified double stranded oligodeoxynucleotides containing nuclear factor κB (NFκB) binding elements (5′-GAG GAA TGT CCC TGT TTG-3′) were 5′ end labelled with [γ-32 P]ATP using T4 polynucleotide kinase (Life Technology, Cergy Pontoise, France). .. End labelled probes were purified using a G-50 column (Pharmacia, Saclay, France) and 1×105 cpm were incubated with 2–5 µg nuclear extract for 30 minutes at room temperature in a final volume of 20 µl containing 25 mM Tris HCl, pH 8, 50 mM KCl, 6.25 mM MgCl2 , 0.5 mM EDTA, 0.5 mM DTT, 10% glycerol, and 1 µg/µl poly(dI-dC).

    Article Title: Tomato Chlorotic Mottle Virus Is a Target of RNA Silencing but the Presence of Specific Short Interfering RNAs Does Not Guarantee Resistance in Transgenic Plants ▿
    Article Snippet: For purification of small RNAs from infected and healthy N. benthamiana and tomato plants, about 30 μg of low-molecular-mass RNAs was fractionated in a 15% denaturing polyacrylamide gel containing 8 M urea. .. The small RNAs (approximately 1 μg) were dephosphorylated with alkaline phosphatase and labeled with 32 P by T4 polynucleotide kinase using [γ-32 P]ATP according to the manufacturer's instructions (Invitrogen).

    Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
    Article Snippet: For the electromobility shift assay, the homeodomain of Pros was purified from BL21 cells transfected with the construct pGex-prosL that was kindly provided by Tiffany Cook (Department of Pediatric Ophthalmology, Division of Developmental Biology, Cincinnati Children's Hospital Medical Center, Cincinnati, OH). .. Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg.

    Article Title: Hsp72 Induces Inflammation and Regulates Cytokine Production in Airway Epithelium through a TLR4- and NF-κB-Dependent Mechanism 1
    Article Snippet: .. An oligonucleotide probe encoding the consensus sequence of NF- κ B was purchased from Santa Cruz Biotechnology, was labeled with [ γ -32 P]ATP using T4 polynucleotide kinase (Invitrogen) and purified in MicroBiospin chromatography column. .. In some instances, Abs against p65 (RelA) or p50 (NF- κ B1; Santa Cruz Biotechnology) were added (10 min at room temperature).

    Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
    Article Snippet: To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour. .. The enzyme was heat-inactivated for 15 minutes at 75° C. The 32 P-labeled primer III was purified by electrophoresis in denaturing 12% PAAG.

    Article Title: MTA Is an Arabidopsis Messenger RNA Adenosine Methylase and Interacts with a Homolog of a Sex-Specific Splicing Factor [W] Messenger RNA Adenosine Methylase and Interacts with a Homolog of a Sex-Specific Splicing Factor [W] [OA]
    Article Snippet: Paragraph title: mRNA Purification, Labeling, and TLC Analysis ... The 5′ end of the digested mRNA fragments were then labeled using 10 units of T4 polynucleotide kinase (Fermentas) in the presence of 1 μL of [γ-32 P]ATP (6000 Ci/mmol; Perkin-Elmer).

    Article Title: The VSV Polymerase can initiate at mRNA start sites located either up or downstream of a transcription termination signal but size of the intervening intergenic region affects efficiency of initiation
    Article Snippet: .. Briefly, PAGE-purified oligonucleotides (Operon, Valencia, CA) were end-labeled in the presence of γ33 P ATP using T4 polynucleotide kinase (Invitrogen, Carlsbad, CA), and purified from unincorporated label using a QIAquick nucleotide removal column. .. Primers were annealed in excess to VSV-specific RNAs, and extended for 30 minutes at 42°C using superscript III reverse transcriptase (Invitrogen).

    Sequencing:

    Article Title: An Endonuclease Switching Mechanism in the Virion RNA and cRNA Promoters of Thogoto Orthomyxovirus
    Article Snippet: Short model RNAs were transcribed with T7 RNA polymerase from partial DNA duplexes that consisted of an upstream double-stranded T7 RNA polymerase promoter region and a 5′-terminal overhang corresponding to the transcribed sequence as described previously ( ). .. To estimate concentration the RNA was dephosphorylated with alkaline phosphatase (Boehringer Mannheim) and end labeled with T4 polynucleotide kinase (Gibco BRL) in the presence of [α-32 P]ATP, followed by electrophoresis through a 22% polyacrylamide–7 M urea gel alongside a similarly labeled DNA primer of known concentration.

    Article Title: Hsp72 Induces Inflammation and Regulates Cytokine Production in Airway Epithelium through a TLR4- and NF-κB-Dependent Mechanism 1
    Article Snippet: .. An oligonucleotide probe encoding the consensus sequence of NF- κ B was purchased from Santa Cruz Biotechnology, was labeled with [ γ -32 P]ATP using T4 polynucleotide kinase (Invitrogen) and purified in MicroBiospin chromatography column. .. In some instances, Abs against p65 (RelA) or p50 (NF- κ B1; Santa Cruz Biotechnology) were added (10 min at room temperature).

    Article Title: The VSV Polymerase can initiate at mRNA start sites located either up or downstream of a transcription termination signal but size of the intervening intergenic region affects efficiency of initiation
    Article Snippet: Briefly, PAGE-purified oligonucleotides (Operon, Valencia, CA) were end-labeled in the presence of γ33 P ATP using T4 polynucleotide kinase (Invitrogen, Carlsbad, CA), and purified from unincorporated label using a QIAquick nucleotide removal column. .. Sequence ladders to act as size markers were generated using Sequenase modified T7 DNA polymerase (Sequenase 2.0, US.

    Labeling:

    Article Title: p53 promotes the fidelity of DNA end-joining activity by, in part, enhancing the expression of heterogeneous nuclear ribonucleoprotein G
    Article Snippet: .. To analyze DNA end protection, the EcoRV-linearized plasmid was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Invitrogen). .. The end-labeled DNA was incubated with the extracts for 30 min at 37°C in a 10 μl reaction mixture containing the indicated amount of extracts and 1X binding buffer.

    Article Title: Prokaryotic silencing (psi)RNAs in Pyrococcus furiosus
    Article Snippet: Deoxyribonucleotide probes (MWG) (20 pmol) were 5′ end-labeled with T4 Polynucleotide Kinase (Ambion) and γ-[32 P]-ATP (specific activity > 7000 Ci/mmol, MP Biomedicals) using standard protocols. .. Labeled probes were added to the prehybridization buffer, followed by hybridization overnight at 42°C.

    Article Title: Tomato Chlorotic Mottle Virus Is a Target of RNA Silencing but the Presence of Specific Short Interfering RNAs Does Not Guarantee Resistance in Transgenic Plants ▿
    Article Snippet: .. The small RNAs (approximately 1 μg) were dephosphorylated with alkaline phosphatase and labeled with 32 P by T4 polynucleotide kinase using [γ-32 P]ATP according to the manufacturer's instructions (Invitrogen). .. To evaluate the potential of RNA silencing for the control of ToCMoV-[BA-Se1], an intron-hairpin construct was generated containing the virus sequences that were most highly targeted by RNA silencing during virus infection in N. benthamiana .

    Article Title: Phosphate-Controlled Regulator for the Biosynthesis of the Dalbavancin Precursor A40926 ▿Phosphate-Controlled Regulator for the Biosynthesis of the Dalbavancin Precursor A40926 ▿ †
    Article Snippet: .. The annealed products were recovered from nondenaturing 20% polyacrylamide gels by the crush-soak method ( ) and labeled with T4 polynucleotide kinase (Invitrogen) according to the supplier's protocol. ..

    Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
    Article Snippet: Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg. .. The labeled oligos were mixed with the purified proteins in binding buffer (20 m m HEPES, pH 7.5, 100 m m NaCl, 1 m m DTT, 5 m m MgCl2 ) and incubated for 20 min at RT.

    Article Title: An Endonuclease Switching Mechanism in the Virion RNA and cRNA Promoters of Thogoto Orthomyxovirus
    Article Snippet: .. To estimate concentration the RNA was dephosphorylated with alkaline phosphatase (Boehringer Mannheim) and end labeled with T4 polynucleotide kinase (Gibco BRL) in the presence of [α-32 P]ATP, followed by electrophoresis through a 22% polyacrylamide–7 M urea gel alongside a similarly labeled DNA primer of known concentration. ..

    Article Title: Hsp72 Induces Inflammation and Regulates Cytokine Production in Airway Epithelium through a TLR4- and NF-κB-Dependent Mechanism 1
    Article Snippet: .. An oligonucleotide probe encoding the consensus sequence of NF- κ B was purchased from Santa Cruz Biotechnology, was labeled with [ γ -32 P]ATP using T4 polynucleotide kinase (Invitrogen) and purified in MicroBiospin chromatography column. .. In some instances, Abs against p65 (RelA) or p50 (NF- κ B1; Santa Cruz Biotechnology) were added (10 min at room temperature).

    Article Title: The Oncogenic Signaling Pathways in BRAF-Mutant Melanoma Cells Are Modulated by Naphthalene Diimide-Like G-Quadruplex Ligands
    Article Snippet: .. Taq Polymerase Stop Assay The DNA primer ( ) was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Thermo Scientific, Milan, Italy) at 37 °C for 30 min. .. The labeled primer (final concentration 72 nM) was annealed to the templates (final concentration 36 nM) ( ) in lithium cacodylate buffer (10 mM, pH 7.4) in the presence or absence of KCl 10 mM by heating at 95 °C for 5 min and gradually cooling to room temperature to allow both primer annealing and G4 folding.

    Article Title: MTA Is an Arabidopsis Messenger RNA Adenosine Methylase and Interacts with a Homolog of a Sex-Specific Splicing Factor [W] Messenger RNA Adenosine Methylase and Interacts with a Homolog of a Sex-Specific Splicing Factor [W] [OA]
    Article Snippet: .. The 5′ end of the digested mRNA fragments were then labeled using 10 units of T4 polynucleotide kinase (Fermentas) in the presence of 1 μL of [γ-32 P]ATP (6000 Ci/mmol; Perkin-Elmer). .. After ethanol precipitation, the labeled RNA was resuspended in 10 μL of 50 mM sodium acetate (pH 5.5) and digested to monophosphonucleotides by RNase P1 (Sigma-Aldrich).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Inhibition of Rho kinase modulates radiation induced fibrogenic phenotype in intestinal smooth muscle cells through alteration of the cytoskeleton and connective tissue growth factor expression
    Article Snippet: .. PAGE purified double stranded oligodeoxynucleotides containing nuclear factor κB (NFκB) binding elements (5′-GAG GAA TGT CCC TGT TTG-3′) were 5′ end labelled with [γ-32 P]ATP using T4 polynucleotide kinase (Life Technology, Cergy Pontoise, France). .. End labelled probes were purified using a G-50 column (Pharmacia, Saclay, France) and 1×105 cpm were incubated with 2–5 µg nuclear extract for 30 minutes at room temperature in a final volume of 20 µl containing 25 mM Tris HCl, pH 8, 50 mM KCl, 6.25 mM MgCl2 , 0.5 mM EDTA, 0.5 mM DTT, 10% glycerol, and 1 µg/µl poly(dI-dC).

    Article Title: The VSV Polymerase can initiate at mRNA start sites located either up or downstream of a transcription termination signal but size of the intervening intergenic region affects efficiency of initiation
    Article Snippet: .. Briefly, PAGE-purified oligonucleotides (Operon, Valencia, CA) were end-labeled in the presence of γ33 P ATP using T4 polynucleotide kinase (Invitrogen, Carlsbad, CA), and purified from unincorporated label using a QIAquick nucleotide removal column. .. Primers were annealed in excess to VSV-specific RNAs, and extended for 30 minutes at 42°C using superscript III reverse transcriptase (Invitrogen).

    Article Title: A hexanucleotide selected for increased cellular uptake in cis contains a highly active CpG-motif in human B cells and primary peripheral blood mononuclear cells
    Article Snippet: To measure the cellular uptake of naked ON, 10 pmol ON was 5′-end-labelled with [γ-32 P]ATP using T4 polynucleotide kinase (MBI Fermentas). .. Twenty microlitres of the lysate were separated by PAGE.

    Activated Clotting Time Assay:

    Article Title: The VSV Polymerase can initiate at mRNA start sites located either up or downstream of a transcription termination signal but size of the intervening intergenic region affects efficiency of initiation
    Article Snippet: Briefly, PAGE-purified oligonucleotides (Operon, Valencia, CA) were end-labeled in the presence of γ33 P ATP using T4 polynucleotide kinase (Invitrogen, Carlsbad, CA), and purified from unincorporated label using a QIAquick nucleotide removal column. .. Sequence ladders to act as size markers were generated using Sequenase modified T7 DNA polymerase (Sequenase 2.0, US.

    Plasmid Preparation:

    Article Title: p53 promotes the fidelity of DNA end-joining activity by, in part, enhancing the expression of heterogeneous nuclear ribonucleoprotein G
    Article Snippet: .. To analyze DNA end protection, the EcoRV-linearized plasmid was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Invitrogen). .. The end-labeled DNA was incubated with the extracts for 30 min at 37°C in a 10 μl reaction mixture containing the indicated amount of extracts and 1X binding buffer.

    Article Title: Pausing during Reverse Transcription Increases the Rate of Retroviral Recombination
    Article Snippet: T4 polynucleotide kinase and proteinase K were purchased from Invitrogen. .. Plasmid mutagenesis was performed using the QuikChange site-directed mutagenesis kit from Stratagene.

    Ethanol Precipitation:

    Article Title: The Oncogenic Signaling Pathways in BRAF-Mutant Melanoma Cells Are Modulated by Naphthalene Diimide-Like G-Quadruplex Ligands
    Article Snippet: Taq Polymerase Stop Assay The DNA primer ( ) was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Thermo Scientific, Milan, Italy) at 37 °C for 30 min. .. Reactions were stopped by ethanol precipitation and primer extension products were separated on a 14% denaturing gel, and visualized with phosphorimaging (Typhoon FLA 9000, GE Healthcare, Milan, Italy).

    Article Title: MTA Is an Arabidopsis Messenger RNA Adenosine Methylase and Interacts with a Homolog of a Sex-Specific Splicing Factor [W] Messenger RNA Adenosine Methylase and Interacts with a Homolog of a Sex-Specific Splicing Factor [W] [OA]
    Article Snippet: The 5′ end of the digested mRNA fragments were then labeled using 10 units of T4 polynucleotide kinase (Fermentas) in the presence of 1 μL of [γ-32 P]ATP (6000 Ci/mmol; Perkin-Elmer). .. After ethanol precipitation, the labeled RNA was resuspended in 10 μL of 50 mM sodium acetate (pH 5.5) and digested to monophosphonucleotides by RNase P1 (Sigma-Aldrich).

    Incubation:

    Article Title: p53 promotes the fidelity of DNA end-joining activity by, in part, enhancing the expression of heterogeneous nuclear ribonucleoprotein G
    Article Snippet: To analyze DNA end protection, the EcoRV-linearized plasmid was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Invitrogen). .. The end-labeled DNA was incubated with the extracts for 30 min at 37°C in a 10 μl reaction mixture containing the indicated amount of extracts and 1X binding buffer.

    Article Title: Inhibition of Rho kinase modulates radiation induced fibrogenic phenotype in intestinal smooth muscle cells through alteration of the cytoskeleton and connective tissue growth factor expression
    Article Snippet: PAGE purified double stranded oligodeoxynucleotides containing nuclear factor κB (NFκB) binding elements (5′-GAG GAA TGT CCC TGT TTG-3′) were 5′ end labelled with [γ-32 P]ATP using T4 polynucleotide kinase (Life Technology, Cergy Pontoise, France). .. End labelled probes were purified using a G-50 column (Pharmacia, Saclay, France) and 1×105 cpm were incubated with 2–5 µg nuclear extract for 30 minutes at room temperature in a final volume of 20 µl containing 25 mM Tris HCl, pH 8, 50 mM KCl, 6.25 mM MgCl2 , 0.5 mM EDTA, 0.5 mM DTT, 10% glycerol, and 1 µg/µl poly(dI-dC).

    Article Title: Tomato Chlorotic Mottle Virus Is a Target of RNA Silencing but the Presence of Specific Short Interfering RNAs Does Not Guarantee Resistance in Transgenic Plants ▿
    Article Snippet: After staining with ethidium bromide, the region containing the small RNAs was excised from the gel, cut in small pieces, and incubated in 3 M NaCl overnight at 4°C to allow diffusion. .. The small RNAs (approximately 1 μg) were dephosphorylated with alkaline phosphatase and labeled with 32 P by T4 polynucleotide kinase using [γ-32 P]ATP according to the manufacturer's instructions (Invitrogen).

    Article Title: Phosphate-Controlled Regulator for the Biosynthesis of the Dalbavancin Precursor A40926 ▿Phosphate-Controlled Regulator for the Biosynthesis of the Dalbavancin Precursor A40926 ▿ †
    Article Snippet: The 50-bp fragments 14A, 14B, 14C, and 14D were prepared by incubation of the corresponding oligonucleotides at 90°C for 10 min, followed by slow cooling to room temperature. .. The annealed products were recovered from nondenaturing 20% polyacrylamide gels by the crush-soak method ( ) and labeled with T4 polynucleotide kinase (Invitrogen) according to the supplier's protocol.

    Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
    Article Snippet: Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg. .. The labeled oligos were mixed with the purified proteins in binding buffer (20 m m HEPES, pH 7.5, 100 m m NaCl, 1 m m DTT, 5 m m MgCl2 ) and incubated for 20 min at RT.

    Article Title: The Oncogenic Signaling Pathways in BRAF-Mutant Melanoma Cells Are Modulated by Naphthalene Diimide-Like G-Quadruplex Ligands
    Article Snippet: Taq Polymerase Stop Assay The DNA primer ( ) was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Thermo Scientific, Milan, Italy) at 37 °C for 30 min. .. Where specified, samples were incubated with 1 (37.5–150.0 nM) and primer extension was performed with 2 U/reaction of AmpliTaq Gold DNA polymerase (Applied Biosystem, Carlsbad, CA, USA) at 56 °C for 30 min.

    Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
    Article Snippet: .. To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour. .. The enzyme was heat-inactivated for 15 minutes at 75° C. The 32 P-labeled primer III was purified by electrophoresis in denaturing 12% PAAG.

    Article Title: Small RNA Bidirectional Crosstalk During the Interaction Between Wheat and Zymoseptoria tritici
    Article Snippet: .. Oligonucleotides were end-labeled by incubation with T4 PNK (Thermo Scientific) in the presence of [γ-32P] dATP. .. Multiple small RNAs were hybridized on individual membranes by stripping twice with boiling 0.1% SDS and re-probing.

    Article Title: A hexanucleotide selected for increased cellular uptake in cis contains a highly active CpG-motif in human B cells and primary peripheral blood mononuclear cells
    Article Snippet: To measure the cellular uptake of naked ON, 10 pmol ON was 5′-end-labelled with [γ-32 P]ATP using T4 polynucleotide kinase (MBI Fermentas). .. BHK cells (5 ×105 cells) were seeded in Petri dishes (60 mm in diameter), incubated overnight and then treated with 1·8 n m radiolabelled ON for 2 hr.

    Concentration Assay:

    Article Title: An Endonuclease Switching Mechanism in the Virion RNA and cRNA Promoters of Thogoto Orthomyxovirus
    Article Snippet: .. To estimate concentration the RNA was dephosphorylated with alkaline phosphatase (Boehringer Mannheim) and end labeled with T4 polynucleotide kinase (Gibco BRL) in the presence of [α-32 P]ATP, followed by electrophoresis through a 22% polyacrylamide–7 M urea gel alongside a similarly labeled DNA primer of known concentration. ..

    Article Title: Hsp72 Induces Inflammation and Regulates Cytokine Production in Airway Epithelium through a TLR4- and NF-κB-Dependent Mechanism 1
    Article Snippet: An oligonucleotide probe encoding the consensus sequence of NF- κ B was purchased from Santa Cruz Biotechnology, was labeled with [ γ -32 P]ATP using T4 polynucleotide kinase (Invitrogen) and purified in MicroBiospin chromatography column. .. Cold specific and nonspecific probes were added at 5× the concentration of the radiolabeled probe.

    Article Title: The Oncogenic Signaling Pathways in BRAF-Mutant Melanoma Cells Are Modulated by Naphthalene Diimide-Like G-Quadruplex Ligands
    Article Snippet: Taq Polymerase Stop Assay The DNA primer ( ) was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Thermo Scientific, Milan, Italy) at 37 °C for 30 min. .. The labeled primer (final concentration 72 nM) was annealed to the templates (final concentration 36 nM) ( ) in lithium cacodylate buffer (10 mM, pH 7.4) in the presence or absence of KCl 10 mM by heating at 95 °C for 5 min and gradually cooling to room temperature to allow both primer annealing and G4 folding.

    Diffusion-based Assay:

    Article Title: Tomato Chlorotic Mottle Virus Is a Target of RNA Silencing but the Presence of Specific Short Interfering RNAs Does Not Guarantee Resistance in Transgenic Plants ▿
    Article Snippet: After staining with ethidium bromide, the region containing the small RNAs was excised from the gel, cut in small pieces, and incubated in 3 M NaCl overnight at 4°C to allow diffusion. .. The small RNAs (approximately 1 μg) were dephosphorylated with alkaline phosphatase and labeled with 32 P by T4 polynucleotide kinase using [γ-32 P]ATP according to the manufacturer's instructions (Invitrogen).

    Staining:

    Article Title: Tomato Chlorotic Mottle Virus Is a Target of RNA Silencing but the Presence of Specific Short Interfering RNAs Does Not Guarantee Resistance in Transgenic Plants ▿
    Article Snippet: After staining with ethidium bromide, the region containing the small RNAs was excised from the gel, cut in small pieces, and incubated in 3 M NaCl overnight at 4°C to allow diffusion. .. The small RNAs (approximately 1 μg) were dephosphorylated with alkaline phosphatase and labeled with 32 P by T4 polynucleotide kinase using [γ-32 P]ATP according to the manufacturer's instructions (Invitrogen).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher t4 polynucleotide kinase
    Processing at the −43 site of 16S rRNA.A. Differential RNA-seq data for the 3′ end of 16S rRNA. The screenshot is for the rrnE operon, which is representative of all seven rRNA operons in E. coli . The tracks from top to bottom show the genome position, location of the 3′ end of 16S rRNA and positions of processing sites as identified by differential RNA-seq in the absence of TAP treatment. The positions of the −43 site, sites of known cleavage by RNase III and P and a site of cleavage by an unknown RNase (labelled ‘?’) are indicated. The numbers at the left of the RNA-seq track indicates the scale of the sequencing reads. The schematic at the bottom of panel indicates the position of a BstEII site that was used to confirm the identity of an 88 bp amplicon produced by RLM-RT-PCR analysis of the −43 site (see B and C). The numbers indicate the sizes (bp) of the predicted products of cleavage at the BstEII site. It should be noted that the products have the equivalent of half a base-pair as BstEII generates 5 nt overhangs. Arrows indicate the position of primers used for PCR. Segments of the amplicon corresponding to the 5′ adaptor are drawn at an angle, while those corresponding to the 3′ end of 16S rRNA are drawn horizontally.B. RLM-RT-PCR analysis of RNA isolated from strain BW25113 (labelled wt) growing exponentially (labelled Exp.) and a congenic Δ mazF strain growing exponentially or in stationary phase (labelled Stat.). Prior to RLM-RT-PCR analysis, an aliquot of each sample was treated with <t>T4</t> polynucleotide kinase (labelled P). Aliquots of untreated samples (labelled U) were also analysed. Labelling on the left indicates the sizes of molecular markers from Invitrogen (labelled M). The amplicon corresponding to the −43 cleavage site is indicated (labelled 88 bp) on the right. Products were analysed using a 10% polyacrylamide gel and stained with ethidium bromide. No amplicons were produced in the absence of reverse transcription (data not shown).C. Restriction enzyme analysis of amplicons produced from BW25113 RNA not treated with PNK. The substrate (labelled U) was incubated with BstEII and along with the resulting products (labelled B) analysed using gel electrophoresis as described in (B). Labelling on the right indicates the positions of resolvable substrate (labelled S) and products (labelled P).
    T4 Polynucleotide Kinase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 580 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 polynucleotide kinase/product/Thermo Fisher
    Average 90 stars, based on 580 article reviews
    Price from $9.99 to $1999.99
    t4 polynucleotide kinase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    N/A
    The Invitrogen Anza T4 PNK polynucleotide kinase Kit is used to perform 5 phosphorylation of DNA and oligonucleotides T4 PNK exhibits 5 polynucleotide kinase and 3 phosphatase activity catalyzing the
      Buy from Supplier

    Image Search Results


    Processing at the −43 site of 16S rRNA.A. Differential RNA-seq data for the 3′ end of 16S rRNA. The screenshot is for the rrnE operon, which is representative of all seven rRNA operons in E. coli . The tracks from top to bottom show the genome position, location of the 3′ end of 16S rRNA and positions of processing sites as identified by differential RNA-seq in the absence of TAP treatment. The positions of the −43 site, sites of known cleavage by RNase III and P and a site of cleavage by an unknown RNase (labelled ‘?’) are indicated. The numbers at the left of the RNA-seq track indicates the scale of the sequencing reads. The schematic at the bottom of panel indicates the position of a BstEII site that was used to confirm the identity of an 88 bp amplicon produced by RLM-RT-PCR analysis of the −43 site (see B and C). The numbers indicate the sizes (bp) of the predicted products of cleavage at the BstEII site. It should be noted that the products have the equivalent of half a base-pair as BstEII generates 5 nt overhangs. Arrows indicate the position of primers used for PCR. Segments of the amplicon corresponding to the 5′ adaptor are drawn at an angle, while those corresponding to the 3′ end of 16S rRNA are drawn horizontally.B. RLM-RT-PCR analysis of RNA isolated from strain BW25113 (labelled wt) growing exponentially (labelled Exp.) and a congenic Δ mazF strain growing exponentially or in stationary phase (labelled Stat.). Prior to RLM-RT-PCR analysis, an aliquot of each sample was treated with T4 polynucleotide kinase (labelled P). Aliquots of untreated samples (labelled U) were also analysed. Labelling on the left indicates the sizes of molecular markers from Invitrogen (labelled M). The amplicon corresponding to the −43 cleavage site is indicated (labelled 88 bp) on the right. Products were analysed using a 10% polyacrylamide gel and stained with ethidium bromide. No amplicons were produced in the absence of reverse transcription (data not shown).C. Restriction enzyme analysis of amplicons produced from BW25113 RNA not treated with PNK. The substrate (labelled U) was incubated with BstEII and along with the resulting products (labelled B) analysed using gel electrophoresis as described in (B). Labelling on the right indicates the positions of resolvable substrate (labelled S) and products (labelled P).

    Journal: Molecular Microbiology

    Article Title: A comparison of key aspects of gene regulation in Streptomyces coelicolor and Escherichia coli using nucleotide-resolution transcription maps produced in parallel by global and differential RNA sequencing

    doi: 10.1111/mmi.12810

    Figure Lengend Snippet: Processing at the −43 site of 16S rRNA.A. Differential RNA-seq data for the 3′ end of 16S rRNA. The screenshot is for the rrnE operon, which is representative of all seven rRNA operons in E. coli . The tracks from top to bottom show the genome position, location of the 3′ end of 16S rRNA and positions of processing sites as identified by differential RNA-seq in the absence of TAP treatment. The positions of the −43 site, sites of known cleavage by RNase III and P and a site of cleavage by an unknown RNase (labelled ‘?’) are indicated. The numbers at the left of the RNA-seq track indicates the scale of the sequencing reads. The schematic at the bottom of panel indicates the position of a BstEII site that was used to confirm the identity of an 88 bp amplicon produced by RLM-RT-PCR analysis of the −43 site (see B and C). The numbers indicate the sizes (bp) of the predicted products of cleavage at the BstEII site. It should be noted that the products have the equivalent of half a base-pair as BstEII generates 5 nt overhangs. Arrows indicate the position of primers used for PCR. Segments of the amplicon corresponding to the 5′ adaptor are drawn at an angle, while those corresponding to the 3′ end of 16S rRNA are drawn horizontally.B. RLM-RT-PCR analysis of RNA isolated from strain BW25113 (labelled wt) growing exponentially (labelled Exp.) and a congenic Δ mazF strain growing exponentially or in stationary phase (labelled Stat.). Prior to RLM-RT-PCR analysis, an aliquot of each sample was treated with T4 polynucleotide kinase (labelled P). Aliquots of untreated samples (labelled U) were also analysed. Labelling on the left indicates the sizes of molecular markers from Invitrogen (labelled M). The amplicon corresponding to the −43 cleavage site is indicated (labelled 88 bp) on the right. Products were analysed using a 10% polyacrylamide gel and stained with ethidium bromide. No amplicons were produced in the absence of reverse transcription (data not shown).C. Restriction enzyme analysis of amplicons produced from BW25113 RNA not treated with PNK. The substrate (labelled U) was incubated with BstEII and along with the resulting products (labelled B) analysed using gel electrophoresis as described in (B). Labelling on the right indicates the positions of resolvable substrate (labelled S) and products (labelled P).

    Article Snippet: Specific E. coli transcripts were probed using complementary oligonucleotides (see ) labelled at their 5′ ends with 32 P using T4 polynucleotide kinase (Thermo Scientific) and γ-32 P-ATP (3000 Ci mmol−1 , 10 mCi ml−1 , 250 μCi, Perkin Elmer).

    Techniques: RNA Sequencing Assay, Sequencing, Amplification, Produced, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Isolation, Staining, Incubation, Nucleic Acid Electrophoresis

    Sso2081 and Sso1393 cA 4 degradation mechanism investigated by TLC. Csm generated cOA (lane 1) was incubated with 2 μM Sso2081 dimer at 60 °C to determine the intermediate (Y) and final (X) reaction product over time (lanes 2-10). Lanes 11-13 show reaction product seen in lanes 2, 4 and 6, 5’-end phosphorylated using T4 polynucleotide kinase (PNK) for identification of reaction intermediates and products by comparison to 5’-end phosphorylated MazF nuclease generated HO-A 2 > P and HO-A 4 > P standards. Lanes 14 15 show the reaction products of 2 μM Sso1393 dimer incubated with cOA at 70 °C for 20 and 120 min, respectively. Reaction product from lanes 14 15 are 5’-end phosphorylated by PNK for comparison to P-A 2 > P and P-A 4 > P standards. Comparison of PNK treated reaction product to standards showed the presence of a low amount of intermediate (P-Y) during the Sso2081 cA 4 cleavage reaction, which migrated similarly to the P-A 4 > P standard and did not change in abundance over time, whereas the abundance of the final product (P-X) increased over time. In contrast, comparison of Sso1393 PNK treated 20 min and 120 min reaction products showed a decrease of the intermediate (P-Y) over time and increase of product (P-X).

    Journal: Nature

    Article Title: Ring nucleases deactivate Type III CRISPR ribonucleases by degrading cyclic oligoadenylate

    doi: 10.1038/s41586-018-0557-5

    Figure Lengend Snippet: Sso2081 and Sso1393 cA 4 degradation mechanism investigated by TLC. Csm generated cOA (lane 1) was incubated with 2 μM Sso2081 dimer at 60 °C to determine the intermediate (Y) and final (X) reaction product over time (lanes 2-10). Lanes 11-13 show reaction product seen in lanes 2, 4 and 6, 5’-end phosphorylated using T4 polynucleotide kinase (PNK) for identification of reaction intermediates and products by comparison to 5’-end phosphorylated MazF nuclease generated HO-A 2 > P and HO-A 4 > P standards. Lanes 14 15 show the reaction products of 2 μM Sso1393 dimer incubated with cOA at 70 °C for 20 and 120 min, respectively. Reaction product from lanes 14 15 are 5’-end phosphorylated by PNK for comparison to P-A 2 > P and P-A 4 > P standards. Comparison of PNK treated reaction product to standards showed the presence of a low amount of intermediate (P-Y) during the Sso2081 cA 4 cleavage reaction, which migrated similarly to the P-A 4 > P standard and did not change in abundance over time, whereas the abundance of the final product (P-X) increased over time. In contrast, comparison of Sso1393 PNK treated 20 min and 120 min reaction products showed a decrease of the intermediate (P-Y) over time and increase of product (P-X).

    Article Snippet: For use as standards, A2 > P and A4 > P linear oligoadenylates were 5’-end labelled using 32 P-γ-ATP and T4 Polynucleotide Kinase (PNK; Thermo Fisher Scientific) via its forward reaction.

    Techniques: Thin Layer Chromatography, Generated, Incubation