t4 pnk  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    T4 Polynucleotide Kinase 3 phosphatase minus
    Description:
    T4 Polynucleotide Kinase 3 phosphatase minus 1 000 units
    Catalog Number:
    m0236l
    Price:
    428
    Size:
    1 000 units
    Category:
    Polynucleotide Kinases
    Buy from Supplier


    Structured Review

    New England Biolabs t4 pnk
    T4 Polynucleotide Kinase 3 phosphatase minus
    T4 Polynucleotide Kinase 3 phosphatase minus 1 000 units
    https://www.bioz.com/result/t4 pnk/product/New England Biolabs
    Average 90 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    t4 pnk - by Bioz Stars, 2020-01
    90/100 stars

    Images

    1) Product Images from "Purification of cross-linked RNA-protein complexes by phenol-toluol extraction"

    Article Title: Purification of cross-linked RNA-protein complexes by phenol-toluol extraction

    Journal: Nature Communications

    doi: 10.1038/s41467-019-08942-3

    PTex recovers bacterial RNPs.  a Salmonella  Typhimurium SL1344 Hfq-FLAG was UV-cross-linked and HOT-PTex was performed to purify bacterial RNPs.  b  Western blot using an anti-FLAG antibody demonstrates recovery of Hfq monomers linked to RNA. Note that the physiologically active Hfq hexamer partially withstands SDS-PAGE conditions  49  and that this complex is also enriched after PTex.  c  RNPs in  Salmonella  were purified by PTex globally. 172 Proteins enriched after UV-cross-linking (PTex CL) contain ribosomal proteins (transparent red), known RBPs (red) and DNA-binders (orange). Individual enriched proteins not known to associate with RNA before were used for validation (in parentheses).  d  Validation of PTex-enriched RNA-interactors:  Salmonella  strains expressing FLAG-tagged proteins were immunoprecipitated  ±UV irradiation. RNA-association is confirmed by radioactive labelling of RNA 5′ ends by polynucleotide kinase (T4 PNK) using autoradiography; a signal is exclusively detectable after UV-cross-linking and radiolabelling of precipitated RNA. CsrA-FLAG (pos. ctr.), YigA-FLAG (neg. ctr.), AhpC-FLAG, SipA-FLAG and YihI-FLAG are bound to RNA in vivo.  e  GO terms significantly enriched among the RNA-associated proteins;  p -value derived from a one-tail Fisher Exact test  75 . For full gels/blots see Supplementary Figures   25 ,   26
    Figure Legend Snippet: PTex recovers bacterial RNPs. a Salmonella Typhimurium SL1344 Hfq-FLAG was UV-cross-linked and HOT-PTex was performed to purify bacterial RNPs. b Western blot using an anti-FLAG antibody demonstrates recovery of Hfq monomers linked to RNA. Note that the physiologically active Hfq hexamer partially withstands SDS-PAGE conditions 49 and that this complex is also enriched after PTex. c RNPs in Salmonella were purified by PTex globally. 172 Proteins enriched after UV-cross-linking (PTex CL) contain ribosomal proteins (transparent red), known RBPs (red) and DNA-binders (orange). Individual enriched proteins not known to associate with RNA before were used for validation (in parentheses). d Validation of PTex-enriched RNA-interactors: Salmonella strains expressing FLAG-tagged proteins were immunoprecipitated  ±UV irradiation. RNA-association is confirmed by radioactive labelling of RNA 5′ ends by polynucleotide kinase (T4 PNK) using autoradiography; a signal is exclusively detectable after UV-cross-linking and radiolabelling of precipitated RNA. CsrA-FLAG (pos. ctr.), YigA-FLAG (neg. ctr.), AhpC-FLAG, SipA-FLAG and YihI-FLAG are bound to RNA in vivo. e GO terms significantly enriched among the RNA-associated proteins; p -value derived from a one-tail Fisher Exact test 75 . For full gels/blots see Supplementary Figures  25 , 26

    Techniques Used: Western Blot, SDS Page, Purification, Expressing, Immunoprecipitation, Irradiation, Autoradiography, In Vivo, Derivative Assay

    2) Product Images from "High-throughput determination of RNA structure by proximity ligation"

    Article Title: High-throughput determination of RNA structure by proximity ligation

    Journal: Nature biotechnology

    doi: 10.1038/nbt.3289

    RNA Proximity Ligation identifies structurally proximate regions within the complex secondary structures of S. cerevisiae ribosomal RNAs. a.) A schematic representation of the RPL method. Whole cells are spheroplasted with zymolyase and RNA is allowed to react with endogenous RNases. RNA ends are repaired in situ via T4 PNK to yield 5′-phosphate termini. Complexes are ligated overnight in the presence of T4 RNA Ligase I. Ligation products are cleaned up via acid guanidinium-phenol and subsequent DNase treatment, and subjected to Illumina TruSeq RNA-seq library preparation. These libraries are sequenced to map and count ligation junctions; b.-c.) We examined the distribution of ligation junctions as a function of distance from known base-pair partners in the 25S/5.8S rRNA and 18S rRNAs. Ligation products capture the structural proximity implied by base-pairing relationships, as evidenced by the enrichment for ligation junctions immediately near paired bases. Y-axes are shown as ligation counts per million reads analyzed. d.) Contact probability map for the eukaryotic 5.8S/25S rRNA based on RPL scores, which are calculated from the frequencies of ligation events between pairs of 21 nt windows ( Methods ). Lower inset : Ligation events, shown for bases 1300 to 1475 of the LSU rRNA in orange, primarily occur across digested single-stranded loops. RPL scores effectively smooth this noisy signal and are enriched for pairs of interacting regions. Plotted here are the 8,463 ligation events where both nucleotides fall within the displayed domain (compared to 17,029 ligation events where one nucleotide falls within the displayed domain and one does not, not shown). Right inset: RPL scores localize known pseudo-knots in the LSU rRNA structure, such as the interaction between bases 1727-1812 (shown in red) and bases 1941 – 2038 (shown in blue).
    Figure Legend Snippet: RNA Proximity Ligation identifies structurally proximate regions within the complex secondary structures of S. cerevisiae ribosomal RNAs. a.) A schematic representation of the RPL method. Whole cells are spheroplasted with zymolyase and RNA is allowed to react with endogenous RNases. RNA ends are repaired in situ via T4 PNK to yield 5′-phosphate termini. Complexes are ligated overnight in the presence of T4 RNA Ligase I. Ligation products are cleaned up via acid guanidinium-phenol and subsequent DNase treatment, and subjected to Illumina TruSeq RNA-seq library preparation. These libraries are sequenced to map and count ligation junctions; b.-c.) We examined the distribution of ligation junctions as a function of distance from known base-pair partners in the 25S/5.8S rRNA and 18S rRNAs. Ligation products capture the structural proximity implied by base-pairing relationships, as evidenced by the enrichment for ligation junctions immediately near paired bases. Y-axes are shown as ligation counts per million reads analyzed. d.) Contact probability map for the eukaryotic 5.8S/25S rRNA based on RPL scores, which are calculated from the frequencies of ligation events between pairs of 21 nt windows ( Methods ). Lower inset : Ligation events, shown for bases 1300 to 1475 of the LSU rRNA in orange, primarily occur across digested single-stranded loops. RPL scores effectively smooth this noisy signal and are enriched for pairs of interacting regions. Plotted here are the 8,463 ligation events where both nucleotides fall within the displayed domain (compared to 17,029 ligation events where one nucleotide falls within the displayed domain and one does not, not shown). Right inset: RPL scores localize known pseudo-knots in the LSU rRNA structure, such as the interaction between bases 1727-1812 (shown in red) and bases 1941 – 2038 (shown in blue).

    Techniques Used: Ligation, In Situ, RNA Sequencing Assay

    Related Articles

    Amplification:

    Article Title: Transcriptional Regulation of Genes Encoding Arabinan-Degrading Enzymes in Bacillus subtilis
    Article Snippet: PCR amplification with chromosomal DNA as a template and primers ARA87 and ARA91 (Table ) yielded a DNA fragment that, after digestion with Bcl I, resulted in a 1.4-kb xsa DNA probe. .. Primer ARA86, complementary to the abnA sequence (Table ), and primer ARA90, complementary to the xsa sequence (Table ), were end labeled with [γ-32 P]ATP (3,000 Ci/mmol) by using T4 polynucleotide kinase (NEB).

    Article Title: Multimodal RNA-seq using single-strand, double-strand, and CircLigase-based capture yields a refined and extended description of the C. elegans transcriptome
    Article Snippet: The cDNA was then treated with T4 polynucleotide kinase (New England Biolabs) and T4 DNA polymerase (New England Biolabs) to generate double-stranded cDNA fragments with blunt ends. .. After ligation the cDNA fragments where excised between 175 and 300 bp and purified from a 6% acrylamide gel and then subjected to PCR amplification with primers SG-135, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and SG-137, CAAGCAGAAGACGGCATACGAGCT.

    Synthesized:

    Article Title: Multimodal RNA-seq using single-strand, double-strand, and CircLigase-based capture yields a refined and extended description of the C. elegans transcriptome
    Article Snippet: The second strand was synthesized using DNA polymerase I (Invitrogen). .. The cDNA was then treated with T4 polynucleotide kinase (New England Biolabs) and T4 DNA polymerase (New England Biolabs) to generate double-stranded cDNA fragments with blunt ends.

    Article Title: Mechanism of Efficient and Accurate Nucleotide Incorporation Opposite 7,8-Dihydro-8-Oxoguanine by Saccharomyces cerevisiae DNA Polymerase ?
    Article Snippet: The oligonucleotide containing the 8-oxoG was synthesized by Midland Certified Reagent Company, Inc. .. The primer strand was 5′-32 P end labeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32 P]ATP (6,000 Ci/mmol; Amersham BioSciences) at 37°C for 1 h. Labeled primer strands were separated from unreacted [γ-32 P]ATP with a Sephadex G-25 spin column (Amersham BioSciences).

    Electrophoresis:

    Article Title: Reciprocal Regulation of l-Arabinose and d-Xylose Metabolism in Escherichia coli
    Article Snippet: DNA fragments for the PxylA (genomic region from nt 3729038 to 3728713), ParaC /ParaB (genomic region from nt 70059 to 70386), and PflgB (genomic region from nt 1129902 to 1130228) promoters were 32 P-labeled in a phosphorylation reaction mixture containing 5 pmol DNA, 2 μl T4 polynucleotide kinase 10× buffer, 1 μl T4 polynucleotide kinase (New England BioLabs), and 2 μl of [γ-32 P]ATP in a final volume of 20 μl. .. The electrophoresis was carried out on a 5% native polyacrylamide gel in TBE buffer (10.8 g/liter Tris, 5.5 g/liter boric acid, 0.37 g/liter EDTA disodium salt) at room temperature.

    Modification:

    Article Title: Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles
    Article Snippet: Total RNA was isolated using TRIzol (Invitrogen), and small RNA samples were 5′ labeled by first treating with calf alkaline phosphatase (Roche) followed by phosphorylation with T4 polynucleotide kinase (NEB) and 32 P-γ-ATP. .. Northern blots were prepared using 7.5 or 20 μg of total RNA and 5 μg of low-molecular-weight enriched RNA (mirVana miRNA isolation kit with modification).

    Incubation:

    Article Title: Role of the primer activation signal in tRNA annealing onto the HIV-1 genome studied by single-molecule FRET microscopy
    Article Snippet: .. The RNA2 oligonucleotide was phosphorylated by incubation with ATP and T4 polynucleotide kinase (NEB). .. The phosphorylated RNA2 oligonucleotide was mixed with the RNA1 oligonucleotide and the DNA splint oligonucleotide at a 1:1:1 molar ratio, at a final oligonucleotide concentration of 4 μM.

    Article Title: Phosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP-Driven Ribonuclease
    Article Snippet: Synthetic RNAs and synthetic Drosophila pre- let-7 (Dharmacon, Lafayette, CO) were 5′ 32 P-radiolabeled using γ-32 P ATP (6000 Ci/mmol; PerkinElmer, Waltham, MA) and T4 polynucleotide kinase (NEB, Ipswich, MA). .. After gel purification, RNA strands or pre- let-7 were incubated at 65°C for 5 min and then at 25°C for 30 min. Site-specifically radiolabeled 120 nt dsRNAs were prepared by DNA-splinted ligation ( ) ( ; ).

    Article Title: Identification and Characterization of CdgB, a Diguanylate Cyclase Involved in Developmental Processes in Streptomyces coelicolor ▿
    Article Snippet: Oligonucleotides were first end labeled using T4 polynucleotide kinase (New England BioLabs) and [γ-32 P]ATP (PerkinElmer) as described by the manufacturer. .. Prior to DNase I treatment, radioactive probes (approximately 110,000 cpm) were incubated with various amounts of histidine-tagged BldD, purified as described previously , at 30°C in a 40-μl volume containing 10 mM Tris-HCl (pH 7.8), 150 mM NaCl, 2 mM dithiothreitol, 1 μg of poly(dI·dC) (Roche), and 10% glycerol.

    Article Title: Transcriptional Regulation of Genes Encoding Arabinan-Degrading Enzymes in Bacillus subtilis
    Article Snippet: Primer ARA86, complementary to the abnA sequence (Table ), and primer ARA90, complementary to the xsa sequence (Table ), were end labeled with [γ-32 P]ATP (3,000 Ci/mmol) by using T4 polynucleotide kinase (NEB). .. A total of 2.5 ρmol of each labeled primer was mixed with 50 to 100 μg of RNA in separate experiments, denatured by heating to 85°C for 10 min, and annealed by incubation at 45°C overnight.

    Article Title: Further Characterization of Equine Foamy Virus Reveals Unusual Features among the Foamy Viruses
    Article Snippet: Minus-strand primers (LTR+1 , GAGCAAATTAAGTGCATC; IP+1 , CAGGCCAGATGTCTTCTA) were end-labeled in a reaction mixture containing 100 pmol of primer, 1× kinase buffer, 2.8 μM [γ-32 P]ATP (NEG-035C; NEN), and 5 U of T4 polynucleotide kinase (New England Biolabs) for 45 min at 37°C. .. The reaction was stopped by incubation at 55°C for 5 min and then was purified on a G50 column.

    Activity Assay:

    Article Title: Modulation of the Structure, Catalytic Activity, and Fidelity of African Swine Fever Virus DNA Polymerase X by a Reversible Disulfide Switch *
    Article Snippet: Preparation of the labeled primers was as follows: [γ-32 P]ATP (specific activity 3 × 103 Ci mmol−1 ) was purchased from PerkinElmer Life Sciences. .. T4 polynucleotide kinase was purchased from New England Biolabs (Beverly, MA).

    Acrylamide Gel Assay:

    Article Title: Multimodal RNA-seq using single-strand, double-strand, and CircLigase-based capture yields a refined and extended description of the C. elegans transcriptome
    Article Snippet: The cDNA was then treated with T4 polynucleotide kinase (New England Biolabs) and T4 DNA polymerase (New England Biolabs) to generate double-stranded cDNA fragments with blunt ends. .. After ligation the cDNA fragments where excised between 175 and 300 bp and purified from a 6% acrylamide gel and then subjected to PCR amplification with primers SG-135, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and SG-137, CAAGCAGAAGACGGCATACGAGCT.

    Gel Purification:

    Article Title: Phosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP-Driven Ribonuclease
    Article Snippet: Synthetic RNAs and synthetic Drosophila pre- let-7 (Dharmacon, Lafayette, CO) were 5′ 32 P-radiolabeled using γ-32 P ATP (6000 Ci/mmol; PerkinElmer, Waltham, MA) and T4 polynucleotide kinase (NEB, Ipswich, MA). .. After gel purification, RNA strands or pre- let-7 were incubated at 65°C for 5 min and then at 25°C for 30 min. Site-specifically radiolabeled 120 nt dsRNAs were prepared by DNA-splinted ligation ( ) ( ; ).

    High Performance Liquid Chromatography:

    Article Title: Role of the primer activation signal in tRNA annealing onto the HIV-1 genome studied by single-molecule FRET microscopy
    Article Snippet: The RNA oligonucleotides (Ribotask) were HPLC-purified for single-molecule fluorescence measurements. .. The RNA2 oligonucleotide was phosphorylated by incubation with ATP and T4 polynucleotide kinase (NEB).

    Ligation:

    Article Title: Role of the primer activation signal in tRNA annealing onto the HIV-1 genome studied by single-molecule FRET microscopy
    Article Snippet: A DNA splint oligonucleotide (TGTTCGGGCGCCACTGCTAGCCACACTGACTAAAAGGGTC) partially complementary to oligonucleotides RNA1 and RNA2 was used to guide the ligation reaction. .. The RNA2 oligonucleotide was phosphorylated by incubation with ATP and T4 polynucleotide kinase (NEB).

    Article Title: Phosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP-Driven Ribonuclease
    Article Snippet: Synthetic RNAs and synthetic Drosophila pre- let-7 (Dharmacon, Lafayette, CO) were 5′ 32 P-radiolabeled using γ-32 P ATP (6000 Ci/mmol; PerkinElmer, Waltham, MA) and T4 polynucleotide kinase (NEB, Ipswich, MA). .. After gel purification, RNA strands or pre- let-7 were incubated at 65°C for 5 min and then at 25°C for 30 min. Site-specifically radiolabeled 120 nt dsRNAs were prepared by DNA-splinted ligation ( ) ( ; ).

    Article Title: Multimodal RNA-seq using single-strand, double-strand, and CircLigase-based capture yields a refined and extended description of the C. elegans transcriptome
    Article Snippet: The cDNA was then treated with T4 polynucleotide kinase (New England Biolabs) and T4 DNA polymerase (New England Biolabs) to generate double-stranded cDNA fragments with blunt ends. .. After ligation the cDNA fragments where excised between 175 and 300 bp and purified from a 6% acrylamide gel and then subjected to PCR amplification with primers SG-135, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and SG-137, CAAGCAGAAGACGGCATACGAGCT.

    Footprinting:

    Article Title: Identification and Characterization of CdgB, a Diguanylate Cyclase Involved in Developmental Processes in Streptomyces coelicolor ▿
    Article Snippet: Paragraph title: DNase I footprinting experiments. ... Oligonucleotides were first end labeled using T4 polynucleotide kinase (New England BioLabs) and [γ-32 P]ATP (PerkinElmer) as described by the manufacturer.

    Northern Blot:

    Article Title: Identification of Potential microRNAs and Their Targets in Brassica rapa L.
    Article Snippet: Paragraph title: Northern blot analyses ... Blots were hybridized with the ULTRA-Hyb Oligo solution (Ambion, USA) and oligonucleotide probes that were end-labeled using 32 P-γATP and T4 polynucleotide kinase (New England Biolabs).

    Article Title: Transcriptional Regulation of Genes Encoding Arabinan-Degrading Enzymes in Bacillus subtilis
    Article Snippet: Paragraph title: RNA preparation, Northern blot analysis, and primer extension analysis. ... Primer ARA86, complementary to the abnA sequence (Table ), and primer ARA90, complementary to the xsa sequence (Table ), were end labeled with [γ-32 P]ATP (3,000 Ci/mmol) by using T4 polynucleotide kinase (NEB).

    Article Title: Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles
    Article Snippet: Paragraph title: Small RNA labeling and Northern blot analyses ... Total RNA was isolated using TRIzol (Invitrogen), and small RNA samples were 5′ labeled by first treating with calf alkaline phosphatase (Roche) followed by phosphorylation with T4 polynucleotide kinase (NEB) and 32 P-γ-ATP.

    Generated:

    Article Title: Phosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP-Driven Ribonuclease
    Article Snippet: PCR templates for transcription of sense and antisense RNAs were generated from the EGFP sequence of pN3-eGFP using primers listed in . .. Synthetic RNAs and synthetic Drosophila pre- let-7 (Dharmacon, Lafayette, CO) were 5′ 32 P-radiolabeled using γ-32 P ATP (6000 Ci/mmol; PerkinElmer, Waltham, MA) and T4 polynucleotide kinase (NEB, Ipswich, MA).

    Article Title: Identification and Characterization of CdgB, a Diguanylate Cyclase Involved in Developmental Processes in Streptomyces coelicolor ▿
    Article Snippet: A 167-bp probe spanning the promoter region of cdgB was generated by PCR using oligonucleotides 4281_F5 (5′-GAAACCCCACGCAATTGTTC-3′) and 4281_R5 (5′-GACCTCGCAGTGAATCAAGG-3′). .. Oligonucleotides were first end labeled using T4 polynucleotide kinase (New England BioLabs) and [γ-32 P]ATP (PerkinElmer) as described by the manufacturer.

    Article Title: Widespread backtracking by RNA pol II is a major effector of gene activation, 5’ pause release, termination and transcription elongation rate
    Article Snippet: .. RNA was extracted with Trizol, treated with T4 PNK (3’ phosphatase minus, NET M0236) and DNaseI (NEB, M0303) and libraries were generated using the Lexogen small RNA-seq kit (052). ..

    other:

    Article Title: Variation in Mutation Rates Caused by RB69pol Fidelity Mutants Can Be Rationalized on the Basis of Their Kinetic Behavior and Crystal Structures
    Article Snippet: T4 polynucleotide kinase was purchased from New England Biolabs (Boston, MA).

    DNA Labeling:

    Article Title: Transcriptional Regulation of Genes Encoding Arabinan-Degrading Enzymes in Bacillus subtilis
    Article Snippet: The DNA probes were labeled with a Megaprime DNA labeling system (Amersham) and [α-32 P]dCTP (3,000 Ci/mmol; Amersham). .. Primer ARA86, complementary to the abnA sequence (Table ), and primer ARA90, complementary to the xsa sequence (Table ), were end labeled with [γ-32 P]ATP (3,000 Ci/mmol) by using T4 polynucleotide kinase (NEB).

    Sequencing:

    Article Title: Phosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP-Driven Ribonuclease
    Article Snippet: PCR templates for transcription of sense and antisense RNAs were generated from the EGFP sequence of pN3-eGFP using primers listed in . .. Synthetic RNAs and synthetic Drosophila pre- let-7 (Dharmacon, Lafayette, CO) were 5′ 32 P-radiolabeled using γ-32 P ATP (6000 Ci/mmol; PerkinElmer, Waltham, MA) and T4 polynucleotide kinase (NEB, Ipswich, MA).

    Article Title: Transcriptional Regulation of Genes Encoding Arabinan-Degrading Enzymes in Bacillus subtilis
    Article Snippet: .. Primer ARA86, complementary to the abnA sequence (Table ), and primer ARA90, complementary to the xsa sequence (Table ), were end labeled with [γ-32 P]ATP (3,000 Ci/mmol) by using T4 polynucleotide kinase (NEB). .. A total of 2.5 ρmol of each labeled primer was mixed with 50 to 100 μg of RNA in separate experiments, denatured by heating to 85°C for 10 min, and annealed by incubation at 45°C overnight.

    Article Title: Mechanism of Efficient and Accurate Nucleotide Incorporation Opposite 7,8-Dihydro-8-Oxoguanine by Saccharomyces cerevisiae DNA Polymerase ?
    Article Snippet: Two 45-mer templates were used with the sequence 5′-GGA CGG CAT TGG ATC GAC CT G GAG TTG GTT GGA CGG CTG CGA GGC; in one template the underlined G is a nondamaged G, and in the other the underlined base is an 8-oxoG. .. The primer strand was 5′-32 P end labeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32 P]ATP (6,000 Ci/mmol; Amersham BioSciences) at 37°C for 1 h. Labeled primer strands were separated from unreacted [γ-32 P]ATP with a Sephadex G-25 spin column (Amersham BioSciences).

    Article Title: Induction of NEIL1 and NEIL2 DNA glycosylases in aniline-induced splenic toxicity
    Article Snippet: A 51-mer oligonucleotide containing 5-OHU at position 26 from the 5′-end (sequence shown below) were obtained from Sigma (St. Louis, MO). .. Oligonucleotides (5.5 pmol) were end-labeled using 5 μCi of [γ-32 P]ATP (3000Ci/mmol, Perkin -Elmer Life & Analytical Sciences, Boston, MA) and T4 polynucleotide kinase (New England BioLabs, Ipswich, MA) and then passed through a G-25 spin column (GE Healthcare, Piscataway, NJ) for purifying the radio labeled oligonucleotides, and annealed with 1.5–2 fold complementary oligonucleotide by gradual cooling to room temperature.

    Binding Assay:

    Article Title: Reciprocal Regulation of l-Arabinose and d-Xylose Metabolism in Escherichia coli
    Article Snippet: DNA fragments for the PxylA (genomic region from nt 3729038 to 3728713), ParaC /ParaB (genomic region from nt 70059 to 70386), and PflgB (genomic region from nt 1129902 to 1130228) promoters were 32 P-labeled in a phosphorylation reaction mixture containing 5 pmol DNA, 2 μl T4 polynucleotide kinase 10× buffer, 1 μl T4 polynucleotide kinase (New England BioLabs), and 2 μl of [γ-32 P]ATP in a final volume of 20 μl. .. The binding reaction was performed by mixing 0.5 pmol 32 P-labeled DNA, 0.5 μg salmon sperm DNA (Invitrogen), 10 mM Tris-HCl (pH 8.0), 50 mM KCl, 100 μg/ml bovine serum albumin (BSA), 10% glycerol, 1 mM dithiothreitol (DTT), 0.5 mM EDTA, 10 mM xylose (only when indicated), and 100 ng purified XylR protein (only when indicated) in a total volume of 50 μl.

    Cellular Antioxidant Activity Assay:

    Article Title: Mechanism of Efficient and Accurate Nucleotide Incorporation Opposite 7,8-Dihydro-8-Oxoguanine by Saccharomyces cerevisiae DNA Polymerase ?
    Article Snippet: The same 24-mer primer sequence, 5′-GCC TCG CAG CCG TCC AAC CAA CTC, was used for all incorporation measurements. .. The primer strand was 5′-32 P end labeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32 P]ATP (6,000 Ci/mmol; Amersham BioSciences) at 37°C for 1 h. Labeled primer strands were separated from unreacted [γ-32 P]ATP with a Sephadex G-25 spin column (Amersham BioSciences).

    RNA Sequencing Assay:

    Article Title: Widespread backtracking by RNA pol II is a major effector of gene activation, 5’ pause release, termination and transcription elongation rate
    Article Snippet: .. RNA was extracted with Trizol, treated with T4 PNK (3’ phosphatase minus, NET M0236) and DNaseI (NEB, M0303) and libraries were generated using the Lexogen small RNA-seq kit (052). ..

    Fluorescence:

    Article Title: Role of the primer activation signal in tRNA annealing onto the HIV-1 genome studied by single-molecule FRET microscopy
    Article Snippet: The RNA oligonucleotides (Ribotask) were HPLC-purified for single-molecule fluorescence measurements. .. The RNA2 oligonucleotide was phosphorylated by incubation with ATP and T4 polynucleotide kinase (NEB).

    Isolation:

    Article Title: Identification of Potential microRNAs and Their Targets in Brassica rapa L.
    Article Snippet: Total RNA was isolated from, 20-day-old B. rapa cultivar Kenshin seedling plants by using Trizol reagent (Invitrogen, USA) according to the procedure previously described by . .. Blots were hybridized with the ULTRA-Hyb Oligo solution (Ambion, USA) and oligonucleotide probes that were end-labeled using 32 P-γATP and T4 polynucleotide kinase (New England Biolabs).

    Article Title: Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles
    Article Snippet: .. Total RNA was isolated using TRIzol (Invitrogen), and small RNA samples were 5′ labeled by first treating with calf alkaline phosphatase (Roche) followed by phosphorylation with T4 polynucleotide kinase (NEB) and 32 P-γ-ATP. .. Small RNA samples were 3′ labeled using T4 RNA ligase (NEB) and 32 P-pCp as described by the manufacturer.

    Labeling:

    Article Title: The twenty-nine amino acid C-terminal cytoplasmic domain of poliovirus 3AB is critical for nucleic acid chaperone activity
    Article Snippet: .. Reactions for primer labeling were done in a 50 µl volume containing 70 mM Tris-HCl, pH = 7.6, 10 mM MgCl2 , 5 mM DTT, 10 µl of ³-32 P ATP (3,000 Ci/mmol, 10 µCi/µl) and 2 µl (20 units) of T4 polynucleotide kinase. .. The reaction mixture was incubated for 30 minutes at 37°C and then the T4 polynucleotide kinase was heat inactivated for 10 minutes at 70°C according to the manufacturer's recommendation.

    Article Title: Identification and Characterization of CdgB, a Diguanylate Cyclase Involved in Developmental Processes in Streptomyces coelicolor ▿
    Article Snippet: .. Oligonucleotides were first end labeled using T4 polynucleotide kinase (New England BioLabs) and [γ-32 P]ATP (PerkinElmer) as described by the manufacturer. .. Prior to DNase I treatment, radioactive probes (approximately 110,000 cpm) were incubated with various amounts of histidine-tagged BldD, purified as described previously , at 30°C in a 40-μl volume containing 10 mM Tris-HCl (pH 7.8), 150 mM NaCl, 2 mM dithiothreitol, 1 μg of poly(dI·dC) (Roche), and 10% glycerol.

    Article Title: Transcriptional Regulation of Genes Encoding Arabinan-Degrading Enzymes in Bacillus subtilis
    Article Snippet: .. Primer ARA86, complementary to the abnA sequence (Table ), and primer ARA90, complementary to the xsa sequence (Table ), were end labeled with [γ-32 P]ATP (3,000 Ci/mmol) by using T4 polynucleotide kinase (NEB). .. A total of 2.5 ρmol of each labeled primer was mixed with 50 to 100 μg of RNA in separate experiments, denatured by heating to 85°C for 10 min, and annealed by incubation at 45°C overnight.

    Article Title: Deep small RNA sequencing from the nematode Ascaris reveals conservation, functional diversification, and novel developmental profiles
    Article Snippet: .. Total RNA was isolated using TRIzol (Invitrogen), and small RNA samples were 5′ labeled by first treating with calf alkaline phosphatase (Roche) followed by phosphorylation with T4 polynucleotide kinase (NEB) and 32 P-γ-ATP. .. Small RNA samples were 3′ labeled using T4 RNA ligase (NEB) and 32 P-pCp as described by the manufacturer.

    Article Title: Modulation of the Structure, Catalytic Activity, and Fidelity of African Swine Fever Virus DNA Polymerase X by a Reversible Disulfide Switch *
    Article Snippet: Preparation of the labeled primers was as follows: [γ-32 P]ATP (specific activity 3 × 103 Ci mmol−1 ) was purchased from PerkinElmer Life Sciences. .. T4 polynucleotide kinase was purchased from New England Biolabs (Beverly, MA).

    Article Title: Mechanism of Efficient and Accurate Nucleotide Incorporation Opposite 7,8-Dihydro-8-Oxoguanine by Saccharomyces cerevisiae DNA Polymerase ?
    Article Snippet: .. The primer strand was 5′-32 P end labeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32 P]ATP (6,000 Ci/mmol; Amersham BioSciences) at 37°C for 1 h. Labeled primer strands were separated from unreacted [γ-32 P]ATP with a Sephadex G-25 spin column (Amersham BioSciences). .. The labeled primer strands were annealed to template strands in 50 mM Tris Cl and 100 mM NaCl by heating at 90°C for 2 min and slow cooling to room temperature over several hours.

    Article Title: Induction of NEIL1 and NEIL2 DNA glycosylases in aniline-induced splenic toxicity
    Article Snippet: .. Oligonucleotides (5.5 pmol) were end-labeled using 5 μCi of [γ-32 P]ATP (3000Ci/mmol, Perkin -Elmer Life & Analytical Sciences, Boston, MA) and T4 polynucleotide kinase (New England BioLabs, Ipswich, MA) and then passed through a G-25 spin column (GE Healthcare, Piscataway, NJ) for purifying the radio labeled oligonucleotides, and annealed with 1.5–2 fold complementary oligonucleotide by gradual cooling to room temperature. .. 5-OHU(U): bubble: Oligonucleotide substrate sequence *5′-GCT TAG CTT GGA ATC GTA TCA TGT AUA CTC GTG TGC CGT GTA GAC GAT GCC-3′ 3′ CGA ATC GAA CCT TAG CAT AG GCACCCGACAA AC ACG GCA CAT CTG CTA CGG-5′

    Purification:

    Article Title: Identification and Characterization of CdgB, a Diguanylate Cyclase Involved in Developmental Processes in Streptomyces coelicolor ▿
    Article Snippet: Oligonucleotides were first end labeled using T4 polynucleotide kinase (New England BioLabs) and [γ-32 P]ATP (PerkinElmer) as described by the manufacturer. .. Prior to DNase I treatment, radioactive probes (approximately 110,000 cpm) were incubated with various amounts of histidine-tagged BldD, purified as described previously , at 30°C in a 40-μl volume containing 10 mM Tris-HCl (pH 7.8), 150 mM NaCl, 2 mM dithiothreitol, 1 μg of poly(dI·dC) (Roche), and 10% glycerol.

    Article Title: Multimodal RNA-seq using single-strand, double-strand, and CircLigase-based capture yields a refined and extended description of the C. elegans transcriptome
    Article Snippet: Total RNA was extracted from frozen tissue samples with mirVana (Ambion), and 10 μg was used for initial mRNA purification. .. The cDNA was then treated with T4 polynucleotide kinase (New England Biolabs) and T4 DNA polymerase (New England Biolabs) to generate double-stranded cDNA fragments with blunt ends.

    Article Title: Further Characterization of Equine Foamy Virus Reveals Unusual Features among the Foamy Viruses
    Article Snippet: Minus-strand primers (LTR+1 , GAGCAAATTAAGTGCATC; IP+1 , CAGGCCAGATGTCTTCTA) were end-labeled in a reaction mixture containing 100 pmol of primer, 1× kinase buffer, 2.8 μM [γ-32 P]ATP (NEG-035C; NEN), and 5 U of T4 polynucleotide kinase (New England Biolabs) for 45 min at 37°C. .. The reaction was stopped by incubation at 55°C for 5 min and then was purified on a G50 column.

    Article Title: Reciprocal Regulation of l-Arabinose and d-Xylose Metabolism in Escherichia coli
    Article Snippet: DNA fragments for the PxylA (genomic region from nt 3729038 to 3728713), ParaC /ParaB (genomic region from nt 70059 to 70386), and PflgB (genomic region from nt 1129902 to 1130228) promoters were 32 P-labeled in a phosphorylation reaction mixture containing 5 pmol DNA, 2 μl T4 polynucleotide kinase 10× buffer, 1 μl T4 polynucleotide kinase (New England BioLabs), and 2 μl of [γ-32 P]ATP in a final volume of 20 μl. .. The binding reaction was performed by mixing 0.5 pmol 32 P-labeled DNA, 0.5 μg salmon sperm DNA (Invitrogen), 10 mM Tris-HCl (pH 8.0), 50 mM KCl, 100 μg/ml bovine serum albumin (BSA), 10% glycerol, 1 mM dithiothreitol (DTT), 0.5 mM EDTA, 10 mM xylose (only when indicated), and 100 ng purified XylR protein (only when indicated) in a total volume of 50 μl.

    Polymerase Chain Reaction:

    Article Title: Phosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP-Driven Ribonuclease
    Article Snippet: PCR templates for transcription of sense and antisense RNAs were generated from the EGFP sequence of pN3-eGFP using primers listed in . .. Synthetic RNAs and synthetic Drosophila pre- let-7 (Dharmacon, Lafayette, CO) were 5′ 32 P-radiolabeled using γ-32 P ATP (6000 Ci/mmol; PerkinElmer, Waltham, MA) and T4 polynucleotide kinase (NEB, Ipswich, MA).

    Article Title: Identification and Characterization of CdgB, a Diguanylate Cyclase Involved in Developmental Processes in Streptomyces coelicolor ▿
    Article Snippet: A 167-bp probe spanning the promoter region of cdgB was generated by PCR using oligonucleotides 4281_F5 (5′-GAAACCCCACGCAATTGTTC-3′) and 4281_R5 (5′-GACCTCGCAGTGAATCAAGG-3′). .. Oligonucleotides were first end labeled using T4 polynucleotide kinase (New England BioLabs) and [γ-32 P]ATP (PerkinElmer) as described by the manufacturer.

    Article Title: Transcriptional Regulation of Genes Encoding Arabinan-Degrading Enzymes in Bacillus subtilis
    Article Snippet: PCR amplification with chromosomal DNA as a template and primers ARA87 and ARA91 (Table ) yielded a DNA fragment that, after digestion with Bcl I, resulted in a 1.4-kb xsa DNA probe. .. Primer ARA86, complementary to the abnA sequence (Table ), and primer ARA90, complementary to the xsa sequence (Table ), were end labeled with [γ-32 P]ATP (3,000 Ci/mmol) by using T4 polynucleotide kinase (NEB).

    Article Title: Multimodal RNA-seq using single-strand, double-strand, and CircLigase-based capture yields a refined and extended description of the C. elegans transcriptome
    Article Snippet: The cDNA was then treated with T4 polynucleotide kinase (New England Biolabs) and T4 DNA polymerase (New England Biolabs) to generate double-stranded cDNA fragments with blunt ends. .. After ligation the cDNA fragments where excised between 175 and 300 bp and purified from a 6% acrylamide gel and then subjected to PCR amplification with primers SG-135, AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and SG-137, CAAGCAGAAGACGGCATACGAGCT.

    Article Title: Widespread backtracking by RNA pol II is a major effector of gene activation, 5’ pause release, termination and transcription elongation rate
    Article Snippet: RNA was extracted with Trizol, treated with T4 PNK (3’ phosphatase minus, NET M0236) and DNaseI (NEB, M0303) and libraries were generated using the Lexogen small RNA-seq kit (052). .. PCR duplicates were filtered using a custom script that removes reads having the same 5’ and 3’ ends.

    Electrophoretic Mobility Shift Assay:

    Article Title: Reciprocal Regulation of l-Arabinose and d-Xylose Metabolism in Escherichia coli
    Article Snippet: Paragraph title: Electrophoretic mobility shift assay. ... DNA fragments for the PxylA (genomic region from nt 3729038 to 3728713), ParaC /ParaB (genomic region from nt 70059 to 70386), and PflgB (genomic region from nt 1129902 to 1130228) promoters were 32 P-labeled in a phosphorylation reaction mixture containing 5 pmol DNA, 2 μl T4 polynucleotide kinase 10× buffer, 1 μl T4 polynucleotide kinase (New England BioLabs), and 2 μl of [γ-32 P]ATP in a final volume of 20 μl.

    Concentration Assay:

    Article Title: Role of the primer activation signal in tRNA annealing onto the HIV-1 genome studied by single-molecule FRET microscopy
    Article Snippet: The RNA2 oligonucleotide was phosphorylated by incubation with ATP and T4 polynucleotide kinase (NEB). .. The phosphorylated RNA2 oligonucleotide was mixed with the RNA1 oligonucleotide and the DNA splint oligonucleotide at a 1:1:1 molar ratio, at a final oligonucleotide concentration of 4 μM.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Mechanism of Efficient and Accurate Nucleotide Incorporation Opposite 7,8-Dihydro-8-Oxoguanine by Saccharomyces cerevisiae DNA Polymerase ?
    Article Snippet: Two 45-mer templates were used with the sequence 5′-GGA CGG CAT TGG ATC GAC CT G GAG TTG GTT GGA CGG CTG CGA GGC; in one template the underlined G is a nondamaged G, and in the other the underlined base is an 8-oxoG. .. The primer strand was 5′-32 P end labeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32 P]ATP (6,000 Ci/mmol; Amersham BioSciences) at 37°C for 1 h. Labeled primer strands were separated from unreacted [γ-32 P]ATP with a Sephadex G-25 spin column (Amersham BioSciences).

    Article Title: Induction of NEIL1 and NEIL2 DNA glycosylases in aniline-induced splenic toxicity
    Article Snippet: Oligonucleotides (5.5 pmol) were end-labeled using 5 μCi of [γ-32 P]ATP (3000Ci/mmol, Perkin -Elmer Life & Analytical Sciences, Boston, MA) and T4 polynucleotide kinase (New England BioLabs, Ipswich, MA) and then passed through a G-25 spin column (GE Healthcare, Piscataway, NJ) for purifying the radio labeled oligonucleotides, and annealed with 1.5–2 fold complementary oligonucleotide by gradual cooling to room temperature. .. 5-OHU(U): bubble: Oligonucleotide substrate sequence *5′-GCT TAG CTT GGA ATC GTA TCA TGT AUA CTC GTG TGC CGT GTA GAC GAT GCC-3′ 3′ CGA ATC GAA CCT TAG CAT AG GCACCCGACAA AC ACG GCA CAT CTG CTA CGG-5′

    Random Hexamer Labeling:

    Article Title: Multimodal RNA-seq using single-strand, double-strand, and CircLigase-based capture yields a refined and extended description of the C. elegans transcriptome
    Article Snippet: First-strand cDNA was synthesized from the mRNA fractions using random hexamer primers and Superscript II Reverse Transcriptase (Invitrogen). .. The cDNA was then treated with T4 polynucleotide kinase (New England Biolabs) and T4 DNA polymerase (New England Biolabs) to generate double-stranded cDNA fragments with blunt ends.

    Produced:

    Article Title: Phosphate and R2D2 Restrict the Substrate Specificity of Dicer-2, an ATP-Driven Ribonuclease
    Article Snippet: Synthetic RNAs and synthetic Drosophila pre- let-7 (Dharmacon, Lafayette, CO) were 5′ 32 P-radiolabeled using γ-32 P ATP (6000 Ci/mmol; PerkinElmer, Waltham, MA) and T4 polynucleotide kinase (NEB, Ipswich, MA). .. The fourth siRNA produced corresponds to the sum of the two 32 P-radiolabeled cleavage products produced when the dsRNA was cleaved to generate the fourth and fifth siRNAs.

    Immunoprecipitation:

    Article Title: Widespread backtracking by RNA pol II is a major effector of gene activation, 5’ pause release, termination and transcription elongation rate
    Article Snippet: Reactions were stopped by adding10 μl 250 mM EGTA and pooled supernatants (400–600 μl) were diluted 10X with NET-2 buffer and immunoprecipitated with 400–600 μl antibody-conjugated protein A/G dynabeads (Invitrogen 10015D). .. RNA was extracted with Trizol, treated with T4 PNK (3’ phosphatase minus, NET M0236) and DNaseI (NEB, M0303) and libraries were generated using the Lexogen small RNA-seq kit (052).

    End Labeling:

    Article Title: Induction of NEIL1 and NEIL2 DNA glycosylases in aniline-induced splenic toxicity
    Article Snippet: Paragraph title: Oligonucleotide 5′ end-labeling for NEIL1/2-mediated BER assay ... Oligonucleotides (5.5 pmol) were end-labeled using 5 μCi of [γ-32 P]ATP (3000Ci/mmol, Perkin -Elmer Life & Analytical Sciences, Boston, MA) and T4 polynucleotide kinase (New England BioLabs, Ipswich, MA) and then passed through a G-25 spin column (GE Healthcare, Piscataway, NJ) for purifying the radio labeled oligonucleotides, and annealed with 1.5–2 fold complementary oligonucleotide by gradual cooling to room temperature.

    CTG Assay:

    Article Title: Mechanism of Efficient and Accurate Nucleotide Incorporation Opposite 7,8-Dihydro-8-Oxoguanine by Saccharomyces cerevisiae DNA Polymerase ?
    Article Snippet: Two 45-mer templates were used with the sequence 5′-GGA CGG CAT TGG ATC GAC CT G GAG TTG GTT GGA CGG CTG CGA GGC; in one template the underlined G is a nondamaged G, and in the other the underlined base is an 8-oxoG. .. The primer strand was 5′-32 P end labeled with T4 polynucleotide kinase (New England Biolabs) and [γ-32 P]ATP (6,000 Ci/mmol; Amersham BioSciences) at 37°C for 1 h. Labeled primer strands were separated from unreacted [γ-32 P]ATP with a Sephadex G-25 spin column (Amersham BioSciences).

    Article Title: Induction of NEIL1 and NEIL2 DNA glycosylases in aniline-induced splenic toxicity
    Article Snippet: Oligonucleotides (5.5 pmol) were end-labeled using 5 μCi of [γ-32 P]ATP (3000Ci/mmol, Perkin -Elmer Life & Analytical Sciences, Boston, MA) and T4 polynucleotide kinase (New England BioLabs, Ipswich, MA) and then passed through a G-25 spin column (GE Healthcare, Piscataway, NJ) for purifying the radio labeled oligonucleotides, and annealed with 1.5–2 fold complementary oligonucleotide by gradual cooling to room temperature. .. 5-OHU(U): bubble: Oligonucleotide substrate sequence *5′-GCT TAG CTT GGA ATC GTA TCA TGT AUA CTC GTG TGC CGT GTA GAC GAT GCC-3′ 3′ CGA ATC GAA CCT TAG CAT AG GCACCCGACAA AC ACG GCA CAT CTG CTA CGG-5′

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs t4 polynucleotide kinase
    Removal of the terminal 2′,3′ cyclic phosphate group of the released tRNA resulting from the HDV ribozyme cleavage reaction. Treatment with <t>T4</t> polynucleotide kinase (T4 PNK) leads to the removal of the phosphate group and therefore to a reduced net charge of the RNA. This can be observed by a reduced electrophoretic mobility on a denaturing 10% polyacrylamide gel in comparison with the untreated control (mock incubation without T4 PNK).
    T4 Polynucleotide Kinase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 377 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 polynucleotide kinase/product/New England Biolabs
    Average 90 stars, based on 377 article reviews
    Price from $9.99 to $1999.99
    t4 polynucleotide kinase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results


    Removal of the terminal 2′,3′ cyclic phosphate group of the released tRNA resulting from the HDV ribozyme cleavage reaction. Treatment with T4 polynucleotide kinase (T4 PNK) leads to the removal of the phosphate group and therefore to a reduced net charge of the RNA. This can be observed by a reduced electrophoretic mobility on a denaturing 10% polyacrylamide gel in comparison with the untreated control (mock incubation without T4 PNK).

    Journal: Nucleic Acids Research

    Article Title: A universal method to produce in vitro transcripts with homogeneous 3? ends

    doi:

    Figure Lengend Snippet: Removal of the terminal 2′,3′ cyclic phosphate group of the released tRNA resulting from the HDV ribozyme cleavage reaction. Treatment with T4 polynucleotide kinase (T4 PNK) leads to the removal of the phosphate group and therefore to a reduced net charge of the RNA. This can be observed by a reduced electrophoretic mobility on a denaturing 10% polyacrylamide gel in comparison with the untreated control (mock incubation without T4 PNK).

    Article Snippet: Radioactively labeled transcripts carrying a 2′,3′ cyclic phosphate at the 3′ end (as a consequence of the self-cleavage reaction of the downstream HDV ribozyme) were dephosphorylated using either of the following methods. (i) Up to 50 pmol RNA were incubated with 6 U T4 polynucleotide kinase (New England Biolabs) in 100 mM Tris–HCl pH 6.5, 100 mM magnesium acetate, 5 mM β-mercaptoethanol in a final volume of 50 µl for 6 h at 37°C ( ). (ii) Transcripts were incubated with 0.1 mM ATP, 100 mM imidazole–HCl pH 6.0, 10 mM MgCl2 , 10 mM β-mercaptoethanol, 20 µg/ml BSA and 1 U T4 polynucleotide kinase (New England Biolabs) per 100 pmol RNA in a final volume of 50 µl for 6 h at 37°C ( ). (iii) Up to 300 pmol tRNA were incubated in 100 mM morpholinoethanesulfonate-NaOH pH 5.5, 10 mM MgCl2 , 10 mM β-mercaptoethanol, 300 mM NaCl and 10 U T4 polynucleotide kinase (New England Biolabs) in a final volume of 20 µl for 6 h at 37°C ( ).

    Techniques: Incubation