Structured Review

TaKaRa t4 ligase
T4 Ligase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 ligase/product/TaKaRa
Average 92 stars, based on 23 article reviews
Price from $9.99 to $1999.99
t4 ligase - by Bioz Stars, 2020-05
92/100 stars

Images

Related Articles

Transfection:

Article Title: Activating Transcription Factor 6 Is Necessary and Sufficient for Alcoholic Fatty Liver Disease in Zebrafish
Article Snippet: .. The resulting PCR product was ligated into pCI-Neo via T4 ligase. pEGFP-C1 (Clontech) was used as a positive control for transfection. .. Cell culture and transfection 293T and HepG2 cells were grown in 100 mm dishes (BD Biosciences) with DMEM (Corning Cellgro, Manassas, VA) containing 10% fetal bovine serum (Invitrogen) and penicillin/streptomycin (Cellgro), and housed in a humidified incubator at 37 C with 5% CO2 .

Amplification:

Article Title: A Capillary Electrophoresis Sequencing Method for the Identification of Mutations in the Inverted Terminal Repeats of Adeno-Associated Virus
Article Snippet: .. Using T4 ligase, GenomeWalker adaptors (Clontech, Mountain View, CA) were ligated to the digested product for 16 hr at 16°C and integration junctions were amplified through nested PCR using the following primer pairs: round 1 amplification, AAV-specific primer AGGAACCCCTAGTGATGGAGTTGGCCAC or TACGTAGATAAGTAGCATGGCGGGTTA and adaptor-specific primer GTAATACGACTCACTATAGGGC; round 2 amplification, AAV-specific primer TGATGGAGTTGGCCACTCCCTCTCTG or AGTAGCATGGCGGGTTAATCATTAACT and adaptor-specific primer ACTATAGGGCACGCGTGGT. .. Amplicons were then subjected to agarose gel electrophoresis and the DNA corresponding to various bands was purified with the QIAquick gel purification kit (Qiagen).

Positive Control:

Article Title: Activating Transcription Factor 6 Is Necessary and Sufficient for Alcoholic Fatty Liver Disease in Zebrafish
Article Snippet: .. The resulting PCR product was ligated into pCI-Neo via T4 ligase. pEGFP-C1 (Clontech) was used as a positive control for transfection. .. Cell culture and transfection 293T and HepG2 cells were grown in 100 mm dishes (BD Biosciences) with DMEM (Corning Cellgro, Manassas, VA) containing 10% fetal bovine serum (Invitrogen) and penicillin/streptomycin (Cellgro), and housed in a humidified incubator at 37 C with 5% CO2 .

Modification:

Article Title: Molecular mechanism of the synergistic activity of ethambutol and isoniazid against Mycobacterium tuberculosis
Article Snippet: .. DNA polymerase, dNTPs, restriction enzymes, modification enzymes, T4 ligase, and all antibiotics were obtained from TaKaRa Biotech (Shiga, Japan). .. Ni2+ -NTA–agarose, sensor chip CM5 was purchased from Qiagen (Hilden, Germany).

DNA Purification:

Article Title: Citrate lyase CitE in Mycobacterium tuberculosis contributes to mycobacterial survival under hypoxic conditions
Article Snippet: .. Restriction enzymes, T4 ligase, dNTPs and all antibiotics were purchased from TaKaRa Biotech, whereas DNA purification kits were purchased from Watson Biotechnologies. .. Ni-NTA agarose columns were obtained from Qiagen.

Polymerase Chain Reaction:

Article Title: Activating Transcription Factor 6 Is Necessary and Sufficient for Alcoholic Fatty Liver Disease in Zebrafish
Article Snippet: .. The resulting PCR product was ligated into pCI-Neo via T4 ligase. pEGFP-C1 (Clontech) was used as a positive control for transfection. .. Cell culture and transfection 293T and HepG2 cells were grown in 100 mm dishes (BD Biosciences) with DMEM (Corning Cellgro, Manassas, VA) containing 10% fetal bovine serum (Invitrogen) and penicillin/streptomycin (Cellgro), and housed in a humidified incubator at 37 C with 5% CO2 .

Article Title: Structure and Function of the Intracellular Region of the Plexin-B1 Transmembrane Receptor *
Article Snippet: .. The DNA was PCR-amplified and inserted into pET19b vector (Invitrogen) using T4 ligase and into pFBOH-LIC vector (GenBankTM GI:134105591 ) using the In-Fusion kit (Clontech). .. His6 -tagged recombinant plexin-B1 was expressed in Spodoptera frugiperda cells via baculovirus infection.

Nested PCR:

Article Title: A Capillary Electrophoresis Sequencing Method for the Identification of Mutations in the Inverted Terminal Repeats of Adeno-Associated Virus
Article Snippet: .. Using T4 ligase, GenomeWalker adaptors (Clontech, Mountain View, CA) were ligated to the digested product for 16 hr at 16°C and integration junctions were amplified through nested PCR using the following primer pairs: round 1 amplification, AAV-specific primer AGGAACCCCTAGTGATGGAGTTGGCCAC or TACGTAGATAAGTAGCATGGCGGGTTA and adaptor-specific primer GTAATACGACTCACTATAGGGC; round 2 amplification, AAV-specific primer TGATGGAGTTGGCCACTCCCTCTCTG or AGTAGCATGGCGGGTTAATCATTAACT and adaptor-specific primer ACTATAGGGCACGCGTGGT. .. Amplicons were then subjected to agarose gel electrophoresis and the DNA corresponding to various bands was purified with the QIAquick gel purification kit (Qiagen).

Plasmid Preparation:

Article Title: Structure and Function of the Intracellular Region of the Plexin-B1 Transmembrane Receptor *
Article Snippet: .. The DNA was PCR-amplified and inserted into pET19b vector (Invitrogen) using T4 ligase and into pFBOH-LIC vector (GenBankTM GI:134105591 ) using the In-Fusion kit (Clontech). .. His6 -tagged recombinant plexin-B1 was expressed in Spodoptera frugiperda cells via baculovirus infection.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa t4 dna ligase
    Stimulation of DNA ligation by histone H1 and deletion mutants. The 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 1–15 nM ( left to right ) histone H1 (fl) or deletion mutants within the highly basic C-terminus, followed by ligation by <t>T4</t> DNA ligase. Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer.
    T4 Dna Ligase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 297 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/TaKaRa
    Average 99 stars, based on 297 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-05
    99/100 stars
      Buy from Supplier

    Image Search Results


    Stimulation of DNA ligation by histone H1 and deletion mutants. The 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 1–15 nM ( left to right ) histone H1 (fl) or deletion mutants within the highly basic C-terminus, followed by ligation by T4 DNA ligase. Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer.

    Journal: PLoS ONE

    Article Title: Histone H1 Differentially Inhibits DNA Bending by Reduced and Oxidized HMGB1 Protein

    doi: 10.1371/journal.pone.0138774

    Figure Lengend Snippet: Stimulation of DNA ligation by histone H1 and deletion mutants. The 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 1–15 nM ( left to right ) histone H1 (fl) or deletion mutants within the highly basic C-terminus, followed by ligation by T4 DNA ligase. Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer.

    Article Snippet: In agreement with previous reports [ , ], histone H1 could stimulate formation of linear multimers by T4 DNA ligase at low H1-to-DNA ratios.

    Techniques: DNA Ligation, Labeling, Incubation, Ligation, Electrophoresis

    Histone H1 inhibits the ability of HMGB1 to bend DNA. A , formation of DNA circles by HMGB1 is inhibited by the full-length histone H1 (DNA circularization assay). The 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 5 nM HMGB1, followed by titration with increasing concentrations of H1 (0.2–15 nM, left to right ) and ligation by T4 DNA ligase. Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer. Panels B - E , DNA circularization assays in the presence of the full-length histone H1(fl) or peptides H1Δ24, H1Δ48 and H1Δ72. The percentage of DNA circles by reduced or oxidized HMGB1 or HMGB1ΔC (50 nM) in the presence of increasing concentrations of H1 or H1 peptides (1–15 nM, left to right ) is indicated. The percentage of the minicircles formed by HMGB1 or HMGB1ΔC in the absence of H1 or peptides was arbitrary set to 100%. Oxidized HMGB1 or HMGB1ΔC proteins are indicated in red.

    Journal: PLoS ONE

    Article Title: Histone H1 Differentially Inhibits DNA Bending by Reduced and Oxidized HMGB1 Protein

    doi: 10.1371/journal.pone.0138774

    Figure Lengend Snippet: Histone H1 inhibits the ability of HMGB1 to bend DNA. A , formation of DNA circles by HMGB1 is inhibited by the full-length histone H1 (DNA circularization assay). The 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 5 nM HMGB1, followed by titration with increasing concentrations of H1 (0.2–15 nM, left to right ) and ligation by T4 DNA ligase. Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer. Panels B - E , DNA circularization assays in the presence of the full-length histone H1(fl) or peptides H1Δ24, H1Δ48 and H1Δ72. The percentage of DNA circles by reduced or oxidized HMGB1 or HMGB1ΔC (50 nM) in the presence of increasing concentrations of H1 or H1 peptides (1–15 nM, left to right ) is indicated. The percentage of the minicircles formed by HMGB1 or HMGB1ΔC in the absence of H1 or peptides was arbitrary set to 100%. Oxidized HMGB1 or HMGB1ΔC proteins are indicated in red.

    Article Snippet: In agreement with previous reports [ , ], histone H1 could stimulate formation of linear multimers by T4 DNA ligase at low H1-to-DNA ratios.

    Techniques: Labeling, Incubation, Titration, Ligation, Electrophoresis

    The effect of oxidization and mutation of Cys22/Cys44 or Phe37 of HMGB1ΔC on DNA bending. A , the 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 2, 5, 10, 15, 25, 50 and 100 nM of HMGB1 lacking the acidic C-tail (HMGB1ΔC, left to right ), followed by ligation by T4 DNA ligase (DNA circularization assay). Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer. B , percentage of DNA circles formed by reduced (black triangle) or oxidized (empty triangle) HMGB1ΔC, as compared to DNA circles formed under the same conditions by reduced (black circles) or oxidized (empty circles) full-length HMGB1. The percentage of the minicircles formed at 100 nM HMGB1 was arbitrary set to 100% (each of the curves represent an average of three independent experiments). C , representative circularization assay using reduced HMGB1ΔC, oxidized HMGB1ΔC, and HMGB1ΔC(F37A). Concentrations of proteins were 5, 10, 25, 50 and 100 nM ( left to right ).

    Journal: PLoS ONE

    Article Title: Histone H1 Differentially Inhibits DNA Bending by Reduced and Oxidized HMGB1 Protein

    doi: 10.1371/journal.pone.0138774

    Figure Lengend Snippet: The effect of oxidization and mutation of Cys22/Cys44 or Phe37 of HMGB1ΔC on DNA bending. A , the 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 2, 5, 10, 15, 25, 50 and 100 nM of HMGB1 lacking the acidic C-tail (HMGB1ΔC, left to right ), followed by ligation by T4 DNA ligase (DNA circularization assay). Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer. B , percentage of DNA circles formed by reduced (black triangle) or oxidized (empty triangle) HMGB1ΔC, as compared to DNA circles formed under the same conditions by reduced (black circles) or oxidized (empty circles) full-length HMGB1. The percentage of the minicircles formed at 100 nM HMGB1 was arbitrary set to 100% (each of the curves represent an average of three independent experiments). C , representative circularization assay using reduced HMGB1ΔC, oxidized HMGB1ΔC, and HMGB1ΔC(F37A). Concentrations of proteins were 5, 10, 25, 50 and 100 nM ( left to right ).

    Article Snippet: In agreement with previous reports [ , ], histone H1 could stimulate formation of linear multimers by T4 DNA ligase at low H1-to-DNA ratios.

    Techniques: Mutagenesis, Labeling, Incubation, Ligation, Electrophoresis

    The effect of oxidization and mutation of Cys22/Cys44 or Phe37 of HMGB1 on DNA bending. A , the 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was preincubated with 2, 5, 10, 15, 25, 50 and 100 nM HMGB1 proteins ( left to right ), followed by ligation by T4 DNA ligase (DNA circularization assay). Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer. B , percentage of DNA circles formed by reduced HMGB1, oxidized HMGB1 or HMGB1(Cys22A/Cys44A) mutant. The percentage of the minicircles formed at 100 nM HMGB1 was arbitrary set to 100% (each of the curves represent an average of three independent experiments). C , representative circularization assay using reduced HMGB1 and HMGB1(F37A) mutant (5, 20, 50 and 100 nM HMGB1, left to right ). C22/C44, HMGB1(Cys22A/Cys44A) mutant.

    Journal: PLoS ONE

    Article Title: Histone H1 Differentially Inhibits DNA Bending by Reduced and Oxidized HMGB1 Protein

    doi: 10.1371/journal.pone.0138774

    Figure Lengend Snippet: The effect of oxidization and mutation of Cys22/Cys44 or Phe37 of HMGB1 on DNA bending. A , the 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was preincubated with 2, 5, 10, 15, 25, 50 and 100 nM HMGB1 proteins ( left to right ), followed by ligation by T4 DNA ligase (DNA circularization assay). Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer. B , percentage of DNA circles formed by reduced HMGB1, oxidized HMGB1 or HMGB1(Cys22A/Cys44A) mutant. The percentage of the minicircles formed at 100 nM HMGB1 was arbitrary set to 100% (each of the curves represent an average of three independent experiments). C , representative circularization assay using reduced HMGB1 and HMGB1(F37A) mutant (5, 20, 50 and 100 nM HMGB1, left to right ). C22/C44, HMGB1(Cys22A/Cys44A) mutant.

    Article Snippet: In agreement with previous reports [ , ], histone H1 could stimulate formation of linear multimers by T4 DNA ligase at low H1-to-DNA ratios.

    Techniques: Mutagenesis, Labeling, Ligation, Electrophoresis

    Dependence of the efficiency of DNA ligation using T4 DNA ligase immobilized on ferromagnetic particles in the absence of a magnetic field on the ambient temperature. The ordinate axis represents the ligation efficiency, which is normalized by that at 16 °C. The standard deviations are obtained from 6 independent experiments.

    Journal: Biochemistry and Biophysics Reports

    Article Title: Efficient DNA ligation by selective heating of DNA ligase with a radio frequency alternating magnetic field

    doi: 10.1016/j.bbrep.2016.10.006

    Figure Lengend Snippet: Dependence of the efficiency of DNA ligation using T4 DNA ligase immobilized on ferromagnetic particles in the absence of a magnetic field on the ambient temperature. The ordinate axis represents the ligation efficiency, which is normalized by that at 16 °C. The standard deviations are obtained from 6 independent experiments.

    Article Snippet: In summary, we carried out the ligation of DNA fragments with cohesive ends using T4 DNA ligase immobilized on ferromagnetic particles and found that the ligation efficiency was increased under a radio frequency alternating magnetic field caused by heat generation from the particles.

    Techniques: DNA Ligation, Ligation

    Dependence of the efficiency of DNA ligation using T4 DNA ligase immobilized on ferromagnetic particles under an ac magnetic field of 0.34 MHz on the amplitude of the magnetic field. The ambient temperature is 16 °C. The ordinate axis represents the ligation efficiency under an ac magnetic field, which is normalized by that in the absence of a magnetic field. The inset shows the ligation efficiency under the ac magnetic field as a function of the average surface temperature of ferromagnetic particles, noting that the surface temperature increases with an increase in the field amplitude. The standard deviations are obtained from 6 independent experiments.

    Journal: Biochemistry and Biophysics Reports

    Article Title: Efficient DNA ligation by selective heating of DNA ligase with a radio frequency alternating magnetic field

    doi: 10.1016/j.bbrep.2016.10.006

    Figure Lengend Snippet: Dependence of the efficiency of DNA ligation using T4 DNA ligase immobilized on ferromagnetic particles under an ac magnetic field of 0.34 MHz on the amplitude of the magnetic field. The ambient temperature is 16 °C. The ordinate axis represents the ligation efficiency under an ac magnetic field, which is normalized by that in the absence of a magnetic field. The inset shows the ligation efficiency under the ac magnetic field as a function of the average surface temperature of ferromagnetic particles, noting that the surface temperature increases with an increase in the field amplitude. The standard deviations are obtained from 6 independent experiments.

    Article Snippet: In summary, we carried out the ligation of DNA fragments with cohesive ends using T4 DNA ligase immobilized on ferromagnetic particles and found that the ligation efficiency was increased under a radio frequency alternating magnetic field caused by heat generation from the particles.

    Techniques: DNA Ligation, Ligation

    Ligation assay by T4 DNA ligase. Time scan curves of liga tion catalyzed by various concentrations of T4 DNA ligase. The curves from top to bottom are those obtained with different T4 DNA ligase concentrations: 2.3, 0.23, 0.115, 6.9 × 10 –2 , 2.3 × 10 –2 , 1.2 × 10 –2 , 6.9 × 10 –3 , 2.3 × 10 –3 , 1.2 × 10 –3 and 2.3 × 10 –4 U/ml. (Insert) The initial ligation velocity is plotted as a function of the concentration of T4 DNA ligase.

    Journal: Nucleic Acids Research

    Article Title: Real-time monitoring of nucleic acid ligation in homogenous solutions using molecular beacons

    doi: 10.1093/nar/gng146

    Figure Lengend Snippet: Ligation assay by T4 DNA ligase. Time scan curves of liga tion catalyzed by various concentrations of T4 DNA ligase. The curves from top to bottom are those obtained with different T4 DNA ligase concentrations: 2.3, 0.23, 0.115, 6.9 × 10 –2 , 2.3 × 10 –2 , 1.2 × 10 –2 , 6.9 × 10 –3 , 2.3 × 10 –3 , 1.2 × 10 –3 and 2.3 × 10 –4 U/ml. (Insert) The initial ligation velocity is plotted as a function of the concentration of T4 DNA ligase.

    Article Snippet: Two samples containing 10 µl reaction solutions were moved from each sample before adding T4 DNA ligase, and after the ligation process had taken place for 360 s with the addition of ligase.

    Techniques: Ligation, Concentration Assay

    Real-time fluorescence scans and corresponding gel electrophoresis. (Left) Curve A is a time scan of fluorescence intensity of MB with N1; B is of MB with N2 and N4; C is of MB with N2 and N3; curve D is of MB itself. t 0 is the time when T4 DNA ligase is added into the MB/oligo solution. (Right) Gel electrophoresis images. Lanes 1 and 2 are for sample D; 3 and 4 for sample C; 5 and 6 for sample B; and 7 and 8 for sample A. Lanes 1, 3, 5 and 7 represent samples D, C, B and A before the addition of T4 DNA ligase, while lanes 2, 4, 6 and 8 represent corresponding samples obtained at 360 s after the addition of ligase. There is a major difference between lanes 5 and 6, while there is basically no difference for all the other pairs.

    Journal: Nucleic Acids Research

    Article Title: Real-time monitoring of nucleic acid ligation in homogenous solutions using molecular beacons

    doi: 10.1093/nar/gng146

    Figure Lengend Snippet: Real-time fluorescence scans and corresponding gel electrophoresis. (Left) Curve A is a time scan of fluorescence intensity of MB with N1; B is of MB with N2 and N4; C is of MB with N2 and N3; curve D is of MB itself. t 0 is the time when T4 DNA ligase is added into the MB/oligo solution. (Right) Gel electrophoresis images. Lanes 1 and 2 are for sample D; 3 and 4 for sample C; 5 and 6 for sample B; and 7 and 8 for sample A. Lanes 1, 3, 5 and 7 represent samples D, C, B and A before the addition of T4 DNA ligase, while lanes 2, 4, 6 and 8 represent corresponding samples obtained at 360 s after the addition of ligase. There is a major difference between lanes 5 and 6, while there is basically no difference for all the other pairs.

    Article Snippet: Two samples containing 10 µl reaction solutions were moved from each sample before adding T4 DNA ligase, and after the ligation process had taken place for 360 s with the addition of ligase.

    Techniques: Fluorescence, Nucleic Acid Electrophoresis