Structured Review

TaKaRa t4 ligase
T4 Ligase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 75 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 ligase/product/TaKaRa
Average 95 stars, based on 75 article reviews
Price from $9.99 to $1999.99
t4 ligase - by Bioz Stars, 2019-12
95/100 stars

Images

Related Articles

Clone Assay:

Article Title: Nuclear envelope-distributed CD147 interacts with and inhibits the transcriptional function of RING1 and promotes melanoma cell motility
Article Snippet: Paragraph title: PCR and cloning ... Both PCR products and plasmids were recovered from 1.5% agarose gels and ligated using T4 ligase (Takara Bio, Otsu, Japan) to yield pcDNA4ToA- CD147 and pcDNA3ToA- RING1.

Article Title: Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: The cassette was then digested using Hind III and Eco RI, after which it was cloned into Eco RI–Hind III-digested pSA to generate pSAPDK. .. Genomic DNA was then digested by restriction enzyme Hind III, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: The tmcI’ fragment, digested using Bam HI and Hind III, was cloned into modified pSBAC to generate pSATNI. .. Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: The tumor marker Fascin is induced by the Epstein-Barr virus-encoded oncoprotein LMP1 via NF-κB in lymphocytes and contributes to their invasive migration
Article Snippet: They contained (5′ to 3′) a Bam HI site, the respective siRNA sequence (bold), a loop region, the complementary siRNA sequence (bold), an RNA polymerase III termination sequence, an Mlu I restriction enzyme site (italicized), and an Eco RI cloning site (shFascin4-fwd: 5′-gatccG CAAAGACTCCACAGGCAAA TTCAAGAGA TTTGCCTGTGGAGTCTTTG TTTTTTACGCGT g-3′; shFascin4-rev: 5′-aattcACGCGT AAAAAA CAAAGACTCCACAGGCAAA TCTCTTGAA TTTGCCTGTGGAGTCTTTGC g-3′) Oligonucleotides were annealed in 10 mM Tris and 20 mM NaCl (pH 7.6) by heating to 95°C for 2 min followed by cooling to room temperature. .. Double-stranded oligonucleotides were thereafter inserted into the retroviral vector pSiren-IRES-EGFP-shNonsense (shNon) [[ ]] using T4 ligase (DNA Ligation kit , TaKaRa Biomedicals, Gennevilliers, France) after removal of the shNon fragment via Bam HI and Eco RI restriction sites.

Article Title: PES1 promotes the occurrence and development of papillary thyroid cancer by upregulating the ERα/ERβ protein ratio
Article Snippet: The underlined, boldface and italic letters denote the hairpin loop, terminal signal and target sites of BamHI and HindIII restriction enzymes, respectively. .. These shRNA sequences were digested with BamHI and HindIII restriction enzymes (Takara Biotechnology Co., Ltd., Dalian, China) and cloned into the pRNAT-U6.1/neo vector with T4 ligase (Takara). .. The resulting constructs were verified by direct sequencing (Sangon Biotech Co., Ltd., Shanghai, China).

Article Title: Engineering Corynebacterium glutamicum triggers glutamic acid accumulation in biotin-rich corn stover hydrolysate
Article Snippet: DNA polymerase and T4 ligase were purchased from Takara, Otsu, Japan. .. DNA polymerase and T4 ligase were purchased from Takara, Otsu, Japan.

Luciferase:

Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
Article Snippet: Paragraph title: Luciferase reporter assay ... This was followed by ligation of either WT or MT inserts using T4 Ligase (Takara Shuzo Co. Ltd., Kyoto, Japan).

Reporter Assay:

Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
Article Snippet: Paragraph title: Luciferase reporter assay ... This was followed by ligation of either WT or MT inserts using T4 Ligase (Takara Shuzo Co. Ltd., Kyoto, Japan).

Mass Spectrometry:

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: The desired mutant (named CK4412-2XB) was selected on kanamycin-included MS agar medium, and its genotypes were verified using PCR. .. Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

DNA Ligation:

Article Title: The tumor marker Fascin is induced by the Epstein-Barr virus-encoded oncoprotein LMP1 via NF-κB in lymphocytes and contributes to their invasive migration
Article Snippet: They contained (5′ to 3′) a Bam HI site, the respective siRNA sequence (bold), a loop region, the complementary siRNA sequence (bold), an RNA polymerase III termination sequence, an Mlu I restriction enzyme site (italicized), and an Eco RI cloning site (shFascin4-fwd: 5′-gatccG CAAAGACTCCACAGGCAAA TTCAAGAGA TTTGCCTGTGGAGTCTTTG TTTTTTACGCGT g-3′; shFascin4-rev: 5′-aattcACGCGT AAAAAA CAAAGACTCCACAGGCAAA TCTCTTGAA TTTGCCTGTGGAGTCTTTGC g-3′) Oligonucleotides were annealed in 10 mM Tris and 20 mM NaCl (pH 7.6) by heating to 95°C for 2 min followed by cooling to room temperature. .. Double-stranded oligonucleotides were thereafter inserted into the retroviral vector pSiren-IRES-EGFP-shNonsense (shNon) [[ ]] using T4 ligase (DNA Ligation kit , TaKaRa Biomedicals, Gennevilliers, France) after removal of the shNon fragment via Bam HI and Eco RI restriction sites. .. The resulting shRNA expression plasmid was called pSiren-IRES-EGFP-shFascin4 (target at position +1407 of the Fascin coding sequence, gene bank accession number NM_003088).

Synthesized:

Article Title: Antifibrotic Effect of Smad Decoy Oligodeoxynucleotide in a CCl4-Induced Hepatic Fibrosis Animal Model
Article Snippet: Decoy ODNs were synthesized by Macrogen (Seoul, Korea). .. To obtain a covalent ligation for ring-type decoy ODN molecules, each decoy ODN was mixed with T4 ligase (Takara Bio, Otsu, Japan) and incubated at 16 °C for 18 h.

Article Title: Anti-fibrotic Effects of Synthetic Oligodeoxynucleotide for TGF-β1 and Smad in an Animal Model of Liver Cirrhosis
Article Snippet: Synthetic ODNs were synthesized on a macrogen. .. To obtain a covalent ligation for ring-type ODN, each ODN was mixed with T4 ligase (Takara Bio) and incubated for 18 hr at 16°C.

Article Title: Extraordinary Mechanical Properties of Composite Silk Through Hereditable Transgenic Silkworm Expressing Recombinant Major Ampullate Spidroin
Article Snippet: The sequence of the signal peptide of silkworm Fib -H , two sequential typical repetitive units of MaSp1 or three sequential typical repetitive units of MaSp2 , the C-terminal domain (CTD) of the MaSp1 or MaSp2 , and the partial C-terminal domain (CTD), as well as the polyA signal of the Fib -H gene were synthesized (GENEWIZ, China) and then sub-cloned into the pUC57 vector to generate intermediate pUC57-MaSp1 or pUC57-MaSp2 vectors, which carried Nco І, Spe І, Nhe І and Hind III restriction sites (Fig. , Supplementary Fig. ). .. The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China).

Construct:

Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
Article Snippet: This was followed by ligation of either WT or MT inserts using T4 Ligase (Takara Shuzo Co. Ltd., Kyoto, Japan). .. This was followed by ligation of either WT or MT inserts using T4 Ligase (Takara Shuzo Co. Ltd., Kyoto, Japan).

Article Title: Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: Genomic DNA was then digested by restriction enzyme Hind III, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa). .. Recombinants were selected on apramycin- and kanamycin-containing LB medium, after which plasmids were isolated by alkali denaturation and screened by PCR using PikRI-AI, PikAII, PikD and PikD-kan check primers in pikromycin cluster to identify pPik.

Article Title: Asymmetric diversification of mating pheromones in fission yeast
Article Snippet: The amplified PCR products were subjected to Dpn I treatment and 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa), ligated by T4 ligase (TaKaRa), and transformed into Escherichia coli (DH5α). .. All plasmids carrying 4-repeat Map2 ORFs were then constructed, as described above.

Article Title: The tumor marker Fascin is induced by the Epstein-Barr virus-encoded oncoprotein LMP1 via NF-κB in lymphocytes and contributes to their invasive migration
Article Snippet: For knock-down of Fascin by RNA interference (RNAi), the retroviral shRNA expression vectors pSiren-IRES-EGFP-shFascin5 (shFascin5) [[ ]], and pSiren-IRES-EGFP-shFascin4 (shFascin4) were constructed. .. Double-stranded oligonucleotides were thereafter inserted into the retroviral vector pSiren-IRES-EGFP-shNonsense (shNon) [[ ]] using T4 ligase (DNA Ligation kit , TaKaRa Biomedicals, Gennevilliers, France) after removal of the shNon fragment via Bam HI and Eco RI restriction sites.

Incubation:

Article Title: Antifibrotic Effect of Smad Decoy Oligodeoxynucleotide in a CCl4-Induced Hepatic Fibrosis Animal Model
Article Snippet: These decoy ODNs were predicted to form a hair-pin structure ( ). .. To obtain a covalent ligation for ring-type decoy ODN molecules, each decoy ODN was mixed with T4 ligase (Takara Bio, Otsu, Japan) and incubated at 16 °C for 18 h. .. Animal protocols were approved by the Institutional Animal Care and Use Committee of the Catholic University of Daegu (EXP-IRB number: 2014-0001-CU-AEC-04-A).

Article Title: Anti-fibrotic Effects of Synthetic Oligodeoxynucleotide for TGF-β1 and Smad in an Animal Model of Liver Cirrhosis
Article Snippet: TGF-β1/Smad ODN and Scr ODN were annealed for 6 hr, while thetemperature was decreased from 80°C to 25°C. .. To obtain a covalent ligation for ring-type ODN, each ODN was mixed with T4 ligase (Takara Bio) and incubated for 18 hr at 16°C. .. AML12 cells, the murine hepatocyte cell line, were obtained from the American Type Culture Collection (ATCC).

Article Title: Effects of Smad decoy ODN on shear stress-induced atherosclerotic ApoE-/-mouse
Article Snippet: The Smad decoy ODN was predicted to form a stem-loop structure. .. Following the addition of T4 ligase (1U, Takara, Japan), the mixture was incubated for 18 hours at 16°C to generate a covalently ligated ring-type decoy molecule ( ). .. We first examined the effect of western diet and cast placement on the development of atherosclerosis.

Amplification:

Article Title: Nuclear envelope-distributed CD147 interacts with and inhibits the transcriptional function of RING1 and promotes melanoma cell motility
Article Snippet: Deletion mutants of CD147 and the full length (FL) RING1 promoter were amplified by PCR.The pcDNA4ToA and pcDNA3ToA plasmids (Promega, WI, USA) were double digested with the same restriction enzymes. .. Both PCR products and plasmids were recovered from 1.5% agarose gels and ligated using T4 ligase (Takara Bio, Otsu, Japan) to yield pcDNA4ToA- CD147 and pcDNA3ToA- RING1.

Article Title: Functional Identification of Compound Heterozygous Mutations in the CYP17A1 Gene Resulting in Combined 17α-Hydroxylase/17,20-Lyase Deficiency
Article Snippet: The WT CYP17A1 gene was amplified from control complementary DNA (cDNA) using Phusion DNA polymerase (Finnzymes Oy, Espoo, Finland). .. The PCR fragments were ligated with T4 ligase (TaKaRa, Kyoto, Japan) between the HindIII and KpnI sites of pcDNA3 vector with a C-terminal flag tag ( ).

Article Title: Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: The amplified PCR product was ligated into a T & A cloning vector (RBC), after which the ligated vector was sequenced to confirm its integrity (Macrogen, Korea). .. Genomic DNA was then digested by restriction enzyme Hind III, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Asymmetric diversification of mating pheromones in fission yeast
Article Snippet: To generate pTS54, pTS55, pTS145, pTS146, and pTS233, inverse PCR was carried out using pTS10 and the primer sets oTS202/203, oTS204/205, oTS401/402, oTS403/404, and oTS204/404, respectively. .. The amplified PCR products were subjected to Dpn I treatment and 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa), ligated by T4 ligase (TaKaRa), and transformed into Escherichia coli (DH5α). .. All plasmids carrying 4-repeat Map2 ORFs were then constructed, as described above.

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa). .. Plasmids were isolated by alkali denaturation and screened by PCR using randomly selected primers within the tmc cluster to identify pTMC.

Article Title: Extraordinary Mechanical Properties of Composite Silk Through Hereditable Transgenic Silkworm Expressing Recombinant Major Ampullate Spidroin
Article Snippet: The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China). .. The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China).

Activity Assay:

Article Title: Engineering Corynebacterium glutamicum triggers glutamic acid accumulation in biotin-rich corn stover hydrolysate
Article Snippet: The filter paper activity was determined to be 203.2 FPU/mL according to NREL protocol LAP-006 [ ]; cellobiase activity was determined to be 4900 CBU/mL according to the method reported previously [ ]. .. DNA polymerase and T4 ligase were purchased from Takara, Otsu, Japan.

In Silico:

Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
Article Snippet: The complementary target site for miR-182 on CLDN1 3′UTR, predicted using in silico analysis, was flanked by sticky ended 5′SacI and 3′XbaI restriction sites to form the wild-type (WT) insert, or the binding site was deleted to form the mutant type insert (MT). pmirGLO was double digested using XbaI and SacI (Thermo Scientific; Waltham, MA, USA) restriction enzymes. .. This was followed by ligation of either WT or MT inserts using T4 Ligase (Takara Shuzo Co. Ltd., Kyoto, Japan).

Expressing:

Article Title: Functional Identification of Compound Heterozygous Mutations in the CYP17A1 Gene Resulting in Combined 17α-Hydroxylase/17,20-Lyase Deficiency
Article Snippet: Paragraph title: Construction of CYP17A1 expression vectors ... The PCR fragments were ligated with T4 ligase (TaKaRa, Kyoto, Japan) between the HindIII and KpnI sites of pcDNA3 vector with a C-terminal flag tag ( ).

Article Title: Isolation and biochemical characterization of a metagenome-derived 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase gene from subtropical marine mangrove wetland sediments
Article Snippet: The PCR program was as follows: 30 cycles at 98 °C for 10 s and at 68 °C for 60 s. The PCR product (Additional file : Fig. S2) was purified after being digested with Hin dIII and Xho I at 37 °C for 3 h. The purified product was ligated to the Hin dIII and Xho I double-digested vector pET-30a(+) with T4 ligase (Takara). .. The corresponding recombinant plasmid was transformed into competent E. coli Rosetta (DE3) cells.

Article Title: Extraordinary Mechanical Properties of Composite Silk Through Hereditable Transgenic Silkworm Expressing Recombinant Major Ampullate Spidroin
Article Snippet: The codon of the typical repetitive unit sequences of MaSp1 and MaSp2 were optimized according to codon usage in B . mori to ensure a high level of expression of re-MaSp1 and re-MaSp2 in B . mori . .. The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China).

Article Title: The tumor marker Fascin is induced by the Epstein-Barr virus-encoded oncoprotein LMP1 via NF-κB in lymphocytes and contributes to their invasive migration
Article Snippet: Paragraph title: Construction of shRNA expression vectors ... Double-stranded oligonucleotides were thereafter inserted into the retroviral vector pSiren-IRES-EGFP-shNonsense (shNon) [[ ]] using T4 ligase (DNA Ligation kit , TaKaRa Biomedicals, Gennevilliers, France) after removal of the shNon fragment via Bam HI and Eco RI restriction sites.

Article Title: PES1 promotes the occurrence and development of papillary thyroid cancer by upregulating the ERα/ERβ protein ratio
Article Snippet: Paragraph title: Construction of shRNA expression vectors for PES1, ERα and ERβ ... These shRNA sequences were digested with BamHI and HindIII restriction enzymes (Takara Biotechnology Co., Ltd., Dalian, China) and cloned into the pRNAT-U6.1/neo vector with T4 ligase (Takara).

Modification:

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: The tmcI’ fragment, digested using Bam HI and Hind III, was cloned into modified pSBAC to generate pSATNI. .. Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Electroporation:

Article Title: Heterosubtypic protective immunity against widely divergent influenza subtypes induced by fusion protein 4sM2 in BALB/c mice
Article Snippet: The pRSET A vector and sM2 insert (sense 2) were ligated with T4 ligase (TaKaRa Bio, Seoul, Korea) at 16°C for 4 h. Sense 1 for sM2 was fused to sense 2 to produce 2sM2. .. Consequently, 4sM2 was produced by combining 2sM2 (sense 1) to 2sM2 (sense 2).

Transformation Assay:

Article Title: Isolation and biochemical characterization of a metagenome-derived 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase gene from subtropical marine mangrove wetland sediments
Article Snippet: The PCR program was as follows: 30 cycles at 98 °C for 10 s and at 68 °C for 60 s. The PCR product (Additional file : Fig. S2) was purified after being digested with Hin dIII and Xho I at 37 °C for 3 h. The purified product was ligated to the Hin dIII and Xho I double-digested vector pET-30a(+) with T4 ligase (Takara). .. The recombinant plasmid pET-30a(+)-aro1A was confirmed by double digestion with Hin dIII and Xho I (Additional file : Fig. S3) and was sequenced by Sangon Biotech (Shanghai).

Article Title: Asymmetric diversification of mating pheromones in fission yeast
Article Snippet: To generate pTS54, pTS55, pTS145, pTS146, and pTS233, inverse PCR was carried out using pTS10 and the primer sets oTS202/203, oTS204/205, oTS401/402, oTS403/404, and oTS204/404, respectively. .. The amplified PCR products were subjected to Dpn I treatment and 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa), ligated by T4 ligase (TaKaRa), and transformed into Escherichia coli (DH5α). .. All plasmids carrying 4-repeat Map2 ORFs were then constructed, as described above.

Article Title: Heterosubtypic protective immunity against widely divergent influenza subtypes induced by fusion protein 4sM2 in BALB/c mice
Article Snippet: The pRSET A vector and sM2 insert (sense 2) were ligated with T4 ligase (TaKaRa Bio, Seoul, Korea) at 16°C for 4 h. Sense 1 for sM2 was fused to sense 2 to produce 2sM2. .. Consequently, 4sM2 was produced by combining 2sM2 (sense 1) to 2sM2 (sense 2).

Over Expression:

Article Title: Isolation and biochemical characterization of a metagenome-derived 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase gene from subtropical marine mangrove wetland sediments
Article Snippet: Paragraph title: Overexpression and purification of the recombinant DAHPS protein ... The PCR program was as follows: 30 cycles at 98 °C for 10 s and at 68 °C for 60 s. The PCR product (Additional file : Fig. S2) was purified after being digested with Hin dIII and Xho I at 37 °C for 3 h. The purified product was ligated to the Hin dIII and Xho I double-digested vector pET-30a(+) with T4 ligase (Takara).

Derivative Assay:

Article Title: Asymmetric diversification of mating pheromones in fission yeast
Article Snippet: The amplified PCR products were subjected to Dpn I treatment and 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa), ligated by T4 ligase (TaKaRa), and transformed into Escherichia coli (DH5α). .. To construct plasmids carrying two tandem map2 genes with 4 repeats, the map2 gene (approximately 2.6 kb) containing the promoter and terminator regions was amplified from the appropriate plasmid (pTS59, pTS48, pTS60, pTS147, pTS148, and pTS239) using the primer set oTS887/888.

Article Title: Extraordinary Mechanical Properties of Composite Silk Through Hereditable Transgenic Silkworm Expressing Recombinant Major Ampullate Spidroin
Article Snippet: A series of piggy Bac vectors containing 2, 12 or 16 times the number of typical repetitive units in MaSp1 or 24 times the number of typical repetitive units of MaSp2 derived from the black widow spider, L . hesperus , were designed. .. The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China).

High Performance Liquid Chromatography:

Article Title: Improving squalene production by enhancing the NADPH/NADP+ ratio, modifying the isoprenoid-feeding module and blocking the menaquinone pathway in Escherichia coli
Article Snippet: Restriction enzymes, Taq polymerase and T4 ligase were purchased from Takara (Dalian City, China). .. Gel extraction kit, PCR purification kit and plasmid purification kit were purchased from QIAGEN (Hilden, Germany).

Conjugation Assay:

Article Title: Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: Conjugation was subsequently performed to integrate pSAPDK into the chromosomal DNA in S. venezuelae via homologous recombination. .. Genomic DNA was then digested by restriction enzyme Hind III, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: Conjugation was performed to integrate pSATNI into the chromosome by homologous recombination. .. Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Transfection:

Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
Article Snippet: This was followed by ligation of either WT or MT inserts using T4 Ligase (Takara Shuzo Co. Ltd., Kyoto, Japan). .. Since the XhoI restriction site is located between SacI and XbaI restriction sites, only the empty pmiRGlo vector was digested with XhoI enzyme, while the ligated pmirGLO constructs harboring the WT/MT inserts were not digested, confirming insert ligation.

Inverse PCR:

Article Title: Asymmetric diversification of mating pheromones in fission yeast
Article Snippet: To generate pTS54, pTS55, pTS145, pTS146, and pTS233, inverse PCR was carried out using pTS10 and the primer sets oTS202/203, oTS204/205, oTS401/402, oTS403/404, and oTS204/404, respectively. .. The amplified PCR products were subjected to Dpn I treatment and 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa), ligated by T4 ligase (TaKaRa), and transformed into Escherichia coli (DH5α).

Ligation:

Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
Article Snippet: The complementary target site for miR-182 on CLDN1 3′UTR, predicted using in silico analysis, was flanked by sticky ended 5′SacI and 3′XbaI restriction sites to form the wild-type (WT) insert, or the binding site was deleted to form the mutant type insert (MT). pmirGLO was double digested using XbaI and SacI (Thermo Scientific; Waltham, MA, USA) restriction enzymes. .. This was followed by ligation of either WT or MT inserts using T4 Ligase (Takara Shuzo Co. Ltd., Kyoto, Japan). .. Forward (F) and reverse (R) primers' sequences were designed as follows: for the WT target site F 5′CATCTTTCTACCTCTTTTTTCTATCTGCCAAATTGAGATAAT3′ R 5′CTAGATTATCTCAATTTGGCAGATAGAAAAAAGAGGTAGAAAGATGAGCT3′ and for the MT target site F 5′CATCTTTCTACCTCTTTTTTCTATCATTGAGATAAT3′ R 5′CTAGATTATCTCAATGATAGAAAAAAGAGGTAGAAAGATGAGCT3′.

Article Title: Antifibrotic Effect of Smad Decoy Oligodeoxynucleotide in a CCl4-Induced Hepatic Fibrosis Animal Model
Article Snippet: These decoy ODNs were predicted to form a hair-pin structure ( ). .. To obtain a covalent ligation for ring-type decoy ODN molecules, each decoy ODN was mixed with T4 ligase (Takara Bio, Otsu, Japan) and incubated at 16 °C for 18 h. .. Animal protocols were approved by the Institutional Animal Care and Use Committee of the Catholic University of Daegu (EXP-IRB number: 2014-0001-CU-AEC-04-A).

Article Title: Anti-fibrotic Effects of Synthetic Oligodeoxynucleotide for TGF-β1 and Smad in an Animal Model of Liver Cirrhosis
Article Snippet: TGF-β1/Smad ODN and Scr ODN were annealed for 6 hr, while thetemperature was decreased from 80°C to 25°C. .. To obtain a covalent ligation for ring-type ODN, each ODN was mixed with T4 ligase (Takara Bio) and incubated for 18 hr at 16°C. .. AML12 cells, the murine hepatocyte cell line, were obtained from the American Type Culture Collection (ATCC).

Cell Culture:

Article Title: Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: This strain was cultured in TSB media for 1 day at 30 °C, after which its genomic DNA was prepared using a Wizard® genomic DNA purification kit (Promega). .. Genomic DNA was then digested by restriction enzyme Hind III, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: CK4412-2XB strain was cultured at 28 °C in TSB media for 2 days, and preparation of genomic DNA of CK4412-2XB was carried out using a Wizard® genomic DNA purification kit (Promega). .. Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Improving squalene production by enhancing the NADPH/NADP+ ratio, modifying the isoprenoid-feeding module and blocking the menaquinone pathway in Escherichia coli
Article Snippet: Restriction enzymes, Taq polymerase and T4 ligase were purchased from Takara (Dalian City, China). .. Restriction enzymes, Taq polymerase and T4 ligase were purchased from Takara (Dalian City, China).

Generated:

Article Title: Extraordinary Mechanical Properties of Composite Silk Through Hereditable Transgenic Silkworm Expressing Recombinant Major Ampullate Spidroin
Article Snippet: Then, a series of piggy Bac-derived vectors were generated using the doubling strategy . .. The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China).

Article Title: PES1 promotes the occurrence and development of papillary thyroid cancer by upregulating the ERα/ERβ protein ratio
Article Snippet: A nonsilencing RNAi control vector comprising a scrambled shRNA sequence was generated with the following oligonucleotide 5′-GGATTC CCGG CC TAAGGTTAAGTCGCCC TCG TTCAAGAGA CGAGGGCGACTTAACCTTAGG TTTTTG AAGCTT -3′. .. These shRNA sequences were digested with BamHI and HindIII restriction enzymes (Takara Biotechnology Co., Ltd., Dalian, China) and cloned into the pRNAT-U6.1/neo vector with T4 ligase (Takara).

DNA Sequencing:

Article Title: Heterosubtypic protective immunity against widely divergent influenza subtypes induced by fusion protein 4sM2 in BALB/c mice
Article Snippet: The pRSET A vector and sM2 insert (sense 2) were ligated with T4 ligase (TaKaRa Bio, Seoul, Korea) at 16°C for 4 h. Sense 1 for sM2 was fused to sense 2 to produce 2sM2. .. The recombinant plasmids were recovered by plasmid DNA extraction following the manufacturer’s instructions using Accuprep Plasmid Mini-prep (Bioneer, Daejeon, Korea).

Protein Concentration:

Article Title: Engineering Corynebacterium glutamicum triggers glutamic acid accumulation in biotin-rich corn stover hydrolysate
Article Snippet: Total protein concentration was 87.3 mg/mL based on the Bradford method [ ]. .. DNA polymerase and T4 ligase were purchased from Takara, Otsu, Japan.

Sequencing:

Article Title: Nuclear envelope-distributed CD147 interacts with and inhibits the transcriptional function of RING1 and promotes melanoma cell motility
Article Snippet: Both PCR products and plasmids were recovered from 1.5% agarose gels and ligated using T4 ligase (Takara Bio, Otsu, Japan) to yield pcDNA4ToA- CD147 and pcDNA3ToA- RING1. .. After a 1 h of incubation at room temperature, plasmids of colonies grown on ampicillin-containing LB medium.

Article Title: Antifibrotic Effect of Smad Decoy Oligodeoxynucleotide in a CCl4-Induced Hepatic Fibrosis Animal Model
Article Snippet: Smad and scrambled (Scr) decoy ODN sequences used are listed below in (consensus sequence is underlined). .. To obtain a covalent ligation for ring-type decoy ODN molecules, each decoy ODN was mixed with T4 ligase (Takara Bio, Otsu, Japan) and incubated at 16 °C for 18 h.

Article Title: Functional Identification of Compound Heterozygous Mutations in the CYP17A1 Gene Resulting in Combined 17α-Hydroxylase/17,20-Lyase Deficiency
Article Snippet: The PCR fragments were ligated with T4 ligase (TaKaRa, Kyoto, Japan) between the HindIII and KpnI sites of pcDNA3 vector with a C-terminal flag tag ( ). .. Mutant (mutant type 1 [MT1]-flag/pcDNA3 and mutant type 2 [MT2]-flag/pcDNA3) expression vectors were constructed by mutating the WT CYP17A1 expression vector (WT-flag/pcDNA3) with a QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA).

Article Title: Isolation and biochemical characterization of a metagenome-derived 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase gene from subtropical marine mangrove wetland sediments
Article Snippet: The forward primer (5′-CGG AAGCTT GCATGATGGCCCCATTGGTAACACAAA-3′) and the reverse primer (5′-GGA CTCGAG CACCAACTCCCTGTCTATAGCTGCC-3′) were designed based on the nucleotide sequence of aro1A , and the restriction enzyme sites for Hin dIII and Xho I were underlined in the above-mentioned primers, respectively. .. The PCR program was as follows: 30 cycles at 98 °C for 10 s and at 68 °C for 60 s. The PCR product (Additional file : Fig. S2) was purified after being digested with Hin dIII and Xho I at 37 °C for 3 h. The purified product was ligated to the Hin dIII and Xho I double-digested vector pET-30a(+) with T4 ligase (Takara).

Article Title: Anti-fibrotic Effects of Synthetic Oligodeoxynucleotide for TGF-β1 and Smad in an Animal Model of Liver Cirrhosis
Article Snippet: Synthetic ODN sequences were used as follows (the target site or consensus binding sequence is underlined): scrambled (Scr) ODN: 5′-GAATTCCCGAAGTGCCAAGTCCTCCTCTCCACGG-3′; 5′-GAATTCCAGGTACGGCAAAAAATTGCCGTACCTG-3′; TGF-β1 antisense ODN (target site): 5′-GAATTCCCG AAAGCCCTGTATTCCGTCTCCT CGG-3′; Smad decoy ODN (consensus sequence is underlined): 5′-GAATTCGT GTCTAGAC TGAAAACA GTCTAGAC AC-3′. .. To obtain a covalent ligation for ring-type ODN, each ODN was mixed with T4 ligase (Takara Bio) and incubated for 18 hr at 16°C.

Article Title: Extraordinary Mechanical Properties of Composite Silk Through Hereditable Transgenic Silkworm Expressing Recombinant Major Ampullate Spidroin
Article Snippet: The sequence of the signal peptide of silkworm Fib -H , two sequential typical repetitive units of MaSp1 or three sequential typical repetitive units of MaSp2 , the C-terminal domain (CTD) of the MaSp1 or MaSp2 , and the partial C-terminal domain (CTD), as well as the polyA signal of the Fib -H gene were synthesized (GENEWIZ, China) and then sub-cloned into the pUC57 vector to generate intermediate pUC57-MaSp1 or pUC57-MaSp2 vectors, which carried Nco І, Spe І, Nhe І and Hind III restriction sites (Fig. , Supplementary Fig. ). .. The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China).

Article Title: The tumor marker Fascin is induced by the Epstein-Barr virus-encoded oncoprotein LMP1 via NF-κB in lymphocytes and contributes to their invasive migration
Article Snippet: They contained (5′ to 3′) a Bam HI site, the respective siRNA sequence (bold), a loop region, the complementary siRNA sequence (bold), an RNA polymerase III termination sequence, an Mlu I restriction enzyme site (italicized), and an Eco RI cloning site (shFascin4-fwd: 5′-gatccG CAAAGACTCCACAGGCAAA TTCAAGAGA TTTGCCTGTGGAGTCTTTG TTTTTTACGCGT g-3′; shFascin4-rev: 5′-aattcACGCGT AAAAAA CAAAGACTCCACAGGCAAA TCTCTTGAA TTTGCCTGTGGAGTCTTTGC g-3′) Oligonucleotides were annealed in 10 mM Tris and 20 mM NaCl (pH 7.6) by heating to 95°C for 2 min followed by cooling to room temperature. .. Double-stranded oligonucleotides were thereafter inserted into the retroviral vector pSiren-IRES-EGFP-shNonsense (shNon) [[ ]] using T4 ligase (DNA Ligation kit , TaKaRa Biomedicals, Gennevilliers, France) after removal of the shNon fragment via Bam HI and Eco RI restriction sites.

Article Title: Effects of Smad decoy ODN on shear stress-induced atherosclerotic ApoE-/-mouse
Article Snippet: The following sequences of ODN were utilized (Consensus sequence is underlined): Smad decoy ODN: 5’-CAGTCTAGACACGTGATCACGTGTCTAGACTG-3’. .. Following the addition of T4 ligase (1U, Takara, Japan), the mixture was incubated for 18 hours at 16°C to generate a covalently ligated ring-type decoy molecule ( ).

Article Title: PES1 promotes the occurrence and development of papillary thyroid cancer by upregulating the ERα/ERβ protein ratio
Article Snippet: A nonsilencing RNAi control vector comprising a scrambled shRNA sequence was generated with the following oligonucleotide 5′-GGATTC CCGG CC TAAGGTTAAGTCGCCC TCG TTCAAGAGA CGAGGGCGACTTAACCTTAGG TTTTTG AAGCTT -3′. .. These shRNA sequences were digested with BamHI and HindIII restriction enzymes (Takara Biotechnology Co., Ltd., Dalian, China) and cloned into the pRNAT-U6.1/neo vector with T4 ligase (Takara).

Binding Assay:

Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
Article Snippet: The complementary target site for miR-182 on CLDN1 3′UTR, predicted using in silico analysis, was flanked by sticky ended 5′SacI and 3′XbaI restriction sites to form the wild-type (WT) insert, or the binding site was deleted to form the mutant type insert (MT). pmirGLO was double digested using XbaI and SacI (Thermo Scientific; Waltham, MA, USA) restriction enzymes. .. This was followed by ligation of either WT or MT inserts using T4 Ligase (Takara Shuzo Co. Ltd., Kyoto, Japan).

Article Title: Anti-fibrotic Effects of Synthetic Oligodeoxynucleotide for TGF-β1 and Smad in an Animal Model of Liver Cirrhosis
Article Snippet: Synthetic ODN sequences were used as follows (the target site or consensus binding sequence is underlined): scrambled (Scr) ODN: 5′-GAATTCCCGAAGTGCCAAGTCCTCCTCTCCACGG-3′; 5′-GAATTCCAGGTACGGCAAAAAATTGCCGTACCTG-3′; TGF-β1 antisense ODN (target site): 5′-GAATTCCCG AAAGCCCTGTATTCCGTCTCCT CGG-3′; Smad decoy ODN (consensus sequence is underlined): 5′-GAATTCGT GTCTAGAC TGAAAACA GTCTAGAC AC-3′. .. To obtain a covalent ligation for ring-type ODN, each ODN was mixed with T4 ligase (Takara Bio) and incubated for 18 hr at 16°C.

DNA Extraction:

Article Title: Heterosubtypic protective immunity against widely divergent influenza subtypes induced by fusion protein 4sM2 in BALB/c mice
Article Snippet: The pRSET A vector and sM2 insert (sense 2) were ligated with T4 ligase (TaKaRa Bio, Seoul, Korea) at 16°C for 4 h. Sense 1 for sM2 was fused to sense 2 to produce 2sM2. .. The ligated products were transformed into E. coli JM83 competent cells using an electroporation method described previously.

DNA Purification:

Article Title: Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: This strain was cultured in TSB media for 1 day at 30 °C, after which its genomic DNA was prepared using a Wizard® genomic DNA purification kit (Promega). .. Genomic DNA was then digested by restriction enzyme Hind III, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: CK4412-2XB strain was cultured at 28 °C in TSB media for 2 days, and preparation of genomic DNA of CK4412-2XB was carried out using a Wizard® genomic DNA purification kit (Promega). .. Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Methylation:

Article Title: Chilling-induced DNA Demethylation is associated with the cold tolerance of Hevea brasiliensis
Article Snippet: Paragraph title: Methylated CpG island screening ... The 5′-CCGGTAGCTAATGAACCAT-3′ and 5′-ATCGATTACTTGGTA -3′ oligonucleotides (50 μM each) were mixed and annealed at 65 °C for 5 min. A 500-ng aliquot of digested DNA was ligated with T4 ligase (TaKaRa, Dalian) at 16 °C overnight.

Mutagenesis:

Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
Article Snippet: The complementary target site for miR-182 on CLDN1 3′UTR, predicted using in silico analysis, was flanked by sticky ended 5′SacI and 3′XbaI restriction sites to form the wild-type (WT) insert, or the binding site was deleted to form the mutant type insert (MT). pmirGLO was double digested using XbaI and SacI (Thermo Scientific; Waltham, MA, USA) restriction enzymes. .. This was followed by ligation of either WT or MT inserts using T4 Ligase (Takara Shuzo Co. Ltd., Kyoto, Japan).

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: The desired mutant (named CK4412-2XB) was selected on kanamycin-included MS agar medium, and its genotypes were verified using PCR. .. Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Isolation:

Article Title: Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: Paragraph title: Isolation of entire pikromycin biosynthetic gene cluster into pSBAC ... Genomic DNA was then digested by restriction enzyme Hind III, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: Paragraph title: Isolation of entire tautomycetin biosynthetic gene cluster into pSBAC ... Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Extraordinary Mechanical Properties of Composite Silk Through Hereditable Transgenic Silkworm Expressing Recombinant Major Ampullate Spidroin
Article Snippet: The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China). .. The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China).

Purification:

Article Title: Isolation and biochemical characterization of a metagenome-derived 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase gene from subtropical marine mangrove wetland sediments
Article Snippet: PCR was performed in a 50 μL reactor consisting of 1× PrimeSTAR buffer (Takara), 1.25 U PrimeSTAR HS DNA polymerase (Takara), 4 μL of dNTP mixture (2.5 mM) (Takara), 0.2 μM forward primer, 0.2 μM reverse primer, 50 ng plasmid, and H2 O. .. The PCR program was as follows: 30 cycles at 98 °C for 10 s and at 68 °C for 60 s. The PCR product (Additional file : Fig. S2) was purified after being digested with Hin dIII and Xho I at 37 °C for 3 h. The purified product was ligated to the Hin dIII and Xho I double-digested vector pET-30a(+) with T4 ligase (Takara). .. The recombinant plasmid pET-30a(+)-aro1A was confirmed by double digestion with Hin dIII and Xho I (Additional file : Fig. S3) and was sequenced by Sangon Biotech (Shanghai).

Article Title: Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: This strain was cultured in TSB media for 1 day at 30 °C, after which its genomic DNA was prepared using a Wizard® genomic DNA purification kit (Promega). .. Genomic DNA was then digested by restriction enzyme Hind III, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa). .. After desalting, the ligation mixture was used for electroporation of E. coli EPI300.

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: CK4412-2XB strain was cultured at 28 °C in TSB media for 2 days, and preparation of genomic DNA of CK4412-2XB was carried out using a Wizard® genomic DNA purification kit (Promega). .. Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa). .. After desalting, the ligation mixture was used for electroporation of E. coli EPI300.

Article Title: Heterosubtypic protective immunity against widely divergent influenza subtypes induced by fusion protein 4sM2 in BALB/c mice
Article Snippet: Each plasmid was linearized by RE digestion using Bam H I, Hin d III for the pRSET A vector and Bgl II, Hin d III for the T Easy Vector at 37°C for 2 h and purified by phenol/chloroform/ isoamylalcohol treatment. .. The pRSET A vector and sM2 insert (sense 2) were ligated with T4 ligase (TaKaRa Bio, Seoul, Korea) at 16°C for 4 h. Sense 1 for sM2 was fused to sense 2 to produce 2sM2.

Polymerase Chain Reaction:

Article Title: Nuclear envelope-distributed CD147 interacts with and inhibits the transcriptional function of RING1 and promotes melanoma cell motility
Article Snippet: Deletion mutants of CD147 and the full length (FL) RING1 promoter were amplified by PCR.The pcDNA4ToA and pcDNA3ToA plasmids (Promega, WI, USA) were double digested with the same restriction enzymes. .. Both PCR products and plasmids were recovered from 1.5% agarose gels and ligated using T4 ligase (Takara Bio, Otsu, Japan) to yield pcDNA4ToA- CD147 and pcDNA3ToA- RING1. .. After a 1 h of incubation at room temperature, plasmids of colonies grown on ampicillin-containing LB medium.

Article Title: Functional Identification of Compound Heterozygous Mutations in the CYP17A1 Gene Resulting in Combined 17α-Hydroxylase/17,20-Lyase Deficiency
Article Snippet: A HindIII site was introduced into the upstream primer (5' CTATAGGGAGACCCAAGCTTCCTCCTTGTGCCCTAGAG 3') of P450c17 and a KpnI site into the downstream primer (5' GTCCTTGTAATCGGTACCG-GTGCTACCCTCAGCCTGGG 3'). .. The PCR fragments were ligated with T4 ligase (TaKaRa, Kyoto, Japan) between the HindIII and KpnI sites of pcDNA3 vector with a C-terminal flag tag ( ). .. Mutant (mutant type 1 [MT1]-flag/pcDNA3 and mutant type 2 [MT2]-flag/pcDNA3) expression vectors were constructed by mutating the WT CYP17A1 expression vector (WT-flag/pcDNA3) with a QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA).

Article Title: Isolation and biochemical characterization of a metagenome-derived 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase gene from subtropical marine mangrove wetland sediments
Article Snippet: PCR was performed in a 50 μL reactor consisting of 1× PrimeSTAR buffer (Takara), 1.25 U PrimeSTAR HS DNA polymerase (Takara), 4 μL of dNTP mixture (2.5 mM) (Takara), 0.2 μM forward primer, 0.2 μM reverse primer, 50 ng plasmid, and H2 O. .. The PCR program was as follows: 30 cycles at 98 °C for 10 s and at 68 °C for 60 s. The PCR product (Additional file : Fig. S2) was purified after being digested with Hin dIII and Xho I at 37 °C for 3 h. The purified product was ligated to the Hin dIII and Xho I double-digested vector pET-30a(+) with T4 ligase (Takara). .. The recombinant plasmid pET-30a(+)-aro1A was confirmed by double digestion with Hin dIII and Xho I (Additional file : Fig. S3) and was sequenced by Sangon Biotech (Shanghai).

Article Title: Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: Next, the desired mutants were selected on apramycin- and kanamycin-containing ISP4 agar, verified using PCR and named S. venezuelae HindBAC. .. Genomic DNA was then digested by restriction enzyme Hind III, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Asymmetric diversification of mating pheromones in fission yeast
Article Snippet: To generate pTS54, pTS55, pTS145, pTS146, and pTS233, inverse PCR was carried out using pTS10 and the primer sets oTS202/203, oTS204/205, oTS401/402, oTS403/404, and oTS204/404, respectively. .. The amplified PCR products were subjected to Dpn I treatment and 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa), ligated by T4 ligase (TaKaRa), and transformed into Escherichia coli (DH5α). .. All plasmids carrying 4-repeat Map2 ORFs were then constructed, as described above.

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: The desired mutant (named CK4412-2XB) was selected on kanamycin-included MS agar medium, and its genotypes were verified using PCR. .. Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Extraordinary Mechanical Properties of Composite Silk Through Hereditable Transgenic Silkworm Expressing Recombinant Major Ampullate Spidroin
Article Snippet: The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China). .. The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China).

Article Title: Heterosubtypic protective immunity against widely divergent influenza subtypes induced by fusion protein 4sM2 in BALB/c mice
Article Snippet: The polymerase chain reaction (PCR) was employed to amplify the gene using the primer pair 5′-CTA GCT AGC ATG TCA TTA TTA ACA-3′ (sense 1), 5′-GAA GAT CTA TGT CAT TAT TAA CA- 3′ (sense 2) and 5′-AAG CTT TTA TCA GGA TCC ACC TGA ACC ACC TGA ACC ACC TGA ACC ACC TTC AAG TTC-3′ (anti sense). .. The pRSET A vector and sM2 insert (sense 2) were ligated with T4 ligase (TaKaRa Bio, Seoul, Korea) at 16°C for 4 h. Sense 1 for sM2 was fused to sense 2 to produce 2sM2.

Article Title: Chilling-induced DNA Demethylation is associated with the cold tolerance of Hevea brasiliensis
Article Snippet: The 5′-CCGGTAGCTAATGAACCAT-3′ and 5′-ATCGATTACTTGGTA -3′ oligonucleotides (50 μM each) were mixed and annealed at 65 °C for 5 min. A 500-ng aliquot of digested DNA was ligated with T4 ligase (TaKaRa, Dalian) at 16 °C overnight. .. The ligated fragments were amplified by PCR at 96 °C for 20 s, 58 °C for 25 s, and 72 °C for 2 min for 30 cycles using a single adaptor-specific primer (5′-ATGGTTCATTAGCTACCGGG-3′).

shRNA:

Article Title: The tumor marker Fascin is induced by the Epstein-Barr virus-encoded oncoprotein LMP1 via NF-κB in lymphocytes and contributes to their invasive migration
Article Snippet: Paragraph title: Construction of shRNA expression vectors ... Double-stranded oligonucleotides were thereafter inserted into the retroviral vector pSiren-IRES-EGFP-shNonsense (shNon) [[ ]] using T4 ligase (DNA Ligation kit , TaKaRa Biomedicals, Gennevilliers, France) after removal of the shNon fragment via Bam HI and Eco RI restriction sites.

Article Title: PES1 promotes the occurrence and development of papillary thyroid cancer by upregulating the ERα/ERβ protein ratio
Article Snippet: The underlined, boldface and italic letters denote the hairpin loop, terminal signal and target sites of BamHI and HindIII restriction enzymes, respectively. .. These shRNA sequences were digested with BamHI and HindIII restriction enzymes (Takara Biotechnology Co., Ltd., Dalian, China) and cloned into the pRNAT-U6.1/neo vector with T4 ligase (Takara). .. The resulting constructs were verified by direct sequencing (Sangon Biotech Co., Ltd., Shanghai, China).

Gel Extraction:

Article Title: Heterosubtypic protective immunity against widely divergent influenza subtypes induced by fusion protein 4sM2 in BALB/c mice
Article Snippet: The linearized plasmids were electrophoresed on a 0.9% agarose gel and recovered using a QIAquick Gel Extraction kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. .. The pRSET A vector and sM2 insert (sense 2) were ligated with T4 ligase (TaKaRa Bio, Seoul, Korea) at 16°C for 4 h. Sense 1 for sM2 was fused to sense 2 to produce 2sM2.

Chloramphenicol Acetyltransferase Assay:

Article Title: Heterosubtypic protective immunity against widely divergent influenza subtypes induced by fusion protein 4sM2 in BALB/c mice
Article Snippet: The polymerase chain reaction (PCR) was employed to amplify the gene using the primer pair 5′-CTA GCT AGC ATG TCA TTA TTA ACA-3′ (sense 1), 5′-GAA GAT CTA TGT CAT TAT TAA CA- 3′ (sense 2) and 5′-AAG CTT TTA TCA GGA TCC ACC TGA ACC ACC TGA ACC ACC TGA ACC ACC TTC AAG TTC-3′ (anti sense). .. The pRSET A vector and sM2 insert (sense 2) were ligated with T4 ligase (TaKaRa Bio, Seoul, Korea) at 16°C for 4 h. Sense 1 for sM2 was fused to sense 2 to produce 2sM2.

Plasmid Preparation:

Article Title: Disruption of Claudin-1 Expression by miRNA-182 Alters the Susceptibility to Viral Infectivity in HCV Cell Models
Article Snippet: To confirm binding of miR-182 to CLDN1 3′UTR, firefly luciferase reporter vector was used (pmirGLO) (Promega; Madison, WI, USA). .. This was followed by ligation of either WT or MT inserts using T4 Ligase (Takara Shuzo Co. Ltd., Kyoto, Japan).

Article Title: Functional Identification of Compound Heterozygous Mutations in the CYP17A1 Gene Resulting in Combined 17α-Hydroxylase/17,20-Lyase Deficiency
Article Snippet: A HindIII site was introduced into the upstream primer (5' CTATAGGGAGACCCAAGCTTCCTCCTTGTGCCCTAGAG 3') of P450c17 and a KpnI site into the downstream primer (5' GTCCTTGTAATCGGTACCG-GTGCTACCCTCAGCCTGGG 3'). .. The PCR fragments were ligated with T4 ligase (TaKaRa, Kyoto, Japan) between the HindIII and KpnI sites of pcDNA3 vector with a C-terminal flag tag ( ). .. Mutant (mutant type 1 [MT1]-flag/pcDNA3 and mutant type 2 [MT2]-flag/pcDNA3) expression vectors were constructed by mutating the WT CYP17A1 expression vector (WT-flag/pcDNA3) with a QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA).

Article Title: Isolation and biochemical characterization of a metagenome-derived 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase gene from subtropical marine mangrove wetland sediments
Article Snippet: PCR was performed in a 50 μL reactor consisting of 1× PrimeSTAR buffer (Takara), 1.25 U PrimeSTAR HS DNA polymerase (Takara), 4 μL of dNTP mixture (2.5 mM) (Takara), 0.2 μM forward primer, 0.2 μM reverse primer, 50 ng plasmid, and H2 O. .. The PCR program was as follows: 30 cycles at 98 °C for 10 s and at 68 °C for 60 s. The PCR product (Additional file : Fig. S2) was purified after being digested with Hin dIII and Xho I at 37 °C for 3 h. The purified product was ligated to the Hin dIII and Xho I double-digested vector pET-30a(+) with T4 ligase (Takara). .. The recombinant plasmid pET-30a(+)-aro1A was confirmed by double digestion with Hin dIII and Xho I (Additional file : Fig. S3) and was sequenced by Sangon Biotech (Shanghai).

Article Title: Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: The amplified PCR product was ligated into a T & A cloning vector (RBC), after which the ligated vector was sequenced to confirm its integrity (Macrogen, Korea). .. Genomic DNA was then digested by restriction enzyme Hind III, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Asymmetric diversification of mating pheromones in fission yeast
Article Snippet: The amplified PCR products were subjected to Dpn I treatment and 5′-phosphorylated by T4 polynucleotide kinase (TaKaRa), ligated by T4 ligase (TaKaRa), and transformed into Escherichia coli (DH5α). .. All plasmids carrying 4-repeat Map2 ORFs were then constructed, as described above.

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa). .. Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Extraordinary Mechanical Properties of Composite Silk Through Hereditable Transgenic Silkworm Expressing Recombinant Major Ampullate Spidroin
Article Snippet: Paragraph title: Vector Design and Construction ... The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China).

Article Title: Heterosubtypic protective immunity against widely divergent influenza subtypes induced by fusion protein 4sM2 in BALB/c mice
Article Snippet: The linearized plasmids were electrophoresed on a 0.9% agarose gel and recovered using a QIAquick Gel Extraction kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. .. The pRSET A vector and sM2 insert (sense 2) were ligated with T4 ligase (TaKaRa Bio, Seoul, Korea) at 16°C for 4 h. Sense 1 for sM2 was fused to sense 2 to produce 2sM2. .. Consequently, 4sM2 was produced by combining 2sM2 (sense 1) to 2sM2 (sense 2).

Article Title: The tumor marker Fascin is induced by the Epstein-Barr virus-encoded oncoprotein LMP1 via NF-κB in lymphocytes and contributes to their invasive migration
Article Snippet: They contained (5′ to 3′) a Bam HI site, the respective siRNA sequence (bold), a loop region, the complementary siRNA sequence (bold), an RNA polymerase III termination sequence, an Mlu I restriction enzyme site (italicized), and an Eco RI cloning site (shFascin4-fwd: 5′-gatccG CAAAGACTCCACAGGCAAA TTCAAGAGA TTTGCCTGTGGAGTCTTTG TTTTTTACGCGT g-3′; shFascin4-rev: 5′-aattcACGCGT AAAAAA CAAAGACTCCACAGGCAAA TCTCTTGAA TTTGCCTGTGGAGTCTTTGC g-3′) Oligonucleotides were annealed in 10 mM Tris and 20 mM NaCl (pH 7.6) by heating to 95°C for 2 min followed by cooling to room temperature. .. Double-stranded oligonucleotides were thereafter inserted into the retroviral vector pSiren-IRES-EGFP-shNonsense (shNon) [[ ]] using T4 ligase (DNA Ligation kit , TaKaRa Biomedicals, Gennevilliers, France) after removal of the shNon fragment via Bam HI and Eco RI restriction sites. .. The resulting shRNA expression plasmid was called pSiren-IRES-EGFP-shFascin4 (target at position +1407 of the Fascin coding sequence, gene bank accession number NM_003088).

Article Title: PES1 promotes the occurrence and development of papillary thyroid cancer by upregulating the ERα/ERβ protein ratio
Article Snippet: The underlined, boldface and italic letters denote the hairpin loop, terminal signal and target sites of BamHI and HindIII restriction enzymes, respectively. .. These shRNA sequences were digested with BamHI and HindIII restriction enzymes (Takara Biotechnology Co., Ltd., Dalian, China) and cloned into the pRNAT-U6.1/neo vector with T4 ligase (Takara). .. The resulting constructs were verified by direct sequencing (Sangon Biotech Co., Ltd., Shanghai, China).

Recombinant:

Article Title: Isolation and biochemical characterization of a metagenome-derived 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase gene from subtropical marine mangrove wetland sediments
Article Snippet: Paragraph title: Overexpression and purification of the recombinant DAHPS protein ... The PCR program was as follows: 30 cycles at 98 °C for 10 s and at 68 °C for 60 s. The PCR product (Additional file : Fig. S2) was purified after being digested with Hin dIII and Xho I at 37 °C for 3 h. The purified product was ligated to the Hin dIII and Xho I double-digested vector pET-30a(+) with T4 ligase (Takara).

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa). .. After desalting, the ligation mixture was used for electroporation of E. coli EPI300.

Article Title: Heterosubtypic protective immunity against widely divergent influenza subtypes induced by fusion protein 4sM2 in BALB/c mice
Article Snippet: Paragraph title: Construction of recombinant plasmid with four copies of the sM2 gene ... The pRSET A vector and sM2 insert (sense 2) were ligated with T4 ligase (TaKaRa Bio, Seoul, Korea) at 16°C for 4 h. Sense 1 for sM2 was fused to sense 2 to produce 2sM2.

Agarose Gel Electrophoresis:

Article Title: Heterosubtypic protective immunity against widely divergent influenza subtypes induced by fusion protein 4sM2 in BALB/c mice
Article Snippet: The linearized plasmids were electrophoresed on a 0.9% agarose gel and recovered using a QIAquick Gel Extraction kit (Qiagen, Hilden, Germany) following the manufacturer’s instructions. .. The pRSET A vector and sM2 insert (sense 2) were ligated with T4 ligase (TaKaRa Bio, Seoul, Korea) at 16°C for 4 h. Sense 1 for sM2 was fused to sense 2 to produce 2sM2.

Article Title: Chilling-induced DNA Demethylation is associated with the cold tolerance of Hevea brasiliensis
Article Snippet: The 5′-CCGGTAGCTAATGAACCAT-3′ and 5′-ATCGATTACTTGGTA -3′ oligonucleotides (50 μM each) were mixed and annealed at 65 °C for 5 min. A 500-ng aliquot of digested DNA was ligated with T4 ligase (TaKaRa, Dalian) at 16 °C overnight. .. Differential display screening was performed by amplifying DNA fragments by PCR using the initial PCR product as a template and a 10-base oligonucleotide primer.

Selection:

Article Title: Effects of Smad decoy ODN on shear stress-induced atherosclerotic ApoE-/-mouse
Article Snippet: Paragraph title: Synthesis of ring type decoy ODN and selection of target sequences ... Following the addition of T4 ligase (1U, Takara, Japan), the mixture was incubated for 18 hours at 16°C to generate a covalently ligated ring-type decoy molecule ( ).

Article Title: Improving squalene production by enhancing the NADPH/NADP+ ratio, modifying the isoprenoid-feeding module and blocking the menaquinone pathway in Escherichia coli
Article Snippet: Restriction enzymes, Taq polymerase and T4 ligase were purchased from Takara (Dalian City, China). .. Engineered strains for squalene overproduction were cultured at 37 °C in LB medium (10 g/L NaCl, 10 g/L peptone, 5 g/L yeast extract) supplemented with 10 g/L glucose and 1.0 g/L MgSO4 ·7H2 O.

Ethanol Precipitation:

Article Title: Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: This strain was cultured in TSB media for 1 day at 30 °C, after which its genomic DNA was prepared using a Wizard® genomic DNA purification kit (Promega). .. Genomic DNA was then digested by restriction enzyme Hind III, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa). .. After desalting, the ligation mixture was used for electroporation of E. coli EPI300.

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: CK4412-2XB strain was cultured at 28 °C in TSB media for 2 days, and preparation of genomic DNA of CK4412-2XB was carried out using a Wizard® genomic DNA purification kit (Promega). .. Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa). .. After desalting, the ligation mixture was used for electroporation of E. coli EPI300.

Produced:

Article Title: Extraordinary Mechanical Properties of Composite Silk Through Hereditable Transgenic Silkworm Expressing Recombinant Major Ampullate Spidroin
Article Snippet: The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China). .. The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China).

FLAG-tag:

Article Title: Functional Identification of Compound Heterozygous Mutations in the CYP17A1 Gene Resulting in Combined 17α-Hydroxylase/17,20-Lyase Deficiency
Article Snippet: A HindIII site was introduced into the upstream primer (5' CTATAGGGAGACCCAAGCTTCCTCCTTGTGCCCTAGAG 3') of P450c17 and a KpnI site into the downstream primer (5' GTCCTTGTAATCGGTACCG-GTGCTACCCTCAGCCTGGG 3'). .. The PCR fragments were ligated with T4 ligase (TaKaRa, Kyoto, Japan) between the HindIII and KpnI sites of pcDNA3 vector with a C-terminal flag tag ( ). .. Mutant (mutant type 1 [MT1]-flag/pcDNA3 and mutant type 2 [MT2]-flag/pcDNA3) expression vectors were constructed by mutating the WT CYP17A1 expression vector (WT-flag/pcDNA3) with a QuikChange site-directed mutagenesis kit (Agilent Technologies, Santa Clara, CA, USA).

BAC Assay:

Article Title: Extraordinary Mechanical Properties of Composite Silk Through Hereditable Transgenic Silkworm Expressing Recombinant Major Ampullate Spidroin
Article Snippet: Then, a series of piggy Bac-derived vectors were generated using the doubling strategy . .. The two fragments were ligated together, which led to a doubling of the length of the typical repetitive units of MaSp using T4 ligase (TaKaRa, China).

Staining:

Article Title: Chilling-induced DNA Demethylation is associated with the cold tolerance of Hevea brasiliensis
Article Snippet: The 5′-CCGGTAGCTAATGAACCAT-3′ and 5′-ATCGATTACTTGGTA -3′ oligonucleotides (50 μM each) were mixed and annealed at 65 °C for 5 min. A 500-ng aliquot of digested DNA was ligated with T4 ligase (TaKaRa, Dalian) at 16 °C overnight. .. Differential display screening was performed by amplifying DNA fragments by PCR using the initial PCR product as a template and a 10-base oligonucleotide primer.

Positron Emission Tomography:

Article Title: Isolation and biochemical characterization of a metagenome-derived 3-deoxy-d-arabino-heptulosonate-7-phosphate synthase gene from subtropical marine mangrove wetland sediments
Article Snippet: PCR was performed in a 50 μL reactor consisting of 1× PrimeSTAR buffer (Takara), 1.25 U PrimeSTAR HS DNA polymerase (Takara), 4 μL of dNTP mixture (2.5 mM) (Takara), 0.2 μM forward primer, 0.2 μM reverse primer, 50 ng plasmid, and H2 O. .. The PCR program was as follows: 30 cycles at 98 °C for 10 s and at 68 °C for 60 s. The PCR product (Additional file : Fig. S2) was purified after being digested with Hin dIII and Xho I at 37 °C for 3 h. The purified product was ligated to the Hin dIII and Xho I double-digested vector pET-30a(+) with T4 ligase (Takara). .. The recombinant plasmid pET-30a(+)-aro1A was confirmed by double digestion with Hin dIII and Xho I (Additional file : Fig. S3) and was sequenced by Sangon Biotech (Shanghai).

Homologous Recombination:

Article Title: Heterologous expression of pikromycin biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: Conjugation was subsequently performed to integrate pSAPDK into the chromosomal DNA in S. venezuelae via homologous recombination. .. Genomic DNA was then digested by restriction enzyme Hind III, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Article Title: Precise cloning and tandem integration of large polyketide biosynthetic gene cluster using Streptomyces artificial chromosome system
Article Snippet: Conjugation was performed to integrate pSATNI into the chromosome by homologous recombination. .. Genomic DNA was digested by restriction enzyme Xba I, purified, and concentrated by ethanol precipitation before self-ligation using T4 ligase (TaKaRa).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 75
    TaKaRa t4 dna ligase
    15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.
    T4 Dna Ligase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 75/100, based on 0 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/TaKaRa
    Average 75 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2019-12
    75/100 stars
      Buy from Supplier

    Image Search Results


    15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: 15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

    Article Snippet: Therefore, the ligation products would decrease when the 5′-phosphate generated by the spontaneous nucleotide deletion was removed by CIAP, but increase again when the linkers deleting one or more nucleotide(s) at their 5′-ends increased as the CIAP inactivation at 85°C was extended from 15 min to 30–90 min. Our kinase assay for T4 DNA ligase showed that about 0.025–0.1% of oligo 11 could be phosphorylated by T4 DNA ligase and the phosphorylation of oligo 11 by T4 DNA ligase could be inhibited by CIAP treatment of oligo 11.

    Techniques: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

    12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B  = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B  = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

    Article Snippet: Therefore, the ligation products would decrease when the 5′-phosphate generated by the spontaneous nucleotide deletion was removed by CIAP, but increase again when the linkers deleting one or more nucleotide(s) at their 5′-ends increased as the CIAP inactivation at 85°C was extended from 15 min to 30–90 min. Our kinase assay for T4 DNA ligase showed that about 0.025–0.1% of oligo 11 could be phosphorylated by T4 DNA ligase and the phosphorylation of oligo 11 by T4 DNA ligase could be inhibited by CIAP treatment of oligo 11.

    Techniques: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Positive Control, Negative Control

    12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4  and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

    Article Snippet: Therefore, the ligation products would decrease when the 5′-phosphate generated by the spontaneous nucleotide deletion was removed by CIAP, but increase again when the linkers deleting one or more nucleotide(s) at their 5′-ends increased as the CIAP inactivation at 85°C was extended from 15 min to 30–90 min. Our kinase assay for T4 DNA ligase showed that about 0.025–0.1% of oligo 11 could be phosphorylated by T4 DNA ligase and the phosphorylation of oligo 11 by T4 DNA ligase could be inhibited by CIAP treatment of oligo 11.

    Techniques: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

    The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B  = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B  = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

    Article Snippet: Therefore, the ligation products would decrease when the 5′-phosphate generated by the spontaneous nucleotide deletion was removed by CIAP, but increase again when the linkers deleting one or more nucleotide(s) at their 5′-ends increased as the CIAP inactivation at 85°C was extended from 15 min to 30–90 min. Our kinase assay for T4 DNA ligase showed that about 0.025–0.1% of oligo 11 could be phosphorylated by T4 DNA ligase and the phosphorylation of oligo 11 by T4 DNA ligase could be inhibited by CIAP treatment of oligo 11.

    Techniques: Polyacrylamide Gel Electrophoresis, Electrophoresis, Negative Control, Positive Control