t4 polynucleotide kinase pnk buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    T4 Polynucleotide Kinase
    Description:
    T4 Polynucleotide Kinase 2 500 units
    Catalog Number:
    m0201l
    Price:
    228
    Size:
    2 500 units
    Category:
    Polynucleotide Kinases
    Buy from Supplier


    Structured Review

    New England Biolabs t4 polynucleotide kinase pnk buffer
    T4 Polynucleotide Kinase
    T4 Polynucleotide Kinase 2 500 units
    https://www.bioz.com/result/t4 polynucleotide kinase pnk buffer/product/New England Biolabs
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    t4 polynucleotide kinase pnk buffer - by Bioz Stars, 2020-04
    99/100 stars

    Images

    Related Articles

    Synthesized:

    Article Title: Evidence that base stacking potential in annealed 3' overhangs determines polymerase utilization in yeast nonhomologous end joining
    Article Snippet: Oligonucleotides were synthesized with deoxyuracil residues in the desired dRP position. .. After ligation, OMPs were treated with T4 PNK (NEB) to add 5’ phosphates, and then UDG (NEB) to remove the uracil bases, leaving 5’ dRPs.

    Article Title: Ribozyme-enhanced single-stranded Ago2-processed interfering RNA triggers efficient gene silencing with fewer off-target effects
    Article Snippet: RNA ladders composed of 21, 24, 27, 30, 40 and 50 nt chemically synthesized RNA oligonucleotides that contained the common sequence (5′ AACUUCAGGGUCAGCUUGCCG -3′) were used for probing in the Northern blotting assay. .. To remove 2′, 3′-cyclic phosphate from the 3′ end of the saiRNA, in vitro transcribed saiRNA-RZ products were treated with T4 PNK (NEB) under conditions deprived of ATP at 37 °C for 2 h. Then, T4 PNK was inactivated by incubating at 65 °C for 20 min.

    Quantitative RT-PCR:

    Article Title: Genome-wide identification of short 2′,3′-cyclic phosphate-containing RNAs and their regulation in aging
    Article Snippet: For TaqMan RT-qPCR, frozen tissues were crushed using a frozen mortar and a pestle, followed by total RNA extraction by TRIsure. .. To investigate the terminal structures of the 5′-tRNA half, total RNA was treated with CIP (New England Biolabs), T4 PNK (New England Biolabs), or acid (incubation in 10 mM HCl at 4°C for 3 h) followed by CIP treatment as previously described [ , ].

    Incubation:

    Article Title: Genome-wide identification of short 2′,3′-cyclic phosphate-containing RNAs and their regulation in aging
    Article Snippet: .. To investigate the terminal structures of the 5′-tRNA half, total RNA was treated with CIP (New England Biolabs), T4 PNK (New England Biolabs), or acid (incubation in 10 mM HCl at 4°C for 3 h) followed by CIP treatment as previously described [ , ]. .. Northern blot Northern blot was performed as previously described [ ] with the following antisense probes: 5′-tRNALysCUU half, 5′- GTCTCATGCTCTACCGACTG-3′; 3′-tRNALysCUU half, 5′-GCTCGAACCCACGACCCTGAGA-3′; 5′-tRNAAspGUC half, 5′-GGGATACTCACCACTATACTAACGAGGA-3′; 3′-tRNAAspGUC half, 5′- GAATCGAACCCCGGTCTCC-3; and miR-16, 5′-GCCAATATTTACGTGCTGCTA-3′.

    Article Title: A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi
    Article Snippet: .. The protocol was modified as follows when CIP or T4 PNK treatment is necessary: (1) for CIP treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of CIP, 4 μL of 10× CutSmart buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min; and (2) for T4 PNK treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of T4 PNK, 4 μL of 10× T4 PNK buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min. All T7 in vitro transcription products were purified by Micro Bio-Spin P-30 Gel Columns, Tris Buffer, from Bio-Rad. ..

    Article Title: PARP3 is a sensor of nicked nucleosomes and monoribosylates histone H2BGlu2
    Article Snippet: Following purification (QIAquick spin column; Qiagen), the DNA was incubated with different concentrations of micrococcal nuclease (MNase)(Worthington) in 50 mM Tris-HCl 7.5, 5 mM CaCl2 and 0.1 mg ml−1 bovine serum albumin for 30 min at room temperature. .. DNA from the MNase concentration that produced the greatest SSB/DSB ratio (0.015 U) was mock-treated or treated with T4 PNK in the presence of 2 mM ATP and 10U T4 PNK enzyme (wild-type or 3′-phosphatase dead; New England Biolabs).

    Article Title: Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver
    Article Snippet: .. After 60 min of incubation at 37 °C, ATP was supplemented to a final concentration of 1 mM together with an addition of 10 U T4 PNK and the reaction was further incubated 60 min at 37 °C. .. RNAs were purified with the RNA Clean and Concentrator 5 kit (Zymo Research) and eluted once with 7 μL H2 O.

    Article Title: Removal of deaminated cytosines and detection of in vivo methylation in ancient DNA
    Article Snippet: Repair Each oligo of 500 ng was added to a 50 μl repair reaction containing 1× NE Buffer 2, 0.1 mg ml−1 bovine serum albumen (BSA), 1 mM ATP, 300 μM each of dATP, dCTP, dGTP and dTTP, and one of the following four enzyme repair combinations: (i) 20 U T4 PNK (New England Biolabs); (ii) 20 U PNK, 5 U Escherichia coli UDG (New England Biolabs); (iii) 20 U PNK, 3 U USER enzyme (New England Biolabs). .. After an incubation period of 3 h at 37°C, 6 U T4 DNA polymerase were added to every tube followed by incubation at 25°C for 30 min. Products were purified with QIAGEN MinElute spin columns and eluted in 14 μl buffer EB (Qiagen).

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities
    Article Snippet: .. Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK. ..

    Activity Assay:

    Article Title: Perturbation of base excision repair sensitizes breast cancer cells to APOBEC3 deaminase-mediated mutations
    Article Snippet: .. 3’ phosphatase activity of PNKP A 26 nt oligonucleotide with U at the 5’ end was labeled with 32 P by T4 PNK (NEB) as described above. .. As illustrated in , the oligonucleotide was annealed to a 51 nt complementary oligonucleotide, and then annealed to a 25 nt oligonucleotide in annealing buffer (10 mM Tris, pH 7.5, 50 mM NaCl, 1 mM EDTA), followed by ligation with T4 DNA ligase (NEB) to form an internally-labeled duplex oligonucleotide (designated S, ).

    Modification:

    Article Title: A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi
    Article Snippet: .. The protocol was modified as follows when CIP or T4 PNK treatment is necessary: (1) for CIP treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of CIP, 4 μL of 10× CutSmart buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min; and (2) for T4 PNK treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of T4 PNK, 4 μL of 10× T4 PNK buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min. All T7 in vitro transcription products were purified by Micro Bio-Spin P-30 Gel Columns, Tris Buffer, from Bio-Rad. ..

    Transfection:

    Article Title: Ribozyme-enhanced single-stranded Ago2-processed interfering RNA triggers efficient gene silencing with fewer off-target effects
    Article Snippet: RNA oligonucleotides The RNA oligonucleotides for siGP, shGP, saiGP, sip53, shp53 and saip53 used for transfection were chemically synthesized by Integrated DNA Technologies (IDT). .. To remove 2′, 3′-cyclic phosphate from the 3′ end of the saiRNA, in vitro transcribed saiRNA-RZ products were treated with T4 PNK (NEB) under conditions deprived of ATP at 37 °C for 2 h. Then, T4 PNK was inactivated by incubating at 65 °C for 20 min.

    Ligation:

    Article Title: Evidence that base stacking potential in annealed 3' overhangs determines polymerase utilization in yeast nonhomologous end joining
    Article Snippet: .. After ligation, OMPs were treated with T4 PNK (NEB) to add 5’ phosphates, and then UDG (NEB) to remove the uracil bases, leaving 5’ dRPs. ..

    Article Title: Perturbation of base excision repair sensitizes breast cancer cells to APOBEC3 deaminase-mediated mutations
    Article Snippet: 3’ phosphatase activity of PNKP A 26 nt oligonucleotide with U at the 5’ end was labeled with 32 P by T4 PNK (NEB) as described above. .. As illustrated in , the oligonucleotide was annealed to a 51 nt complementary oligonucleotide, and then annealed to a 25 nt oligonucleotide in annealing buffer (10 mM Tris, pH 7.5, 50 mM NaCl, 1 mM EDTA), followed by ligation with T4 DNA ligase (NEB) to form an internally-labeled duplex oligonucleotide (designated S, ).

    Northern Blot:

    Article Title: Ribozyme-enhanced single-stranded Ago2-processed interfering RNA triggers efficient gene silencing with fewer off-target effects
    Article Snippet: RNA ladders composed of 21, 24, 27, 30, 40 and 50 nt chemically synthesized RNA oligonucleotides that contained the common sequence (5′ AACUUCAGGGUCAGCUUGCCG -3′) were used for probing in the Northern blotting assay. .. To remove 2′, 3′-cyclic phosphate from the 3′ end of the saiRNA, in vitro transcribed saiRNA-RZ products were treated with T4 PNK (NEB) under conditions deprived of ATP at 37 °C for 2 h. Then, T4 PNK was inactivated by incubating at 65 °C for 20 min.

    Sequencing:

    Article Title: Ribozyme-enhanced single-stranded Ago2-processed interfering RNA triggers efficient gene silencing with fewer off-target effects
    Article Snippet: RNA ladders composed of 21, 24, 27, 30, 40 and 50 nt chemically synthesized RNA oligonucleotides that contained the common sequence (5′ AACUUCAGGGUCAGCUUGCCG -3′) were used for probing in the Northern blotting assay. .. To remove 2′, 3′-cyclic phosphate from the 3′ end of the saiRNA, in vitro transcribed saiRNA-RZ products were treated with T4 PNK (NEB) under conditions deprived of ATP at 37 °C for 2 h. Then, T4 PNK was inactivated by incubating at 65 °C for 20 min.

    Fluorescence:

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities
    Article Snippet: The gels were imaged directly through low fluorescence glass plates (CBS Scientific) using a Typhoon FLA 9000 (GE Healthcare Life Sciences). .. Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK.

    Isolation:

    Article Title: Genome-wide identification of short 2′,3′-cyclic phosphate-containing RNAs and their regulation in aging
    Article Snippet: Paragraph title: RNA isolation and enzymatic treatment ... To investigate the terminal structures of the 5′-tRNA half, total RNA was treated with CIP (New England Biolabs), T4 PNK (New England Biolabs), or acid (incubation in 10 mM HCl at 4°C for 3 h) followed by CIP treatment as previously described [ , ].

    Labeling:

    Article Title: Perturbation of base excision repair sensitizes breast cancer cells to APOBEC3 deaminase-mediated mutations
    Article Snippet: .. 3’ phosphatase activity of PNKP A 26 nt oligonucleotide with U at the 5’ end was labeled with 32 P by T4 PNK (NEB) as described above. .. As illustrated in , the oligonucleotide was annealed to a 51 nt complementary oligonucleotide, and then annealed to a 25 nt oligonucleotide in annealing buffer (10 mM Tris, pH 7.5, 50 mM NaCl, 1 mM EDTA), followed by ligation with T4 DNA ligase (NEB) to form an internally-labeled duplex oligonucleotide (designated S, ).

    Mouse Assay:

    Article Title: Genome-wide identification of short 2′,3′-cyclic phosphate-containing RNAs and their regulation in aging
    Article Snippet: RNA isolation and enzymatic treatment For cP-RNA-seq, tissues of thymus, lung, spleen, and skeletal muscle from hindlimbs were dissected from male C57BL/6J (B6) mice at approximately 3-months ages. .. To investigate the terminal structures of the 5′-tRNA half, total RNA was treated with CIP (New England Biolabs), T4 PNK (New England Biolabs), or acid (incubation in 10 mM HCl at 4°C for 3 h) followed by CIP treatment as previously described [ , ].

    Blocking Assay:

    Article Title: Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)
    Article Snippet: Paragraph title: RNA substrates and DNA blocking oligos ... Radiolabeled RNAs were prepared with γ-32 P-ATP (PerkinElmer) and T4 PNK (New England Biolabs) and purified by 20% denaturing PAGE followed by ethanol precipitation.

    Polyacrylamide Gel Electrophoresis:

    Article Title: Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)
    Article Snippet: .. Radiolabeled RNAs were prepared with γ-32 P-ATP (PerkinElmer) and T4 PNK (New England Biolabs) and purified by 20% denaturing PAGE followed by ethanol precipitation. .. Short DNA blocking oligos ( < 20-mers) were obtained from IDT.

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities
    Article Snippet: Samples were resolved on a 20% 19:1 acrylamide:bis-acrylamide PAGE gel containing 8 M urea, 89 mM Tris borate and 2 mM EDTA. .. Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK.

    Purification:

    Article Title: A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi
    Article Snippet: .. The protocol was modified as follows when CIP or T4 PNK treatment is necessary: (1) for CIP treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of CIP, 4 μL of 10× CutSmart buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min; and (2) for T4 PNK treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of T4 PNK, 4 μL of 10× T4 PNK buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min. All T7 in vitro transcription products were purified by Micro Bio-Spin P-30 Gel Columns, Tris Buffer, from Bio-Rad. ..

    Article Title: Perturbation of base excision repair sensitizes breast cancer cells to APOBEC3 deaminase-mediated mutations
    Article Snippet: 3’ phosphatase activity of PNKP A 26 nt oligonucleotide with U at the 5’ end was labeled with 32 P by T4 PNK (NEB) as described above. .. The products were purified by PCI extraction and ethanol precipitation and treated with PNKP (25 mM HEPES-KOH, pH 7.6, 50 mM NaCl, 0.5 mM EDTA, 0.5 mM DTT, 100 ng/ml BSA, 5% Glycerol) or T4 PNK (70 mM Tris-HCl, 10 mM MgCl2 , 5 mM DTT, pH 6.0) at 37°C for 30 min.

    Article Title: PARP3 is a sensor of nicked nucleosomes and monoribosylates histone H2BGlu2
    Article Snippet: Reactions were stopped with EDTA (50 mM final) and the DNA purified as above. .. DNA from the MNase concentration that produced the greatest SSB/DSB ratio (0.015 U) was mock-treated or treated with T4 PNK in the presence of 2 mM ATP and 10U T4 PNK enzyme (wild-type or 3′-phosphatase dead; New England Biolabs).

    Article Title: Removal of deaminated cytosines and detection of in vivo methylation in ancient DNA
    Article Snippet: Repair Each oligo of 500 ng was added to a 50 μl repair reaction containing 1× NE Buffer 2, 0.1 mg ml−1 bovine serum albumen (BSA), 1 mM ATP, 300 μM each of dATP, dCTP, dGTP and dTTP, and one of the following four enzyme repair combinations: (i) 20 U T4 PNK (New England Biolabs); (ii) 20 U PNK, 5 U Escherichia coli UDG (New England Biolabs); (iii) 20 U PNK, 3 U USER enzyme (New England Biolabs). .. After an incubation period of 3 h at 37°C, 6 U T4 DNA polymerase were added to every tube followed by incubation at 25°C for 30 min. Products were purified with QIAGEN MinElute spin columns and eluted in 14 μl buffer EB (Qiagen).

    Article Title: Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)
    Article Snippet: .. Radiolabeled RNAs were prepared with γ-32 P-ATP (PerkinElmer) and T4 PNK (New England Biolabs) and purified by 20% denaturing PAGE followed by ethanol precipitation. .. Short DNA blocking oligos ( < 20-mers) were obtained from IDT.

    RNA Extraction:

    Article Title: Genome-wide identification of short 2′,3′-cyclic phosphate-containing RNAs and their regulation in aging
    Article Snippet: For TaqMan RT-qPCR, frozen tissues were crushed using a frozen mortar and a pestle, followed by total RNA extraction by TRIsure. .. To investigate the terminal structures of the 5′-tRNA half, total RNA was treated with CIP (New England Biolabs), T4 PNK (New England Biolabs), or acid (incubation in 10 mM HCl at 4°C for 3 h) followed by CIP treatment as previously described [ , ].

    shRNA:

    Article Title: Ribozyme-enhanced single-stranded Ago2-processed interfering RNA triggers efficient gene silencing with fewer off-target effects
    Article Snippet: For shRNA and saiRNA, the resuspended oligonucleotides were heated to 95 °C for 5 min and snap-cooled in an ice-water bath to eliminate dimers. .. To remove 2′, 3′-cyclic phosphate from the 3′ end of the saiRNA, in vitro transcribed saiRNA-RZ products were treated with T4 PNK (NEB) under conditions deprived of ATP at 37 °C for 2 h. Then, T4 PNK was inactivated by incubating at 65 °C for 20 min.

    In Vitro:

    Article Title: The wobble nucleotide-excising anticodon nuclease RloC is governed by the zinc-hook and DNA-dependent ATPase of its Rad50-like region
    Article Snippet: .. Such a reaction performed in vitro and followed by T4 Pnk and Rnl1-mediated repair in the presence of [γ-32 P]ATP yielded the desired internally labelled sc-tRNAGlu(UUC) . ..

    Article Title: A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi
    Article Snippet: .. The protocol was modified as follows when CIP or T4 PNK treatment is necessary: (1) for CIP treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of CIP, 4 μL of 10× CutSmart buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min; and (2) for T4 PNK treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of T4 PNK, 4 μL of 10× T4 PNK buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min. All T7 in vitro transcription products were purified by Micro Bio-Spin P-30 Gel Columns, Tris Buffer, from Bio-Rad. ..

    Article Title: Ribozyme-enhanced single-stranded Ago2-processed interfering RNA triggers efficient gene silencing with fewer off-target effects
    Article Snippet: .. To remove 2′, 3′-cyclic phosphate from the 3′ end of the saiRNA, in vitro transcribed saiRNA-RZ products were treated with T4 PNK (NEB) under conditions deprived of ATP at 37 °C for 2 h. Then, T4 PNK was inactivated by incubating at 65 °C for 20 min. ..

    Article Title: Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)
    Article Snippet: The RNA substrate S1 terminating in a 2′,3′-cyclic phosphate was prepared by in vitro transcription of a precursor RNA using an annealed DNA oligonucleotides template ( ; ) followed by cleavage with a 10–23 deoxyribozyme ( ; ). .. Radiolabeled RNAs were prepared with γ-32 P-ATP (PerkinElmer) and T4 PNK (New England Biolabs) and purified by 20% denaturing PAGE followed by ethanol precipitation.

    Ethanol Precipitation:

    Article Title: Perturbation of base excision repair sensitizes breast cancer cells to APOBEC3 deaminase-mediated mutations
    Article Snippet: 3’ phosphatase activity of PNKP A 26 nt oligonucleotide with U at the 5’ end was labeled with 32 P by T4 PNK (NEB) as described above. .. The products were purified by PCI extraction and ethanol precipitation and treated with PNKP (25 mM HEPES-KOH, pH 7.6, 50 mM NaCl, 0.5 mM EDTA, 0.5 mM DTT, 100 ng/ml BSA, 5% Glycerol) or T4 PNK (70 mM Tris-HCl, 10 mM MgCl2 , 5 mM DTT, pH 6.0) at 37°C for 30 min.

    Article Title: Practical and general synthesis of 5?-adenylated RNA (5?-AppRNA)
    Article Snippet: .. Radiolabeled RNAs were prepared with γ-32 P-ATP (PerkinElmer) and T4 PNK (New England Biolabs) and purified by 20% denaturing PAGE followed by ethanol precipitation. .. Short DNA blocking oligos ( < 20-mers) were obtained from IDT.

    Produced:

    Article Title: PARP3 is a sensor of nicked nucleosomes and monoribosylates histone H2BGlu2
    Article Snippet: .. DNA from the MNase concentration that produced the greatest SSB/DSB ratio (0.015 U) was mock-treated or treated with T4 PNK in the presence of 2 mM ATP and 10U T4 PNK enzyme (wild-type or 3′-phosphatase dead; New England Biolabs). .. The synthetic oligonucleotide sequences (MWG or Eurogentec) employed to generate duplex substrates are listed in .

    Article Title: Removal of deaminated cytosines and detection of in vivo methylation in ancient DNA
    Article Snippet: Repair Each oligo of 500 ng was added to a 50 μl repair reaction containing 1× NE Buffer 2, 0.1 mg ml−1 bovine serum albumen (BSA), 1 mM ATP, 300 μM each of dATP, dCTP, dGTP and dTTP, and one of the following four enzyme repair combinations: (i) 20 U T4 PNK (New England Biolabs); (ii) 20 U PNK, 5 U Escherichia coli UDG (New England Biolabs); (iii) 20 U PNK, 3 U USER enzyme (New England Biolabs). .. USER enzyme is a proprietary-ratio mixture of UDG and endonuclease VIII (endoVIII) produced by New England Biolabs.

    Article Title: Usb1 controls U6 snRNP assembly through evolutionarily divergent cyclic phosphodiesterase activities
    Article Snippet: Alkaline hydrolysis ladders were produced by incubating 5 µL of RNA substrate (200 nM) in buffer with 5 µL of 50 mM bicarbonate buffer pH 9.2, 1 mM EDTA at 95 °C for 10 min. .. Samples were treated with CIP or T4 PNK by addition of “Cutsmart” or “PNK” buffer from New England Biolabs and 10 units of CIP or T4 PNK and incubation at 37 °C for 15 min. Mock treated samples contained only Cutsmart buffer and water in lieu of CIP or T4 PNK.

    Concentration Assay:

    Article Title: PARP3 is a sensor of nicked nucleosomes and monoribosylates histone H2BGlu2
    Article Snippet: .. DNA from the MNase concentration that produced the greatest SSB/DSB ratio (0.015 U) was mock-treated or treated with T4 PNK in the presence of 2 mM ATP and 10U T4 PNK enzyme (wild-type or 3′-phosphatase dead; New England Biolabs). .. The synthetic oligonucleotide sequences (MWG or Eurogentec) employed to generate duplex substrates are listed in .

    Article Title: Circadian and feeding rhythms differentially affect rhythmic mRNA transcription and translation in mouse liver
    Article Snippet: .. After 60 min of incubation at 37 °C, ATP was supplemented to a final concentration of 1 mM together with an addition of 10 U T4 PNK and the reaction was further incubated 60 min at 37 °C. .. RNAs were purified with the RNA Clean and Concentrator 5 kit (Zymo Research) and eluted once with 7 μL H2 O.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs t4 pnk buffer
    Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and <t>T4</t> PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.
    T4 Pnk Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 pnk buffer/product/New England Biolabs
    Average 90 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    t4 pnk buffer - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results


    Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi

    doi: 10.1016/j.omtn.2017.07.008

    Figure Lengend Snippet: Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.

    Article Snippet: The protocol was modified as follows when CIP or T4 PNK treatment is necessary: (1) for CIP treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of CIP, 4 μL of 10× CutSmart buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min; and (2) for T4 PNK treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of T4 PNK, 4 μL of 10× T4 PNK buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min. All T7 in vitro transcription products were purified by Micro Bio-Spin P-30 Gel Columns, Tris Buffer, from Bio-Rad.

    Techniques: Transfection, Concentration Assay, Real-time Polymerase Chain Reaction, Expressing

    Read distribution of ex‑mRNA reads across the full-length mRNA transcripts. ( A and B ) Read coverage for the hemoglobin A2 transcript ( A ) and the albumin transcript ( B ) by sample type for untreated and T4 PNK end-treated samples. Exon boundaries (HBA2: 3 exons, ALB: 15 exons) are indicated by alternating intensities of gray, and UTRs are distinguished from CDS by thinner bars. ( C ) Metagene analysis with relative read coverage (percentage) across 5′ UTRs, CDSs, and 3′ UTRs for untreated and PNK-treated samples as well as corresponding data obtained after 100 random simulations (across an average of 2342–3500 captured transcripts for untreated samples and an average of 12,789–16,487 captured transcripts for PNK-treated samples, depending on sample type). Shown are results from n = 6 individual samples per condition.

    Journal: JCI Insight

    Article Title: Detection of circulating extracellular mRNAs by modified small-RNA-sequencing analysis

    doi: 10.1172/jci.insight.127317

    Figure Lengend Snippet: Read distribution of ex‑mRNA reads across the full-length mRNA transcripts. ( A and B ) Read coverage for the hemoglobin A2 transcript ( A ) and the albumin transcript ( B ) by sample type for untreated and T4 PNK end-treated samples. Exon boundaries (HBA2: 3 exons, ALB: 15 exons) are indicated by alternating intensities of gray, and UTRs are distinguished from CDS by thinner bars. ( C ) Metagene analysis with relative read coverage (percentage) across 5′ UTRs, CDSs, and 3′ UTRs for untreated and PNK-treated samples as well as corresponding data obtained after 100 random simulations (across an average of 2342–3500 captured transcripts for untreated samples and an average of 12,789–16,487 captured transcripts for PNK-treated samples, depending on sample type). Shown are results from n = 6 individual samples per condition.

    Article Snippet: To half of the eluted exRNA, i.e., 14 μl, we added 6 μl of a master mix corresponding to the equivalent of 2 μl ×10 T4 PNK buffer, 2 μl 10 mM ATP, 1 μl RNase-free water, and 1 μl T4 PNK (NEB, catalog M0201S) for a final reaction volume of 20 μl in a 1.5 ml siliconized microcentrifuge tube.

    Techniques:

    Treatment of total extracellular RNA with T4 polynucleotide kinase followed by small-RNA-sequencing. ( A ) Total RNA was isolated from 450 μl serum or platelet-depleted EDTA, acid citrate dextrose (ACD), and heparin plasma from 6 healthy individuals and purified using silica-based spin columns. Half of the RNA was treated with T4 polynucleotide kinase (T4 PNK) and repurified (PNK treated), and multiplexed small-RNA-sequencing (sRNA-seq) libraries were prepared separately for the untreated (libraries 1 and 3) and PNK-treated RNA (libraries 2 and 4). ( B ) Differences in read annotation in the 4 sample types for untreated RNA and PNK-treated RNA using initial annotation settings (reads 12–42 nt, up to 2 mismatches, multimapping). ( C ) Differences in ex‑mRNA capture between untreated and PNK-treated RNA using final annotation criteria (reads  > 15 nt, no mismatch and up to 2 mapping locations). Box plots show the median and first and third quartiles (bottom and top hinges). Whiskers extend at most ×1.5 interquartile range from the hinges; any data outside this are shown as individual outlier points. Shown are results from  n  = 6 individual samples per condition.

    Journal: JCI Insight

    Article Title: Detection of circulating extracellular mRNAs by modified small-RNA-sequencing analysis

    doi: 10.1172/jci.insight.127317

    Figure Lengend Snippet: Treatment of total extracellular RNA with T4 polynucleotide kinase followed by small-RNA-sequencing. ( A ) Total RNA was isolated from 450 μl serum or platelet-depleted EDTA, acid citrate dextrose (ACD), and heparin plasma from 6 healthy individuals and purified using silica-based spin columns. Half of the RNA was treated with T4 polynucleotide kinase (T4 PNK) and repurified (PNK treated), and multiplexed small-RNA-sequencing (sRNA-seq) libraries were prepared separately for the untreated (libraries 1 and 3) and PNK-treated RNA (libraries 2 and 4). ( B ) Differences in read annotation in the 4 sample types for untreated RNA and PNK-treated RNA using initial annotation settings (reads 12–42 nt, up to 2 mismatches, multimapping). ( C ) Differences in ex‑mRNA capture between untreated and PNK-treated RNA using final annotation criteria (reads > 15 nt, no mismatch and up to 2 mapping locations). Box plots show the median and first and third quartiles (bottom and top hinges). Whiskers extend at most ×1.5 interquartile range from the hinges; any data outside this are shown as individual outlier points. Shown are results from n = 6 individual samples per condition.

    Article Snippet: To half of the eluted exRNA, i.e., 14 μl, we added 6 μl of a master mix corresponding to the equivalent of 2 μl ×10 T4 PNK buffer, 2 μl 10 mM ATP, 1 μl RNase-free water, and 1 μl T4 PNK (NEB, catalog M0201S) for a final reaction volume of 20 μl in a 1.5 ml siliconized microcentrifuge tube.

    Techniques: RNA Sequencing Assay, Isolation, Purification

    Endonucleolytically cleaved 5′-OH RNAs are phosphorylated by Trl1. a 8% PAGE followed by northern blot analysis using probe prA. Levels of 3′-NGD RNA fragments in trl1/dom34 cells compared with those from TRL1/dom34 cells. b B1 and B4 RNA quantification relative to 5S rRNA from three independent experiments as shown in a . c 12% PAGE followed by northern blot analysis using probe prA. Treatment using T4 PNK to determine 5’-OH and 5’-P B4 RNA positions in the indicated strains. One-fourth of trl1/dom34 total RNA treated was loaded to limit scan saturation and allow TRL1/dom34 B4 RNA detection. The 5S rRNA served as a loading control. d As in Fig. 3a , Xrn1 digestion of total RNA extracts from trl1/dom34 mutant cells in the presence or absence of T4 PNK treatment in vitro. A minor band detected in trl1 is indicated by an asterisk (see also Supplementary Fig. 5 in which this band is detectable in TRL1 cells). Error bars indicate standard deviation (s.d.) calculated from three independent experiments. Source data are provided as a Source Data file.

    Journal: Nature Communications

    Article Title: No-Go Decay mRNA cleavage in the ribosome exit tunnel produces 5′-OH ends phosphorylated by Trl1

    doi: 10.1038/s41467-019-13991-9

    Figure Lengend Snippet: Endonucleolytically cleaved 5′-OH RNAs are phosphorylated by Trl1. a 8% PAGE followed by northern blot analysis using probe prA. Levels of 3′-NGD RNA fragments in trl1/dom34 cells compared with those from TRL1/dom34 cells. b B1 and B4 RNA quantification relative to 5S rRNA from three independent experiments as shown in a . c 12% PAGE followed by northern blot analysis using probe prA. Treatment using T4 PNK to determine 5’-OH and 5’-P B4 RNA positions in the indicated strains. One-fourth of trl1/dom34 total RNA treated was loaded to limit scan saturation and allow TRL1/dom34 B4 RNA detection. The 5S rRNA served as a loading control. d As in Fig. 3a , Xrn1 digestion of total RNA extracts from trl1/dom34 mutant cells in the presence or absence of T4 PNK treatment in vitro. A minor band detected in trl1 is indicated by an asterisk (see also Supplementary Fig. 5 in which this band is detectable in TRL1 cells). Error bars indicate standard deviation (s.d.) calculated from three independent experiments. Source data are provided as a Source Data file.

    Article Snippet: NEB Buffer 3 was replaced by T4 PNK buffer (NEB) in kinase assays in the presence or absence of Xrn1 (Figs. a and ).

    Techniques: Polyacrylamide Gel Electrophoresis, Northern Blot, RNA Detection, Mutagenesis, In Vitro, Standard Deviation