Structured Review

Thermo Fisher t4 pnk
RNA-interactome capture identifies novel RNA binders in mIMCD-3 cells. (A) Table of novel, mIMCD-3–specific RBPs, previously not identified as mouse or human mRNA-interacting proteins. Depicted are the gene names, protein names according to Uniprot and MGI, and the selection criteria. The top 19 proteins (#) were significant in the performed t test (Perseus software). The bottom six proteins (*) were measured at least four times in the crosslinked samples (+CL) and not more than once in the noncrosslinked samples (−CL). (B) List of proteins selected for biochemical confirmation of RNA-binding capacity. The table contains information on gene name, protein name, presence in previous RIC studies as summarized for mouse (Mm) and human (Hs) datasets in the Hentze compendium, classification in the mIMCD-3 RBPome (class), and t test significance. (C) Cellular localization pattern of MFAP1, GADD45GIP1, and HIC2. MFAP1: HEK293T cells expressing an integrated, single copy of the human MFAP1 CDS fused to eGFP, using the TALEN approach, were subjected to fluorescent imaging. GADD45GIP1 and HIC2: HEK293T cells transiently expressing the human CDS of GADD45GIP1 or HIC2 fused to triple FLAG were subjected to immunofluorescent imaging. DAPI was used as a nuclear counterstain. Scale bar, 20 µ m. (D) Biochemical validation of Mfap1a/b, Hic2, and Gadd45Gip1 as RBPs. Briefly, the human CDS of MFAP1, HIC2, and GADD45GIP1 were cloned into the 3xFLAG-pcDNA6 and transiently expressed in HEK293T cell. FLAG-tagged proteins were immunoprecipitated from crosslinked (+) and noncrosslinked (−) samples and the associated RNA was labeled by <t>T4</t> PNK with 32P. The protein-RNA complexes were separated on PAA-gels and blotted onto nitrocellulose membranes. PNK-assay: autoradiograph of the membrane containing the indicated protein with the associated RNA labeled with 32P. Western blot: visualization of FLAG-tagged protein by western blotting with the anti-FLAG antibody. Hs, homo sapiens; Mm, mus musculus; n.d., not detected.
T4 Pnk, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 49 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 pnk/product/Thermo Fisher
Average 94 stars, based on 49 article reviews
Price from $9.99 to $1999.99
t4 pnk - by Bioz Stars, 2020-04
94/100 stars

Images

1) Product Images from "The RNA-Protein Interactome of Differentiated Kidney Tubular Epithelial Cells"

Article Title: The RNA-Protein Interactome of Differentiated Kidney Tubular Epithelial Cells

Journal: Journal of the American Society of Nephrology : JASN

doi: 10.1681/ASN.2018090914

RNA-interactome capture identifies novel RNA binders in mIMCD-3 cells. (A) Table of novel, mIMCD-3–specific RBPs, previously not identified as mouse or human mRNA-interacting proteins. Depicted are the gene names, protein names according to Uniprot and MGI, and the selection criteria. The top 19 proteins (#) were significant in the performed t test (Perseus software). The bottom six proteins (*) were measured at least four times in the crosslinked samples (+CL) and not more than once in the noncrosslinked samples (−CL). (B) List of proteins selected for biochemical confirmation of RNA-binding capacity. The table contains information on gene name, protein name, presence in previous RIC studies as summarized for mouse (Mm) and human (Hs) datasets in the Hentze compendium, classification in the mIMCD-3 RBPome (class), and t test significance. (C) Cellular localization pattern of MFAP1, GADD45GIP1, and HIC2. MFAP1: HEK293T cells expressing an integrated, single copy of the human MFAP1 CDS fused to eGFP, using the TALEN approach, were subjected to fluorescent imaging. GADD45GIP1 and HIC2: HEK293T cells transiently expressing the human CDS of GADD45GIP1 or HIC2 fused to triple FLAG were subjected to immunofluorescent imaging. DAPI was used as a nuclear counterstain. Scale bar, 20 µ m. (D) Biochemical validation of Mfap1a/b, Hic2, and Gadd45Gip1 as RBPs. Briefly, the human CDS of MFAP1, HIC2, and GADD45GIP1 were cloned into the 3xFLAG-pcDNA6 and transiently expressed in HEK293T cell. FLAG-tagged proteins were immunoprecipitated from crosslinked (+) and noncrosslinked (−) samples and the associated RNA was labeled by T4 PNK with 32P. The protein-RNA complexes were separated on PAA-gels and blotted onto nitrocellulose membranes. PNK-assay: autoradiograph of the membrane containing the indicated protein with the associated RNA labeled with 32P. Western blot: visualization of FLAG-tagged protein by western blotting with the anti-FLAG antibody. Hs, homo sapiens; Mm, mus musculus; n.d., not detected.
Figure Legend Snippet: RNA-interactome capture identifies novel RNA binders in mIMCD-3 cells. (A) Table of novel, mIMCD-3–specific RBPs, previously not identified as mouse or human mRNA-interacting proteins. Depicted are the gene names, protein names according to Uniprot and MGI, and the selection criteria. The top 19 proteins (#) were significant in the performed t test (Perseus software). The bottom six proteins (*) were measured at least four times in the crosslinked samples (+CL) and not more than once in the noncrosslinked samples (−CL). (B) List of proteins selected for biochemical confirmation of RNA-binding capacity. The table contains information on gene name, protein name, presence in previous RIC studies as summarized for mouse (Mm) and human (Hs) datasets in the Hentze compendium, classification in the mIMCD-3 RBPome (class), and t test significance. (C) Cellular localization pattern of MFAP1, GADD45GIP1, and HIC2. MFAP1: HEK293T cells expressing an integrated, single copy of the human MFAP1 CDS fused to eGFP, using the TALEN approach, were subjected to fluorescent imaging. GADD45GIP1 and HIC2: HEK293T cells transiently expressing the human CDS of GADD45GIP1 or HIC2 fused to triple FLAG were subjected to immunofluorescent imaging. DAPI was used as a nuclear counterstain. Scale bar, 20 µ m. (D) Biochemical validation of Mfap1a/b, Hic2, and Gadd45Gip1 as RBPs. Briefly, the human CDS of MFAP1, HIC2, and GADD45GIP1 were cloned into the 3xFLAG-pcDNA6 and transiently expressed in HEK293T cell. FLAG-tagged proteins were immunoprecipitated from crosslinked (+) and noncrosslinked (−) samples and the associated RNA was labeled by T4 PNK with 32P. The protein-RNA complexes were separated on PAA-gels and blotted onto nitrocellulose membranes. PNK-assay: autoradiograph of the membrane containing the indicated protein with the associated RNA labeled with 32P. Western blot: visualization of FLAG-tagged protein by western blotting with the anti-FLAG antibody. Hs, homo sapiens; Mm, mus musculus; n.d., not detected.

Techniques Used: Selection, Software, RNA Binding Assay, Expressing, Imaging, Clone Assay, Immunoprecipitation, Labeling, Autoradiography, Western Blot

Related Articles

Centrifugation:

Article Title: The RNA-Protein Interactome of Differentiated Kidney Tubular Epithelial Cells
Article Snippet: Lysates were cleared by centrifugation (20,000 × g ) and treated with 2 U/ml Turbo DNase (Invitrogen) and 40 U/ml RNase I (Ambion) for 15 minutes at 37°C. .. Beads were resuspended in PNK buffer containing 5 mM DTT, 0.2 μ Ci/ μ l ( γ 32 P)ATP (Hartmann-Analytic), and 1 U/ μ l T4 PNK (ThermoFisher).

Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
Article Snippet: After a three-fold phenol deproteinization, the DNA duplex was precipitated with 2.5 volumes of ethanol, with the addition of a 1/10 volume of 3 M NaOAc (pH 5.5) by keeping for 2 hours at -20° C. The pellet was precipitated by centrifugation at 14000 rpm for 10 minutes, washed with 70% ethanol, dried in vacuum, and dissolved in 20 ≤l of water. .. To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour.

Article Title: Persistent Increased DNA-Binding and Expression of Serum Response Factor Occur with Epilepsy-Associated Long-Term Plasticity Changes
Article Snippet: Hippocampi were homogenized in 50 m m Tris, pH 7.5, 6 m m EGTA, 320 m m sucrose, 1 m m DTT, and 0.3 m m PMSF, followed by removal of cellular debris by centrifugation at 14,000 × g for 20 min. .. The SRE consensus ( ) double-stranded oligonucleotide (5′-GGATGTCCATATTAGGACATCT-3′; Santa Cruz Biotechnology, Santa Cruz, CA) was end-labeled with [γ-32 P]ATP ( > 4000 Ci/m m ; ICN Biochemicals, Costa Mesa, CA) using T4 polynucleotide kinase (10 U; Life Technologies, Gaithersburg, MD).

DNA Synthesis:

Article Title: Prevention of DNA multimerization using phosphoryl guanidine primers during isothermal amplification with Bst exo- DNA polymerase.
Article Snippet: .. Over the last two decades, isothermal amplification of nucleic acids has gained more attention due to a number of advantages over the widely used polymerase chain reaction. .. Over the last two decades, isothermal amplification of nucleic acids has gained more attention due to a number of advantages over the widely used polymerase chain reaction.

Autoradiography:

Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
Article Snippet: To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour. .. The area containing primer III with the radioactive label was visualised using autoradiography and excised.

Construct:

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: The labeled oligos were mixed with the purified proteins in binding buffer (20 m m HEPES, pH 7.5, 100 m m NaCl, 1 m m DTT, 5 m m MgCl2 ) and incubated for 20 min at RT. .. Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg.

SYBR Green Assay:

Article Title: The Influence of Reaction Conditions on DNA Multimerization During Isothermal Amplification with Bst exo- DNA Polymerase.
Article Snippet: .. Methods for isothermal amplification of nucleic acids are gained more attention in the last two decades. .. Methods for isothermal amplification of nucleic acids are gained more attention in the last two decades.

Article Title: Prevention of DNA multimerization using phosphoryl guanidine primers during isothermal amplification with Bst exo- DNA polymerase.
Article Snippet: .. Over the last two decades, isothermal amplification of nucleic acids has gained more attention due to a number of advantages over the widely used polymerase chain reaction. .. Over the last two decades, isothermal amplification of nucleic acids has gained more attention due to a number of advantages over the widely used polymerase chain reaction.

Electro Mobility Shift Assay:

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: Paragraph title: Electromobility shift assay. ... Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg.

Stripping Membranes:


Activity Assay:

Article Title: Prokaryotic silencing (psi)RNAs in Pyrococcus furiosus
Article Snippet: .. Deoxyribonucleotide probes (MWG) (20 pmol) were 5′ end-labeled with T4 Polynucleotide Kinase (Ambion) and γ-[32 P]-ATP (specific activity > 7000 Ci/mmol, MP Biomedicals) using standard protocols. .. Labeled probes were added to the prehybridization buffer, followed by hybridization overnight at 42°C.

Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
Article Snippet: .. To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour. .. The enzyme was heat-inactivated for 15 minutes at 75° C. The 32 P-labeled primer III was purified by electrophoresis in denaturing 12% PAAG.

Expressing:

Article Title: The RNA-Protein Interactome of Differentiated Kidney Tubular Epithelial Cells
Article Snippet: HEK293T cells transfected with pcDNA6 expressing triple FLAG-tagged genes of interest were UVC (254 nm) crosslinked, resuspended in lysis buffer (100 mM KCL, 5 mM MgCl2 , 10 mM Tris pH 7.5%, 0.5% NP40, 1 mM DTT, protease inhibitors), and homogenized through a 23G needle on ice. .. Beads were resuspended in PNK buffer containing 5 mM DTT, 0.2 μ Ci/ μ l ( γ 32 P)ATP (Hartmann-Analytic), and 1 U/ μ l T4 PNK (ThermoFisher).

Bradford Assay:

Article Title: Persistent Increased DNA-Binding and Expression of Serum Response Factor Occur with Epilepsy-Associated Long-Term Plasticity Changes
Article Snippet: Protein concentrations in nuclear-enriched fractions, cytoplasmic-enriched fractions, and crude homogenates were determined by the Bradford assay ( ) (Bio-Rad, Hercules, CA). .. The SRE consensus ( ) double-stranded oligonucleotide (5′-GGATGTCCATATTAGGACATCT-3′; Santa Cruz Biotechnology, Santa Cruz, CA) was end-labeled with [γ-32 P]ATP ( > 4000 Ci/m m ; ICN Biochemicals, Costa Mesa, CA) using T4 polynucleotide kinase (10 U; Life Technologies, Gaithersburg, MD).

Kinase Assay:

Article Title: The RNA-Protein Interactome of Differentiated Kidney Tubular Epithelial Cells
Article Snippet: Paragraph title: Polynucleotide Kinase Assay ... Beads were resuspended in PNK buffer containing 5 mM DTT, 0.2 μ Ci/ μ l ( γ 32 P)ATP (Hartmann-Analytic), and 1 U/ μ l T4 PNK (ThermoFisher).

Hybridization:

Article Title: Prokaryotic silencing (psi)RNAs in Pyrococcus furiosus
Article Snippet: Prehybridization and hybridization was performed in either Oligo-UltraHyb (Ambion) buffer or hybridization buffer containing 5× SSC, 7% SDS, 20 mM sodium phosphate (pH 7.0), and 1× Denhardt's solution. .. Deoxyribonucleotide probes (MWG) (20 pmol) were 5′ end-labeled with T4 Polynucleotide Kinase (Ambion) and γ-[32 P]-ATP (specific activity > 7000 Ci/mmol, MP Biomedicals) using standard protocols.

Article Title: Signal transduction-dependent small regulatory RNA is involved in glutamate metabolism of the human pathogen Bordetella pertussis
Article Snippet: Hybridization signals were visualized using a G:Box Chemi XRQ device (Syngene). .. For primer extension analysis, 20 pmol of RgtA_PE primer were labeled at the 5′ end with γ32 P-ATP by T4 polynucleotide kinase (Fermentas) as described by the manufacturer and purified with QIAquick Nucleotide Removal Kit (Qiagen).

Transfection:

Article Title: The RNA-Protein Interactome of Differentiated Kidney Tubular Epithelial Cells
Article Snippet: HEK293T cells transfected with pcDNA6 expressing triple FLAG-tagged genes of interest were UVC (254 nm) crosslinked, resuspended in lysis buffer (100 mM KCL, 5 mM MgCl2 , 10 mM Tris pH 7.5%, 0.5% NP40, 1 mM DTT, protease inhibitors), and homogenized through a 23G needle on ice. .. Beads were resuspended in PNK buffer containing 5 mM DTT, 0.2 μ Ci/ μ l ( γ 32 P)ATP (Hartmann-Analytic), and 1 U/ μ l T4 PNK (ThermoFisher).

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: The labeled oligos were mixed with the purified proteins in binding buffer (20 m m HEPES, pH 7.5, 100 m m NaCl, 1 m m DTT, 5 m m MgCl2 ) and incubated for 20 min at RT. .. Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg.

Northern Blot:

Article Title: Prokaryotic silencing (psi)RNAs in Pyrococcus furiosus
Article Snippet: Paragraph title: Northern analysis ... Deoxyribonucleotide probes (MWG) (20 pmol) were 5′ end-labeled with T4 Polynucleotide Kinase (Ambion) and γ-[32 P]-ATP (specific activity > 7000 Ci/mmol, MP Biomedicals) using standard protocols.

Article Title: Signal transduction-dependent small regulatory RNA is involved in glutamate metabolism of the human pathogen Bordetella pertussis
Article Snippet: Paragraph title: Northern blot and primer extension analyses ... For primer extension analysis, 20 pmol of RgtA_PE primer were labeled at the 5′ end with γ32 P-ATP by T4 polynucleotide kinase (Fermentas) as described by the manufacturer and purified with QIAquick Nucleotide Removal Kit (Qiagen).

Article Title: Small RNA Bidirectional Crosstalk During the Interaction Between Wheat and Zymoseptoria tritici
Article Snippet: Paragraph title: Northern Blot Analysis ... Oligonucleotides were end-labeled by incubation with T4 PNK (Thermo Scientific) in the presence of [γ-32P] dATP.

Infection:

Article Title: Small RNA Bidirectional Crosstalk During the Interaction Between Wheat and Zymoseptoria tritici
Article Snippet: Northern Blot Analysis Total RNA from wheat leaves infected by Z. tritici at 12 dpi and uninfected wheat leaves at the same time point were used for Northern blot. .. Oligonucleotides were end-labeled by incubation with T4 PNK (Thermo Scientific) in the presence of [γ-32P] dATP.

Labeling:

Article Title: p53 promotes the fidelity of DNA end-joining activity by, in part, enhancing the expression of heterogeneous nuclear ribonucleoprotein G
Article Snippet: .. To analyze DNA end protection, the EcoRV-linearized plasmid was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Invitrogen). .. The end-labeled DNA was incubated with the extracts for 30 min at 37°C in a 10 μl reaction mixture containing the indicated amount of extracts and 1X binding buffer.

Article Title: Prokaryotic silencing (psi)RNAs in Pyrococcus furiosus
Article Snippet: Deoxyribonucleotide probes (MWG) (20 pmol) were 5′ end-labeled with T4 Polynucleotide Kinase (Ambion) and γ-[32 P]-ATP (specific activity > 7000 Ci/mmol, MP Biomedicals) using standard protocols. .. Labeled probes were added to the prehybridization buffer, followed by hybridization overnight at 42°C.

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg. .. The labeled oligos were mixed with the purified proteins in binding buffer (20 m m HEPES, pH 7.5, 100 m m NaCl, 1 m m DTT, 5 m m MgCl2 ) and incubated for 20 min at RT.

Article Title: Signal transduction-dependent small regulatory RNA is involved in glutamate metabolism of the human pathogen Bordetella pertussis
Article Snippet: .. For primer extension analysis, 20 pmol of RgtA_PE primer were labeled at the 5′ end with γ32 P-ATP by T4 polynucleotide kinase (Fermentas) as described by the manufacturer and purified with QIAquick Nucleotide Removal Kit (Qiagen). .. Two picomoles of labeled primer was precipitated with 30 µg of RNA, 2.5 vol 100% ethanol, and 0.1 vol 3 M sodium acetate (pH 4.8) overnight at −20°C.

Article Title: Persistent Increased DNA-Binding and Expression of Serum Response Factor Occur with Epilepsy-Associated Long-Term Plasticity Changes
Article Snippet: The SRE consensus ( ) double-stranded oligonucleotide (5′-GGATGTCCATATTAGGACATCT-3′; Santa Cruz Biotechnology, Santa Cruz, CA) was end-labeled with [γ-32 P]ATP ( > 4000 Ci/m m ; ICN Biochemicals, Costa Mesa, CA) using T4 polynucleotide kinase (10 U; Life Technologies, Gaithersburg, MD). .. Labeled SRE (∼0.028 pmol or 3 × 104 cpm) was then added and incubated for an additional 20 min before electrophoresis.

Polymerase Chain Reaction:

Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
Article Snippet: Formation of DNA-duplex I/II proceeded on a PCR thermal cycler by keeping 20 ≤l of the reaction mixture containing 500 pmol of oligonucleotide I and 550 pmol of oligonucleotide II at 95° C for 3 minutes and then cooling the thermostat from 95 to 35° C at a speed of 0.5°/min and from 35 to 20° C at a speed of 0.25°/min. .. To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour.

Sonication:

Article Title: The RNA-Protein Interactome of Differentiated Kidney Tubular Epithelial Cells
Article Snippet: For nuclear proteins, samples were additionally sonicated (Biorupter Pico; ten intervals: 30 seconds on/off). .. Beads were resuspended in PNK buffer containing 5 mM DTT, 0.2 μ Ci/ μ l ( γ 32 P)ATP (Hartmann-Analytic), and 1 U/ μ l T4 PNK (ThermoFisher).

Binding Assay:

Article Title: p53 promotes the fidelity of DNA end-joining activity by, in part, enhancing the expression of heterogeneous nuclear ribonucleoprotein G
Article Snippet: To analyze DNA end protection, the EcoRV-linearized plasmid was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Invitrogen). .. The end-labeled DNA was incubated with the extracts for 30 min at 37°C in a 10 μl reaction mixture containing the indicated amount of extracts and 1X binding buffer.

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: .. Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg. .. The labeled oligos were mixed with the purified proteins in binding buffer (20 m m HEPES, pH 7.5, 100 m m NaCl, 1 m m DTT, 5 m m MgCl2 ) and incubated for 20 min at RT.

Article Title: Characterization of the survival motor neuron (SMN) promoter provides evidence for complex combinatorial regulation in undifferentiated and differentiated P19 cells
Article Snippet: Double-strand DNA probes (Alpha DNA) V (nt −3 to +47), VI (nt +37 to +87), VII (nt +78 to +127) and VIIa (nt +94 to +128) were 5′-end-labelled with [γ-32 P]dCTP (Amersham Biosciences, Baie d'Urfé, QC, Canada) using T4 polynucleotide kinase (Invitrogen, Burlington, ON, Canada) and the unincorporated isotope removed using a Quick-spin G50 column (Amersham Biosciences). .. Where appropriate, unlabelled double-strand competitor oligonucleotides were added to the binding reaction.

Article Title: Persistent Increased DNA-Binding and Expression of Serum Response Factor Occur with Epilepsy-Associated Long-Term Plasticity Changes
Article Snippet: The level of specific SRF binding to SRE was assessed using electrophoretic mobility-shift assays (EMSAs). .. The SRE consensus ( ) double-stranded oligonucleotide (5′-GGATGTCCATATTAGGACATCT-3′; Santa Cruz Biotechnology, Santa Cruz, CA) was end-labeled with [γ-32 P]ATP ( > 4000 Ci/m m ; ICN Biochemicals, Costa Mesa, CA) using T4 polynucleotide kinase (10 U; Life Technologies, Gaithersburg, MD).

Electrophoretic Mobility Shift Assay:

Article Title: p53 promotes the fidelity of DNA end-joining activity by, in part, enhancing the expression of heterogeneous nuclear ribonucleoprotein G
Article Snippet: Paragraph title: 2.7. DNA end protection gel shift assay ... To analyze DNA end protection, the EcoRV-linearized plasmid was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Invitrogen).

Article Title: Characterization of the survival motor neuron (SMN) promoter provides evidence for complex combinatorial regulation in undifferentiated and differentiated P19 cells
Article Snippet: Paragraph title: Preparation of nuclear extracts and EMSAs (electrophoretic mobility-shift assays) ... Double-strand DNA probes (Alpha DNA) V (nt −3 to +47), VI (nt +37 to +87), VII (nt +78 to +127) and VIIa (nt +94 to +128) were 5′-end-labelled with [γ-32 P]dCTP (Amersham Biosciences, Baie d'Urfé, QC, Canada) using T4 polynucleotide kinase (Invitrogen, Burlington, ON, Canada) and the unincorporated isotope removed using a Quick-spin G50 column (Amersham Biosciences).

Article Title: Persistent Increased DNA-Binding and Expression of Serum Response Factor Occur with Epilepsy-Associated Long-Term Plasticity Changes
Article Snippet: The level of specific SRF binding to SRE was assessed using electrophoretic mobility-shift assays (EMSAs). .. The SRE consensus ( ) double-stranded oligonucleotide (5′-GGATGTCCATATTAGGACATCT-3′; Santa Cruz Biotechnology, Santa Cruz, CA) was end-labeled with [γ-32 P]ATP ( > 4000 Ci/m m ; ICN Biochemicals, Costa Mesa, CA) using T4 polynucleotide kinase (10 U; Life Technologies, Gaithersburg, MD).

Purification:

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: The labeled oligos were mixed with the purified proteins in binding buffer (20 m m HEPES, pH 7.5, 100 m m NaCl, 1 m m DTT, 5 m m MgCl2 ) and incubated for 20 min at RT. .. Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg.

Article Title: The Influence of Reaction Conditions on DNA Multimerization During Isothermal Amplification with Bst exo- DNA Polymerase.
Article Snippet: Methods for isothermal amplification of nucleic acids are gained more attention in the last two decades. .. Methods for isothermal amplification of nucleic acids are gained more attention in the last two decades.

Article Title: Prevention of DNA multimerization using phosphoryl guanidine primers during isothermal amplification with Bst exo- DNA polymerase.
Article Snippet: Over the last two decades, isothermal amplification of nucleic acids has gained more attention due to a number of advantages over the widely used polymerase chain reaction. .. Over the last two decades, isothermal amplification of nucleic acids has gained more attention due to a number of advantages over the widely used polymerase chain reaction.

Article Title: Signal transduction-dependent small regulatory RNA is involved in glutamate metabolism of the human pathogen Bordetella pertussis
Article Snippet: .. For primer extension analysis, 20 pmol of RgtA_PE primer were labeled at the 5′ end with γ32 P-ATP by T4 polynucleotide kinase (Fermentas) as described by the manufacturer and purified with QIAquick Nucleotide Removal Kit (Qiagen). .. Two picomoles of labeled primer was precipitated with 30 µg of RNA, 2.5 vol 100% ethanol, and 0.1 vol 3 M sodium acetate (pH 4.8) overnight at −20°C.

Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
Article Snippet: To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour. .. The enzyme was heat-inactivated for 15 minutes at 75° C. The 32 P-labeled primer III was purified by electrophoresis in denaturing 12% PAAG.

Blocking Assay:

Article Title: Signal transduction-dependent small regulatory RNA is involved in glutamate metabolism of the human pathogen Bordetella pertussis
Article Snippet: After blocking with salmon sperm DNA, the membrane was hybridized overnight at 55°C with a biotinylated RgtA-specific probe RgtA_NB or after rehybridization with biotinylated SsrA-specific probe SsrA_NB. .. For primer extension analysis, 20 pmol of RgtA_PE primer were labeled at the 5′ end with γ32 P-ATP by T4 polynucleotide kinase (Fermentas) as described by the manufacturer and purified with QIAquick Nucleotide Removal Kit (Qiagen).

Plasmid Preparation:

Article Title: p53 promotes the fidelity of DNA end-joining activity by, in part, enhancing the expression of heterogeneous nuclear ribonucleoprotein G
Article Snippet: .. To analyze DNA end protection, the EcoRV-linearized plasmid was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Invitrogen). .. The end-labeled DNA was incubated with the extracts for 30 min at 37°C in a 10 μl reaction mixture containing the indicated amount of extracts and 1X binding buffer.

Article Title: Prevention of DNA multimerization using phosphoryl guanidine primers during isothermal amplification with Bst exo- DNA polymerase.
Article Snippet: .. Over the last two decades, isothermal amplification of nucleic acids has gained more attention due to a number of advantages over the widely used polymerase chain reaction. .. Over the last two decades, isothermal amplification of nucleic acids has gained more attention due to a number of advantages over the widely used polymerase chain reaction.

Electrophoresis:

Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
Article Snippet: To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour. .. The enzyme was heat-inactivated for 15 minutes at 75° C. The 32 P-labeled primer III was purified by electrophoresis in denaturing 12% PAAG.

Article Title: Persistent Increased DNA-Binding and Expression of Serum Response Factor Occur with Epilepsy-Associated Long-Term Plasticity Changes
Article Snippet: The SRE consensus ( ) double-stranded oligonucleotide (5′-GGATGTCCATATTAGGACATCT-3′; Santa Cruz Biotechnology, Santa Cruz, CA) was end-labeled with [γ-32 P]ATP ( > 4000 Ci/m m ; ICN Biochemicals, Costa Mesa, CA) using T4 polynucleotide kinase (10 U; Life Technologies, Gaithersburg, MD). .. Labeled SRE (∼0.028 pmol or 3 × 104 cpm) was then added and incubated for an additional 20 min before electrophoresis.

Incubation:

Article Title: p53 promotes the fidelity of DNA end-joining activity by, in part, enhancing the expression of heterogeneous nuclear ribonucleoprotein G
Article Snippet: To analyze DNA end protection, the EcoRV-linearized plasmid was 5′-end labeled with [γ-32 P]ATP using T4 polynucleotide kinase (Invitrogen). .. The end-labeled DNA was incubated with the extracts for 30 min at 37°C in a 10 μl reaction mixture containing the indicated amount of extracts and 1X binding buffer.

Article Title: A New Prospero and microRNA-279 Pathway Restricts CO2 Receptor Neuron Formation
Article Snippet: Oligos containing the predicted Prospero binding sites, as follows, were annealed and radiolabeled with [γ 32 P] ATP using T4 polynucleotide kinase (Fermentas): P1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaattagaaatgatttaatttcaat; mutP1 forward: gatgcaagcagcatttacagttcaaatgtgccgtctaatttctaatgatttaatttcaat; P4 forward: gagggtagcgcaaggaaaggggaggaaagctaagacagacaacaacccttctggg; and mutP4 forward: gagggtagcgcaaggaaagggggaggaaagca ttcacagacaacaacccttctggg. .. The labeled oligos were mixed with the purified proteins in binding buffer (20 m m HEPES, pH 7.5, 100 m m NaCl, 1 m m DTT, 5 m m MgCl2 ) and incubated for 20 min at RT.

Article Title: Deamination of 5-Methylcytosine Residues in Mammalian Cells
Article Snippet: .. To do this, a 20 ≤l reaction mixture containing a buffer solution for T4 polynucleotide kinase (500 mM Tris-HCl (pH 7.6), 100 mM MgCl2, 50 mM DTT, 1 mM spermidine, 1 mM EDTA, 1 mM ADP), 10 mM of primer III, 5 units of T4 polynucleotide kinase (MBI Fermentas, 10 units/≤l) and 10 mM [≤-32 P] ATP (GE Healthcare, the specific activity of 220 TBq/mmol or 6000 Ci/mmol) was incubated at 37° C for 1 hour. .. The enzyme was heat-inactivated for 15 minutes at 75° C. The 32 P-labeled primer III was purified by electrophoresis in denaturing 12% PAAG.

Article Title: Characterization of the survival motor neuron (SMN) promoter provides evidence for complex combinatorial regulation in undifferentiated and differentiated P19 cells
Article Snippet: Double-strand DNA probes (Alpha DNA) V (nt −3 to +47), VI (nt +37 to +87), VII (nt +78 to +127) and VIIa (nt +94 to +128) were 5′-end-labelled with [γ-32 P]dCTP (Amersham Biosciences, Baie d'Urfé, QC, Canada) using T4 polynucleotide kinase (Invitrogen, Burlington, ON, Canada) and the unincorporated isotope removed using a Quick-spin G50 column (Amersham Biosciences). .. The nuclear extract (4 μg unless otherwise specified) was incubated with 100 fmol of labelled probe in a 20 μl volume of reaction buffer containing 3 μg of Poly[d(I-C)] (Roche Diagnostics Corp.), 100 mM Hepes (pH 7.9), 5 mM EDTA, 50 mM (NH4 )2 SO4 , 5 mM dithiothreitol, 1% (v/v) Tween 20 and 150 mM KCl.

Article Title: Small RNA Bidirectional Crosstalk During the Interaction Between Wheat and Zymoseptoria tritici
Article Snippet: .. Oligonucleotides were end-labeled by incubation with T4 PNK (Thermo Scientific) in the presence of [γ-32P] dATP. .. Multiple small RNAs were hybridized on individual membranes by stripping twice with boiling 0.1% SDS and re-probing.

Article Title: Persistent Increased DNA-Binding and Expression of Serum Response Factor Occur with Epilepsy-Associated Long-Term Plasticity Changes
Article Snippet: The SRE consensus ( ) double-stranded oligonucleotide (5′-GGATGTCCATATTAGGACATCT-3′; Santa Cruz Biotechnology, Santa Cruz, CA) was end-labeled with [γ-32 P]ATP ( > 4000 Ci/m m ; ICN Biochemicals, Costa Mesa, CA) using T4 polynucleotide kinase (10 U; Life Technologies, Gaithersburg, MD). .. Extracts (3 μg of nuclear-enriched fraction, 8 μg of cytoplasmic-enriched fraction, or 6 μg of crude homogenate) were incubated for 10 min at room temperature in a 15 μl volume containing 10 m m Tris-HCl, pH 7.5, 50 m m NaCl, 1 m m MgCl2, 0.5 m m DTT, 0.5 m m EDTA, 4% glycerol, and 0.05 mg/ml poly(dI-dC) · poly(dI-dC) (Amersham Pharmacia Biotech, Piscataway, NJ).

Immunoprecipitation:

Article Title: The RNA-Protein Interactome of Differentiated Kidney Tubular Epithelial Cells
Article Snippet: Immunoprecipitation was performed with anti-FLAG M2 (Sigma) coupled to Protein G Dynabeads (ThermoFisher) for 2 hours at 4°C. .. Beads were resuspended in PNK buffer containing 5 mM DTT, 0.2 μ Ci/ μ l ( γ 32 P)ATP (Hartmann-Analytic), and 1 U/ μ l T4 PNK (ThermoFisher).

Lysis:

Article Title: The RNA-Protein Interactome of Differentiated Kidney Tubular Epithelial Cells
Article Snippet: HEK293T cells transfected with pcDNA6 expressing triple FLAG-tagged genes of interest were UVC (254 nm) crosslinked, resuspended in lysis buffer (100 mM KCL, 5 mM MgCl2 , 10 mM Tris pH 7.5%, 0.5% NP40, 1 mM DTT, protease inhibitors), and homogenized through a 23G needle on ice. .. Beads were resuspended in PNK buffer containing 5 mM DTT, 0.2 μ Ci/ μ l ( γ 32 P)ATP (Hartmann-Analytic), and 1 U/ μ l T4 PNK (ThermoFisher).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher t4 pnk
    RNA-interactome capture identifies novel RNA binders in mIMCD-3 cells. (A) Table of novel, mIMCD-3–specific RBPs, previously not identified as mouse or human mRNA-interacting proteins. Depicted are the gene names, protein names according to Uniprot and MGI, and the selection criteria. The top 19 proteins (#) were significant in the performed t test (Perseus software). The bottom six proteins (*) were measured at least four times in the crosslinked samples (+CL) and not more than once in the noncrosslinked samples (−CL). (B) List of proteins selected for biochemical confirmation of RNA-binding capacity. The table contains information on gene name, protein name, presence in previous RIC studies as summarized for mouse (Mm) and human (Hs) datasets in the Hentze compendium, classification in the mIMCD-3 RBPome (class), and t test significance. (C) Cellular localization pattern of MFAP1, GADD45GIP1, and HIC2. MFAP1: HEK293T cells expressing an integrated, single copy of the human MFAP1 CDS fused to eGFP, using the TALEN approach, were subjected to fluorescent imaging. GADD45GIP1 and HIC2: HEK293T cells transiently expressing the human CDS of GADD45GIP1 or HIC2 fused to triple FLAG were subjected to immunofluorescent imaging. DAPI was used as a nuclear counterstain. Scale bar, 20 µ m. (D) Biochemical validation of Mfap1a/b, Hic2, and Gadd45Gip1 as RBPs. Briefly, the human CDS of MFAP1, HIC2, and GADD45GIP1 were cloned into the 3xFLAG-pcDNA6 and transiently expressed in HEK293T cell. FLAG-tagged proteins were immunoprecipitated from crosslinked (+) and noncrosslinked (−) samples and the associated RNA was labeled by <t>T4</t> PNK with 32P. The protein-RNA complexes were separated on PAA-gels and blotted onto nitrocellulose membranes. PNK-assay: autoradiograph of the membrane containing the indicated protein with the associated RNA labeled with 32P. Western blot: visualization of FLAG-tagged protein by western blotting with the anti-FLAG antibody. Hs, homo sapiens; Mm, mus musculus; n.d., not detected.
    T4 Pnk, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 660 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 pnk/product/Thermo Fisher
    Average 94 stars, based on 660 article reviews
    Price from $9.99 to $1999.99
    t4 pnk - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results


    RNA-interactome capture identifies novel RNA binders in mIMCD-3 cells. (A) Table of novel, mIMCD-3–specific RBPs, previously not identified as mouse or human mRNA-interacting proteins. Depicted are the gene names, protein names according to Uniprot and MGI, and the selection criteria. The top 19 proteins (#) were significant in the performed t test (Perseus software). The bottom six proteins (*) were measured at least four times in the crosslinked samples (+CL) and not more than once in the noncrosslinked samples (−CL). (B) List of proteins selected for biochemical confirmation of RNA-binding capacity. The table contains information on gene name, protein name, presence in previous RIC studies as summarized for mouse (Mm) and human (Hs) datasets in the Hentze compendium, classification in the mIMCD-3 RBPome (class), and t test significance. (C) Cellular localization pattern of MFAP1, GADD45GIP1, and HIC2. MFAP1: HEK293T cells expressing an integrated, single copy of the human MFAP1 CDS fused to eGFP, using the TALEN approach, were subjected to fluorescent imaging. GADD45GIP1 and HIC2: HEK293T cells transiently expressing the human CDS of GADD45GIP1 or HIC2 fused to triple FLAG were subjected to immunofluorescent imaging. DAPI was used as a nuclear counterstain. Scale bar, 20 µ m. (D) Biochemical validation of Mfap1a/b, Hic2, and Gadd45Gip1 as RBPs. Briefly, the human CDS of MFAP1, HIC2, and GADD45GIP1 were cloned into the 3xFLAG-pcDNA6 and transiently expressed in HEK293T cell. FLAG-tagged proteins were immunoprecipitated from crosslinked (+) and noncrosslinked (−) samples and the associated RNA was labeled by T4 PNK with 32P. The protein-RNA complexes were separated on PAA-gels and blotted onto nitrocellulose membranes. PNK-assay: autoradiograph of the membrane containing the indicated protein with the associated RNA labeled with 32P. Western blot: visualization of FLAG-tagged protein by western blotting with the anti-FLAG antibody. Hs, homo sapiens; Mm, mus musculus; n.d., not detected.

    Journal: Journal of the American Society of Nephrology : JASN

    Article Title: The RNA-Protein Interactome of Differentiated Kidney Tubular Epithelial Cells

    doi: 10.1681/ASN.2018090914

    Figure Lengend Snippet: RNA-interactome capture identifies novel RNA binders in mIMCD-3 cells. (A) Table of novel, mIMCD-3–specific RBPs, previously not identified as mouse or human mRNA-interacting proteins. Depicted are the gene names, protein names according to Uniprot and MGI, and the selection criteria. The top 19 proteins (#) were significant in the performed t test (Perseus software). The bottom six proteins (*) were measured at least four times in the crosslinked samples (+CL) and not more than once in the noncrosslinked samples (−CL). (B) List of proteins selected for biochemical confirmation of RNA-binding capacity. The table contains information on gene name, protein name, presence in previous RIC studies as summarized for mouse (Mm) and human (Hs) datasets in the Hentze compendium, classification in the mIMCD-3 RBPome (class), and t test significance. (C) Cellular localization pattern of MFAP1, GADD45GIP1, and HIC2. MFAP1: HEK293T cells expressing an integrated, single copy of the human MFAP1 CDS fused to eGFP, using the TALEN approach, were subjected to fluorescent imaging. GADD45GIP1 and HIC2: HEK293T cells transiently expressing the human CDS of GADD45GIP1 or HIC2 fused to triple FLAG were subjected to immunofluorescent imaging. DAPI was used as a nuclear counterstain. Scale bar, 20 µ m. (D) Biochemical validation of Mfap1a/b, Hic2, and Gadd45Gip1 as RBPs. Briefly, the human CDS of MFAP1, HIC2, and GADD45GIP1 were cloned into the 3xFLAG-pcDNA6 and transiently expressed in HEK293T cell. FLAG-tagged proteins were immunoprecipitated from crosslinked (+) and noncrosslinked (−) samples and the associated RNA was labeled by T4 PNK with 32P. The protein-RNA complexes were separated on PAA-gels and blotted onto nitrocellulose membranes. PNK-assay: autoradiograph of the membrane containing the indicated protein with the associated RNA labeled with 32P. Western blot: visualization of FLAG-tagged protein by western blotting with the anti-FLAG antibody. Hs, homo sapiens; Mm, mus musculus; n.d., not detected.

    Article Snippet: Beads were resuspended in PNK buffer containing 5 mM DTT, 0.2 μ Ci/ μ l ( γ 32 P)ATP (Hartmann-Analytic), and 1 U/ μ l T4 PNK (ThermoFisher).

    Techniques: Selection, Software, RNA Binding Assay, Expressing, Imaging, Clone Assay, Immunoprecipitation, Labeling, Autoradiography, Western Blot

    Processing at the −43 site of 16S rRNA.A. Differential RNA-seq data for the 3′ end of 16S rRNA. The screenshot is for the rrnE operon, which is representative of all seven rRNA operons in E. coli . The tracks from top to bottom show the genome position, location of the 3′ end of 16S rRNA and positions of processing sites as identified by differential RNA-seq in the absence of TAP treatment. The positions of the −43 site, sites of known cleavage by RNase III and P and a site of cleavage by an unknown RNase (labelled ‘?’) are indicated. The numbers at the left of the RNA-seq track indicates the scale of the sequencing reads. The schematic at the bottom of panel indicates the position of a BstEII site that was used to confirm the identity of an 88 bp amplicon produced by RLM-RT-PCR analysis of the −43 site (see B and C). The numbers indicate the sizes (bp) of the predicted products of cleavage at the BstEII site. It should be noted that the products have the equivalent of half a base-pair as BstEII generates 5 nt overhangs. Arrows indicate the position of primers used for PCR. Segments of the amplicon corresponding to the 5′ adaptor are drawn at an angle, while those corresponding to the 3′ end of 16S rRNA are drawn horizontally.B. RLM-RT-PCR analysis of RNA isolated from strain BW25113 (labelled wt) growing exponentially (labelled Exp.) and a congenic Δ mazF strain growing exponentially or in stationary phase (labelled Stat.). Prior to RLM-RT-PCR analysis, an aliquot of each sample was treated with T4 polynucleotide kinase (labelled P). Aliquots of untreated samples (labelled U) were also analysed. Labelling on the left indicates the sizes of molecular markers from Invitrogen (labelled M). The amplicon corresponding to the −43 cleavage site is indicated (labelled 88 bp) on the right. Products were analysed using a 10% polyacrylamide gel and stained with ethidium bromide. No amplicons were produced in the absence of reverse transcription (data not shown).C. Restriction enzyme analysis of amplicons produced from BW25113 RNA not treated with PNK. The substrate (labelled U) was incubated with BstEII and along with the resulting products (labelled B) analysed using gel electrophoresis as described in (B). Labelling on the right indicates the positions of resolvable substrate (labelled S) and products (labelled P).

    Journal: Molecular Microbiology

    Article Title: A comparison of key aspects of gene regulation in Streptomyces coelicolor and Escherichia coli using nucleotide-resolution transcription maps produced in parallel by global and differential RNA sequencing

    doi: 10.1111/mmi.12810

    Figure Lengend Snippet: Processing at the −43 site of 16S rRNA.A. Differential RNA-seq data for the 3′ end of 16S rRNA. The screenshot is for the rrnE operon, which is representative of all seven rRNA operons in E. coli . The tracks from top to bottom show the genome position, location of the 3′ end of 16S rRNA and positions of processing sites as identified by differential RNA-seq in the absence of TAP treatment. The positions of the −43 site, sites of known cleavage by RNase III and P and a site of cleavage by an unknown RNase (labelled ‘?’) are indicated. The numbers at the left of the RNA-seq track indicates the scale of the sequencing reads. The schematic at the bottom of panel indicates the position of a BstEII site that was used to confirm the identity of an 88 bp amplicon produced by RLM-RT-PCR analysis of the −43 site (see B and C). The numbers indicate the sizes (bp) of the predicted products of cleavage at the BstEII site. It should be noted that the products have the equivalent of half a base-pair as BstEII generates 5 nt overhangs. Arrows indicate the position of primers used for PCR. Segments of the amplicon corresponding to the 5′ adaptor are drawn at an angle, while those corresponding to the 3′ end of 16S rRNA are drawn horizontally.B. RLM-RT-PCR analysis of RNA isolated from strain BW25113 (labelled wt) growing exponentially (labelled Exp.) and a congenic Δ mazF strain growing exponentially or in stationary phase (labelled Stat.). Prior to RLM-RT-PCR analysis, an aliquot of each sample was treated with T4 polynucleotide kinase (labelled P). Aliquots of untreated samples (labelled U) were also analysed. Labelling on the left indicates the sizes of molecular markers from Invitrogen (labelled M). The amplicon corresponding to the −43 cleavage site is indicated (labelled 88 bp) on the right. Products were analysed using a 10% polyacrylamide gel and stained with ethidium bromide. No amplicons were produced in the absence of reverse transcription (data not shown).C. Restriction enzyme analysis of amplicons produced from BW25113 RNA not treated with PNK. The substrate (labelled U) was incubated with BstEII and along with the resulting products (labelled B) analysed using gel electrophoresis as described in (B). Labelling on the right indicates the positions of resolvable substrate (labelled S) and products (labelled P).

    Article Snippet: Specific E. coli transcripts were probed using complementary oligonucleotides (see ) labelled at their 5′ ends with 32 P using T4 polynucleotide kinase (Thermo Scientific) and γ-32 P-ATP (3000 Ci mmol−1 , 10 mCi ml−1 , 250 μCi, Perkin Elmer).

    Techniques: RNA Sequencing Assay, Sequencing, Amplification, Produced, Reverse Transcription Polymerase Chain Reaction, Polymerase Chain Reaction, Isolation, Staining, Incubation, Nucleic Acid Electrophoresis

    Sso2081 and Sso1393 cA 4 degradation mechanism investigated by TLC. Csm generated cOA (lane 1) was incubated with 2 μM Sso2081 dimer at 60 °C to determine the intermediate (Y) and final (X) reaction product over time (lanes 2-10). Lanes 11-13 show reaction product seen in lanes 2, 4 and 6, 5’-end phosphorylated using T4 polynucleotide kinase (PNK) for identification of reaction intermediates and products by comparison to 5’-end phosphorylated MazF nuclease generated HO-A 2 > P and HO-A 4 > P standards. Lanes 14 15 show the reaction products of 2 μM Sso1393 dimer incubated with cOA at 70 °C for 20 and 120 min, respectively. Reaction product from lanes 14 15 are 5’-end phosphorylated by PNK for comparison to P-A 2 > P and P-A 4 > P standards. Comparison of PNK treated reaction product to standards showed the presence of a low amount of intermediate (P-Y) during the Sso2081 cA 4 cleavage reaction, which migrated similarly to the P-A 4 > P standard and did not change in abundance over time, whereas the abundance of the final product (P-X) increased over time. In contrast, comparison of Sso1393 PNK treated 20 min and 120 min reaction products showed a decrease of the intermediate (P-Y) over time and increase of product (P-X).

    Journal: Nature

    Article Title: Ring nucleases deactivate Type III CRISPR ribonucleases by degrading cyclic oligoadenylate

    doi: 10.1038/s41586-018-0557-5

    Figure Lengend Snippet: Sso2081 and Sso1393 cA 4 degradation mechanism investigated by TLC. Csm generated cOA (lane 1) was incubated with 2 μM Sso2081 dimer at 60 °C to determine the intermediate (Y) and final (X) reaction product over time (lanes 2-10). Lanes 11-13 show reaction product seen in lanes 2, 4 and 6, 5’-end phosphorylated using T4 polynucleotide kinase (PNK) for identification of reaction intermediates and products by comparison to 5’-end phosphorylated MazF nuclease generated HO-A 2 > P and HO-A 4 > P standards. Lanes 14 15 show the reaction products of 2 μM Sso1393 dimer incubated with cOA at 70 °C for 20 and 120 min, respectively. Reaction product from lanes 14 15 are 5’-end phosphorylated by PNK for comparison to P-A 2 > P and P-A 4 > P standards. Comparison of PNK treated reaction product to standards showed the presence of a low amount of intermediate (P-Y) during the Sso2081 cA 4 cleavage reaction, which migrated similarly to the P-A 4 > P standard and did not change in abundance over time, whereas the abundance of the final product (P-X) increased over time. In contrast, comparison of Sso1393 PNK treated 20 min and 120 min reaction products showed a decrease of the intermediate (P-Y) over time and increase of product (P-X).

    Article Snippet: For use as standards, A2 > P and A4 > P linear oligoadenylates were 5’-end labelled using 32 P-γ-ATP and T4 Polynucleotide Kinase (PNK; Thermo Fisher Scientific) via its forward reaction.

    Techniques: Thin Layer Chromatography, Generated, Incubation