t4 pnk buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    T4 Polynucleotide Kinase Reaction Buffer
    Description:
    T4 Polynucleotide Kinase Reaction Buffer 4 0 ml
    Catalog Number:
    b0201s
    Price:
    24
    Size:
    4 0 ml
    Category:
    Buffers
    Buy from Supplier


    Structured Review

    New England Biolabs t4 pnk buffer
    T4 Polynucleotide Kinase Reaction Buffer
    T4 Polynucleotide Kinase Reaction Buffer 4 0 ml
    https://www.bioz.com/result/t4 pnk buffer/product/New England Biolabs
    Average 99 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    t4 pnk buffer - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi"

    Article Title: A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi

    Journal: Molecular Therapy. Nucleic Acids

    doi: 10.1016/j.omtn.2017.07.008

    Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.
    Figure Legend Snippet: Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.

    Techniques Used: Transfection, Concentration Assay, Real-time Polymerase Chain Reaction, Expressing

    2) Product Images from "Detection of circulating extracellular mRNAs by modified small-RNA-sequencing analysis"

    Article Title: Detection of circulating extracellular mRNAs by modified small-RNA-sequencing analysis

    Journal: JCI Insight

    doi: 10.1172/jci.insight.127317

    Read distribution of ex‑mRNA reads across the full-length mRNA transcripts. ( A and B ) Read coverage for the hemoglobin A2 transcript ( A ) and the albumin transcript ( B ) by sample type for untreated and T4 PNK end-treated samples. Exon boundaries (HBA2: 3 exons, ALB: 15 exons) are indicated by alternating intensities of gray, and UTRs are distinguished from CDS by thinner bars. ( C ) Metagene analysis with relative read coverage (percentage) across 5′ UTRs, CDSs, and 3′ UTRs for untreated and PNK-treated samples as well as corresponding data obtained after 100 random simulations (across an average of 2342–3500 captured transcripts for untreated samples and an average of 12,789–16,487 captured transcripts for PNK-treated samples, depending on sample type). Shown are results from n = 6 individual samples per condition.
    Figure Legend Snippet: Read distribution of ex‑mRNA reads across the full-length mRNA transcripts. ( A and B ) Read coverage for the hemoglobin A2 transcript ( A ) and the albumin transcript ( B ) by sample type for untreated and T4 PNK end-treated samples. Exon boundaries (HBA2: 3 exons, ALB: 15 exons) are indicated by alternating intensities of gray, and UTRs are distinguished from CDS by thinner bars. ( C ) Metagene analysis with relative read coverage (percentage) across 5′ UTRs, CDSs, and 3′ UTRs for untreated and PNK-treated samples as well as corresponding data obtained after 100 random simulations (across an average of 2342–3500 captured transcripts for untreated samples and an average of 12,789–16,487 captured transcripts for PNK-treated samples, depending on sample type). Shown are results from n = 6 individual samples per condition.

    Techniques Used:

    Treatment of total extracellular RNA with T4 polynucleotide kinase followed by small-RNA-sequencing. ( A ) Total RNA was isolated from 450 μl serum or platelet-depleted EDTA, acid citrate dextrose (ACD), and heparin plasma from 6 healthy individuals and purified using silica-based spin columns. Half of the RNA was treated with T4 polynucleotide kinase (T4 PNK) and repurified (PNK treated), and multiplexed small-RNA-sequencing (sRNA-seq) libraries were prepared separately for the untreated (libraries 1 and 3) and PNK-treated RNA (libraries 2 and 4). ( B ) Differences in read annotation in the 4 sample types for untreated RNA and PNK-treated RNA using initial annotation settings (reads 12–42 nt, up to 2 mismatches, multimapping). ( C ) Differences in ex‑mRNA capture between untreated and PNK-treated RNA using final annotation criteria (reads  > 15 nt, no mismatch and up to 2 mapping locations). Box plots show the median and first and third quartiles (bottom and top hinges). Whiskers extend at most ×1.5 interquartile range from the hinges; any data outside this are shown as individual outlier points. Shown are results from  n  = 6 individual samples per condition.
    Figure Legend Snippet: Treatment of total extracellular RNA with T4 polynucleotide kinase followed by small-RNA-sequencing. ( A ) Total RNA was isolated from 450 μl serum or platelet-depleted EDTA, acid citrate dextrose (ACD), and heparin plasma from 6 healthy individuals and purified using silica-based spin columns. Half of the RNA was treated with T4 polynucleotide kinase (T4 PNK) and repurified (PNK treated), and multiplexed small-RNA-sequencing (sRNA-seq) libraries were prepared separately for the untreated (libraries 1 and 3) and PNK-treated RNA (libraries 2 and 4). ( B ) Differences in read annotation in the 4 sample types for untreated RNA and PNK-treated RNA using initial annotation settings (reads 12–42 nt, up to 2 mismatches, multimapping). ( C ) Differences in ex‑mRNA capture between untreated and PNK-treated RNA using final annotation criteria (reads > 15 nt, no mismatch and up to 2 mapping locations). Box plots show the median and first and third quartiles (bottom and top hinges). Whiskers extend at most ×1.5 interquartile range from the hinges; any data outside this are shown as individual outlier points. Shown are results from n = 6 individual samples per condition.

    Techniques Used: RNA Sequencing Assay, Isolation, Purification

    3) Product Images from "No-Go Decay mRNA cleavage in the ribosome exit tunnel produces 5′-OH ends phosphorylated by Trl1"

    Article Title: No-Go Decay mRNA cleavage in the ribosome exit tunnel produces 5′-OH ends phosphorylated by Trl1

    Journal: Nature Communications

    doi: 10.1038/s41467-019-13991-9

    Endonucleolytically cleaved 5′-OH RNAs are phosphorylated by Trl1. a 8% PAGE followed by northern blot analysis using probe prA. Levels of 3′-NGD RNA fragments in trl1/dom34 cells compared with those from TRL1/dom34 cells. b B1 and B4 RNA quantification relative to 5S rRNA from three independent experiments as shown in a . c 12% PAGE followed by northern blot analysis using probe prA. Treatment using T4 PNK to determine 5’-OH and 5’-P B4 RNA positions in the indicated strains. One-fourth of trl1/dom34 total RNA treated was loaded to limit scan saturation and allow TRL1/dom34 B4 RNA detection. The 5S rRNA served as a loading control. d As in Fig. 3a , Xrn1 digestion of total RNA extracts from trl1/dom34 mutant cells in the presence or absence of T4 PNK treatment in vitro. A minor band detected in trl1 is indicated by an asterisk (see also Supplementary Fig. 5 in which this band is detectable in TRL1 cells). Error bars indicate standard deviation (s.d.) calculated from three independent experiments. Source data are provided as a Source Data file.
    Figure Legend Snippet: Endonucleolytically cleaved 5′-OH RNAs are phosphorylated by Trl1. a 8% PAGE followed by northern blot analysis using probe prA. Levels of 3′-NGD RNA fragments in trl1/dom34 cells compared with those from TRL1/dom34 cells. b B1 and B4 RNA quantification relative to 5S rRNA from three independent experiments as shown in a . c 12% PAGE followed by northern blot analysis using probe prA. Treatment using T4 PNK to determine 5’-OH and 5’-P B4 RNA positions in the indicated strains. One-fourth of trl1/dom34 total RNA treated was loaded to limit scan saturation and allow TRL1/dom34 B4 RNA detection. The 5S rRNA served as a loading control. d As in Fig. 3a , Xrn1 digestion of total RNA extracts from trl1/dom34 mutant cells in the presence or absence of T4 PNK treatment in vitro. A minor band detected in trl1 is indicated by an asterisk (see also Supplementary Fig. 5 in which this band is detectable in TRL1 cells). Error bars indicate standard deviation (s.d.) calculated from three independent experiments. Source data are provided as a Source Data file.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Northern Blot, RNA Detection, Mutagenesis, In Vitro, Standard Deviation

    Related Articles

    Clone Assay:

    Article Title: Neisserial Correia Repeat-Enclosed Elements Do Not Influence the Transcription of pil Genes in Neisseria gonorrhoeae and Neisseria meningitidis ▿ ▿ †
    Article Snippet: The DNA in this 40 μl was blunt ended ( ) in a 50-μl reaction mixture containing a final concentration of 1× T4 polynucleotide kinase buffer (NEB), 20 units T4 polynucleotide kinase (NEB), 30 units T4 DNA polymerase (NEB), 0.2 mM ATP (NEB), and 0.04 mM PCR deoxynucleoside triphosphates (dNTPs) (Promega). .. All P pil :: cat constructs were cloned into pJKD3172, which contains a spectinomycin resistance cassette inserted into a copy of the gonococcal iga gene (Ryan and Davies, unpublished; see Table S1 in the supplemental material). pJKD3172 was linearized by digestion with BglII, blunt ended as described above, and alkaline phosphatase (Boehringer Mannheim) treated.

    Amplification:

    Article Title: A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT
    Article Snippet: A 204 bp fragment of the PA3900 gene was PCR amplified from the same genomic DNA using primers GT049 (CCGCAGGTGGCTGAACA) and GT050 (CGAATGCGGTGCGTTGATGG). .. 400 nM DNA fragment, 4 μL γ-32 P ATP (3,000 Ci/mmol, 10 mCi/mL, Perkin Elmer), 1x polynucleotide kinase buffer and T4 polynucleotide kinase enzyme (New England Biolabs) were incubated in a total of 40 μL at 37°C for 30 min.

    Article Title: Neisserial Correia Repeat-Enclosed Elements Do Not Influence the Transcription of pil Genes in Neisseria gonorrhoeae and Neisseria meningitidis ▿ ▿ †
    Article Snippet: The promoterless cat gene was amplified from pJKD699 ( ) using the appropriate promoter-specific forward P pil :: cat primers and oligonucleotide primer M13RP ( ). .. The DNA in this 40 μl was blunt ended ( ) in a 50-μl reaction mixture containing a final concentration of 1× T4 polynucleotide kinase buffer (NEB), 20 units T4 polynucleotide kinase (NEB), 30 units T4 DNA polymerase (NEB), 0.2 mM ATP (NEB), and 0.04 mM PCR deoxynucleoside triphosphates (dNTPs) (Promega).

    Construct:

    Article Title: Neisserial Correia Repeat-Enclosed Elements Do Not Influence the Transcription of pil Genes in Neisseria gonorrhoeae and Neisseria meningitidis ▿ ▿ †
    Article Snippet: Paragraph title: Construction of promoter:: cat reporter constructs. ... The DNA in this 40 μl was blunt ended ( ) in a 50-μl reaction mixture containing a final concentration of 1× T4 polynucleotide kinase buffer (NEB), 20 units T4 polynucleotide kinase (NEB), 30 units T4 DNA polymerase (NEB), 0.2 mM ATP (NEB), and 0.04 mM PCR deoxynucleoside triphosphates (dNTPs) (Promega).

    Article Title: A microfluidic oligonucleotide synthesizer
    Article Snippet: .. Ligation assembly of DNA constructs Each oligonucleotide strand (8 µl, 5 µM) was mixed with 1 µl of T4 polynucleotide kinase reaction buffer (New England Biolabs) and 1 µl of 10 mM ATP, then cooled to 4°C. ..

    Incubation:

    Article Title: IDH3α regulates one-carbon metabolism in glioblastoma
    Article Snippet: The product band was excised, extracted, and treated with 10 U of T4 PNK (catalog no. M0201, New England Biolabs) in 1× of T4 PNK buffer (catalog no. B0201, New England Biolabs), 1 mM ATP (catalog no. P0756, New England Biolabs), and nuclease-free water (total volume, 50 μl). .. The samples were then incubated at 37°C for 30 min and heat-inactivated at 65°C for 20 min. One microliter of T4 DNA ligase (catalog no. M1804, Promega) was added to the reaction tube.

    Article Title: Detection of circulating extracellular mRNAs by modified small-RNA-sequencing analysis
    Article Snippet: To half of the eluted exRNA, i.e., 14 μl, we added 6 μl of a master mix corresponding to the equivalent of 2 μl ×10 T4 PNK buffer, 2 μl 10 mM ATP, 1 μl RNase-free water, and 1 μl T4 PNK (NEB, catalog M0201S) for a final reaction volume of 20 μl in a 1.5 ml siliconized microcentrifuge tube. .. The reaction was incubated for 30 minutes at 37°C followed by the addition of 40 μl buffer VB2G (for composition see above) and reapplied to the same silica column used for the initial purification.

    Article Title: m6A modification of a 3′ UTR site reduces RME1 mRNA levels to promote meiosis
    Article Snippet: m6 A IP for m6 A-Seq m6 A IP followed the procedure described in refs, , , for three wild-type and three ime4-cat samples with some modifications as follows: mRNA purified as described above from meiotic cells incubated for 5 h in SPO was fragmented using RNA Fragmentation Reagents (Life Technologies) by incubation at 70 °C for 2 min in a total volume of 10 μl. .. Then 0.5 μl Murine RNase inhibitor (NEB #M0314) was added, followed by 2 μl of 10× T4 polynucleotide kinase buffer (PKN, NEB #B0201), 1 μl T4 PKN enzyme (NEB #M0201), and 1 μl TURBO DNAse (Life Technologies).

    Article Title: A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT
    Article Snippet: .. 400 nM DNA fragment, 4 μL γ-32 P ATP (3,000 Ci/mmol, 10 mCi/mL, Perkin Elmer), 1x polynucleotide kinase buffer and T4 polynucleotide kinase enzyme (New England Biolabs) were incubated in a total of 40 μL at 37°C for 30 min. .. The reaction was stopped by the addition of 1 μL of 0.5 M EDTA and excess radioisotopes were removed using a G-25 spin column (GE Healthcare Life Sciences).

    Article Title: Neisserial Correia Repeat-Enclosed Elements Do Not Influence the Transcription of pil Genes in Neisseria gonorrhoeae and Neisseria meningitidis ▿ ▿ †
    Article Snippet: The DNA in this 40 μl was blunt ended ( ) in a 50-μl reaction mixture containing a final concentration of 1× T4 polynucleotide kinase buffer (NEB), 20 units T4 polynucleotide kinase (NEB), 30 units T4 DNA polymerase (NEB), 0.2 mM ATP (NEB), and 0.04 mM PCR deoxynucleoside triphosphates (dNTPs) (Promega). .. The blunt-ending reaction mixture was incubated at 37°C for 1 h and cleaned with a QIAquick PCR Purification Kit (Qiagen).

    Modification:

    Article Title: Txe, an endoribonuclease of the enterococcal Axe-Txe toxin-antitoxin system, cleaves mRNA and inhibits protein synthesis
    Article Snippet: Primer lpp 21 (5′-CTGAACGTCAGAAGACAGCTGATCG-3′) ( ) was 5′-end-labelled with [γ -32 P]ATP according to a modification of the protocol reported by . .. In a 10 μl reaction volume, 10 pmol of the lpp 21 primer was mixed with 1 μl 10× T4 polynucleotide kinase (PNK) reaction buffer (NEB), 1 μl 10 U T4 PNK (NEB) ml−1 and 3 μl [γ -32 P]ATP [6 mCi mmol−1 (222 MBq mmol−1 ), 10 mCi ml−1 (370 MBq ml−1 ) or adjusted appropriately for decay].

    Gel Purification:

    Article Title: Neisserial Correia Repeat-Enclosed Elements Do Not Influence the Transcription of pil Genes in Neisseria gonorrhoeae and Neisseria meningitidis ▿ ▿ †
    Article Snippet: The fusion PCR product was gel purified (QIAquick Gel Purification Kit; Qiagen) into 40 μl water. .. The DNA in this 40 μl was blunt ended ( ) in a 50-μl reaction mixture containing a final concentration of 1× T4 polynucleotide kinase buffer (NEB), 20 units T4 polynucleotide kinase (NEB), 30 units T4 DNA polymerase (NEB), 0.2 mM ATP (NEB), and 0.04 mM PCR deoxynucleoside triphosphates (dNTPs) (Promega).

    Electron Microscopy:

    Article Title: A detailed protocol for subcellular RNA sequencing (subRNA-seq)
    Article Snippet: .. RNase/DNase-free H2 O (Life Technologies, cat. no. 10977-015) Ribo-Zero rRNA Removal Kit (Epicentre, cat. no. MRZH116) 80% (vol/vol) ethanol (VWR, cat. no. V1016) Sodium carbonate anhydrous (VWR, cat. no. M138) Sodium bicarbonate (VWR, cat. no. 3509) EDTA (0.5 M; Life Technologies, cat. no. AM9260G) Isopropanol (Sigma, cat. no. 278475) RNA control ladder (0.1–2 kb; Life Technologies, cat. no. 15623-100) 2x TBU denaturing loading buffer (Life Technologies, cat. no. LC6876) TBE-urea gels, 15% (wt/vol) (Life Technologies, cat. no. EC68852BOX) TBE buffer, 10x (Life Technologies, cat. no. 15581-044) Orange G (Sigma, cat. no. O3756) SYBR Gold Nucleic Acid Gel Stain (10,000x concentrate; Life Technologies, cat. no. S-11494) PEG8000 (part of T4 RNA Ligase 2, truncated, NEB, cat. no. M0242S) DMSO (Sigma, cat. no. D8418) T4 RNA Ligase Buffer, 10x (part of T4 RNA Ligase 2, truncated, NEB, cat. no. M0242S) T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) GlycoBlue (15 mg/ml; Life Technologies, cat. no. AM9515) Sodium acetate, RNase-free (3 M; Life Technologies, cat. no. AM9740) T4 PNK Buffer, 10x (part of T4 Polynucleotide Kinase, NEB, cat. no. M0201S) T4 Polynucleotide Kinase (10,000 U/ml; NEB, cat. no. M0201S) DTT (0.1 M; part of the SuperScript III First-Strand Synthesis System, Life Technologies, cat. no. 18080-051) SUPERase.In (20 U/μl; Life Technologies, cat. no. AM2696) 5x First-Strand Buffer (part of SuperScript III First-Strand Synthesis System, Life Technologies, cat. no. 18080-051) dNTP mix (10 mM; Life Technologies, cat. no. 18427-013) SuperScript III First-Strand Synthesis System (Life Technologies, cat. no. 18080-051) TBE-urea gels, 10% (wt/vol) (Life Technologies, cat. no. EC68752BOX) CircLigase Reaction Buffer, 10x (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K) ATP, 1 mM (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K) MnCl2 , 50 mM (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K) CircLigase ssDNA Ligase (100 U/μl; Epicentre, cat. no. CL4111K) Phusion HF Buffer, 5x (part of Phusion High-Fidelity DNA Polymerase, NEB, cat. no. M0530S) Phusion DNA Polymerase (2,000 U/ml; NEB, cat. no. M0530S) DNA control ladder (10 bp; Life Technologies, cat. no. 10821-015) TBE gels, 8% (wt/vol) (Life Technologies, cat. no. EC62152BOX) Qubit dsDNA HS Assay Kit (Life Technologies, cat. no. ) High Sensitivity DNA Analysis Kit (Agilent Technologies, cat. no. 5067-4626) Scalpels (Electron Microscopy Sciences, cat. no. 72042-11) 20G Needle (BD, cat. no. 305175) Microfuge tube filter: Costar Spin-X centrifuge tube filters (Sigma, cat. no. CLS8162-96EA) CAUTION: Sodium carbonate causes irritations. ..

    Chromatography:

    Article Title: An Evolutionarily Conserved Enhancer Regulates Bmp4 Expression in Developing Incisor and Limb Bud
    Article Snippet: They were then labeled in a 20 µl reaction volume using 20 ng of annealed oligonucleotide in polynucleotide kinase (PNK) buffer (New England BioLabs, Inc., Beverly, MA), 10 units of T4 polynucleotide kinase (New England BioLabs, Beverly, MA) and 5 µCi of γ-32 P-ATP. .. To remove unincorporated oligonucleotides, the labeled probe reactions were loaded onto Micro Bio-Spin P-30 Tris Chromatography columns (Bio-RAD, Hercules, CA) and centrifuged according to the manufacturer’s instructions and diluted with protein binding buffer to ∼2×104 cpm/µg.

    Ligation:

    Article Title: A microfluidic oligonucleotide synthesizer
    Article Snippet: .. Ligation assembly of DNA constructs Each oligonucleotide strand (8 µl, 5 µM) was mixed with 1 µl of T4 polynucleotide kinase reaction buffer (New England Biolabs) and 1 µl of 10 mM ATP, then cooled to 4°C. ..

    other:

    Article Title: The CRISPR-associated Csx1 protein of Pyrococcus furiosus is an adenosine-specific endoribonuclease
    Article Snippet: The oligonucleotides were 5′ end-labeled with T4 polynucleotide kinase (New England Biolabs [NEB]) in a 20 μL reaction containing 20 pmol oligonucleotide, 150 μCi of [γ-32 P] ATP (6000 Ci/mmol; Perkin Elmer), 1× T4 PNK buffer, and 10 U of T4 kinase (NEB).

    Overlap Extension Polymerase Chain Reaction:

    Article Title: Neisserial Correia Repeat-Enclosed Elements Do Not Influence the Transcription of pil Genes in Neisseria gonorrhoeae and Neisseria meningitidis ▿ ▿ †
    Article Snippet: Approximately equal amounts of the promoter fragment and cat fragment were fused using site-overlapping extension (SOE) PCR (25 cycles of 94°C for 1 min, 50°C for 1 min, and 72°C for 2 min, followed by 94°C for 1 min and 72°C for 10 min) ( ). .. The DNA in this 40 μl was blunt ended ( ) in a 50-μl reaction mixture containing a final concentration of 1× T4 polynucleotide kinase buffer (NEB), 20 units T4 polynucleotide kinase (NEB), 30 units T4 DNA polymerase (NEB), 0.2 mM ATP (NEB), and 0.04 mM PCR deoxynucleoside triphosphates (dNTPs) (Promega).

    Polymerase Chain Reaction:

    Article Title: A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT
    Article Snippet: PCR products were 5' end-radiolabeled with γ-32 P ATP using T4 polynucleotide kinase (New England Biolabs). .. 400 nM DNA fragment, 4 μL γ-32 P ATP (3,000 Ci/mmol, 10 mCi/mL, Perkin Elmer), 1x polynucleotide kinase buffer and T4 polynucleotide kinase enzyme (New England Biolabs) were incubated in a total of 40 μL at 37°C for 30 min.

    Article Title: Neisserial Correia Repeat-Enclosed Elements Do Not Influence the Transcription of pil Genes in Neisseria gonorrhoeae and Neisseria meningitidis ▿ ▿ †
    Article Snippet: .. The DNA in this 40 μl was blunt ended ( ) in a 50-μl reaction mixture containing a final concentration of 1× T4 polynucleotide kinase buffer (NEB), 20 units T4 polynucleotide kinase (NEB), 30 units T4 DNA polymerase (NEB), 0.2 mM ATP (NEB), and 0.04 mM PCR deoxynucleoside triphosphates (dNTPs) (Promega). .. The blunt-ending reaction mixture was incubated at 37°C for 1 h and cleaned with a QIAquick PCR Purification Kit (Qiagen).

    Injection:

    Article Title: The Effect of Chemical Modification and Nanoparticle Formulation on Stability and Biodistribution of siRNA in Mice
    Article Snippet: For radioactive labeling siRNA the AS were labeled at the 5′-end in a 100-µl reaction containing ~30 µg single-strand siRNA, 10 µl [γ-32 P] (7,000 Ci/mmol) adenosine triphosphate, 5 µl T4 polynucleotide kinase, and 10 µl polynucleotide kinase reaction buffer (New England Biolabs, Beverly, MA) at 37 °C for 0.5 hours. .. The siRNA was diluted to 10 µg in a final volume of 200-µl 1× phosphate-buffered saline per mouse before injection.

    Size-exclusion Chromatography:

    Article Title: A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT
    Article Snippet: 400 nM DNA fragment, 4 μL γ-32 P ATP (3,000 Ci/mmol, 10 mCi/mL, Perkin Elmer), 1x polynucleotide kinase buffer and T4 polynucleotide kinase enzyme (New England Biolabs) were incubated in a total of 40 μL at 37°C for 30 min. .. Spin column resin was resuspended by vortexing the column upside down for 30 sec.

    Electrophoretic Mobility Shift Assay:

    Article Title: A Novel AT-Rich DNA Recognition Mechanism for Bacterial Xenogeneic Silencer MvaT
    Article Snippet: Paragraph title: Electrophoretic mobility shift assay ... 400 nM DNA fragment, 4 μL γ-32 P ATP (3,000 Ci/mmol, 10 mCi/mL, Perkin Elmer), 1x polynucleotide kinase buffer and T4 polynucleotide kinase enzyme (New England Biolabs) were incubated in a total of 40 μL at 37°C for 30 min.

    Purification:

    Article Title: The Effect of Chemical Modification and Nanoparticle Formulation on Stability and Biodistribution of siRNA in Mice
    Article Snippet: For radioactive labeling siRNA the AS were labeled at the 5′-end in a 100-µl reaction containing ~30 µg single-strand siRNA, 10 µl [γ-32 P] (7,000 Ci/mmol) adenosine triphosphate, 5 µl T4 polynucleotide kinase, and 10 µl polynucleotide kinase reaction buffer (New England Biolabs, Beverly, MA) at 37 °C for 0.5 hours. .. The duplexes were purified on 15% native polyacrylamide gel run at 4 °C, excised by radiography or UV-shadowing, eluted in 0.3 mol/l NaOAc (pH 6.0) overnight at 4 °C, phenol and chloroform extracted, and precipitated with 2½ vol. ethanol.

    Article Title: Detection of circulating extracellular mRNAs by modified small-RNA-sequencing analysis
    Article Snippet: To half of the eluted exRNA, i.e., 14 μl, we added 6 μl of a master mix corresponding to the equivalent of 2 μl ×10 T4 PNK buffer, 2 μl 10 mM ATP, 1 μl RNase-free water, and 1 μl T4 PNK (NEB, catalog M0201S) for a final reaction volume of 20 μl in a 1.5 ml siliconized microcentrifuge tube. .. The reaction was incubated for 30 minutes at 37°C followed by the addition of 40 μl buffer VB2G (for composition see above) and reapplied to the same silica column used for the initial purification.

    Article Title: m6A modification of a 3′ UTR site reduces RME1 mRNA levels to promote meiosis
    Article Snippet: m6 A IP for m6 A-Seq m6 A IP followed the procedure described in refs, , , for three wild-type and three ime4-cat samples with some modifications as follows: mRNA purified as described above from meiotic cells incubated for 5 h in SPO was fragmented using RNA Fragmentation Reagents (Life Technologies) by incubation at 70 °C for 2 min in a total volume of 10 μl. .. Then 0.5 μl Murine RNase inhibitor (NEB #M0314) was added, followed by 2 μl of 10× T4 polynucleotide kinase buffer (PKN, NEB #B0201), 1 μl T4 PKN enzyme (NEB #M0201), and 1 μl TURBO DNAse (Life Technologies).

    Article Title: Neisserial Correia Repeat-Enclosed Elements Do Not Influence the Transcription of pil Genes in Neisseria gonorrhoeae and Neisseria meningitidis ▿ ▿ †
    Article Snippet: The fusion PCR product was gel purified (QIAquick Gel Purification Kit; Qiagen) into 40 μl water. .. The DNA in this 40 μl was blunt ended ( ) in a 50-μl reaction mixture containing a final concentration of 1× T4 polynucleotide kinase buffer (NEB), 20 units T4 polynucleotide kinase (NEB), 30 units T4 DNA polymerase (NEB), 0.2 mM ATP (NEB), and 0.04 mM PCR deoxynucleoside triphosphates (dNTPs) (Promega).

    Sequencing:

    Article Title: Neisserial Correia Repeat-Enclosed Elements Do Not Influence the Transcription of pil Genes in Neisseria gonorrhoeae and Neisseria meningitidis ▿ ▿ †
    Article Snippet: The WT promoter sequence was PCR amplified from the genomic DNA of N. gonorrhoeae strain FA1090, unless otherwise specified. .. The DNA in this 40 μl was blunt ended ( ) in a 50-μl reaction mixture containing a final concentration of 1× T4 polynucleotide kinase buffer (NEB), 20 units T4 polynucleotide kinase (NEB), 30 units T4 DNA polymerase (NEB), 0.2 mM ATP (NEB), and 0.04 mM PCR deoxynucleoside triphosphates (dNTPs) (Promega).

    Labeling:

    Article Title: The Effect of Chemical Modification and Nanoparticle Formulation on Stability and Biodistribution of siRNA in Mice
    Article Snippet: .. For radioactive labeling siRNA the AS were labeled at the 5′-end in a 100-µl reaction containing ~30 µg single-strand siRNA, 10 µl [γ-32 P] (7,000 Ci/mmol) adenosine triphosphate, 5 µl T4 polynucleotide kinase, and 10 µl polynucleotide kinase reaction buffer (New England Biolabs, Beverly, MA) at 37 °C for 0.5 hours. .. The reaction was stopped by adding 1-µl 0.5 mol/l EDTA (pH 8.0) and run through a G50 spin column (Roche, Basel, Switzerland) to remove unincorporated [γ-32 P] adenosine triphosphate, prior to annealing. siRNA duplexes were prepared by annealing equimolar concentrations (20 µmol/l) of the sense and antisense siRNA in 5× annealing buffer (150 mmol/l HEPES, pH 7.6, 500 mmol/l KCl, 0.05 mmol/l MgCl2 ) at 95 °C for 1 minute and at 37 °C for 1 hour.

    Article Title: An Evolutionarily Conserved Enhancer Regulates Bmp4 Expression in Developing Incisor and Limb Bud
    Article Snippet: .. They were then labeled in a 20 µl reaction volume using 20 ng of annealed oligonucleotide in polynucleotide kinase (PNK) buffer (New England BioLabs, Inc., Beverly, MA), 10 units of T4 polynucleotide kinase (New England BioLabs, Beverly, MA) and 5 µCi of γ-32 P-ATP. .. To remove unincorporated oligonucleotides, the labeled probe reactions were loaded onto Micro Bio-Spin P-30 Tris Chromatography columns (Bio-RAD, Hercules, CA) and centrifuged according to the manufacturer’s instructions and diluted with protein binding buffer to ∼2×104 cpm/µg.

    Plasmid Preparation:

    Article Title: IDH3α regulates one-carbon metabolism in glioblastoma
    Article Snippet: These primers were then added at 0.5 μM concentration to 100 ng of IDH3α vector DNA along with 200 μM of deoxynucleotide triphosphate, 1.25 U of PrimeSTAR HS (catalog no. R010A, Takara), and PrimeSTAR 5× Buffer to obtain a 1× final concentration. .. The product band was excised, extracted, and treated with 10 U of T4 PNK (catalog no. M0201, New England Biolabs) in 1× of T4 PNK buffer (catalog no. B0201, New England Biolabs), 1 mM ATP (catalog no. P0756, New England Biolabs), and nuclease-free water (total volume, 50 μl).

    Ethanol Precipitation:

    Article Title: m6A modification of a 3′ UTR site reduces RME1 mRNA levels to promote meiosis
    Article Snippet: Fragmented mRNA was re-suspended following ethanol precipitation in 13.5 μl RNase-free water. .. Then 0.5 μl Murine RNase inhibitor (NEB #M0314) was added, followed by 2 μl of 10× T4 polynucleotide kinase buffer (PKN, NEB #B0201), 1 μl T4 PKN enzyme (NEB #M0201), and 1 μl TURBO DNAse (Life Technologies).

    Concentration Assay:

    Article Title: IDH3α regulates one-carbon metabolism in glioblastoma
    Article Snippet: These primers were then added at 0.5 μM concentration to 100 ng of IDH3α vector DNA along with 200 μM of deoxynucleotide triphosphate, 1.25 U of PrimeSTAR HS (catalog no. R010A, Takara), and PrimeSTAR 5× Buffer to obtain a 1× final concentration. .. The product band was excised, extracted, and treated with 10 U of T4 PNK (catalog no. M0201, New England Biolabs) in 1× of T4 PNK buffer (catalog no. B0201, New England Biolabs), 1 mM ATP (catalog no. P0756, New England Biolabs), and nuclease-free water (total volume, 50 μl).

    Article Title: Txe, an endoribonuclease of the enterococcal Axe-Txe toxin-antitoxin system, cleaves mRNA and inhibits protein synthesis
    Article Snippet: In a 10 μl reaction volume, 10 pmol of the lpp 21 primer was mixed with 1 μl 10× T4 polynucleotide kinase (PNK) reaction buffer (NEB), 1 μl 10 U T4 PNK (NEB) ml−1 and 3 μl [γ -32 P]ATP [6 mCi mmol−1 (222 MBq mmol−1 ), 10 mCi ml−1 (370 MBq ml−1 ) or adjusted appropriately for decay]. .. The final concentration of the end-labelled primer was adjusted to 100 fmol μl−1 with RNase-free dH2 O.

    Article Title: Neisserial Correia Repeat-Enclosed Elements Do Not Influence the Transcription of pil Genes in Neisseria gonorrhoeae and Neisseria meningitidis ▿ ▿ †
    Article Snippet: .. The DNA in this 40 μl was blunt ended ( ) in a 50-μl reaction mixture containing a final concentration of 1× T4 polynucleotide kinase buffer (NEB), 20 units T4 polynucleotide kinase (NEB), 30 units T4 DNA polymerase (NEB), 0.2 mM ATP (NEB), and 0.04 mM PCR deoxynucleoside triphosphates (dNTPs) (Promega). .. The blunt-ending reaction mixture was incubated at 37°C for 1 h and cleaned with a QIAquick PCR Purification Kit (Qiagen).

    Protein Binding:

    Article Title: An Evolutionarily Conserved Enhancer Regulates Bmp4 Expression in Developing Incisor and Limb Bud
    Article Snippet: They were then labeled in a 20 µl reaction volume using 20 ng of annealed oligonucleotide in polynucleotide kinase (PNK) buffer (New England BioLabs, Inc., Beverly, MA), 10 units of T4 polynucleotide kinase (New England BioLabs, Beverly, MA) and 5 µCi of γ-32 P-ATP. .. To remove unincorporated oligonucleotides, the labeled probe reactions were loaded onto Micro Bio-Spin P-30 Tris Chromatography columns (Bio-RAD, Hercules, CA) and centrifuged according to the manufacturer’s instructions and diluted with protein binding buffer to ∼2×104 cpm/µg.

    Staining:

    Article Title: A detailed protocol for subcellular RNA sequencing (subRNA-seq)
    Article Snippet: .. RNase/DNase-free H2 O (Life Technologies, cat. no. 10977-015) Ribo-Zero rRNA Removal Kit (Epicentre, cat. no. MRZH116) 80% (vol/vol) ethanol (VWR, cat. no. V1016) Sodium carbonate anhydrous (VWR, cat. no. M138) Sodium bicarbonate (VWR, cat. no. 3509) EDTA (0.5 M; Life Technologies, cat. no. AM9260G) Isopropanol (Sigma, cat. no. 278475) RNA control ladder (0.1–2 kb; Life Technologies, cat. no. 15623-100) 2x TBU denaturing loading buffer (Life Technologies, cat. no. LC6876) TBE-urea gels, 15% (wt/vol) (Life Technologies, cat. no. EC68852BOX) TBE buffer, 10x (Life Technologies, cat. no. 15581-044) Orange G (Sigma, cat. no. O3756) SYBR Gold Nucleic Acid Gel Stain (10,000x concentrate; Life Technologies, cat. no. S-11494) PEG8000 (part of T4 RNA Ligase 2, truncated, NEB, cat. no. M0242S) DMSO (Sigma, cat. no. D8418) T4 RNA Ligase Buffer, 10x (part of T4 RNA Ligase 2, truncated, NEB, cat. no. M0242S) T4 RNA Ligase 2, truncated (NEB, cat. no. M0242S) GlycoBlue (15 mg/ml; Life Technologies, cat. no. AM9515) Sodium acetate, RNase-free (3 M; Life Technologies, cat. no. AM9740) T4 PNK Buffer, 10x (part of T4 Polynucleotide Kinase, NEB, cat. no. M0201S) T4 Polynucleotide Kinase (10,000 U/ml; NEB, cat. no. M0201S) DTT (0.1 M; part of the SuperScript III First-Strand Synthesis System, Life Technologies, cat. no. 18080-051) SUPERase.In (20 U/μl; Life Technologies, cat. no. AM2696) 5x First-Strand Buffer (part of SuperScript III First-Strand Synthesis System, Life Technologies, cat. no. 18080-051) dNTP mix (10 mM; Life Technologies, cat. no. 18427-013) SuperScript III First-Strand Synthesis System (Life Technologies, cat. no. 18080-051) TBE-urea gels, 10% (wt/vol) (Life Technologies, cat. no. EC68752BOX) CircLigase Reaction Buffer, 10x (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K) ATP, 1 mM (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K) MnCl2 , 50 mM (part of CircLigase ssDNA Ligase, Epicentre, cat. no. CL4111K) CircLigase ssDNA Ligase (100 U/μl; Epicentre, cat. no. CL4111K) Phusion HF Buffer, 5x (part of Phusion High-Fidelity DNA Polymerase, NEB, cat. no. M0530S) Phusion DNA Polymerase (2,000 U/ml; NEB, cat. no. M0530S) DNA control ladder (10 bp; Life Technologies, cat. no. 10821-015) TBE gels, 8% (wt/vol) (Life Technologies, cat. no. EC62152BOX) Qubit dsDNA HS Assay Kit (Life Technologies, cat. no. ) High Sensitivity DNA Analysis Kit (Agilent Technologies, cat. no. 5067-4626) Scalpels (Electron Microscopy Sciences, cat. no. 72042-11) 20G Needle (BD, cat. no. 305175) Microfuge tube filter: Costar Spin-X centrifuge tube filters (Sigma, cat. no. CLS8162-96EA) CAUTION: Sodium carbonate causes irritations. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs t4 pnk buffer
    Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and <t>T4</t> PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.
    T4 Pnk Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 pnk buffer/product/New England Biolabs
    Average 90 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    t4 pnk buffer - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results


    Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.

    Journal: Molecular Therapy. Nucleic Acids

    Article Title: A Simple and Cost-Effective Approach for In Vitro Production of Sliced siRNAs as Potent Triggers for RNAi

    doi: 10.1016/j.omtn.2017.07.008

    Figure Lengend Snippet: Manipulation of 5′ppp-Triggered Interferon Response HEK293 cells were transfected with poly(I:C) or several tsli-siRNAs. The final concentration of 10 nM for each RNAi reagent was used in transfection for qPCR assay. Gene expression level changes in OAS1, IRF9, CDKL, and IFNB relative to GAPDH were measured by qPCR. (A) Mild interferon response was observed from all four tsli-siRNAs, with tsli-RRM2 having the strongest response among them. G-tsli-Stat3 exhibited a much stronger response than tsli-Stat3, and GG-tsli-Stat3 reversed this effect to some extent. (B) CIP treatment minimized the strong interferon response by G-tsli-Stat3. (C) CIP treatment minimized and T4 PNK treatment elevated the interferon response by tsli-RRM2. Fold changes in gene expression were normalized to untreated HEK293 cells. Details of qPCR procedure and results calculation were provided in the Materials and Methods . Error bars indicate SD.

    Article Snippet: The protocol was modified as follows when CIP or T4 PNK treatment is necessary: (1) for CIP treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of CIP, 4 μL of 10× CutSmart buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min; and (2) for T4 PNK treatment, in 20 μL of products from one in vitro transcription reaction before DNase treatment, we added 1 μL of DNase (supplied with T7 Transcription Kit), 1 μL of T4 PNK, 4 μL of 10× T4 PNK buffer (NEB), and water to total volume of 40 μL, and incubated at 37°C for 15 min. All T7 in vitro transcription products were purified by Micro Bio-Spin P-30 Gel Columns, Tris Buffer, from Bio-Rad.

    Techniques: Transfection, Concentration Assay, Real-time Polymerase Chain Reaction, Expressing

    Read distribution of ex‑mRNA reads across the full-length mRNA transcripts. ( A and B ) Read coverage for the hemoglobin A2 transcript ( A ) and the albumin transcript ( B ) by sample type for untreated and T4 PNK end-treated samples. Exon boundaries (HBA2: 3 exons, ALB: 15 exons) are indicated by alternating intensities of gray, and UTRs are distinguished from CDS by thinner bars. ( C ) Metagene analysis with relative read coverage (percentage) across 5′ UTRs, CDSs, and 3′ UTRs for untreated and PNK-treated samples as well as corresponding data obtained after 100 random simulations (across an average of 2342–3500 captured transcripts for untreated samples and an average of 12,789–16,487 captured transcripts for PNK-treated samples, depending on sample type). Shown are results from n = 6 individual samples per condition.

    Journal: JCI Insight

    Article Title: Detection of circulating extracellular mRNAs by modified small-RNA-sequencing analysis

    doi: 10.1172/jci.insight.127317

    Figure Lengend Snippet: Read distribution of ex‑mRNA reads across the full-length mRNA transcripts. ( A and B ) Read coverage for the hemoglobin A2 transcript ( A ) and the albumin transcript ( B ) by sample type for untreated and T4 PNK end-treated samples. Exon boundaries (HBA2: 3 exons, ALB: 15 exons) are indicated by alternating intensities of gray, and UTRs are distinguished from CDS by thinner bars. ( C ) Metagene analysis with relative read coverage (percentage) across 5′ UTRs, CDSs, and 3′ UTRs for untreated and PNK-treated samples as well as corresponding data obtained after 100 random simulations (across an average of 2342–3500 captured transcripts for untreated samples and an average of 12,789–16,487 captured transcripts for PNK-treated samples, depending on sample type). Shown are results from n = 6 individual samples per condition.

    Article Snippet: To half of the eluted exRNA, i.e., 14 μl, we added 6 μl of a master mix corresponding to the equivalent of 2 μl ×10 T4 PNK buffer, 2 μl 10 mM ATP, 1 μl RNase-free water, and 1 μl T4 PNK (NEB, catalog M0201S) for a final reaction volume of 20 μl in a 1.5 ml siliconized microcentrifuge tube.

    Techniques:

    Treatment of total extracellular RNA with T4 polynucleotide kinase followed by small-RNA-sequencing. ( A ) Total RNA was isolated from 450 μl serum or platelet-depleted EDTA, acid citrate dextrose (ACD), and heparin plasma from 6 healthy individuals and purified using silica-based spin columns. Half of the RNA was treated with T4 polynucleotide kinase (T4 PNK) and repurified (PNK treated), and multiplexed small-RNA-sequencing (sRNA-seq) libraries were prepared separately for the untreated (libraries 1 and 3) and PNK-treated RNA (libraries 2 and 4). ( B ) Differences in read annotation in the 4 sample types for untreated RNA and PNK-treated RNA using initial annotation settings (reads 12–42 nt, up to 2 mismatches, multimapping). ( C ) Differences in ex‑mRNA capture between untreated and PNK-treated RNA using final annotation criteria (reads  > 15 nt, no mismatch and up to 2 mapping locations). Box plots show the median and first and third quartiles (bottom and top hinges). Whiskers extend at most ×1.5 interquartile range from the hinges; any data outside this are shown as individual outlier points. Shown are results from  n  = 6 individual samples per condition.

    Journal: JCI Insight

    Article Title: Detection of circulating extracellular mRNAs by modified small-RNA-sequencing analysis

    doi: 10.1172/jci.insight.127317

    Figure Lengend Snippet: Treatment of total extracellular RNA with T4 polynucleotide kinase followed by small-RNA-sequencing. ( A ) Total RNA was isolated from 450 μl serum or platelet-depleted EDTA, acid citrate dextrose (ACD), and heparin plasma from 6 healthy individuals and purified using silica-based spin columns. Half of the RNA was treated with T4 polynucleotide kinase (T4 PNK) and repurified (PNK treated), and multiplexed small-RNA-sequencing (sRNA-seq) libraries were prepared separately for the untreated (libraries 1 and 3) and PNK-treated RNA (libraries 2 and 4). ( B ) Differences in read annotation in the 4 sample types for untreated RNA and PNK-treated RNA using initial annotation settings (reads 12–42 nt, up to 2 mismatches, multimapping). ( C ) Differences in ex‑mRNA capture between untreated and PNK-treated RNA using final annotation criteria (reads > 15 nt, no mismatch and up to 2 mapping locations). Box plots show the median and first and third quartiles (bottom and top hinges). Whiskers extend at most ×1.5 interquartile range from the hinges; any data outside this are shown as individual outlier points. Shown are results from n = 6 individual samples per condition.

    Article Snippet: To half of the eluted exRNA, i.e., 14 μl, we added 6 μl of a master mix corresponding to the equivalent of 2 μl ×10 T4 PNK buffer, 2 μl 10 mM ATP, 1 μl RNase-free water, and 1 μl T4 PNK (NEB, catalog M0201S) for a final reaction volume of 20 μl in a 1.5 ml siliconized microcentrifuge tube.

    Techniques: RNA Sequencing Assay, Isolation, Purification

    Endonucleolytically cleaved 5′-OH RNAs are phosphorylated by Trl1. a 8% PAGE followed by northern blot analysis using probe prA. Levels of 3′-NGD RNA fragments in trl1/dom34 cells compared with those from TRL1/dom34 cells. b B1 and B4 RNA quantification relative to 5S rRNA from three independent experiments as shown in a . c 12% PAGE followed by northern blot analysis using probe prA. Treatment using T4 PNK to determine 5’-OH and 5’-P B4 RNA positions in the indicated strains. One-fourth of trl1/dom34 total RNA treated was loaded to limit scan saturation and allow TRL1/dom34 B4 RNA detection. The 5S rRNA served as a loading control. d As in Fig. 3a , Xrn1 digestion of total RNA extracts from trl1/dom34 mutant cells in the presence or absence of T4 PNK treatment in vitro. A minor band detected in trl1 is indicated by an asterisk (see also Supplementary Fig. 5 in which this band is detectable in TRL1 cells). Error bars indicate standard deviation (s.d.) calculated from three independent experiments. Source data are provided as a Source Data file.

    Journal: Nature Communications

    Article Title: No-Go Decay mRNA cleavage in the ribosome exit tunnel produces 5′-OH ends phosphorylated by Trl1

    doi: 10.1038/s41467-019-13991-9

    Figure Lengend Snippet: Endonucleolytically cleaved 5′-OH RNAs are phosphorylated by Trl1. a 8% PAGE followed by northern blot analysis using probe prA. Levels of 3′-NGD RNA fragments in trl1/dom34 cells compared with those from TRL1/dom34 cells. b B1 and B4 RNA quantification relative to 5S rRNA from three independent experiments as shown in a . c 12% PAGE followed by northern blot analysis using probe prA. Treatment using T4 PNK to determine 5’-OH and 5’-P B4 RNA positions in the indicated strains. One-fourth of trl1/dom34 total RNA treated was loaded to limit scan saturation and allow TRL1/dom34 B4 RNA detection. The 5S rRNA served as a loading control. d As in Fig. 3a , Xrn1 digestion of total RNA extracts from trl1/dom34 mutant cells in the presence or absence of T4 PNK treatment in vitro. A minor band detected in trl1 is indicated by an asterisk (see also Supplementary Fig. 5 in which this band is detectable in TRL1 cells). Error bars indicate standard deviation (s.d.) calculated from three independent experiments. Source data are provided as a Source Data file.

    Article Snippet: NEB Buffer 3 was replaced by T4 PNK buffer (NEB) in kinase assays in the presence or absence of Xrn1 (Figs. a and ).

    Techniques: Polyacrylamide Gel Electrophoresis, Northern Blot, RNA Detection, Mutagenesis, In Vitro, Standard Deviation