Structured Review

TaKaRa t4 ligase
T4 Ligase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 31 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 ligase/product/TaKaRa
Average 95 stars, based on 31 article reviews
Price from $9.99 to $1999.99
t4 ligase - by Bioz Stars, 2020-01
95/100 stars

Images

Related Articles

Clone Assay:

Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
Article Snippet: .. E. coli strain DH5α, cloning vector pUCm-T Vector, small amount of UNIQ-10 column plasmid extraction kit and DNA gel extraction kit were purchased from Shanghai Sangon biotech Company; Oligo (dT) 15, RTase M-MLV, Taq enzyme, dNTP, restriction endonucleases, T4 ligase and DNA Marker were purchased from TAKARA company; Agrobacterium strain EHA105 and binary expression vector GFP-pBI121 containing the GFP gene was provided by our laboratory; other conventional chemical reagents were all AR. ..

Article Title: Dynamic interaction of SARAF with STIM1 and Orai1 to modulate store-operated calcium entry
Article Snippet: Mouse anti-GFP antibody (mixture of two monoclonal antibodies, clones 7.1 and 13.1, which recognize both wild-type and mutant forms of GFP, such as YFP ; catalogue number 11814460001) and complete EDTA-free protease inhibitor tablets were from Roche (Madrid, Spain). .. Taq Polimerase, T4 ligase, EcoRI and EcoRV enzymes were from Takara (Bio Inc, Japan).

Article Title: Expression of HERV-K108 envelope interferes with HIV-1 production
Article Snippet: .. All env PCR products were cloned using HinDIII-SmaI restriction sites and either T4 ligase or In-fusion technology (Clontech Laboratories, Inc.) into a derivative of vector pTR600 [ ] containing the HERV-K RcRe (Rec response element) segment, for RNA nuclear export [ ]. .. All HERV-K env mutants where obtained by PCR mediated site directed mutagenesis, using as template HERV-Kcon env encoding plasmid pCRV1/ env and verified by sequencing. pCRV1/ env pcRV1 K-rev, and pNL4-3 Luc HXB3, were a kind gift from Dr. Paul Bieniasz (Aaron Diamond AIDS Research Center, The Rockefeller University). pTR600 rec -HA was generated by PCR using pcRV1 K-rev as template, and cloned using HinDIII-SmaI restriction sites and In-fusion technology (Clontech Laboratories, Inc.) into a derivative of vector pTR600.

Article Title: Dissecting transcription regulatory pathways through a new bacterial one-hybrid reporter system
Article Snippet: The E. coli DH5α host strain for cloning was purchased from Stratagene. .. Restriction enzymes, T4 ligase, and modification enzymes were from TaKaRa Biotech.

Article Title: Differential binding of tetrodotoxin and its derivatives to voltage‐sensitive sodium channel subtypes (Nav1.1 to Nav1.7)) Differential binding of tetrodotoxin and its derivatives to voltage‐sensitive sodium channel subtypes (Nav1.1 to Nav1.7)
Article Snippet: .. KOD‐Plus, T4 ligase and the In‐Fusion HD Cloning kit were purchased from Takara Bio, Inc. (Kusatsu, Shiga, Japan). .. PCR primers were purchased from Fasmac Co., Ltd. (Atsugi, Kanagawa, Japan).

Amplification:

Article Title: Identification of Genes Involved in the Responses of Tangor (C. reticulata × C. sinensis) to Drought Stress
Article Snippet: Finally, 122 marker pairs with highly polymorphism and better amplification were picked out and performed in this study. .. The two steps of digestion were conducted in NEBuffer 3 (New England Biolabs, Inc., Beverly, MA) in a total volume of 50 μ l. The digested products were purified and ligated to adapters using 1 U of T4 ligase supplemented with T4 DNA ligase buffer (Takara, Dalian, China).

Expressing:

Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
Article Snippet: .. E. coli strain DH5α, cloning vector pUCm-T Vector, small amount of UNIQ-10 column plasmid extraction kit and DNA gel extraction kit were purchased from Shanghai Sangon biotech Company; Oligo (dT) 15, RTase M-MLV, Taq enzyme, dNTP, restriction endonucleases, T4 ligase and DNA Marker were purchased from TAKARA company; Agrobacterium strain EHA105 and binary expression vector GFP-pBI121 containing the GFP gene was provided by our laboratory; other conventional chemical reagents were all AR. ..

Article Title: Expression of HERV-K108 envelope interferes with HIV-1 production
Article Snippet: All env PCR products were cloned using HinDIII-SmaI restriction sites and either T4 ligase or In-fusion technology (Clontech Laboratories, Inc.) into a derivative of vector pTR600 [ ] containing the HERV-K RcRe (Rec response element) segment, for RNA nuclear export [ ]. .. The EGFP expressing plasmid used is pEGFP-N1 obtained from Clontech.

Article Title: Differential binding of tetrodotoxin and its derivatives to voltage‐sensitive sodium channel subtypes (Nav1.1 to Nav1.7)) Differential binding of tetrodotoxin and its derivatives to voltage‐sensitive sodium channel subtypes (Nav1.1 to Nav1.7)
Article Snippet: A vector for the expression of VSSCs in a HEK cell line, pCDM8, was kindly provided by associate professor Frank H. Yu of the School of Dentistry, Seoul National University. .. KOD‐Plus, T4 ligase and the In‐Fusion HD Cloning kit were purchased from Takara Bio, Inc. (Kusatsu, Shiga, Japan).

Synthesized:

Article Title: Novel TetR family transcriptional factor regulates expression of multiple transport-related genes and affects rifampicin resistance in Mycobacterium smegmatis
Article Snippet: Restriction enzymes, T4 ligase, dNTPs and all antibiotics were purchased from TaKaRa Biotech (Shiga, Japan). .. All primers were synthesized by Tsingke Biological Technology (Wuhan, China) ( ).

Article Title: Cordycepin kills Mycobacterium tuberculosis through hijacking the bacterial adenosine kinase
Article Snippet: Restriction enzymes, T4 ligase, modification enzymes, DNA polymerase, dNTPs were obtained from TaKaRa Biotech (Shiga, Japan). .. PCR primers were synthesized by Invitrogen (Carlsbad, USA).

Article Title: A TetR-like regulator broadly affects the expressions of diverse genes in Mycobacterium smegmatis
Article Snippet: Restriction enzymes, T4 ligase, modification enzymes, Pyrobest DNA polymerase, dNTPs and all antibiotics were obtained from TaKaRa Biotech. .. Polymerase Chain Reaction (PCR) primers were synthesized by Invitrogen ( Supplementary Table S1 ) and Ni-NTA (Ni2+ -nitrilotriacetate) agarose was obtained from Qiagen.

Article Title: Differential binding of tetrodotoxin and its derivatives to voltage‐sensitive sodium channel subtypes (Nav1.1 to Nav1.7)) Differential binding of tetrodotoxin and its derivatives to voltage‐sensitive sodium channel subtypes (Nav1.1 to Nav1.7)
Article Snippet: TTX ( 1 ) (Ohyabu et al., ; Nishikawa et al., ; Urabe et al., ), CHTX ( 2 ) (Adachi et al., ), 8‐deoxyTTX ( 3 ) (Satake et al., ( 4 ) (Ohyabu et al., ; Nishikawa et al., ; Urabe et al., ), 4,9‐anhydroCHTX ( 5 ), 4,9‐anhydro‐8‐deoxyTTX ( 6 ), 5‐deoxyTTX ( 7 ) (Satake et al., ), 5,11‐dideoxyTTX ( 8 ) (Nishikawa et al., ; Asai et al., ; Yotsu‐Yamashita et al., ), 5,6,11‐trideoxyTTX ( 9 ) (Adachi et al., ), 4,9‐anhydro‐5‐deoxyTTX ( 10 ) (Satake et al., ), 4,9‐anhydro‐5,11‐dideoxyTTX ( 11 ) (Nishikawa et al., ; Asai et al., ; Yotsu‐Yamashita et al., ) and 4,9‐anhydro‐5,6,11‐trideoxyTTX ( 12 ) (Adachi et al., ) were synthesized as reported in the literature (Figure ). cDNAs for each subtype of human voltage‐dependent sodium channel were purchased from Origene Technologies, Inc. (Rockville, MD, USA). .. KOD‐Plus, T4 ligase and the In‐Fusion HD Cloning kit were purchased from Takara Bio, Inc. (Kusatsu, Shiga, Japan).

Article Title: A GntR family transcription factor positively regulates mycobacterial isoniazid resistance by controlling the expression of a putative permease
Article Snippet: Restriction enzymes, T4 ligase, Modification enzymes, Pyrobest DNA polymerase, dNTPs and all antibiotics were obtained from TaKaRa Biotech (Shiga, Japan). .. Polymerase Chain Reaction (PCR) primers were synthesized by Invitrogen (Carlsbad, CA, USA) (Additional file : Table S2).

Article Title: InbR, a TetR family regulator, binds with isoniazid and influences multidrug resistance in Mycobacterium bovis BCG
Article Snippet: Restriction enzymes, T4 ligase, modification enzymes, DNA polymerase, dNTPs, and all antibiotics were obtained from TaKaRa Biotech (Shiga, Japan). .. PCR primers were synthesized by Invitrogen (Carlsbad, USA).

Article Title: Identification of Genes Involved in the Responses of Tangor (C. reticulata × C. sinensis) to Drought Stress
Article Snippet: To select the perfect primer pairs for this study, a total of 256 primer pairs that flowed from the permutation and combination of A, T, C, and G were synthesized. .. The two steps of digestion were conducted in NEBuffer 3 (New England Biolabs, Inc., Beverly, MA) in a total volume of 50 μ l. The digested products were purified and ligated to adapters using 1 U of T4 ligase supplemented with T4 DNA ligase buffer (Takara, Dalian, China).

Article Title: Characterization of the Interaction and Cross-Regulation of Three Mycobacterium tuberculosis RelBE Modules
Article Snippet: Restriction enzymes, T4 ligase, modification enzymes, Pyrobest DNA polymerase, dNTPs and all antibiotics were from TaKaRa Biotech. .. PCR primers were synthesized by Invitrogen ( ).

Mutagenesis:

Article Title: Dynamic interaction of SARAF with STIM1 and Orai1 to modulate store-operated calcium entry
Article Snippet: Mouse anti-GFP antibody (mixture of two monoclonal antibodies, clones 7.1 and 13.1, which recognize both wild-type and mutant forms of GFP, such as YFP ; catalogue number 11814460001) and complete EDTA-free protease inhibitor tablets were from Roche (Madrid, Spain). .. Taq Polimerase, T4 ligase, EcoRI and EcoRV enzymes were from Takara (Bio Inc, Japan).

Article Title: Expression of HERV-K108 envelope interferes with HIV-1 production
Article Snippet: All env PCR products were cloned using HinDIII-SmaI restriction sites and either T4 ligase or In-fusion technology (Clontech Laboratories, Inc.) into a derivative of vector pTR600 [ ] containing the HERV-K RcRe (Rec response element) segment, for RNA nuclear export [ ]. .. All HERV-K env mutants where obtained by PCR mediated site directed mutagenesis, using as template HERV-Kcon env encoding plasmid pCRV1/ env and verified by sequencing. pCRV1/ env pcRV1 K-rev, and pNL4-3 Luc HXB3, were a kind gift from Dr. Paul Bieniasz (Aaron Diamond AIDS Research Center, The Rockefeller University). pTR600 rec -HA was generated by PCR using pcRV1 K-rev as template, and cloned using HinDIII-SmaI restriction sites and In-fusion technology (Clontech Laboratories, Inc.) into a derivative of vector pTR600.

Protease Inhibitor:

Article Title: Dynamic interaction of SARAF with STIM1 and Orai1 to modulate store-operated calcium entry
Article Snippet: Mouse anti-GFP antibody (mixture of two monoclonal antibodies, clones 7.1 and 13.1, which recognize both wild-type and mutant forms of GFP, such as YFP ; catalogue number 11814460001) and complete EDTA-free protease inhibitor tablets were from Roche (Madrid, Spain). .. Taq Polimerase, T4 ligase, EcoRI and EcoRV enzymes were from Takara (Bio Inc, Japan).

Marker:

Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
Article Snippet: .. E. coli strain DH5α, cloning vector pUCm-T Vector, small amount of UNIQ-10 column plasmid extraction kit and DNA gel extraction kit were purchased from Shanghai Sangon biotech Company; Oligo (dT) 15, RTase M-MLV, Taq enzyme, dNTP, restriction endonucleases, T4 ligase and DNA Marker were purchased from TAKARA company; Agrobacterium strain EHA105 and binary expression vector GFP-pBI121 containing the GFP gene was provided by our laboratory; other conventional chemical reagents were all AR. ..

Article Title: Identification of Genes Involved in the Responses of Tangor (C. reticulata × C. sinensis) to Drought Stress
Article Snippet: Finally, 122 marker pairs with highly polymorphism and better amplification were picked out and performed in this study. .. The two steps of digestion were conducted in NEBuffer 3 (New England Biolabs, Inc., Beverly, MA) in a total volume of 50 μ l. The digested products were purified and ligated to adapters using 1 U of T4 ligase supplemented with T4 DNA ligase buffer (Takara, Dalian, China).

Construct:

Article Title: Novel TetR family transcriptional factor regulates expression of multiple transport-related genes and affects rifampicin resistance in Mycobacterium smegmatis
Article Snippet: Strains, enzymes, plasmid, regents and DNA primers E.coli DH5α cells were used to construct the recombinant plasmids. .. Restriction enzymes, T4 ligase, dNTPs and all antibiotics were purchased from TaKaRa Biotech (Shiga, Japan).

Purification:

Article Title: Identification of Genes Involved in the Responses of Tangor (C. reticulata × C. sinensis) to Drought Stress
Article Snippet: .. The two steps of digestion were conducted in NEBuffer 3 (New England Biolabs, Inc., Beverly, MA) in a total volume of 50 μ l. The digested products were purified and ligated to adapters using 1 U of T4 ligase supplemented with T4 DNA ligase buffer (Takara, Dalian, China). .. The 2.5 μ l diluted (1 : 10) ligated products was used as the cDNA template to perform preamplification in a 25 μ l reaction mixture containing 0.4 μ M of each primer ( Taq I: 5′- GACGATGAGTCCTGACCGA -3′, Ase I: 5′- CTCGTAGACTGCGTACCTAAT -3′), 2.5 μ l 10x amplification buffer, and 1 U Taq DNA polymerase (Takara).

Modification:

Article Title: Cordycepin kills Mycobacterium tuberculosis through hijacking the bacterial adenosine kinase
Article Snippet: .. Restriction enzymes, T4 ligase, modification enzymes, DNA polymerase, dNTPs were obtained from TaKaRa Biotech (Shiga, Japan). .. PCR primers were synthesized by Invitrogen (Carlsbad, USA).

Article Title: Dissecting transcription regulatory pathways through a new bacterial one-hybrid reporter system
Article Snippet: .. Restriction enzymes, T4 ligase, and modification enzymes were from TaKaRa Biotech. .. Pyrobest DNA polymerase and deoxynucleoside triphosphates (dNTPs) were purchased from TaKaRa Biotech.

Article Title: A TetR-like regulator broadly affects the expressions of diverse genes in Mycobacterium smegmatis
Article Snippet: .. Restriction enzymes, T4 ligase, modification enzymes, Pyrobest DNA polymerase, dNTPs and all antibiotics were obtained from TaKaRa Biotech. .. The reagents for one-hybrid assay were purchased from Stratagene.

Article Title: A GntR family transcription factor positively regulates mycobacterial isoniazid resistance by controlling the expression of a putative permease
Article Snippet: .. Restriction enzymes, T4 ligase, Modification enzymes, Pyrobest DNA polymerase, dNTPs and all antibiotics were obtained from TaKaRa Biotech (Shiga, Japan). .. The reagents for one-hybrid assay were purchased from Stratagene.

Article Title: InbR, a TetR family regulator, binds with isoniazid and influences multidrug resistance in Mycobacterium bovis BCG
Article Snippet: .. Restriction enzymes, T4 ligase, modification enzymes, DNA polymerase, dNTPs, and all antibiotics were obtained from TaKaRa Biotech (Shiga, Japan). .. PCR primers were synthesized by Invitrogen (Carlsbad, USA).

Article Title: Characterization of the Interaction and Cross-Regulation of Three Mycobacterium tuberculosis RelBE Modules
Article Snippet: .. Restriction enzymes, T4 ligase, modification enzymes, Pyrobest DNA polymerase, dNTPs and all antibiotics were from TaKaRa Biotech. .. The reagents for one-hybrid assay and two-hybrid assay were purchased from Stratagene.

Generated:

Article Title: Expression of HERV-K108 envelope interferes with HIV-1 production
Article Snippet: All HERV-K env s, except HERV-Kcon env , were generated by PCR using genomic DNA or cDNA from primary PBMCs. .. All env PCR products were cloned using HinDIII-SmaI restriction sites and either T4 ligase or In-fusion technology (Clontech Laboratories, Inc.) into a derivative of vector pTR600 [ ] containing the HERV-K RcRe (Rec response element) segment, for RNA nuclear export [ ].

Polymerase Chain Reaction:

Article Title: Cordycepin kills Mycobacterium tuberculosis through hijacking the bacterial adenosine kinase
Article Snippet: Restriction enzymes, T4 ligase, modification enzymes, DNA polymerase, dNTPs were obtained from TaKaRa Biotech (Shiga, Japan). .. PCR primers were synthesized by Invitrogen (Carlsbad, USA).

Article Title: Expression of HERV-K108 envelope interferes with HIV-1 production
Article Snippet: .. All env PCR products were cloned using HinDIII-SmaI restriction sites and either T4 ligase or In-fusion technology (Clontech Laboratories, Inc.) into a derivative of vector pTR600 [ ] containing the HERV-K RcRe (Rec response element) segment, for RNA nuclear export [ ]. .. All HERV-K env mutants where obtained by PCR mediated site directed mutagenesis, using as template HERV-Kcon env encoding plasmid pCRV1/ env and verified by sequencing. pCRV1/ env pcRV1 K-rev, and pNL4-3 Luc HXB3, were a kind gift from Dr. Paul Bieniasz (Aaron Diamond AIDS Research Center, The Rockefeller University). pTR600 rec -HA was generated by PCR using pcRV1 K-rev as template, and cloned using HinDIII-SmaI restriction sites and In-fusion technology (Clontech Laboratories, Inc.) into a derivative of vector pTR600.

Article Title: A TetR-like regulator broadly affects the expressions of diverse genes in Mycobacterium smegmatis
Article Snippet: Restriction enzymes, T4 ligase, modification enzymes, Pyrobest DNA polymerase, dNTPs and all antibiotics were obtained from TaKaRa Biotech. .. Polymerase Chain Reaction (PCR) primers were synthesized by Invitrogen ( Supplementary Table S1 ) and Ni-NTA (Ni2+ -nitrilotriacetate) agarose was obtained from Qiagen.

Article Title: Differential binding of tetrodotoxin and its derivatives to voltage‐sensitive sodium channel subtypes (Nav1.1 to Nav1.7)) Differential binding of tetrodotoxin and its derivatives to voltage‐sensitive sodium channel subtypes (Nav1.1 to Nav1.7)
Article Snippet: KOD‐Plus, T4 ligase and the In‐Fusion HD Cloning kit were purchased from Takara Bio, Inc. (Kusatsu, Shiga, Japan). .. PCR primers were purchased from Fasmac Co., Ltd. (Atsugi, Kanagawa, Japan).

Article Title: A GntR family transcription factor positively regulates mycobacterial isoniazid resistance by controlling the expression of a putative permease
Article Snippet: Restriction enzymes, T4 ligase, Modification enzymes, Pyrobest DNA polymerase, dNTPs and all antibiotics were obtained from TaKaRa Biotech (Shiga, Japan). .. Polymerase Chain Reaction (PCR) primers were synthesized by Invitrogen (Carlsbad, CA, USA) (Additional file : Table S2).

Article Title: InbR, a TetR family regulator, binds with isoniazid and influences multidrug resistance in Mycobacterium bovis BCG
Article Snippet: Restriction enzymes, T4 ligase, modification enzymes, DNA polymerase, dNTPs, and all antibiotics were obtained from TaKaRa Biotech (Shiga, Japan). .. PCR primers were synthesized by Invitrogen (Carlsbad, USA).

Article Title: Identification of Genes Involved in the Responses of Tangor (C. reticulata × C. sinensis) to Drought Stress
Article Snippet: The two steps of digestion were conducted in NEBuffer 3 (New England Biolabs, Inc., Beverly, MA) in a total volume of 50 μ l. The digested products were purified and ligated to adapters using 1 U of T4 ligase supplemented with T4 DNA ligase buffer (Takara, Dalian, China). .. The PCR was carried out using the following cycling parameters: 94°C for 5 min; 25 cycles of 94°C for 30 s, 56°C for 30 s, 72°C for 1 min, and 72°C for 10 min. For further selective amplification, the PCR solution included 1 μ l of 10-fold diluted preamplification products, 1.5 μ l 10x amplification buffer, 0.5 U Taq polymerase, and 0.4 μ M of each primer with selective nucleotides on the 3′ end ( Taq I/ Ase I: AA, AC, AG, AT, CA, CC, CG, CT, GA, GC, GG, GT, TA, TC, TG, TT) in 15 μ l total reaction volume.

Article Title: Characterization of the Interaction and Cross-Regulation of Three Mycobacterium tuberculosis RelBE Modules
Article Snippet: Restriction enzymes, T4 ligase, modification enzymes, Pyrobest DNA polymerase, dNTPs and all antibiotics were from TaKaRa Biotech. .. PCR primers were synthesized by Invitrogen ( ).

cDNA-AFLP Assay:

Article Title: Identification of Genes Involved in the Responses of Tangor (C. reticulata × C. sinensis) to Drought Stress
Article Snippet: Paragraph title: 2.4. cDNA-AFLP Analysis ... The two steps of digestion were conducted in NEBuffer 3 (New England Biolabs, Inc., Beverly, MA) in a total volume of 50 μ l. The digested products were purified and ligated to adapters using 1 U of T4 ligase supplemented with T4 DNA ligase buffer (Takara, Dalian, China).

DNA Purification:

Article Title: Novel TetR family transcriptional factor regulates expression of multiple transport-related genes and affects rifampicin resistance in Mycobacterium smegmatis
Article Snippet: Restriction enzymes, T4 ligase, dNTPs and all antibiotics were purchased from TaKaRa Biotech (Shiga, Japan). .. DNA purification kits were purchased from Waston Biotechnologies (Wuhan China).

Sequencing:

Article Title: Expression of HERV-K108 envelope interferes with HIV-1 production
Article Snippet: All env PCR products were cloned using HinDIII-SmaI restriction sites and either T4 ligase or In-fusion technology (Clontech Laboratories, Inc.) into a derivative of vector pTR600 [ ] containing the HERV-K RcRe (Rec response element) segment, for RNA nuclear export [ ]. .. All HERV-K env mutants where obtained by PCR mediated site directed mutagenesis, using as template HERV-Kcon env encoding plasmid pCRV1/ env and verified by sequencing. pCRV1/ env pcRV1 K-rev, and pNL4-3 Luc HXB3, were a kind gift from Dr. Paul Bieniasz (Aaron Diamond AIDS Research Center, The Rockefeller University). pTR600 rec -HA was generated by PCR using pcRV1 K-rev as template, and cloned using HinDIII-SmaI restriction sites and In-fusion technology (Clontech Laboratories, Inc.) into a derivative of vector pTR600.

Gel Extraction:

Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
Article Snippet: .. E. coli strain DH5α, cloning vector pUCm-T Vector, small amount of UNIQ-10 column plasmid extraction kit and DNA gel extraction kit were purchased from Shanghai Sangon biotech Company; Oligo (dT) 15, RTase M-MLV, Taq enzyme, dNTP, restriction endonucleases, T4 ligase and DNA Marker were purchased from TAKARA company; Agrobacterium strain EHA105 and binary expression vector GFP-pBI121 containing the GFP gene was provided by our laboratory; other conventional chemical reagents were all AR. ..

Recombinant:

Article Title: Novel TetR family transcriptional factor regulates expression of multiple transport-related genes and affects rifampicin resistance in Mycobacterium smegmatis
Article Snippet: Strains, enzymes, plasmid, regents and DNA primers E.coli DH5α cells were used to construct the recombinant plasmids. .. Restriction enzymes, T4 ligase, dNTPs and all antibiotics were purchased from TaKaRa Biotech (Shiga, Japan).

Two Hybrid Assay:

Article Title: Characterization of the Interaction and Cross-Regulation of Three Mycobacterium tuberculosis RelBE Modules
Article Snippet: Restriction enzymes, T4 ligase, modification enzymes, Pyrobest DNA polymerase, dNTPs and all antibiotics were from TaKaRa Biotech. .. The reagents for one-hybrid assay and two-hybrid assay were purchased from Stratagene.

Plasmid Preparation:

Article Title: Transformation of tobacco plants by Yali PPO-GFP fusion gene and observation of subcellular localization
Article Snippet: .. E. coli strain DH5α, cloning vector pUCm-T Vector, small amount of UNIQ-10 column plasmid extraction kit and DNA gel extraction kit were purchased from Shanghai Sangon biotech Company; Oligo (dT) 15, RTase M-MLV, Taq enzyme, dNTP, restriction endonucleases, T4 ligase and DNA Marker were purchased from TAKARA company; Agrobacterium strain EHA105 and binary expression vector GFP-pBI121 containing the GFP gene was provided by our laboratory; other conventional chemical reagents were all AR. ..

Article Title: Dynamic interaction of SARAF with STIM1 and Orai1 to modulate store-operated calcium entry
Article Snippet: Taq Polimerase, T4 ligase, EcoRI and EcoRV enzymes were from Takara (Bio Inc, Japan). .. Ultraclean GelSpin Kit® and Ultraclean Midi plasmid prep Kit® were from MoBio (MO BIO Laboratories, Carlsbad, USA).

Article Title: Novel TetR family transcriptional factor regulates expression of multiple transport-related genes and affects rifampicin resistance in Mycobacterium smegmatis
Article Snippet: Paragraph title: Strains, enzymes, plasmid, regents and DNA primers ... Restriction enzymes, T4 ligase, dNTPs and all antibiotics were purchased from TaKaRa Biotech (Shiga, Japan).

Article Title: Expression of HERV-K108 envelope interferes with HIV-1 production
Article Snippet: .. All env PCR products were cloned using HinDIII-SmaI restriction sites and either T4 ligase or In-fusion technology (Clontech Laboratories, Inc.) into a derivative of vector pTR600 [ ] containing the HERV-K RcRe (Rec response element) segment, for RNA nuclear export [ ]. .. All HERV-K env mutants where obtained by PCR mediated site directed mutagenesis, using as template HERV-Kcon env encoding plasmid pCRV1/ env and verified by sequencing. pCRV1/ env pcRV1 K-rev, and pNL4-3 Luc HXB3, were a kind gift from Dr. Paul Bieniasz (Aaron Diamond AIDS Research Center, The Rockefeller University). pTR600 rec -HA was generated by PCR using pcRV1 K-rev as template, and cloned using HinDIII-SmaI restriction sites and In-fusion technology (Clontech Laboratories, Inc.) into a derivative of vector pTR600.

Article Title: Differential binding of tetrodotoxin and its derivatives to voltage‐sensitive sodium channel subtypes (Nav1.1 to Nav1.7)) Differential binding of tetrodotoxin and its derivatives to voltage‐sensitive sodium channel subtypes (Nav1.1 to Nav1.7)
Article Snippet: A vector for the expression of VSSCs in a HEK cell line, pCDM8, was kindly provided by associate professor Frank H. Yu of the School of Dentistry, Seoul National University. .. KOD‐Plus, T4 ligase and the In‐Fusion HD Cloning kit were purchased from Takara Bio, Inc. (Kusatsu, Shiga, Japan).

Article Title: A GntR family transcription factor positively regulates mycobacterial isoniazid resistance by controlling the expression of a putative permease
Article Snippet: Strains, enzymes, plasmids and reagents E. coli BL21 cells and pET28a vector were purchased from Novagen (Darmstadt, Germany). pBT, pTRG vectors and E. coli XR host strains were purchased from Stratagene (La Jolla, CA, USA) (Additional file : Table S1). .. Restriction enzymes, T4 ligase, Modification enzymes, Pyrobest DNA polymerase, dNTPs and all antibiotics were obtained from TaKaRa Biotech (Shiga, Japan).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa t4 dna ligase
    15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using <t>T4</t> DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.
    T4 Dna Ligase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 592 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/TaKaRa
    Average 90 stars, based on 592 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results


    15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: 15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

    Article Snippet: Therefore, the ligation products would decrease when the 5′-phosphate generated by the spontaneous nucleotide deletion was removed by CIAP, but increase again when the linkers deleting one or more nucleotide(s) at their 5′-ends increased as the CIAP inactivation at 85°C was extended from 15 min to 30–90 min. Our kinase assay for T4 DNA ligase showed that about 0.025–0.1% of oligo 11 could be phosphorylated by T4 DNA ligase and the phosphorylation of oligo 11 by T4 DNA ligase could be inhibited by CIAP treatment of oligo 11.

    Techniques: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

    12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

    Article Snippet: Therefore, the ligation products would decrease when the 5′-phosphate generated by the spontaneous nucleotide deletion was removed by CIAP, but increase again when the linkers deleting one or more nucleotide(s) at their 5′-ends increased as the CIAP inactivation at 85°C was extended from 15 min to 30–90 min. Our kinase assay for T4 DNA ligase showed that about 0.025–0.1% of oligo 11 could be phosphorylated by T4 DNA ligase and the phosphorylation of oligo 11 by T4 DNA ligase could be inhibited by CIAP treatment of oligo 11.

    Techniques: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Positive Control, Negative Control

    12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

    Article Snippet: Therefore, the ligation products would decrease when the 5′-phosphate generated by the spontaneous nucleotide deletion was removed by CIAP, but increase again when the linkers deleting one or more nucleotide(s) at their 5′-ends increased as the CIAP inactivation at 85°C was extended from 15 min to 30–90 min. Our kinase assay for T4 DNA ligase showed that about 0.025–0.1% of oligo 11 could be phosphorylated by T4 DNA ligase and the phosphorylation of oligo 11 by T4 DNA ligase could be inhibited by CIAP treatment of oligo 11.

    Techniques: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

    The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

    Article Snippet: Therefore, the ligation products would decrease when the 5′-phosphate generated by the spontaneous nucleotide deletion was removed by CIAP, but increase again when the linkers deleting one or more nucleotide(s) at their 5′-ends increased as the CIAP inactivation at 85°C was extended from 15 min to 30–90 min. Our kinase assay for T4 DNA ligase showed that about 0.025–0.1% of oligo 11 could be phosphorylated by T4 DNA ligase and the phosphorylation of oligo 11 by T4 DNA ligase could be inhibited by CIAP treatment of oligo 11.

    Techniques: Polyacrylamide Gel Electrophoresis, Electrophoresis, Negative Control, Positive Control