Structured Review

Promega t4 polynucleotide kinase
Direct labelling of RNA on the 5′ termini of replication intermediates with vaccinia virus guanylyltransferase, an enzyme responsible for messenger RNA capping. ( A ) The 5′ ends of RNA primers attached to P. abyssi replication intermediates were capped with radioactive GTP and samples were fractionated on a sequencing gel (lane 2). Lane 3 contains the same reaction as lane 2, except that total DNA was treated with the restriction endonuclease Eco RI before analysis, confirming that nascent strands were efficiently denatured from template strands. Lane 1, size marker (10-base ladder; Gibco-BRL) labelled with [γ-32 P]ATP using <t>T4</t> polynucleotide kinase. ( B ) Schematic diagram of the archaeal Okazaki fragment. The smallest replication intermediate detected (10 nt) is in accordance with the minimum length of RNA primers detected in vitro ( <xref ref-type= Liu et al ., 2001 ). " width="250" height="auto" />
T4 Polynucleotide Kinase, supplied by Promega, used in various techniques. Bioz Stars score: 97/100, based on 220 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 polynucleotide kinase/product/Promega
Average 97 stars, based on 220 article reviews
Price from $9.99 to $1999.99
t4 polynucleotide kinase - by Bioz Stars, 2019-12
97/100 stars

Images

1) Product Images from "Identification of short 'eukaryotic' Okazaki fragments synthesized from a prokaryotic replication origin"

Article Title: Identification of short 'eukaryotic' Okazaki fragments synthesized from a prokaryotic replication origin

Journal:

doi: 10.1038/sj.embor.embor732

Direct labelling of RNA on the 5′ termini of replication intermediates with vaccinia virus guanylyltransferase, an enzyme responsible for messenger RNA capping. ( A ) The 5′ ends of RNA primers attached to P. abyssi replication intermediates were capped with radioactive GTP and samples were fractionated on a sequencing gel (lane 2). Lane 3 contains the same reaction as lane 2, except that total DNA was treated with the restriction endonuclease Eco RI before analysis, confirming that nascent strands were efficiently denatured from template strands. Lane 1, size marker (10-base ladder; Gibco-BRL) labelled with [γ-32 P]ATP using T4 polynucleotide kinase. ( B ) Schematic diagram of the archaeal Okazaki fragment. The smallest replication intermediate detected (10 nt) is in accordance with the minimum length of RNA primers detected in vitro ( <xref ref-type= Liu et al ., 2001 ). " title="... (10-base ladder; Gibco-BRL) labelled with [γ-32 P]ATP using T4 polynucleotide kinase. ( B ) Schematic diagram of ..." property="contentUrl" width="100%" height="100%"/>
Figure Legend Snippet: Direct labelling of RNA on the 5′ termini of replication intermediates with vaccinia virus guanylyltransferase, an enzyme responsible for messenger RNA capping. ( A ) The 5′ ends of RNA primers attached to P. abyssi replication intermediates were capped with radioactive GTP and samples were fractionated on a sequencing gel (lane 2). Lane 3 contains the same reaction as lane 2, except that total DNA was treated with the restriction endonuclease Eco RI before analysis, confirming that nascent strands were efficiently denatured from template strands. Lane 1, size marker (10-base ladder; Gibco-BRL) labelled with [γ-32 P]ATP using T4 polynucleotide kinase. ( B ) Schematic diagram of the archaeal Okazaki fragment. The smallest replication intermediate detected (10 nt) is in accordance with the minimum length of RNA primers detected in vitro ( Liu et al ., 2001 ).

Techniques Used: Sequencing, Marker, In Vitro, Electron Microscopy

Unmasking assay showing short replication intermediates in Pyrococcus abyssi and Sulfolobus acidocaldarius . The 5′-OH groups of RNA-primed replication intermediates were selectively exposed by alkaline treatment. 'Unmasked' 5′-OH ends of replication intermediates were labelled with T4 polynucleotide kinase and [γ-32 P]ATP, and run on an alkaline agarose gel. A control experiment without alkaline treatment is also shown for each experiment. The positions of size markers (100, 200 and 500 nucleotides (nt)) are shown on the left.
Figure Legend Snippet: Unmasking assay showing short replication intermediates in Pyrococcus abyssi and Sulfolobus acidocaldarius . The 5′-OH groups of RNA-primed replication intermediates were selectively exposed by alkaline treatment. 'Unmasked' 5′-OH ends of replication intermediates were labelled with T4 polynucleotide kinase and [γ-32 P]ATP, and run on an alkaline agarose gel. A control experiment without alkaline treatment is also shown for each experiment. The positions of size markers (100, 200 and 500 nucleotides (nt)) are shown on the left.

Techniques Used: Agarose Gel Electrophoresis

Related Articles

Clone Assay:

Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
Article Snippet: Gene-specific outer and inner primers are given in . .. For subsequent cloning, the inner primers were phosphorylated with T4 polynucleotide kinase (Promega) and the PCR amplicons ligated into pBSK-vector linearized and dephosphorylated with EcoRV (NEB) and thermosensitive alkaline phosphatase. .. Plasmids were sequenced using M13 forward and reverse primers.

Centrifugation:

Article Title: p21WAF1 Is Required for Interleukin-16-Induced Migration and Invasion of Vascular Smooth Muscle Cells via the p38MAPK/Sp-1/MMP-9 Pathway
Article Snippet: In brief, the oligonucleotides spanning the -79 MMP-9 cis element of interest were end-labeled with 32 P-ATP by T4 polynucleotide kinase (Promega, Madison, WI). .. In brief, the oligonucleotides spanning the -79 MMP-9 cis element of interest were end-labeled with 32 P-ATP by T4 polynucleotide kinase (Promega, Madison, WI).

Article Title: Transcriptome-wide identification of the RNA-binding landscape of the chromatin-associated protein PARP1 reveals functions in RNA biogenesis
Article Snippet: Cells were pelleted by centrifugation at 18 000g for 15 min using an Eppendorf 5810R centrifuge 5810R with an A-4-81swing bucket rotor. .. The beads were washed three times and the immunoprecipitated RNA was digested again with RNase T1 to a final concentration of 63 U μl−1 for 15 min. After dephosphorylation, the RNA segments crosslinked to PARP1 were 5′-radiolabeled using γ-32 P-ATP and T4 polynucleotide kinase (Promega Madison, WI, USA) in one original bead volume.

Amplification:

Article Title: Epigenetic and transcriptional dysregulation of VWA2 associated with a MYC-driven oncogenic program in colorectal cancer
Article Snippet: Paragraph title: Methylation-sensitive amplified fragment length polymorphism (MS-AFLP) ... A primer complementary to the NotI adaptor (Not I primer) was labeled at the 5′ end using 32 P-γ-ATP and T4 polynucleotide kinase (Promega, Madison, WI).

Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
Article Snippet: Total RNA was extracted from zebrafish larvae at 3 dpf and cDNA ends amplified using the FirstChoice RLM-RACE Kit (Life Technologies) according to the manufacturer's recommendations. .. For subsequent cloning, the inner primers were phosphorylated with T4 polynucleotide kinase (Promega) and the PCR amplicons ligated into pBSK-vector linearized and dephosphorylated with EcoRV (NEB) and thermosensitive alkaline phosphatase.

Article Title: The Small RNA ErsA of Pseudomonas aeruginosa Contributes to Biofilm Development and Motility through Post-transcriptional Modulation of AmrZ
Article Snippet: DNA fragments for ErsA RNA and amrZ mRNAs (amrZ , amrZ CIS1, amrZ ΔIS2, amrZ CIS1ΔIS2) preparations were amplified from P.aeruginosa PAO1 genomic DNA with oligo pairs 4/5 or 4/6 and 7/8, respectively. .. DNA probe was 5′-end–labeled with (γ-32 P) ATP and T4 polynucleotide kinase (Promega) according to manufacturer’s instruction.

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: Potential 3′ phosphates were removed by incubation at 37°C for 45 minutes using T4 Polynucleotide Kinase (Promega). .. RNA libraries were generated from 100ng treated small RNA using TGIRT™- III Enzyme (InGex, USA) using the manufacturer’s protocol for the total RNA-seq method.

DNA Synthesis:

Article Title: The use of an artificial nucleotide for polymerase-based recognition of carcinogenic O6-alkylguanine DNA adducts
Article Snippet: Radioactive labeling of primer strands at their 5′ end was carried out using T4 polynucleotide kinase (Promega ) and [γ-32 P] ATP following manufacturer protocol. .. Radioactive labeling of primer strands at their 5′ end was carried out using T4 polynucleotide kinase (Promega ) and [γ-32 P] ATP following manufacturer protocol.

Polyacrylamide Gel Electrophoresis:

Article Title: The Small RNA ErsA of Pseudomonas aeruginosa Contributes to Biofilm Development and Motility through Post-transcriptional Modulation of AmrZ
Article Snippet: DNA probe was 5′-end–labeled with (γ-32 P) ATP and T4 polynucleotide kinase (Promega) according to manufacturer’s instruction. .. Synthesized RNA was precipitated and resuspended in diethylpyrocarbonate-treated water.

Positive Control:

Article Title: The Cytotoxic Enterotoxin of Aeromonas hydrophila Induces Proinflammatory Cytokine Production and Activates Arachidonic Acid Metabolism in Macrophages
Article Snippet: Labeling of the consensus oligonucleotide was performed by assembling the following reaction mixture: 2 μl of NF-κB/CREB/AP-1/AP-2/SP-1 (promoter-specific factor required for transcription of the simian virus 40 early and late promoters)/OCT-1 (octamer transcription factors)/TFIID (general transcription factors) consensus oligonucleotide (1.75 pmol/μl; Promega), 1 μl of T4 polynucleotide kinase 10× buffer (Promega), 1 μl of [γ-32 P]ATP (3,000 Ci/mmol at 10 mCi/ml; ICN), 5 μl of nuclease-free water, and 1 μl of T4 polynucleotide kinase (5 to 10 U/μl; Promega). .. Next, DNA binding reaction mixtures were assembled.

Synthesized:

Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
Article Snippet: The oligonucleotide sequences having ERE site present in the ERRβ promoter region were synthesized and were designated as ERRβ EMSA site 1 (− 888 to − 859) and ERRβ EMSA site 2 (− 822 to − 793). .. The forward strands of both EMSA site 1 and EMSA site 2 were labeled at 5′ end with [γ− 32 P] ATP (BRIT, Hyderabad, India) using T4 polynucleotide kinase (Promega, Madison, USA).

Autoradiography:

Article Title: Synovial fibroblast‐targeting liposomes encapsulating an NF‐κB‐blocking peptide ameliorates zymosan‐induced synovial inflammation, et al. Synovial fibroblast‐targeting liposomes encapsulating an NF‐κB‐blocking peptide ameliorates zymosan‐induced synovial inflammation
Article Snippet: 2.4 The NF‐κB probe (5′‐AGTTGAGGGGACTTTCCCAGGC‐3′) was labelled with [γ‐32P] ATP by T4 polynucleotide kinase (Promega) and was purified. .. 2.4 The NF‐κB probe (5′‐AGTTGAGGGGACTTTCCCAGGC‐3′) was labelled with [γ‐32P] ATP by T4 polynucleotide kinase (Promega) and was purified.

Article Title: Transcriptome-wide identification of the RNA-binding landscape of the chromatin-associated protein PARP1 reveals functions in RNA biogenesis
Article Snippet: The beads were washed three times and the immunoprecipitated RNA was digested again with RNase T1 to a final concentration of 63 U μl−1 for 15 min. After dephosphorylation, the RNA segments crosslinked to PARP1 were 5′-radiolabeled using γ-32 P-ATP and T4 polynucleotide kinase (Promega Madison, WI, USA) in one original bead volume. .. Samples were then resuspended in SDS-PAGE loading buffer, incubated at 95 °C for 5 min to denature, and the PARP1-RNA crosslinks were release.

Electrophoresis:

Article Title: A Point Mutation in a lincRNA Upstream of GDNF Is Associated to a Canine Insensitivity to Pain: A Spontaneous Model for Human Sensory Neuropathies
Article Snippet: Probe labeling and duplex formation: 10 pmoles of primers wild type sequence (WT: 5’- TGTTGTCTTTGCTGCTGTCATGATGG-3’) and mutated sequence (Mut: 5’- TGTTGTCTTTGCTACTGTCATGATGG-3’) were 5'-end labeled using T4-PNK (Promega M4101) and 20μCi of 32 P-g ATP. .. Unlabeled complementary oligonucleotides were then annealed to form a WT-duplex or Mut-duplex in hybridization buffer (10mM Tris pH7.4; 6mM MgCl2 ; 50mM NaCl; 6mM B-Mercapto-Ethanol) by incubation for 1 min at 95°C and gradually cool down to room temperature.

Incubation:

Article Title: A Point Mutation in a lincRNA Upstream of GDNF Is Associated to a Canine Insensitivity to Pain: A Spontaneous Model for Human Sensory Neuropathies
Article Snippet: Probe labeling and duplex formation: 10 pmoles of primers wild type sequence (WT: 5’- TGTTGTCTTTGCTGCTGTCATGATGG-3’) and mutated sequence (Mut: 5’- TGTTGTCTTTGCTACTGTCATGATGG-3’) were 5'-end labeled using T4-PNK (Promega M4101) and 20μCi of 32 P-g ATP. .. Labeled oligonucleotides were purified on a Sephadex G-25 column.

Article Title: Increased expression of the ubiquitin - proteasome pathway in murine myotubes by proteolysis-inducing factor (PIF) is associated with activation of the transcription factor NF-κB
Article Snippet: The cells were incubated for 20 min with PIF prior to the EMSA assay. .. In all, 2 μ l NF-κ B (1.75 pmol μ l−1 ) (Promega UK), oligonucleotide sequence 5′-AGT TGA GGG GAC TTT CCC AGG C-3′; 3′-TCA ACT CCC CTG AAA GGG TCC G-5′; 1 μ l T4 polynucleotide kinase 10 × buffer (Promega, UK); 2 μ Ci [γ -32 P]ATP (Amersham Biosciences, UK); 1 μ l T4 polynucleotide kinase (Promega, UK) were assembled in a sterile microcentrifuge tube, the volume was adjusted to 10 μ l with nuclease-free H2 O (Promega, UK), and incubated at 37°C for 1 h. The reaction was stopped by the addition of 2 μ l 0.5 M EDTA followed by 88 μ l of TE buffer. .. The cells were rinsed, scraped and pelleted in wash buffer (10 mM HEPES/KOH pH 7.5, 10 mM KCl, 2 mM MgCl2 , 1 mM DTT, 0.1 mM EDTA, 0.4 mM PMSF, 0.2 mM NaF, 0.2 mM sodium orthovanadate, 0.3 mg ml−1 leupeptin).

Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
Article Snippet: The forward strands of both EMSA site 1 and EMSA site 2 were labeled at 5′ end with [γ− 32 P] ATP (BRIT, Hyderabad, India) using T4 polynucleotide kinase (Promega, Madison, USA). .. The 5′ labeled oligonucleotides were annealed with unlabeled reverse complementary strands incubating in annealing buffer (1 M Tris-HCl (pH 7.5), 4 M NaCl, 0.5 M MgCl2 ).

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: Briefly, 2 μg of small-size RNA ( < 200 nt) were deacylated with 0.1 mM TrisHCl pH = 9 at 37°C for 30 min in the presence of RNasin Ribonuclease Inhibitor (Promega). .. Potential 3′ phosphates were removed by incubation at 37°C for 45 minutes using T4 Polynucleotide Kinase (Promega). .. RNA was purified using Chloroform extraction and EtOH precipitation.

Article Title: Yin Yang 1 contains G-quadruplex structures in its promoter and 5?-UTR and its expression is modulated by G4 resolvase 1
Article Snippet: The CD spectra were presented with the subtraction of the signal contributed by the buffer. .. To produce a 5′-32 P-labeled G4 oligonucleotide, an aliquot ( < 1/10 of the final volume for the labeling reaction) of the annealed G4 oligonucleotide was incubated with T4 polynucleotide kinase (Promega Corp.) and γ-32 P-ATP for 30 min at 37°C, according to the manufacturer's instructions. .. The 5′-32 P-labeled G4 oligonucleotides were purified with a MicroSpin G25 column (GE Healthcare) equilibrated with TEK buffer (10 mM Tris, 1 mM EDTA and 50 mM KCl) and stored at −20°C.

Article Title: The use of an artificial nucleotide for polymerase-based recognition of carcinogenic O6-alkylguanine DNA adducts
Article Snippet: Radioactive labeling of primer strands at their 5′ end was carried out using T4 polynucleotide kinase (Promega ) and [γ-32 P] ATP following manufacturer protocol. .. In full-length DNA synthesis experiments, reactions contained all four natural dNTPs (10 μM total) with or without Benzi TP (10 μM).

Article Title: BIRC5 is a novel target of peroxisome proliferator-activated receptor γ in brain microvascular endothelium cells during cerebral ischemia
Article Snippet: Double-stranded oligonucleotides for PPARγ were end-labeled with adenosine-5′-triphosphate (ATP)-γ-32 P using the T4 polynucleotide kinase (Promega), according to the manufacturer's instructions. .. Double-stranded oligonucleotides for PPARγ were end-labeled with adenosine-5′-triphosphate (ATP)-γ-32 P using the T4 polynucleotide kinase (Promega), according to the manufacturer's instructions.

Article Title: Synovial fibroblast‐targeting liposomes encapsulating an NF‐κB‐blocking peptide ameliorates zymosan‐induced synovial inflammation, et al. Synovial fibroblast‐targeting liposomes encapsulating an NF‐κB‐blocking peptide ameliorates zymosan‐induced synovial inflammation
Article Snippet: 2.4 The NF‐κB probe (5′‐AGTTGAGGGGACTTTCCCAGGC‐3′) was labelled with [γ‐32P] ATP by T4 polynucleotide kinase (Promega) and was purified. .. Nuclear extract from SFs (20 μg) was mixed with 2 μL of binding buffer and kept on ice for 10 minutes.

Article Title: Transcriptome-wide identification of the RNA-binding landscape of the chromatin-associated protein PARP1 reveals functions in RNA biogenesis
Article Snippet: The RNase-treated supernatant was then incubated for 2 h with 600 μl of protein A dynabeads (Invitrogen, Thermo fisher Scientific, Waltham, MA,USA) bound to 15 μg of anti-PARP1 antibody (Active Motif, Carlsbad, CA, USA) or control IgG antibody. .. The beads were washed three times and the immunoprecipitated RNA was digested again with RNase T1 to a final concentration of 63 U μl−1 for 15 min. After dephosphorylation, the RNA segments crosslinked to PARP1 were 5′-radiolabeled using γ-32 P-ATP and T4 polynucleotide kinase (Promega Madison, WI, USA) in one original bead volume.

Mass Spectrometry:

Article Title: Epigenetic and transcriptional dysregulation of VWA2 associated with a MYC-driven oncogenic program in colorectal cancer
Article Snippet: Paragraph title: Methylation-sensitive amplified fragment length polymorphism (MS-AFLP) ... A primer complementary to the NotI adaptor (Not I primer) was labeled at the 5′ end using 32 P-γ-ATP and T4 polynucleotide kinase (Promega, Madison, WI).

Acrylamide Gel Assay:

Article Title: A Point Mutation in a lincRNA Upstream of GDNF Is Associated to a Canine Insensitivity to Pain: A Spontaneous Model for Human Sensory Neuropathies
Article Snippet: Probe labeling and duplex formation: 10 pmoles of primers wild type sequence (WT: 5’- TGTTGTCTTTGCTGCTGTCATGATGG-3’) and mutated sequence (Mut: 5’- TGTTGTCTTTGCTACTGTCATGATGG-3’) were 5'-end labeled using T4-PNK (Promega M4101) and 20μCi of 32 P-g ATP. .. Unlabeled complementary oligonucleotides were then annealed to form a WT-duplex or Mut-duplex in hybridization buffer (10mM Tris pH7.4; 6mM MgCl2 ; 50mM NaCl; 6mM B-Mercapto-Ethanol) by incubation for 1 min at 95°C and gradually cool down to room temperature.

Hybridization:

Article Title: Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana
Article Snippet: For detection of pre-rRNA precursors and small RNA, 10 pmoles of oligonucleotide primers were 5′end labeled using 50 µCi of [γ32 P] ATP (6000 Ci/mmol) and T4 PNK (Promega). .. For detection of pre-rRNA precursors and small RNA, 10 pmoles of oligonucleotide primers were 5′end labeled using 50 µCi of [γ32 P] ATP (6000 Ci/mmol) and T4 PNK (Promega).

Article Title: A Point Mutation in a lincRNA Upstream of GDNF Is Associated to a Canine Insensitivity to Pain: A Spontaneous Model for Human Sensory Neuropathies
Article Snippet: Probe labeling and duplex formation: 10 pmoles of primers wild type sequence (WT: 5’- TGTTGTCTTTGCTGCTGTCATGATGG-3’) and mutated sequence (Mut: 5’- TGTTGTCTTTGCTACTGTCATGATGG-3’) were 5'-end labeled using T4-PNK (Promega M4101) and 20μCi of 32 P-g ATP. .. Labeled oligonucleotides were purified on a Sephadex G-25 column.

Countercurrent Chromatography:

Article Title: Increased expression of the ubiquitin - proteasome pathway in murine myotubes by proteolysis-inducing factor (PIF) is associated with activation of the transcription factor NF-κB
Article Snippet: The cells were incubated for 20 min with PIF prior to the EMSA assay. .. In all, 2 μ l NF-κ B (1.75 pmol μ l−1 ) (Promega UK), oligonucleotide sequence 5′-AGT TGA GGG GAC TTT CCC AGG C-3′; 3′-TCA ACT CCC CTG AAA GGG TCC G-5′; 1 μ l T4 polynucleotide kinase 10 × buffer (Promega, UK); 2 μ Ci [γ -32 P]ATP (Amersham Biosciences, UK); 1 μ l T4 polynucleotide kinase (Promega, UK) were assembled in a sterile microcentrifuge tube, the volume was adjusted to 10 μ l with nuclease-free H2 O (Promega, UK), and incubated at 37°C for 1 h. The reaction was stopped by the addition of 2 μ l 0.5 M EDTA followed by 88 μ l of TE buffer. .. The cells were rinsed, scraped and pelleted in wash buffer (10 mM HEPES/KOH pH 7.5, 10 mM KCl, 2 mM MgCl2 , 1 mM DTT, 0.1 mM EDTA, 0.4 mM PMSF, 0.2 mM NaF, 0.2 mM sodium orthovanadate, 0.3 mg ml−1 leupeptin).

Concentration Assay:

Article Title: Transcriptome-wide identification of the RNA-binding landscape of the chromatin-associated protein PARP1 reveals functions in RNA biogenesis
Article Snippet: The RNase-treated supernatant was then incubated for 2 h with 600 μl of protein A dynabeads (Invitrogen, Thermo fisher Scientific, Waltham, MA,USA) bound to 15 μg of anti-PARP1 antibody (Active Motif, Carlsbad, CA, USA) or control IgG antibody. .. The beads were washed three times and the immunoprecipitated RNA was digested again with RNase T1 to a final concentration of 63 U μl−1 for 15 min. After dephosphorylation, the RNA segments crosslinked to PARP1 were 5′-radiolabeled using γ-32 P-ATP and T4 polynucleotide kinase (Promega Madison, WI, USA) in one original bead volume. .. After several washes, each CLIP sample (on the beads) was then treated with 5 U of DNase1 (NEB Ipswich, MA, USA) for every 100 μl of bead volume for 15 min at 37 °C.

Northern Blot:

Article Title: A small stem-loop structure of the Ebola virus trailer is essential for replication and interacts with heat-shock protein A8
Article Snippet: Paragraph title: Northern blot analysis ... Probes specific for genomic and RI RNAs (Table ) were labeled with 32 P ATP using T4 Polynucleotide Kinase (Promega).

Generated:

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: Potential 3′ phosphates were removed by incubation at 37°C for 45 minutes using T4 Polynucleotide Kinase (Promega). .. RNA was purified using Chloroform extraction and EtOH precipitation.

Imaging:

Article Title: Identification of short 'eukaryotic' Okazaki fragments synthesized from a prokaryotic replication origin
Article Snippet: All 5′-OH termini existing in denatured DNA were first 'masked' by treatment for 1 h with 8 units of T4 polynucleotide kinase (PNK; Promega) and non-radioactive ATP at 37 °C in the buffer supplied by the manufacturer. .. Exposed 5′-OH ends were labelled with PNK and [γ-32 P]ATP (5,000 Ci mmol−1 ) at 4 °C and samples were run on an alkaline 1.8% agarose gel in running buffer (30 mM NaOH and 1 mM EDTA).

Sequencing:

Article Title: A Point Mutation in a lincRNA Upstream of GDNF Is Associated to a Canine Insensitivity to Pain: A Spontaneous Model for Human Sensory Neuropathies
Article Snippet: The supernatant was kept and the protein concentration was subsequently estimated by the BCA assay. .. Probe labeling and duplex formation: 10 pmoles of primers wild type sequence (WT: 5’- TGTTGTCTTTGCTGCTGTCATGATGG-3’) and mutated sequence (Mut: 5’- TGTTGTCTTTGCTACTGTCATGATGG-3’) were 5'-end labeled using T4-PNK (Promega M4101) and 20μCi of 32 P-g ATP. .. Labeled oligonucleotides were purified on a Sephadex G-25 column.

Article Title: Increased expression of the ubiquitin - proteasome pathway in murine myotubes by proteolysis-inducing factor (PIF) is associated with activation of the transcription factor NF-κB
Article Snippet: The cells were incubated for 20 min with PIF prior to the EMSA assay. .. In all, 2 μ l NF-κ B (1.75 pmol μ l−1 ) (Promega UK), oligonucleotide sequence 5′-AGT TGA GGG GAC TTT CCC AGG C-3′; 3′-TCA ACT CCC CTG AAA GGG TCC G-5′; 1 μ l T4 polynucleotide kinase 10 × buffer (Promega, UK); 2 μ Ci [γ -32 P]ATP (Amersham Biosciences, UK); 1 μ l T4 polynucleotide kinase (Promega, UK) were assembled in a sterile microcentrifuge tube, the volume was adjusted to 10 μ l with nuclease-free H2 O (Promega, UK), and incubated at 37°C for 1 h. The reaction was stopped by the addition of 2 μ l 0.5 M EDTA followed by 88 μ l of TE buffer. .. The cells were rinsed, scraped and pelleted in wash buffer (10 mM HEPES/KOH pH 7.5, 10 mM KCl, 2 mM MgCl2 , 1 mM DTT, 0.1 mM EDTA, 0.4 mM PMSF, 0.2 mM NaF, 0.2 mM sodium orthovanadate, 0.3 mg ml−1 leupeptin).

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: Paragraph title: RNA and Sequencing Library preparation ... Potential 3′ phosphates were removed by incubation at 37°C for 45 minutes using T4 Polynucleotide Kinase (Promega).

Article Title: BIRC5 is a novel target of peroxisome proliferator-activated receptor γ in brain microvascular endothelium cells during cerebral ischemia
Article Snippet: Biotin-labeled PPARγ specific oligonucleotides (Invitrogen; Thermo Fisher Scientific, Inc.), with the following sequence, 5′-AAAGGAGGTTAGAGGGGAAGGGGCGTAG-′3, were prepared as labeled probes, according to the manufacturer's instructions (Promega). .. Double-stranded oligonucleotides for PPARγ were end-labeled with adenosine-5′-triphosphate (ATP)-γ-32 P using the T4 polynucleotide kinase (Promega), according to the manufacturer's instructions.

Binding Assay:

Article Title: The Cytotoxic Enterotoxin of Aeromonas hydrophila Induces Proinflammatory Cytokine Production and Activates Arachidonic Acid Metabolism in Macrophages
Article Snippet: Labeling of the consensus oligonucleotide was performed by assembling the following reaction mixture: 2 μl of NF-κB/CREB/AP-1/AP-2/SP-1 (promoter-specific factor required for transcription of the simian virus 40 early and late promoters)/OCT-1 (octamer transcription factors)/TFIID (general transcription factors) consensus oligonucleotide (1.75 pmol/μl; Promega), 1 μl of T4 polynucleotide kinase 10× buffer (Promega), 1 μl of [γ-32 P]ATP (3,000 Ci/mmol at 10 mCi/ml; ICN), 5 μl of nuclease-free water, and 1 μl of T4 polynucleotide kinase (5 to 10 U/μl; Promega). .. Finally, the volume of the reaction mixture was made up to 100 μl using 1× Tris-EDTA buffer ( ) before the mixture was passed through the Sephadex G-25 spin column to remove unincorporated labeled ATP.

Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
Article Snippet: The forward strands of both EMSA site 1 and EMSA site 2 were labeled at 5′ end with [γ− 32 P] ATP (BRIT, Hyderabad, India) using T4 polynucleotide kinase (Promega, Madison, USA). .. The 5′ labeled oligonucleotides were annealed with unlabeled reverse complementary strands incubating in annealing buffer (1 M Tris-HCl (pH 7.5), 4 M NaCl, 0.5 M MgCl2 ).

Article Title: BIRC5 is a novel target of peroxisome proliferator-activated receptor γ in brain microvascular endothelium cells during cerebral ischemia
Article Snippet: Double-stranded oligonucleotides for PPARγ were end-labeled with adenosine-5′-triphosphate (ATP)-γ-32 P using the T4 polynucleotide kinase (Promega), according to the manufacturer's instructions. .. Nuclear protein extracts (5 µg) from bEnd.3 cells were incubated with 100,000 cpm 32 P-labeled oligonucleotide probe in 25 mM HEPES (pH 7.4), 50 mM KCl, 10% glycerol (v/v), 5 mM dithiothreitol and 1 µg of poly (deoxyinosinic-deoxycytidylic) acid (GE Healthcare Life Sciences, Shanghai, China) for 30 min at room temperature in a final volume of 20 µl.

RNA Sequencing Assay:

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: For NextSeq RNA sequencing, small RNAs were enriched using the PureLink® miRNA Isolation Kit (Ambion™). .. Potential 3′ phosphates were removed by incubation at 37°C for 45 minutes using T4 Polynucleotide Kinase (Promega).

Methylation:

Article Title: Epigenetic and transcriptional dysregulation of VWA2 associated with a MYC-driven oncogenic program in colorectal cancer
Article Snippet: Paragraph title: Methylation-sensitive amplified fragment length polymorphism (MS-AFLP) ... A primer complementary to the NotI adaptor (Not I primer) was labeled at the 5′ end using 32 P-γ-ATP and T4 polynucleotide kinase (Promega, Madison, WI).

Isolation:

Article Title: Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana
Article Snippet: Total RNA was isolated using TriZol reagent (GE Healthcare, Littler Chalfont, Bukimhamshire, UK) as described previously . .. For detection of pre-rRNA precursors and small RNA, 10 pmoles of oligonucleotide primers were 5′end labeled using 50 µCi of [γ32 P] ATP (6000 Ci/mmol) and T4 PNK (Promega).

Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
Article Snippet: The nuclear fractions were isolated as described previously [ ] using CelLytic NuCLEAR Extraction Kit (Sigma-Aldrich) and were stored at -80 °C for further use. .. The forward strands of both EMSA site 1 and EMSA site 2 were labeled at 5′ end with [γ− 32 P] ATP (BRIT, Hyderabad, India) using T4 polynucleotide kinase (Promega, Madison, USA).

Article Title: The Small RNA ErsA of Pseudomonas aeruginosa Contributes to Biofilm Development and Motility through Post-transcriptional Modulation of AmrZ
Article Snippet: Paragraph title: RNA Isolation and Synthesis ... DNA probe was 5′-end–labeled with (γ-32 P) ATP and T4 polynucleotide kinase (Promega) according to manufacturer’s instruction.

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: For NextSeq RNA sequencing, small RNAs were enriched using the PureLink® miRNA Isolation Kit (Ambion™). .. Potential 3′ phosphates were removed by incubation at 37°C for 45 minutes using T4 Polynucleotide Kinase (Promega).

RNA Extraction:

Article Title: Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana
Article Snippet: Paragraph title: RNA extraction and blot analysis ... For detection of pre-rRNA precursors and small RNA, 10 pmoles of oligonucleotide primers were 5′end labeled using 50 µCi of [γ32 P] ATP (6000 Ci/mmol) and T4 PNK (Promega).

Labeling:

Article Title: Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana
Article Snippet: Total RNA (15 µg) was either fractionated on 0.8% formaldehyde agarose gels and transferred to nitrocellulose (Hybond+, GE Healthcare) or fractionated on 15% polyacrylamide gels and transferred to Hybond NX (GE Healthcare). .. For detection of pre-rRNA precursors and small RNA, 10 pmoles of oligonucleotide primers were 5′end labeled using 50 µCi of [γ32 P] ATP (6000 Ci/mmol) and T4 PNK (Promega). .. Oligonucleotides probes are listed in the supplementary material ( ).

Article Title: Characterization of cis-Regulatory Elements and Transcription Factor Binding
Article Snippet: Anneal them to generate the double-stranded oligonucleotide probe containing the specific binding site of interest. .. End-label the probe using T4 polynucleotide kinase in the following reaction conditions: 30 μL of 1X T4 polynucleotide kinase buffer containing dephosphorylated DNA fragments (1–50 pmol of PCR-amplified or double-stranded oligonucleotide probe), 150 μCi of [γ-32 P]ATP (6000 Ci/mmol), and 20 U of T4 polynucleotide kinase, 37°C for 1 h. If the double-stranded oligonucleotides are designed to have a 5′ overhang, they can be labeled using Klenow fragment as previously described. .. Remove unincorporated [γ-32 P]ATP by passing the reaction mixture through a micro Bio-spin 6 column (Bio-Rad, UK).

Article Title: A Point Mutation in a lincRNA Upstream of GDNF Is Associated to a Canine Insensitivity to Pain: A Spontaneous Model for Human Sensory Neuropathies
Article Snippet: The supernatant was kept and the protein concentration was subsequently estimated by the BCA assay. .. Probe labeling and duplex formation: 10 pmoles of primers wild type sequence (WT: 5’- TGTTGTCTTTGCTGCTGTCATGATGG-3’) and mutated sequence (Mut: 5’- TGTTGTCTTTGCTACTGTCATGATGG-3’) were 5'-end labeled using T4-PNK (Promega M4101) and 20μCi of 32 P-g ATP. .. Labeled oligonucleotides were purified on a Sephadex G-25 column.

Article Title: The Cytotoxic Enterotoxin of Aeromonas hydrophila Induces Proinflammatory Cytokine Production and Activates Arachidonic Acid Metabolism in Macrophages
Article Snippet: Finally, the optical density was read with a microtiter enzyme-linked immunosorbent assay (ELISA) plate reader (Molecular Devices Corp., Sunnyvale, Calif.) at 405 nm. .. Labeling of the consensus oligonucleotide was performed by assembling the following reaction mixture: 2 μl of NF-κB/CREB/AP-1/AP-2/SP-1 (promoter-specific factor required for transcription of the simian virus 40 early and late promoters)/OCT-1 (octamer transcription factors)/TFIID (general transcription factors) consensus oligonucleotide (1.75 pmol/μl; Promega), 1 μl of T4 polynucleotide kinase 10× buffer (Promega), 1 μl of [γ-32 P]ATP (3,000 Ci/mmol at 10 mCi/ml; ICN), 5 μl of nuclease-free water, and 1 μl of T4 polynucleotide kinase (5 to 10 U/μl; Promega). .. The reaction mixture was incubated at 37°C for 10 min, and the reaction was stopped by adding 1 μl of 0.5 M EDTA.

Article Title: A small stem-loop structure of the Ebola virus trailer is essential for replication and interacts with heat-shock protein A8
Article Snippet: The RNA samples were electrophoresed for 1 h at 100 V in a 1× MOPS and 6% formaldehyde agarose gel and transferred to Hybond-N+ membrane (GE Healthcare Life Sciences). .. Probes specific for genomic and RI RNAs (Table ) were labeled with 32 P ATP using T4 Polynucleotide Kinase (Promega). .. Membranes were prehybridized for 1 h in PerfectHyb Plus Buffer (Sigma-Aldrich), and probe was added and hybridized overnight at 45°C for genomic and 55°C for RI, respectively.

Article Title: Epigenetic and transcriptional dysregulation of VWA2 associated with a MYC-driven oncogenic program in colorectal cancer
Article Snippet: The digested DNA was ligated to 1.25 ml each of 5 pmol/ml Not I and 50 pmol/ml Mse I adaptor using 1 unit of T4 DNA ligase (Roche) overnight at 16 °C. .. A primer complementary to the NotI adaptor (Not I primer) was labeled at the 5′ end using 32 P-γ-ATP and T4 polynucleotide kinase (Promega, Madison, WI). .. The adaptor-ligated template DNA was PCR amplified using 32 P-labeled Not I and Mse I-C primers.

Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
Article Snippet: The oligonucleotide sequences having ERE site present in the ERRβ promoter region were synthesized and were designated as ERRβ EMSA site 1 (− 888 to − 859) and ERRβ EMSA site 2 (− 822 to − 793). .. The forward strands of both EMSA site 1 and EMSA site 2 were labeled at 5′ end with [γ− 32 P] ATP (BRIT, Hyderabad, India) using T4 polynucleotide kinase (Promega, Madison, USA). .. The 5′ labeled oligonucleotides were annealed with unlabeled reverse complementary strands incubating in annealing buffer (1 M Tris-HCl (pH 7.5), 4 M NaCl, 0.5 M MgCl2 ).

Article Title: Yin Yang 1 contains G-quadruplex structures in its promoter and 5?-UTR and its expression is modulated by G4 resolvase 1
Article Snippet: The CD spectra were presented with the subtraction of the signal contributed by the buffer. .. To produce a 5′-32 P-labeled G4 oligonucleotide, an aliquot ( < 1/10 of the final volume for the labeling reaction) of the annealed G4 oligonucleotide was incubated with T4 polynucleotide kinase (Promega Corp.) and γ-32 P-ATP for 30 min at 37°C, according to the manufacturer's instructions. .. The 5′-32 P-labeled G4 oligonucleotides were purified with a MicroSpin G25 column (GE Healthcare) equilibrated with TEK buffer (10 mM Tris, 1 mM EDTA and 50 mM KCl) and stored at −20°C.

Article Title: The use of an artificial nucleotide for polymerase-based recognition of carcinogenic O6-alkylguanine DNA adducts
Article Snippet: Theoretical molar extinction coefficients of the DNA sequences were determined using Integrated DNA technologies online at http://eu.idtdna.com/analyzer/Applications/OligoAnalyzer/ . .. Radioactive labeling of primer strands at their 5′ end was carried out using T4 polynucleotide kinase (Promega ) and [γ-32 P] ATP following manufacturer protocol. .. Primer and templates were annealed by incubating at 95°C for 5 min and slow cooling over 12 h. Final concentrations were 1 μM primer and 1.5 μM template.

Article Title: BIRC5 is a novel target of peroxisome proliferator-activated receptor γ in brain microvascular endothelium cells during cerebral ischemia
Article Snippet: Biotin-labeled PPARγ specific oligonucleotides (Invitrogen; Thermo Fisher Scientific, Inc.), with the following sequence, 5′-AAAGGAGGTTAGAGGGGAAGGGGCGTAG-′3, were prepared as labeled probes, according to the manufacturer's instructions (Promega). .. Double-stranded oligonucleotides for PPARγ were end-labeled with adenosine-5′-triphosphate (ATP)-γ-32 P using the T4 polynucleotide kinase (Promega), according to the manufacturer's instructions.

Purification:

Article Title: Identification of short 'eukaryotic' Okazaki fragments synthesized from a prokaryotic replication origin
Article Snippet: Purified total DNA was denatured for 2 min at 100 °C in 10 mM Tris-HCl, pH 8.3, and 0.1 mM EDTA, followed by rapid quenching in ice water at 0 °C. .. All 5′-OH termini existing in denatured DNA were first 'masked' by treatment for 1 h with 8 units of T4 polynucleotide kinase (PNK; Promega) and non-radioactive ATP at 37 °C in the buffer supplied by the manufacturer.

Article Title: The Small RNA ErsA of Pseudomonas aeruginosa Contributes to Biofilm Development and Motility through Post-transcriptional Modulation of AmrZ
Article Snippet: DNA probe was 5′-end–labeled with (γ-32 P) ATP and T4 polynucleotide kinase (Promega) according to manufacturer’s instruction. .. Synthesized RNA was precipitated and resuspended in diethylpyrocarbonate-treated water.

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: Potential 3′ phosphates were removed by incubation at 37°C for 45 minutes using T4 Polynucleotide Kinase (Promega). .. RNA libraries were generated from 100ng treated small RNA using TGIRT™- III Enzyme (InGex, USA) using the manufacturer’s protocol for the total RNA-seq method.

Article Title: BIRC5 is a novel target of peroxisome proliferator-activated receptor γ in brain microvascular endothelium cells during cerebral ischemia
Article Snippet: Double-stranded oligonucleotides for PPARγ were end-labeled with adenosine-5′-triphosphate (ATP)-γ-32 P using the T4 polynucleotide kinase (Promega), according to the manufacturer's instructions. .. Biotin end-labeled double-stranded DNA and the nuclear extracts were incubated at room temperature for 20 min, and then 10 µl protein-DNA complex was subjected to 6.5% PAGE at 100 V for 1 h at 4°C and transferred onto a nylon membrane.

Article Title: Synovial fibroblast‐targeting liposomes encapsulating an NF‐κB‐blocking peptide ameliorates zymosan‐induced synovial inflammation, et al. Synovial fibroblast‐targeting liposomes encapsulating an NF‐κB‐blocking peptide ameliorates zymosan‐induced synovial inflammation
Article Snippet: Samples were cut in 20‐μm‐thick sections on a cryostat and stained with DAPI. .. 2.4 The NF‐κB probe (5′‐AGTTGAGGGGACTTTCCCAGGC‐3′) was labelled with [γ‐32P] ATP by T4 polynucleotide kinase (Promega) and was purified. .. Nuclear extract from SFs (20 μg) was mixed with 2 μL of binding buffer and kept on ice for 10 minutes.

Polymerase Chain Reaction:

Article Title: Characterization of cis-Regulatory Elements and Transcription Factor Binding
Article Snippet: Anneal them to generate the double-stranded oligonucleotide probe containing the specific binding site of interest. .. End-label the probe using T4 polynucleotide kinase in the following reaction conditions: 30 μL of 1X T4 polynucleotide kinase buffer containing dephosphorylated DNA fragments (1–50 pmol of PCR-amplified or double-stranded oligonucleotide probe), 150 μCi of [γ-32 P]ATP (6000 Ci/mmol), and 20 U of T4 polynucleotide kinase, 37°C for 1 h. If the double-stranded oligonucleotides are designed to have a 5′ overhang, they can be labeled using Klenow fragment as previously described. .. Remove unincorporated [γ-32 P]ATP by passing the reaction mixture through a micro Bio-spin 6 column (Bio-Rad, UK).

Article Title: Epigenetic and transcriptional dysregulation of VWA2 associated with a MYC-driven oncogenic program in colorectal cancer
Article Snippet: A primer complementary to the NotI adaptor (Not I primer) was labeled at the 5′ end using 32 P-γ-ATP and T4 polynucleotide kinase (Promega, Madison, WI). .. The adaptor-ligated template DNA was PCR amplified using 32 P-labeled Not I and Mse I-C primers.

Article Title: Mutations in SLC39A14 disrupt manganese homeostasis and cause childhood-onset parkinsonism–dystonia
Article Snippet: Gene-specific outer and inner primers are given in . .. For subsequent cloning, the inner primers were phosphorylated with T4 polynucleotide kinase (Promega) and the PCR amplicons ligated into pBSK-vector linearized and dephosphorylated with EcoRV (NEB) and thermosensitive alkaline phosphatase. .. Plasmids were sequenced using M13 forward and reverse primers.

Article Title: Oxidative Stress Triggers Selective tRNA Retrograde Transport in Human Cells during the Integrated Stress Response
Article Snippet: Potential 3′ phosphates were removed by incubation at 37°C for 45 minutes using T4 Polynucleotide Kinase (Promega). .. RNA libraries were generated from 100ng treated small RNA using TGIRT™- III Enzyme (InGex, USA) using the manufacturer’s protocol for the total RNA-seq method.

Electrophoretic Mobility Shift Assay:

Article Title: A Point Mutation in a lincRNA Upstream of GDNF Is Associated to a Canine Insensitivity to Pain: A Spontaneous Model for Human Sensory Neuropathies
Article Snippet: Paragraph title: Electrophoretic Mobility Shift Assays ... Probe labeling and duplex formation: 10 pmoles of primers wild type sequence (WT: 5’- TGTTGTCTTTGCTGCTGTCATGATGG-3’) and mutated sequence (Mut: 5’- TGTTGTCTTTGCTACTGTCATGATGG-3’) were 5'-end labeled using T4-PNK (Promega M4101) and 20μCi of 32 P-g ATP.

Article Title: The Cytotoxic Enterotoxin of Aeromonas hydrophila Induces Proinflammatory Cytokine Production and Activates Arachidonic Acid Metabolism in Macrophages
Article Snippet: Paragraph title: Gel shift assay. ... Labeling of the consensus oligonucleotide was performed by assembling the following reaction mixture: 2 μl of NF-κB/CREB/AP-1/AP-2/SP-1 (promoter-specific factor required for transcription of the simian virus 40 early and late promoters)/OCT-1 (octamer transcription factors)/TFIID (general transcription factors) consensus oligonucleotide (1.75 pmol/μl; Promega), 1 μl of T4 polynucleotide kinase 10× buffer (Promega), 1 μl of [γ-32 P]ATP (3,000 Ci/mmol at 10 mCi/ml; ICN), 5 μl of nuclease-free water, and 1 μl of T4 polynucleotide kinase (5 to 10 U/μl; Promega).

Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
Article Snippet: Paragraph title: Electrophoretic mobility shift assay ... The forward strands of both EMSA site 1 and EMSA site 2 were labeled at 5′ end with [γ− 32 P] ATP (BRIT, Hyderabad, India) using T4 polynucleotide kinase (Promega, Madison, USA).

Article Title: BIRC5 is a novel target of peroxisome proliferator-activated receptor γ in brain microvascular endothelium cells during cerebral ischemia
Article Snippet: Paragraph title: Electrophoretic mobility shift assay (EMSA) and supershift assay ... Double-stranded oligonucleotides for PPARγ were end-labeled with adenosine-5′-triphosphate (ATP)-γ-32 P using the T4 polynucleotide kinase (Promega), according to the manufacturer's instructions.

Article Title: Synovial fibroblast‐targeting liposomes encapsulating an NF‐κB‐blocking peptide ameliorates zymosan‐induced synovial inflammation, et al. Synovial fibroblast‐targeting liposomes encapsulating an NF‐κB‐blocking peptide ameliorates zymosan‐induced synovial inflammation
Article Snippet: Paragraph title: Electrophoretic mobility shift assays (EMSA) ... 2.4 The NF‐κB probe (5′‐AGTTGAGGGGACTTTCCCAGGC‐3′) was labelled with [γ‐32P] ATP by T4 polynucleotide kinase (Promega) and was purified.

De-Phosphorylation Assay:

Article Title: Transcriptome-wide identification of the RNA-binding landscape of the chromatin-associated protein PARP1 reveals functions in RNA biogenesis
Article Snippet: The RNase-treated supernatant was then incubated for 2 h with 600 μl of protein A dynabeads (Invitrogen, Thermo fisher Scientific, Waltham, MA,USA) bound to 15 μg of anti-PARP1 antibody (Active Motif, Carlsbad, CA, USA) or control IgG antibody. .. The beads were washed three times and the immunoprecipitated RNA was digested again with RNase T1 to a final concentration of 63 U μl−1 for 15 min. After dephosphorylation, the RNA segments crosslinked to PARP1 were 5′-radiolabeled using γ-32 P-ATP and T4 polynucleotide kinase (Promega Madison, WI, USA) in one original bead volume. .. After several washes, each CLIP sample (on the beads) was then treated with 5 U of DNase1 (NEB Ipswich, MA, USA) for every 100 μl of bead volume for 15 min at 37 °C.

Activated Clotting Time Assay:

Article Title: Increased expression of the ubiquitin - proteasome pathway in murine myotubes by proteolysis-inducing factor (PIF) is associated with activation of the transcription factor NF-κB
Article Snippet: The cells were incubated for 20 min with PIF prior to the EMSA assay. .. In all, 2 μ l NF-κ B (1.75 pmol μ l−1 ) (Promega UK), oligonucleotide sequence 5′-AGT TGA GGG GAC TTT CCC AGG C-3′; 3′-TCA ACT CCC CTG AAA GGG TCC G-5′; 1 μ l T4 polynucleotide kinase 10 × buffer (Promega, UK); 2 μ Ci [γ -32 P]ATP (Amersham Biosciences, UK); 1 μ l T4 polynucleotide kinase (Promega, UK) were assembled in a sterile microcentrifuge tube, the volume was adjusted to 10 μ l with nuclease-free H2 O (Promega, UK), and incubated at 37°C for 1 h. The reaction was stopped by the addition of 2 μ l 0.5 M EDTA followed by 88 μ l of TE buffer. .. The cells were rinsed, scraped and pelleted in wash buffer (10 mM HEPES/KOH pH 7.5, 10 mM KCl, 2 mM MgCl2 , 1 mM DTT, 0.1 mM EDTA, 0.4 mM PMSF, 0.2 mM NaF, 0.2 mM sodium orthovanadate, 0.3 mg ml−1 leupeptin).

Article Title: The Cytotoxic Enterotoxin of Aeromonas hydrophila Induces Proinflammatory Cytokine Production and Activates Arachidonic Acid Metabolism in Macrophages
Article Snippet: Labeling of the consensus oligonucleotide was performed by assembling the following reaction mixture: 2 μl of NF-κB/CREB/AP-1/AP-2/SP-1 (promoter-specific factor required for transcription of the simian virus 40 early and late promoters)/OCT-1 (octamer transcription factors)/TFIID (general transcription factors) consensus oligonucleotide (1.75 pmol/μl; Promega), 1 μl of T4 polynucleotide kinase 10× buffer (Promega), 1 μl of [γ-32 P]ATP (3,000 Ci/mmol at 10 mCi/ml; ICN), 5 μl of nuclease-free water, and 1 μl of T4 polynucleotide kinase (5 to 10 U/μl; Promega). .. Next, DNA binding reaction mixtures were assembled.

SDS Page:

Article Title: Transcriptome-wide identification of the RNA-binding landscape of the chromatin-associated protein PARP1 reveals functions in RNA biogenesis
Article Snippet: The beads were washed three times and the immunoprecipitated RNA was digested again with RNase T1 to a final concentration of 63 U μl−1 for 15 min. After dephosphorylation, the RNA segments crosslinked to PARP1 were 5′-radiolabeled using γ-32 P-ATP and T4 polynucleotide kinase (Promega Madison, WI, USA) in one original bead volume. .. The beads were washed three times and the immunoprecipitated RNA was digested again with RNase T1 to a final concentration of 63 U μl−1 for 15 min. After dephosphorylation, the RNA segments crosslinked to PARP1 were 5′-radiolabeled using γ-32 P-ATP and T4 polynucleotide kinase (Promega Madison, WI, USA) in one original bead volume.

Software:

Article Title: A small stem-loop structure of the Ebola virus trailer is essential for replication and interacts with heat-shock protein A8
Article Snippet: Probes specific for genomic and RI RNAs (Table ) were labeled with 32 P ATP using T4 Polynucleotide Kinase (Promega). .. Probes specific for genomic and RI RNAs (Table ) were labeled with 32 P ATP using T4 Polynucleotide Kinase (Promega).

Negative Control:

Article Title: The Cytotoxic Enterotoxin of Aeromonas hydrophila Induces Proinflammatory Cytokine Production and Activates Arachidonic Acid Metabolism in Macrophages
Article Snippet: Labeling of the consensus oligonucleotide was performed by assembling the following reaction mixture: 2 μl of NF-κB/CREB/AP-1/AP-2/SP-1 (promoter-specific factor required for transcription of the simian virus 40 early and late promoters)/OCT-1 (octamer transcription factors)/TFIID (general transcription factors) consensus oligonucleotide (1.75 pmol/μl; Promega), 1 μl of T4 polynucleotide kinase 10× buffer (Promega), 1 μl of [γ-32 P]ATP (3,000 Ci/mmol at 10 mCi/ml; ICN), 5 μl of nuclease-free water, and 1 μl of T4 polynucleotide kinase (5 to 10 U/μl; Promega). .. Next, DNA binding reaction mixtures were assembled.

Agarose Gel Electrophoresis:

Article Title: Identification of short 'eukaryotic' Okazaki fragments synthesized from a prokaryotic replication origin
Article Snippet: All 5′-OH termini existing in denatured DNA were first 'masked' by treatment for 1 h with 8 units of T4 polynucleotide kinase (PNK; Promega) and non-radioactive ATP at 37 °C in the buffer supplied by the manufacturer. .. All 5′-OH termini existing in denatured DNA were first 'masked' by treatment for 1 h with 8 units of T4 polynucleotide kinase (PNK; Promega) and non-radioactive ATP at 37 °C in the buffer supplied by the manufacturer.

Article Title: A small stem-loop structure of the Ebola virus trailer is essential for replication and interacts with heat-shock protein A8
Article Snippet: The RNA samples were electrophoresed for 1 h at 100 V in a 1× MOPS and 6% formaldehyde agarose gel and transferred to Hybond-N+ membrane (GE Healthcare Life Sciences). .. Probes specific for genomic and RI RNAs (Table ) were labeled with 32 P ATP using T4 Polynucleotide Kinase (Promega).

In Vitro:

Article Title: Estrogen receptor α dependent regulation of estrogen related receptor β and its role in cell cycle in breast cancer
Article Snippet: In-vitro DNA-protein interaction was carried out using Electrophoretic mobility shift assay (EMSA). .. The forward strands of both EMSA site 1 and EMSA site 2 were labeled at 5′ end with [γ− 32 P] ATP (BRIT, Hyderabad, India) using T4 polynucleotide kinase (Promega, Madison, USA).

Activation Assay:

Article Title: p21WAF1 Is Required for Interleukin-16-Induced Migration and Invasion of Vascular Smooth Muscle Cells via the p38MAPK/Sp-1/MMP-9 Pathway
Article Snippet: Transcriptional activation was analyzed by EMSA, as previously described [ ]. .. In brief, the oligonucleotides spanning the -79 MMP-9 cis element of interest were end-labeled with 32 P-ATP by T4 polynucleotide kinase (Promega, Madison, WI).

Immunoprecipitation:

Article Title: Transcriptome-wide identification of the RNA-binding landscape of the chromatin-associated protein PARP1 reveals functions in RNA biogenesis
Article Snippet: The RNase-treated supernatant was then incubated for 2 h with 600 μl of protein A dynabeads (Invitrogen, Thermo fisher Scientific, Waltham, MA,USA) bound to 15 μg of anti-PARP1 antibody (Active Motif, Carlsbad, CA, USA) or control IgG antibody. .. The beads were washed three times and the immunoprecipitated RNA was digested again with RNase T1 to a final concentration of 63 U μl−1 for 15 min. After dephosphorylation, the RNA segments crosslinked to PARP1 were 5′-radiolabeled using γ-32 P-ATP and T4 polynucleotide kinase (Promega Madison, WI, USA) in one original bead volume. .. After several washes, each CLIP sample (on the beads) was then treated with 5 U of DNase1 (NEB Ipswich, MA, USA) for every 100 μl of bead volume for 15 min at 37 °C.

CTG Assay:

Article Title: Increased expression of the ubiquitin - proteasome pathway in murine myotubes by proteolysis-inducing factor (PIF) is associated with activation of the transcription factor NF-κB
Article Snippet: The cells were incubated for 20 min with PIF prior to the EMSA assay. .. In all, 2 μ l NF-κ B (1.75 pmol μ l−1 ) (Promega UK), oligonucleotide sequence 5′-AGT TGA GGG GAC TTT CCC AGG C-3′; 3′-TCA ACT CCC CTG AAA GGG TCC G-5′; 1 μ l T4 polynucleotide kinase 10 × buffer (Promega, UK); 2 μ Ci [γ -32 P]ATP (Amersham Biosciences, UK); 1 μ l T4 polynucleotide kinase (Promega, UK) were assembled in a sterile microcentrifuge tube, the volume was adjusted to 10 μ l with nuclease-free H2 O (Promega, UK), and incubated at 37°C for 1 h. The reaction was stopped by the addition of 2 μ l 0.5 M EDTA followed by 88 μ l of TE buffer. .. The cells were rinsed, scraped and pelleted in wash buffer (10 mM HEPES/KOH pH 7.5, 10 mM KCl, 2 mM MgCl2 , 1 mM DTT, 0.1 mM EDTA, 0.4 mM PMSF, 0.2 mM NaF, 0.2 mM sodium orthovanadate, 0.3 mg ml−1 leupeptin).

Marker:

Article Title: Identification of short 'eukaryotic' Okazaki fragments synthesized from a prokaryotic replication origin
Article Snippet: All 5′-OH termini existing in denatured DNA were first 'masked' by treatment for 1 h with 8 units of T4 polynucleotide kinase (PNK; Promega) and non-radioactive ATP at 37 °C in the buffer supplied by the manufacturer. .. Gels were dried on Whatman DE81 paper and were analysed with a Storm imaging system (Molecular Dynamics).

Lysis:

Article Title: Transcriptome-wide identification of the RNA-binding landscape of the chromatin-associated protein PARP1 reveals functions in RNA biogenesis
Article Snippet: Briefly, 10 ml of packed cell pellet-UV-treated cells were lysed with 3 volumes of 1× NP40 lysis buffer on ice for 5 min. .. The beads were washed three times and the immunoprecipitated RNA was digested again with RNase T1 to a final concentration of 63 U μl−1 for 15 min. After dephosphorylation, the RNA segments crosslinked to PARP1 were 5′-radiolabeled using γ-32 P-ATP and T4 polynucleotide kinase (Promega Madison, WI, USA) in one original bead volume.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Promega t4 polynucleotide kinase
    Direct labelling of RNA on the 5′ termini of replication intermediates with vaccinia virus guanylyltransferase, an enzyme responsible for messenger RNA capping. ( A ) The 5′ ends of RNA primers attached to P. abyssi replication intermediates were capped with radioactive GTP and samples were fractionated on a sequencing gel (lane 2). Lane 3 contains the same reaction as lane 2, except that total DNA was treated with the restriction endonuclease Eco RI before analysis, confirming that nascent strands were efficiently denatured from template strands. Lane 1, size marker (10-base ladder; Gibco-BRL) labelled with [γ-32 P]ATP using <t>T4</t> polynucleotide kinase. ( B ) Schematic diagram of the archaeal Okazaki fragment. The smallest replication intermediate detected (10 nt) is in accordance with the minimum length of RNA primers detected in vitro ( <xref ref-type= Liu et al ., 2001 ). " width="250" height="auto" />
    T4 Polynucleotide Kinase, supplied by Promega, used in various techniques. Bioz Stars score: 97/100, based on 228 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 polynucleotide kinase/product/Promega
    Average 97 stars, based on 228 article reviews
    Price from $9.99 to $1999.99
    t4 polynucleotide kinase - by Bioz Stars, 2019-12
    97/100 stars
      Buy from Supplier

    Image Search Results


    Direct labelling of RNA on the 5′ termini of replication intermediates with vaccinia virus guanylyltransferase, an enzyme responsible for messenger RNA capping. ( A ) The 5′ ends of RNA primers attached to P. abyssi replication intermediates were capped with radioactive GTP and samples were fractionated on a sequencing gel (lane 2). Lane 3 contains the same reaction as lane 2, except that total DNA was treated with the restriction endonuclease Eco RI before analysis, confirming that nascent strands were efficiently denatured from template strands. Lane 1, size marker (10-base ladder; Gibco-BRL) labelled with [γ-32 P]ATP using T4 polynucleotide kinase. ( B ) Schematic diagram of the archaeal Okazaki fragment. The smallest replication intermediate detected (10 nt) is in accordance with the minimum length of RNA primers detected in vitro ( <xref ref-type= Liu et al ., 2001 ). " width="100%" height="100%">

    Journal:

    Article Title: Identification of short 'eukaryotic' Okazaki fragments synthesized from a prokaryotic replication origin

    doi: 10.1038/sj.embor.embor732

    Figure Lengend Snippet: Direct labelling of RNA on the 5′ termini of replication intermediates with vaccinia virus guanylyltransferase, an enzyme responsible for messenger RNA capping. ( A ) The 5′ ends of RNA primers attached to P. abyssi replication intermediates were capped with radioactive GTP and samples were fractionated on a sequencing gel (lane 2). Lane 3 contains the same reaction as lane 2, except that total DNA was treated with the restriction endonuclease Eco RI before analysis, confirming that nascent strands were efficiently denatured from template strands. Lane 1, size marker (10-base ladder; Gibco-BRL) labelled with [γ-32 P]ATP using T4 polynucleotide kinase. ( B ) Schematic diagram of the archaeal Okazaki fragment. The smallest replication intermediate detected (10 nt) is in accordance with the minimum length of RNA primers detected in vitro ( Liu et al ., 2001 ).

    Article Snippet: All 5′-OH termini existing in denatured DNA were first 'masked' by treatment for 1 h with 8 units of T4 polynucleotide kinase (PNK; Promega) and non-radioactive ATP at 37 °C in the buffer supplied by the manufacturer.

    Techniques: Sequencing, Marker, In Vitro, Electron Microscopy

    Unmasking assay showing short replication intermediates in Pyrococcus abyssi and Sulfolobus acidocaldarius . The 5′-OH groups of RNA-primed replication intermediates were selectively exposed by alkaline treatment. 'Unmasked' 5′-OH ends of replication intermediates were labelled with T4 polynucleotide kinase and [γ-32 P]ATP, and run on an alkaline agarose gel. A control experiment without alkaline treatment is also shown for each experiment. The positions of size markers (100, 200 and 500 nucleotides (nt)) are shown on the left.

    Journal:

    Article Title: Identification of short 'eukaryotic' Okazaki fragments synthesized from a prokaryotic replication origin

    doi: 10.1038/sj.embor.embor732

    Figure Lengend Snippet: Unmasking assay showing short replication intermediates in Pyrococcus abyssi and Sulfolobus acidocaldarius . The 5′-OH groups of RNA-primed replication intermediates were selectively exposed by alkaline treatment. 'Unmasked' 5′-OH ends of replication intermediates were labelled with T4 polynucleotide kinase and [γ-32 P]ATP, and run on an alkaline agarose gel. A control experiment without alkaline treatment is also shown for each experiment. The positions of size markers (100, 200 and 500 nucleotides (nt)) are shown on the left.

    Article Snippet: All 5′-OH termini existing in denatured DNA were first 'masked' by treatment for 1 h with 8 units of T4 polynucleotide kinase (PNK; Promega) and non-radioactive ATP at 37 °C in the buffer supplied by the manufacturer.

    Techniques: Agarose Gel Electrophoresis

    Processing of accumulated pre-rRNA in  Atnuc-L1  mutant plants is accurate. A) Northern blot analysis using total RNA isolated from WT and Atnuc-L1-1 mutant plants and [γ 32P ] 5′-end labeled primers p34, p35, p36 and p41 to detect 5′ETS1 (lanes 1–3), 5′ETS2 (lanes 4–6), 18S (lanes 7–9) and 3′ETS (lanes 10–12) pre-rRNA sequences respectively. The asterisk and vertical bar indicate expected 5′ETS cleave off and exonucleolityc products (See also   Figure S4 ). B) RNAseA/T1 protection analysis was carried out with a radiolabelled probe complementary to the 3′ETS (right). The assay was performed with total RNA from WT (lane 4) and Atnuc-L1 (lanes 5 and 6) or with yeast tRNA as a control (lane 3). A control lane loaded with undigested riboprobe is shown (lane 1). Lane 2, pBR322 digested with HpaII and 5′end labeled with T4 PNK and [γ 32P ] ATP. C) Immunolocalization of fibrillarin in roots from WT and Atnuc-L1-1. Panel mFIB; Fibrillarin appears more abundant in the nucleolus of WT (a) than in the disorganized nucleolus of Atnuc-L1 plants (c)   [18] . The nucleolar localization of fibrillarin practically overlaps the localization of AtNUC-L1 (b). Fibrillarin was detected with antibodies against mouse fibrillarin (mFIB 72B9) and Alexa-546 and AtNUC-L1 with antibodies against peptide AtNUC-L1 and Alexa-488. Chromatin in Atnuc-L1-1 is counterstained with DAPI (d). Bar, 10 µm.

    Journal: PLoS Genetics

    Article Title: Nucleolin Is Required for DNA Methylation State and the Expression of rRNA Gene Variants in Arabidopsis thaliana

    doi: 10.1371/journal.pgen.1001225

    Figure Lengend Snippet: Processing of accumulated pre-rRNA in Atnuc-L1 mutant plants is accurate. A) Northern blot analysis using total RNA isolated from WT and Atnuc-L1-1 mutant plants and [γ 32P ] 5′-end labeled primers p34, p35, p36 and p41 to detect 5′ETS1 (lanes 1–3), 5′ETS2 (lanes 4–6), 18S (lanes 7–9) and 3′ETS (lanes 10–12) pre-rRNA sequences respectively. The asterisk and vertical bar indicate expected 5′ETS cleave off and exonucleolityc products (See also Figure S4 ). B) RNAseA/T1 protection analysis was carried out with a radiolabelled probe complementary to the 3′ETS (right). The assay was performed with total RNA from WT (lane 4) and Atnuc-L1 (lanes 5 and 6) or with yeast tRNA as a control (lane 3). A control lane loaded with undigested riboprobe is shown (lane 1). Lane 2, pBR322 digested with HpaII and 5′end labeled with T4 PNK and [γ 32P ] ATP. C) Immunolocalization of fibrillarin in roots from WT and Atnuc-L1-1. Panel mFIB; Fibrillarin appears more abundant in the nucleolus of WT (a) than in the disorganized nucleolus of Atnuc-L1 plants (c) [18] . The nucleolar localization of fibrillarin practically overlaps the localization of AtNUC-L1 (b). Fibrillarin was detected with antibodies against mouse fibrillarin (mFIB 72B9) and Alexa-546 and AtNUC-L1 with antibodies against peptide AtNUC-L1 and Alexa-488. Chromatin in Atnuc-L1-1 is counterstained with DAPI (d). Bar, 10 µm.

    Article Snippet: For detection of pre-rRNA precursors and small RNA, 10 pmoles of oligonucleotide primers were 5′end labeled using 50 µCi of [γ32 P] ATP (6000 Ci/mmol) and T4 PNK (Promega).

    Techniques: Mutagenesis, Northern Blot, Isolation, Labeling