Structured Review

Roche t4 ligase
pol μ ribonucleotide incorporation with mixed nucleotide pools. (A) Alkali cleavage assay for incorporation of ribonucleotides. A single-nucleotide-gapped DNA substrate with template C was 5′ 32 P labeled as indicated (star). Alkali treatment of products containing incorporated ribonucleotides results in product cleavage, as well as transfer of the 32 P from the 20-nt downstream strand to the primer strand, generating a novel 26-nt species (species II). (B) DNA substrate (5 nM) as in panel A was present in all reaction mixtures. Where indicated, 0.05 U of <t>T4</t> ligase (+) and 0.5 nM pol μ (+) or 5 pM pol β (β) were added. Following a 1-min polymerization-ligation reaction, samples were treated with alkali as noted (+). A 25 μM concentration of each dNTP (d) or rNTP (r) was present as noted. Reaction mixtures 8 to 10 contained a mixture of both dNTPs and rNTPs (d + r), with 25 μM each dNTP and 25 μM (lane 8), 125 μM (lane 9), or 500 μM (lane 10) each rNTP. I, species I; II, species II.
T4 Ligase, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 33 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 ligase/product/Roche
Average 95 stars, based on 33 article reviews
Price from $9.99 to $1999.99
t4 ligase - by Bioz Stars, 2020-01
95/100 stars

Images

1) Product Images from "Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase"

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.23.7.2309-2315.2003

pol μ ribonucleotide incorporation with mixed nucleotide pools. (A) Alkali cleavage assay for incorporation of ribonucleotides. A single-nucleotide-gapped DNA substrate with template C was 5′ 32 P labeled as indicated (star). Alkali treatment of products containing incorporated ribonucleotides results in product cleavage, as well as transfer of the 32 P from the 20-nt downstream strand to the primer strand, generating a novel 26-nt species (species II). (B) DNA substrate (5 nM) as in panel A was present in all reaction mixtures. Where indicated, 0.05 U of T4 ligase (+) and 0.5 nM pol μ (+) or 5 pM pol β (β) were added. Following a 1-min polymerization-ligation reaction, samples were treated with alkali as noted (+). A 25 μM concentration of each dNTP (d) or rNTP (r) was present as noted. Reaction mixtures 8 to 10 contained a mixture of both dNTPs and rNTPs (d + r), with 25 μM each dNTP and 25 μM (lane 8), 125 μM (lane 9), or 500 μM (lane 10) each rNTP. I, species I; II, species II.
Figure Legend Snippet: pol μ ribonucleotide incorporation with mixed nucleotide pools. (A) Alkali cleavage assay for incorporation of ribonucleotides. A single-nucleotide-gapped DNA substrate with template C was 5′ 32 P labeled as indicated (star). Alkali treatment of products containing incorporated ribonucleotides results in product cleavage, as well as transfer of the 32 P from the 20-nt downstream strand to the primer strand, generating a novel 26-nt species (species II). (B) DNA substrate (5 nM) as in panel A was present in all reaction mixtures. Where indicated, 0.05 U of T4 ligase (+) and 0.5 nM pol μ (+) or 5 pM pol β (β) were added. Following a 1-min polymerization-ligation reaction, samples were treated with alkali as noted (+). A 25 μM concentration of each dNTP (d) or rNTP (r) was present as noted. Reaction mixtures 8 to 10 contained a mixture of both dNTPs and rNTPs (d + r), with 25 μM each dNTP and 25 μM (lane 8), 125 μM (lane 9), or 500 μM (lane 10) each rNTP. I, species I; II, species II.

Techniques Used: Cleavage Assay, Labeling, Ligation, Concentration Assay

2) Product Images from "Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase"

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase

Journal: Molecular and Cellular Biology

doi: 10.1128/MCB.23.7.2309-2315.2003

pol μ ribonucleotide incorporation with mixed nucleotide pools. (A) Alkali cleavage assay for incorporation of ribonucleotides. A single-nucleotide-gapped DNA substrate with template C was 5′ 32 P labeled as indicated (star). Alkali treatment of products containing incorporated ribonucleotides results in product cleavage, as well as transfer of the 32 P from the 20-nt downstream strand to the primer strand, generating a novel 26-nt species (species II). (B) DNA substrate (5 nM) as in panel A was present in all reaction mixtures. Where indicated, 0.05 U of T4 ligase (+) and 0.5 nM pol μ (+) or 5 pM pol β (β) were added. Following a 1-min polymerization-ligation reaction, samples were treated with alkali as noted (+). A 25 μM concentration of each dNTP (d) or rNTP (r) was present as noted. Reaction mixtures 8 to 10 contained a mixture of both dNTPs and rNTPs (d + r), with 25 μM each dNTP and 25 μM (lane 8), 125 μM (lane 9), or 500 μM (lane 10) each rNTP. I, species I; II, species II.
Figure Legend Snippet: pol μ ribonucleotide incorporation with mixed nucleotide pools. (A) Alkali cleavage assay for incorporation of ribonucleotides. A single-nucleotide-gapped DNA substrate with template C was 5′ 32 P labeled as indicated (star). Alkali treatment of products containing incorporated ribonucleotides results in product cleavage, as well as transfer of the 32 P from the 20-nt downstream strand to the primer strand, generating a novel 26-nt species (species II). (B) DNA substrate (5 nM) as in panel A was present in all reaction mixtures. Where indicated, 0.05 U of T4 ligase (+) and 0.5 nM pol μ (+) or 5 pM pol β (β) were added. Following a 1-min polymerization-ligation reaction, samples were treated with alkali as noted (+). A 25 μM concentration of each dNTP (d) or rNTP (r) was present as noted. Reaction mixtures 8 to 10 contained a mixture of both dNTPs and rNTPs (d + r), with 25 μM each dNTP and 25 μM (lane 8), 125 μM (lane 9), or 500 μM (lane 10) each rNTP. I, species I; II, species II.

Techniques Used: Cleavage Assay, Labeling, Ligation, Concentration Assay

Related Articles

Clone Assay:

Article Title: Colanic Acid Is a Novel Phage Receptor of Pectobacterium carotovorum subsp. carotovorum Phage POP72
Article Snippet: .. Determination of the Transposon Insertion Site by Rescue Cloning Genomic DNA extracted from the selected transposon mutants was digested with the restriction enzyme Bam HI, and purified DNA fragments were self-ligated with T4 ligase (Roche). .. E. coli DH5α λpir was transformed with the circularized DNA fragments by heat shock and plated on LBA/Kan.

Article Title: Genetic differentiation of the oriental rat flea, Xenopsylla cheopis, from two sympatric host species
Article Snippet: Adaptors containing EcoR I and Mse I sites were ligated onto the fragments using T4 ligase (Roche, Basel, Switzerland). .. Enriched DNA was PCR-amplified and cloned using the pMD18-T Vector System Kit (TaKaRa, Tokyo, Japan).

Article Title: Recovery of recombinant Mycobacterium tuberculosis antigens fused with cell wall-anchoring motif (LysM) from inclusion bodies using non-denaturing reagent (N-laurylsarcosine)
Article Snippet: The PCR reactions were carried based on these parameters; denaturation step at 95 °C for 5 min and amplification in 25 cycles of 1 min at 95 °C, 30 s at optimum annealing temperature, which was determined by gradient temperature ranging from 45 to 60 °C, and 1 min at 72 °C followed by one cycle at 72 °C for 10 min. Gel purified PCR products of AR and lys M were digested with Pst I, purified and ligated together at a 1:1 ratio using T4 ligase (Roche, Germany) to produce ligated product of the ARL gene. .. Subsequently, the ARL fusion gene was PCR amplified and cloned into pRSFDuet-1 plasmid.

Article Title: Cross-Reacting Antibacterial Auto-Antibodies Are Produced within Coronary Atherosclerotic Plaques of Acute Coronary Syndrome Patients
Article Snippet: Production and Purification of Klebsiella pneumoniae OmpK36 and Proteus mirabilis OmpF OmpK36, and OmpF were amplified from Klebsiella pneumoniae and Proteus mirabilis lysates respectively and cloned into a pET-28b expression vector (Novagen) by using the following primer pairs containing two distinct 5′ restriction endonuclease sequences: OmpK36NcoIFW: GCGCTAGTATGccatgggcATGAAAGTTAAAGTACTGT and OmpK36XhoIRW: GCGCTTCCTCGATACCTCGAGCTAGAACTGGTAAA ; OmpK36BamHIFW: GCGCTAGTCTGggatccgATGAAAGTTAAAGTACTGTC and OmpK36XhoIRW: TTCCTCGATACCTCGAGCTAGAACTGGTAAACCAG ; OmpF-Pr-BamHI TGATCGATCGAAATGggatccgATGATGAAGCGCAATAT and OmpF-Pr-XhoI GTA CCT AAT CCAGCAACGctcgagGAACTGATAAGT. .. The corresponding digested amplicons were overnight ligated by using 10 units of T4 ligase (Roche).

Luciferase:

Article Title: Hereditary mixed polyposis syndrome is caused by a 40kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1
Article Snippet: These values were further used to normalise test luciferase intensities. .. The ligation reaction used a 10X higher volume to favour ligation events between cross-linked DNA strands using 50 U T4 Ligase (Roche, 5U/μl) and incubation at 16°C over 1-2 nights.

DNA Ligation:

Article Title: Kinetics and Fidelity of the Repair of Cas9-Induced Double-Strand DNA Breaks
Article Snippet: Subsequently, 0.16 μM dsDamID adaptor ( ) was ligated to the blunted broken ends at 16 °C overnight using T4 ligase (5 U/μL, Roche). .. To detect broken DNA a PCR was performed on the adaptor-broken DNA ligation product with 3 μM adaptor primer, EB486 and broken primer (EB487 or EB553).

Construct:

Article Title: Detection and expression analysis of tet(B) in Streptococcus oralis
Article Snippet: To this end, we made a construct consisting of the gene erm (B) surrounded by two sequences homologous to tet (M), which we named M1 (the 5ʹ region) and M2 (the 3ʹ region). erm (B) was extracted by PCR using the primers ermB-NdeI-F and ermB-HindIII-R from a S. oralis clinical strain resistant to erythromycin pertaining to the Dentaid Research Center (Cerdanyola del Vallès, Spain) strain collection. .. Digested fragments were ligated using T4 ligase (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions.

Article Title: Structural Basis for the Selective Inhibition of Cdc2-Like Kinases by CX-4945
Article Snippet: To prepare N-terminally truncated constructs, the amplified CLK genes with each set of primers were digested with restriction enzymes: CLK1 (residues 148–484) with NheI (R016S; Enzynomics, Republic of Korea) and XhoI (R0075; Enzynomics, Republic of Korea), CLK2 (residues 125–488) with NheI and HindIII (Enzynomics, Republic of Korea), CLK3 (residues 127–484) with NdeI and HindIII (R0065; Enzynomics, Republic of Korea). .. The digested genes were ligated to both the pET28a and pET24d vectors with the T4 ligase (M0202S; Roche, Germany) at 18°C for 16 h. The ligated plasmids were transformed into the Escherichia coli DH5α strain, and the transformants were confirmed by colony PCR.

Article Title: Recovery of recombinant Mycobacterium tuberculosis antigens fused with cell wall-anchoring motif (LysM) from inclusion bodies using non-denaturing reagent (N-laurylsarcosine)
Article Snippet: Construction and expression of plasmid pRSF:ARL In order to construct the pRSF:ARL expression plasmid, AR and lys M DNA sequences were individually amplified using pre-designed primers (Table ) from pJET:AR and from genomic DNA of L. lactis MG1363, respectively. .. The PCR reactions were carried based on these parameters; denaturation step at 95 °C for 5 min and amplification in 25 cycles of 1 min at 95 °C, 30 s at optimum annealing temperature, which was determined by gradient temperature ranging from 45 to 60 °C, and 1 min at 72 °C followed by one cycle at 72 °C for 10 min. Gel purified PCR products of AR and lys M were digested with Pst I, purified and ligated together at a 1:1 ratio using T4 ligase (Roche, Germany) to produce ligated product of the ARL gene.

Electrophoresis:

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: Reactions were initiated by addition of the indicated amount of polymerase and transfer to 37°C, were stopped by addition of an equal volume of formamide loading dye, and were analyzed by electrophoresis on a denaturing 10% polyacrylamide gel (denaturing 10% polyacrylamide gel electrophoresis). .. Experiments in Fig. were supplemented with 0.1 mM ATP and 0.05 U of T4 ligase (Roche).

Incubation:

Article Title: Detection and expression analysis of tet(B) in Streptococcus oralis
Article Snippet: Digested fragments were ligated using T4 ligase (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions. .. Electroporated cells were plated on blood agar plates containing 5 µg/ml of erythromycin (Sigma Aldrich, St. Louis, MO, USA) and incubated in anaerobic conditions for 24–48 h. The recombination event was confirmed by PCR using primers M1-F and M2-R.

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: 32 P-labeled DNA substrate (5 nM) was incubated in 10 μl of standard reaction buffer (25 mM Tris [pH 7.5], 100 mM NaCl, 25 mM KCl, 0.1 mM EDTA, 5 mM MgCl2 , 0.05% Triton X-100, 50 μg of bovine serum albumin/ml, 1% glycerol, and 2 mM dithiothreitol [DTT]). .. Experiments in Fig. were supplemented with 0.1 mM ATP and 0.05 U of T4 ligase (Roche).

Article Title: Hereditary mixed polyposis syndrome is caused by a 40kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1
Article Snippet: .. The ligation reaction used a 10X higher volume to favour ligation events between cross-linked DNA strands using 50 U T4 Ligase (Roche, 5U/μl) and incubation at 16°C over 1-2 nights. .. To de-crosslink the samples, 30μl Proteinase K (10 mg/ml) was added and incubated over night at 65°C.

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: For nick ligation reactions, 5 nM 32 P-labeled DNA substrate was incubated at 37°C in 10 μl of standard reaction buffer supplemented with 0.1 mM ATP and various concentrations of ligase such that reactions were in the linear range. .. One unit of T4 ligase (Roche) was equivalent to ∼350 μg of X4-LIV.

Article Title: Kinetics and Fidelity of the Repair of Cas9-Induced Double-Strand DNA Breaks
Article Snippet: Genomic DNA (350 ng, determined by Qubit assay, Thermo Fisher Scientific) was incubated with 0.1 μM extension primer (EB479 or EB551) (see ) and Phusion High Fidelity DNA polymerase (Thermo Fisher Scientific) for 5 min at 95 °C, 30 s at 55°C and 30 s at 72 °C, to extend the non-blunt DNA ends near the break site. .. Subsequently, 0.16 μM dsDamID adaptor ( ) was ligated to the blunted broken ends at 16 °C overnight using T4 ligase (5 U/μL, Roche).

Amplification:

Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
Article Snippet: The antibiotic resistance cassettes were either released by restriction digest from a plasmid or amplified by PCR with restriction sites matching the arms of homology. .. 5´and 3´arms of homology were ligated to the resistance cassette with T4 ligase (Roche).

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: One unit of T4 ligase (Roche) was equivalent to ∼350 μg of X4-LIV. .. The end-joining substrate described for Fig. was generated by PCR amplification in the presence of [α-33 P]dCTP of a 300-bp fragment including the Jκ1 coding region with the primers 5′-GCTCACGCTGTGGACGTTCGGTGGAGGC-3′ and 5′-GGCTACCCTGCTTCTTTGAGC-3′, digestion of this fragment with Dra III (recognition site embedded in the sequence of the first primer) to generate the described 3′ overhang, and purification of the digested fragment with a QIAquick PCR purification kit (Qiagen).

Article Title: Genetic differentiation of the oriental rat flea, Xenopsylla cheopis, from two sympatric host species
Article Snippet: Adaptors containing EcoR I and Mse I sites were ligated onto the fragments using T4 ligase (Roche, Basel, Switzerland). .. Following β-galactosidase screening, ~100 plasmids were isolated, and cloned inserts were amplified and sequenced using M13 universal primers on an automated ABI 3730xl DNA Analyzer (Applied Biosystems Inc., Carlsbad, CA, USA).

Article Title: Structural Basis for the Selective Inhibition of Cdc2-Like Kinases by CX-4945
Article Snippet: To prepare N-terminally truncated constructs, the amplified CLK genes with each set of primers were digested with restriction enzymes: CLK1 (residues 148–484) with NheI (R016S; Enzynomics, Republic of Korea) and XhoI (R0075; Enzynomics, Republic of Korea), CLK2 (residues 125–488) with NheI and HindIII (Enzynomics, Republic of Korea), CLK3 (residues 127–484) with NdeI and HindIII (R0065; Enzynomics, Republic of Korea). .. The digested genes were ligated to both the pET28a and pET24d vectors with the T4 ligase (M0202S; Roche, Germany) at 18°C for 16 h. The ligated plasmids were transformed into the Escherichia coli DH5α strain, and the transformants were confirmed by colony PCR.

Article Title: Recovery of recombinant Mycobacterium tuberculosis antigens fused with cell wall-anchoring motif (LysM) from inclusion bodies using non-denaturing reagent (N-laurylsarcosine)
Article Snippet: .. The PCR reactions were carried based on these parameters; denaturation step at 95 °C for 5 min and amplification in 25 cycles of 1 min at 95 °C, 30 s at optimum annealing temperature, which was determined by gradient temperature ranging from 45 to 60 °C, and 1 min at 72 °C followed by one cycle at 72 °C for 10 min. Gel purified PCR products of AR and lys M were digested with Pst I, purified and ligated together at a 1:1 ratio using T4 ligase (Roche, Germany) to produce ligated product of the ARL gene. .. Subsequently, the ARL fusion gene was PCR amplified and cloned into pRSFDuet-1 plasmid.

Article Title: Cross-Reacting Antibacterial Auto-Antibodies Are Produced within Coronary Atherosclerotic Plaques of Acute Coronary Syndrome Patients
Article Snippet: The amplification products and the pET28b vectors were double digested for 4 hours with the following couples of restriction endonucleases: NcoI/XhoI (New England Biolabs) or BamHI/XhoI (New England Biolabs) for OmpK36 and only BamHI/XhoI for OmpF, loaded onto a 1% agarose gel and purified by using Qiagen Gel Extraction kit. .. The corresponding digested amplicons were overnight ligated by using 10 units of T4 ligase (Roche).

Activity Assay:

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: Paragraph title: Polymerase activity assays. ... Experiments in Fig. were supplemented with 0.1 mM ATP and 0.05 U of T4 ligase (Roche).

Expressing:

Article Title: Hereditary mixed polyposis syndrome is caused by a 40kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1
Article Snippet: Paragraph title: Assessment of control of GREM1 expression ... The ligation reaction used a 10X higher volume to favour ligation events between cross-linked DNA strands using 50 U T4 Ligase (Roche, 5U/μl) and incubation at 16°C over 1-2 nights.

Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
Article Snippet: 5´and 3´arms of homology were ligated to the resistance cassette with T4 ligase (Roche). .. For the HP0857 mutant, an expression plasmid containing the HP0857 gene from the H . pylori 26695 strain was reverse amplified introducing restriction sites in the middle of the gene.

Article Title: Recovery of recombinant Mycobacterium tuberculosis antigens fused with cell wall-anchoring motif (LysM) from inclusion bodies using non-denaturing reagent (N-laurylsarcosine)
Article Snippet: Paragraph title: Construction and expression of plasmid pRSF:ARL ... The PCR reactions were carried based on these parameters; denaturation step at 95 °C for 5 min and amplification in 25 cycles of 1 min at 95 °C, 30 s at optimum annealing temperature, which was determined by gradient temperature ranging from 45 to 60 °C, and 1 min at 72 °C followed by one cycle at 72 °C for 10 min. Gel purified PCR products of AR and lys M were digested with Pst I, purified and ligated together at a 1:1 ratio using T4 ligase (Roche, Germany) to produce ligated product of the ARL gene.

Article Title: Cross-Reacting Antibacterial Auto-Antibodies Are Produced within Coronary Atherosclerotic Plaques of Acute Coronary Syndrome Patients
Article Snippet: Production and Purification of Klebsiella pneumoniae OmpK36 and Proteus mirabilis OmpF OmpK36, and OmpF were amplified from Klebsiella pneumoniae and Proteus mirabilis lysates respectively and cloned into a pET-28b expression vector (Novagen) by using the following primer pairs containing two distinct 5′ restriction endonuclease sequences: OmpK36NcoIFW: GCGCTAGTATGccatgggcATGAAAGTTAAAGTACTGT and OmpK36XhoIRW: GCGCTTCCTCGATACCTCGAGCTAGAACTGGTAAA ; OmpK36BamHIFW: GCGCTAGTCTGggatccgATGAAAGTTAAAGTACTGTC and OmpK36XhoIRW: TTCCTCGATACCTCGAGCTAGAACTGGTAAACCAG ; OmpF-Pr-BamHI TGATCGATCGAAATGggatccgATGATGAAGCGCAATAT and OmpF-Pr-XhoI GTA CCT AAT CCAGCAACGctcgagGAACTGATAAGT. .. The corresponding digested amplicons were overnight ligated by using 10 units of T4 ligase (Roche).

Transformation Assay:

Article Title: Detection and expression analysis of tet(B) in Streptococcus oralis
Article Snippet: Digested fragments were ligated using T4 ligase (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions. .. The construct was then purified using the E.Z.N.A.® Gel extraction Kit and transformed into 469.4 by electroporation using the Gene Pulser Xcell (BioRad, Hercules, CA, USA).

Article Title: Colanic Acid Is a Novel Phage Receptor of Pectobacterium carotovorum subsp. carotovorum Phage POP72
Article Snippet: Determination of the Transposon Insertion Site by Rescue Cloning Genomic DNA extracted from the selected transposon mutants was digested with the restriction enzyme Bam HI, and purified DNA fragments were self-ligated with T4 ligase (Roche). .. E. coli DH5α λpir was transformed with the circularized DNA fragments by heat shock and plated on LBA/Kan.

Article Title: Structural Basis for the Selective Inhibition of Cdc2-Like Kinases by CX-4945
Article Snippet: .. The digested genes were ligated to both the pET28a and pET24d vectors with the T4 ligase (M0202S; Roche, Germany) at 18°C for 16 h. The ligated plasmids were transformed into the Escherichia coli DH5α strain, and the transformants were confirmed by colony PCR. .. The recombinant genes were verified by DNA sequencing.

Article Title: Cross-Reacting Antibacterial Auto-Antibodies Are Produced within Coronary Atherosclerotic Plaques of Acute Coronary Syndrome Patients
Article Snippet: The corresponding digested amplicons were overnight ligated by using 10 units of T4 ligase (Roche). .. After transformation of bacterial cells (E. coli XL1-Blue) and plating, individual colonies were inoculated on Luria Broth (LB) and grown overnight.

Electroporation:

Article Title: Detection and expression analysis of tet(B) in Streptococcus oralis
Article Snippet: Digested fragments were ligated using T4 ligase (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions. .. The construct was then purified using the E.Z.N.A.® Gel extraction Kit and transformed into 469.4 by electroporation using the Gene Pulser Xcell (BioRad, Hercules, CA, USA).

Inverse PCR:

Article Title: Influence of IS256 on Genome Variability and Formation of Small-Colony Variants in Staphylococcus aureus
Article Snippet: The localizations of IS 256 and recombinant IS 256 elements in different insertion mutants of S. aureus HG001 were determined by inverse PCR as previously described ( ) ( ). .. After circularization of the fragments using the T4 ligase (Roche Applied Science GmbH, Mannheim, Germany), the insertion sites were detected by PCR analysis using the outgoing primers IS91rev and IS141for, which anneal within the 5′ end of IS 256 ( ).

Ligation:

Article Title: Hereditary mixed polyposis syndrome is caused by a 40kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1
Article Snippet: .. The ligation reaction used a 10X higher volume to favour ligation events between cross-linked DNA strands using 50 U T4 Ligase (Roche, 5U/μl) and incubation at 16°C over 1-2 nights. .. To de-crosslink the samples, 30μl Proteinase K (10 mg/ml) was added and incubated over night at 65°C.

Article Title: Laminopathies disrupt epigenomic developmental programs and cell fate
Article Snippet: .. The ligation reaction was performed at 16°C for 2 hours using T4 Ligase (Roche; 5 U/μl). .. The enzyme was inactivated by heating to 65°C for 10 min. To remove the fragments that have unmethylated GATCs, we performed Dpn II digestion at 37°C for 1 hour.

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: Paragraph title: Ligation assays. ... One unit of T4 ligase (Roche) was equivalent to ∼350 μg of X4-LIV.

Article Title: Recovery of recombinant Mycobacterium tuberculosis antigens fused with cell wall-anchoring motif (LysM) from inclusion bodies using non-denaturing reagent (N-laurylsarcosine)
Article Snippet: The PCR reactions were carried based on these parameters; denaturation step at 95 °C for 5 min and amplification in 25 cycles of 1 min at 95 °C, 30 s at optimum annealing temperature, which was determined by gradient temperature ranging from 45 to 60 °C, and 1 min at 72 °C followed by one cycle at 72 °C for 10 min. Gel purified PCR products of AR and lys M were digested with Pst I, purified and ligated together at a 1:1 ratio using T4 ligase (Roche, Germany) to produce ligated product of the ARL gene. .. Both insert and plasmid were double digested with Bam HI/Not I before ligation at 14 °C overnight at 1:4 plasmid/insert ratio.

Generated:

Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
Article Snippet: Construction of insertion and allelic exchange mutants and gene complementation in H . pylori HP0857, HP0858, HP0859 and HP0860 mutants were generated by insertion of an aphaA3 (kanamycin resistance) or CAT (chloramphenicol resistance) cassette by allelic exchange mutagenesis in the N6 or P12 H . pylori strains. .. 5´and 3´arms of homology were ligated to the resistance cassette with T4 ligase (Roche).

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: One unit of T4 ligase (Roche) was equivalent to ∼350 μg of X4-LIV. .. The end-joining substrate described for Fig. was generated by PCR amplification in the presence of [α-33 P]dCTP of a 300-bp fragment including the Jκ1 coding region with the primers 5′-GCTCACGCTGTGGACGTTCGGTGGAGGC-3′ and 5′-GGCTACCCTGCTTCTTTGAGC-3′, digestion of this fragment with Dra III (recognition site embedded in the sequence of the first primer) to generate the described 3′ overhang, and purification of the digested fragment with a QIAquick PCR purification kit (Qiagen).

DNA Sequencing:

Article Title: Colanic Acid Is a Novel Phage Receptor of Pectobacterium carotovorum subsp. carotovorum Phage POP72
Article Snippet: Determination of the Transposon Insertion Site by Rescue Cloning Genomic DNA extracted from the selected transposon mutants was digested with the restriction enzyme Bam HI, and purified DNA fragments were self-ligated with T4 ligase (Roche). .. Rescued plasmid DNA harboring the R6Kγ origin with the Tn5 transposon was extracted from the selected clones, and a locus of transposon insertion was identified by DNA sequencing using a pair of oligonucleotide primers tpnRL17-1 and tpnRL 13-2 ( ) (Larsen et al., ).

Article Title: Structural Basis for the Selective Inhibition of Cdc2-Like Kinases by CX-4945
Article Snippet: The digested genes were ligated to both the pET28a and pET24d vectors with the T4 ligase (M0202S; Roche, Germany) at 18°C for 16 h. The ligated plasmids were transformed into the Escherichia coli DH5α strain, and the transformants were confirmed by colony PCR. .. The recombinant genes were verified by DNA sequencing.

Polymerase Chain Reaction:

Article Title: Detection and expression analysis of tet(B) in Streptococcus oralis
Article Snippet: PCR products were purified using the E.Z.N.A.® Gel extraction Kit and digested with Nde I and Hind III (New England Biolabs Inc., Ipswich, MA, USA). .. Digested fragments were ligated using T4 ligase (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions.

Article Title: A widespread bacteriophage abortive infection system functions through a Type IV toxin-antitoxin mechanism
Article Snippet: DNA from PCR and agarose gels was purified using the GE Healthcare Illustra GFX PCR DNA and Gel Band Purification Kit. .. Restriction enzymes and T4 ligase were from Roche or NEB.

Article Title: Hereditary mixed polyposis syndrome is caused by a 40kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1
Article Snippet: The ligation reaction used a 10X higher volume to favour ligation events between cross-linked DNA strands using 50 U T4 Ligase (Roche, 5U/μl) and incubation at 16°C over 1-2 nights. .. 4μl of elute was used per qRT-PCR, using TaqMan Fast Universal PCR System (Applied Biosystems).

Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
Article Snippet: The antibiotic resistance cassettes were either released by restriction digest from a plasmid or amplified by PCR with restriction sites matching the arms of homology. .. 5´and 3´arms of homology were ligated to the resistance cassette with T4 ligase (Roche).

Article Title: Laminopathies disrupt epigenomic developmental programs and cell fate
Article Snippet: The ligation reaction was performed at 16°C for 2 hours using T4 Ligase (Roche; 5 U/μl). .. PCR reaction was performed to amplify the regions flanked by adaptors.

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: One unit of T4 ligase (Roche) was equivalent to ∼350 μg of X4-LIV. .. The end-joining substrate described for Fig. was generated by PCR amplification in the presence of [α-33 P]dCTP of a 300-bp fragment including the Jκ1 coding region with the primers 5′-GCTCACGCTGTGGACGTTCGGTGGAGGC-3′ and 5′-GGCTACCCTGCTTCTTTGAGC-3′, digestion of this fragment with Dra III (recognition site embedded in the sequence of the first primer) to generate the described 3′ overhang, and purification of the digested fragment with a QIAquick PCR purification kit (Qiagen).

Article Title: Kinetics and Fidelity of the Repair of Cas9-Induced Double-Strand DNA Breaks
Article Snippet: Subsequently, 0.16 μM dsDamID adaptor ( ) was ligated to the blunted broken ends at 16 °C overnight using T4 ligase (5 U/μL, Roche). .. To detect broken DNA a PCR was performed on the adaptor-broken DNA ligation product with 3 μM adaptor primer, EB486 and broken primer (EB487 or EB553).

Article Title: Genetic differentiation of the oriental rat flea, Xenopsylla cheopis, from two sympatric host species
Article Snippet: Adaptors containing EcoR I and Mse I sites were ligated onto the fragments using T4 ligase (Roche, Basel, Switzerland). .. Enriched DNA was PCR-amplified and cloned using the pMD18-T Vector System Kit (TaKaRa, Tokyo, Japan).

Article Title: Structural Basis for the Selective Inhibition of Cdc2-Like Kinases by CX-4945
Article Snippet: .. The digested genes were ligated to both the pET28a and pET24d vectors with the T4 ligase (M0202S; Roche, Germany) at 18°C for 16 h. The ligated plasmids were transformed into the Escherichia coli DH5α strain, and the transformants were confirmed by colony PCR. .. The recombinant genes were verified by DNA sequencing.

Article Title: Recovery of recombinant Mycobacterium tuberculosis antigens fused with cell wall-anchoring motif (LysM) from inclusion bodies using non-denaturing reagent (N-laurylsarcosine)
Article Snippet: .. The PCR reactions were carried based on these parameters; denaturation step at 95 °C for 5 min and amplification in 25 cycles of 1 min at 95 °C, 30 s at optimum annealing temperature, which was determined by gradient temperature ranging from 45 to 60 °C, and 1 min at 72 °C followed by one cycle at 72 °C for 10 min. Gel purified PCR products of AR and lys M were digested with Pst I, purified and ligated together at a 1:1 ratio using T4 ligase (Roche, Germany) to produce ligated product of the ARL gene. .. Subsequently, the ARL fusion gene was PCR amplified and cloned into pRSFDuet-1 plasmid.

Article Title: Influence of IS256 on Genome Variability and Formation of Small-Colony Variants in Staphylococcus aureus
Article Snippet: .. After circularization of the fragments using the T4 ligase (Roche Applied Science GmbH, Mannheim, Germany), the insertion sites were detected by PCR analysis using the outgoing primers IS91rev and IS141for, which anneal within the 5′ end of IS 256 ( ). .. Afterwards, the insertion site of the insertion element was detected by Sanger sequencing (SEQLAB Sequence Laboratories Göttingen GmbH, Göttingen, Germany).

Recombinant:

Article Title: Structural Basis for the Selective Inhibition of Cdc2-Like Kinases by CX-4945
Article Snippet: The digested genes were ligated to both the pET28a and pET24d vectors with the T4 ligase (M0202S; Roche, Germany) at 18°C for 16 h. The ligated plasmids were transformed into the Escherichia coli DH5α strain, and the transformants were confirmed by colony PCR. .. The recombinant genes were verified by DNA sequencing.

Article Title: Influence of IS256 on Genome Variability and Formation of Small-Colony Variants in Staphylococcus aureus
Article Snippet: The localizations of IS 256 and recombinant IS 256 elements in different insertion mutants of S. aureus HG001 were determined by inverse PCR as previously described ( ) ( ). .. After circularization of the fragments using the T4 ligase (Roche Applied Science GmbH, Mannheim, Germany), the insertion sites were detected by PCR analysis using the outgoing primers IS91rev and IS141for, which anneal within the 5′ end of IS 256 ( ).

DNA Extraction:

Article Title: A widespread bacteriophage abortive infection system functions through a Type IV toxin-antitoxin mechanism
Article Snippet: Paragraph title: DNA isolation and manipulation ... Restriction enzymes and T4 ligase were from Roche or NEB.

Mutagenesis:

Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
Article Snippet: Construction of insertion and allelic exchange mutants and gene complementation in H . pylori HP0857, HP0858, HP0859 and HP0860 mutants were generated by insertion of an aphaA3 (kanamycin resistance) or CAT (chloramphenicol resistance) cassette by allelic exchange mutagenesis in the N6 or P12 H . pylori strains. .. 5´and 3´arms of homology were ligated to the resistance cassette with T4 ligase (Roche).

Isolation:

Article Title: A widespread bacteriophage abortive infection system functions through a Type IV toxin-antitoxin mechanism
Article Snippet: Plasmid DNA was isolated using the Zyppy Plasmid Miniprep Kit (Zymo). .. Restriction enzymes and T4 ligase were from Roche or NEB.

Article Title: Genetic differentiation of the oriental rat flea, Xenopsylla cheopis, from two sympatric host species
Article Snippet: Microsatellite primer development Microsatellites were developed using a traditional isolation protocol [ ]. .. Adaptors containing EcoR I and Mse I sites were ligated onto the fragments using T4 ligase (Roche, Basel, Switzerland).

Purification:

Article Title: Detection and expression analysis of tet(B) in Streptococcus oralis
Article Snippet: PCR products were purified using the E.Z.N.A.® Gel extraction Kit and digested with Nde I and Hind III (New England Biolabs Inc., Ipswich, MA, USA). .. Digested fragments were ligated using T4 ligase (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions.

Article Title: A widespread bacteriophage abortive infection system functions through a Type IV toxin-antitoxin mechanism
Article Snippet: DNA from PCR and agarose gels was purified using the GE Healthcare Illustra GFX PCR DNA and Gel Band Purification Kit. .. Restriction enzymes and T4 ligase were from Roche or NEB.

Article Title: Colanic Acid Is a Novel Phage Receptor of Pectobacterium carotovorum subsp. carotovorum Phage POP72
Article Snippet: .. Determination of the Transposon Insertion Site by Rescue Cloning Genomic DNA extracted from the selected transposon mutants was digested with the restriction enzyme Bam HI, and purified DNA fragments were self-ligated with T4 ligase (Roche). .. E. coli DH5α λpir was transformed with the circularized DNA fragments by heat shock and plated on LBA/Kan.

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: One unit of T4 ligase (Roche) was equivalent to ∼350 μg of X4-LIV. .. The end-joining substrate described for Fig. was generated by PCR amplification in the presence of [α-33 P]dCTP of a 300-bp fragment including the Jκ1 coding region with the primers 5′-GCTCACGCTGTGGACGTTCGGTGGAGGC-3′ and 5′-GGCTACCCTGCTTCTTTGAGC-3′, digestion of this fragment with Dra III (recognition site embedded in the sequence of the first primer) to generate the described 3′ overhang, and purification of the digested fragment with a QIAquick PCR purification kit (Qiagen).

Article Title: Recovery of recombinant Mycobacterium tuberculosis antigens fused with cell wall-anchoring motif (LysM) from inclusion bodies using non-denaturing reagent (N-laurylsarcosine)
Article Snippet: .. The PCR reactions were carried based on these parameters; denaturation step at 95 °C for 5 min and amplification in 25 cycles of 1 min at 95 °C, 30 s at optimum annealing temperature, which was determined by gradient temperature ranging from 45 to 60 °C, and 1 min at 72 °C followed by one cycle at 72 °C for 10 min. Gel purified PCR products of AR and lys M were digested with Pst I, purified and ligated together at a 1:1 ratio using T4 ligase (Roche, Germany) to produce ligated product of the ARL gene. .. Subsequently, the ARL fusion gene was PCR amplified and cloned into pRSFDuet-1 plasmid.

Article Title: Cross-Reacting Antibacterial Auto-Antibodies Are Produced within Coronary Atherosclerotic Plaques of Acute Coronary Syndrome Patients
Article Snippet: Paragraph title: Production and Purification of Klebsiella pneumoniae OmpK36 and Proteus mirabilis OmpF ... The corresponding digested amplicons were overnight ligated by using 10 units of T4 ligase (Roche).

Sequencing:

Article Title: Detection and expression analysis of tet(B) in Streptococcus oralis
Article Snippet: M1 and M2 sequences were obtained by PCR from the isolate 469.4 using the primers M1-F and M1-NdeI-R for the M1 sequence, and M2-HindIII-F and M2-R for the M2 sequence ( ). .. Digested fragments were ligated using T4 ligase (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions.

Article Title: Colanic Acid Is a Novel Phage Receptor of Pectobacterium carotovorum subsp. carotovorum Phage POP72
Article Snippet: Determination of the Transposon Insertion Site by Rescue Cloning Genomic DNA extracted from the selected transposon mutants was digested with the restriction enzyme Bam HI, and purified DNA fragments were self-ligated with T4 ligase (Roche). .. The nucleotide sequence of Pectobacterium carotovorum subsp. carotovorum strain Pcc21 (GenBank accession number CP003776 ) that was registered in the NCBI database was used as a reference for the sequence analysis.

Article Title: Laminopathies disrupt epigenomic developmental programs and cell fate
Article Snippet: Paragraph title: DamID library preparation and sequencing ... The ligation reaction was performed at 16°C for 2 hours using T4 Ligase (Roche; 5 U/μl).

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: One unit of T4 ligase (Roche) was equivalent to ∼350 μg of X4-LIV. .. The end-joining substrate described for Fig. was generated by PCR amplification in the presence of [α-33 P]dCTP of a 300-bp fragment including the Jκ1 coding region with the primers 5′-GCTCACGCTGTGGACGTTCGGTGGAGGC-3′ and 5′-GGCTACCCTGCTTCTTTGAGC-3′, digestion of this fragment with Dra III (recognition site embedded in the sequence of the first primer) to generate the described 3′ overhang, and purification of the digested fragment with a QIAquick PCR purification kit (Qiagen).

Article Title: Influence of IS256 on Genome Variability and Formation of Small-Colony Variants in Staphylococcus aureus
Article Snippet: After circularization of the fragments using the T4 ligase (Roche Applied Science GmbH, Mannheim, Germany), the insertion sites were detected by PCR analysis using the outgoing primers IS91rev and IS141for, which anneal within the 5′ end of IS 256 ( ). .. Afterwards, the insertion site of the insertion element was detected by Sanger sequencing (SEQLAB Sequence Laboratories Göttingen GmbH, Göttingen, Germany).

Quantitative RT-PCR:

Article Title: Hereditary mixed polyposis syndrome is caused by a 40kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1
Article Snippet: The ligation reaction used a 10X higher volume to favour ligation events between cross-linked DNA strands using 50 U T4 Ligase (Roche, 5U/μl) and incubation at 16°C over 1-2 nights. .. 4μl of elute was used per qRT-PCR, using TaqMan Fast Universal PCR System (Applied Biosystems).

Polyacrylamide Gel Electrophoresis:

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: Reactions were initiated by addition of the indicated amount of polymerase and transfer to 37°C, were stopped by addition of an equal volume of formamide loading dye, and were analyzed by electrophoresis on a denaturing 10% polyacrylamide gel (denaturing 10% polyacrylamide gel electrophoresis). .. Experiments in Fig. were supplemented with 0.1 mM ATP and 0.05 U of T4 ligase (Roche).

Lysis:

Article Title: Hereditary mixed polyposis syndrome is caused by a 40kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1
Article Snippet: After shaking the cells for more than 30 mins in lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 5 mM EDTA, 0.5 % NP-40, 1 % Triton X-100 and protease inhibitors) nuclei were pelleted (1800 rpm, 5 min) and resuspended in 360 μl H2O and 60 μl of the 10x restriction buffer for BglII. .. The ligation reaction used a 10X higher volume to favour ligation events between cross-linked DNA strands using 50 U T4 Ligase (Roche, 5U/μl) and incubation at 16°C over 1-2 nights.

cDNA Library Assay:

Article Title: Structural Basis for the Selective Inhibition of Cdc2-Like Kinases by CX-4945
Article Snippet: Construction of CLKs The CLK1, CLK2, and CLK3 genes were obtained from a cDNA library of the human 293T cell line by PCR with pfu-X (SPX95-E500; Solgent, Republic of Korea). .. The digested genes were ligated to both the pET28a and pET24d vectors with the T4 ligase (M0202S; Roche, Germany) at 18°C for 16 h. The ligated plasmids were transformed into the Escherichia coli DH5α strain, and the transformants were confirmed by colony PCR.

Chloramphenicol Acetyltransferase Assay:

Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
Article Snippet: Construction of insertion and allelic exchange mutants and gene complementation in H . pylori HP0857, HP0858, HP0859 and HP0860 mutants were generated by insertion of an aphaA3 (kanamycin resistance) or CAT (chloramphenicol resistance) cassette by allelic exchange mutagenesis in the N6 or P12 H . pylori strains. .. 5´and 3´arms of homology were ligated to the resistance cassette with T4 ligase (Roche).

Plasmid Preparation:

Article Title: A widespread bacteriophage abortive infection system functions through a Type IV toxin-antitoxin mechanism
Article Snippet: Plasmid DNA was isolated using the Zyppy Plasmid Miniprep Kit (Zymo). .. Restriction enzymes and T4 ligase were from Roche or NEB.

Article Title: Colanic Acid Is a Novel Phage Receptor of Pectobacterium carotovorum subsp. carotovorum Phage POP72
Article Snippet: Determination of the Transposon Insertion Site by Rescue Cloning Genomic DNA extracted from the selected transposon mutants was digested with the restriction enzyme Bam HI, and purified DNA fragments were self-ligated with T4 ligase (Roche). .. Rescued plasmid DNA harboring the R6Kγ origin with the Tn5 transposon was extracted from the selected clones, and a locus of transposon insertion was identified by DNA sequencing using a pair of oligonucleotide primers tpnRL17-1 and tpnRL 13-2 ( ) (Larsen et al., ).

Article Title: Helicobacter pylori modulates host cell responses by CagT4SS-dependent translocation of an intermediate metabolite of LPS inner core heptose biosynthesis
Article Snippet: The antibiotic resistance cassettes were either released by restriction digest from a plasmid or amplified by PCR with restriction sites matching the arms of homology. .. 5´and 3´arms of homology were ligated to the resistance cassette with T4 ligase (Roche).

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: One unit of T4 ligase (Roche) was equivalent to ∼350 μg of X4-LIV. .. Ligation was initiated by addition of polymerase, X4-LIV, dNTPs and/or rNTPs as noted, MgCl2 to 5 mM, 50 ng of plasmid competitor, and 0.1 mM ATP.

Article Title: Genetic differentiation of the oriental rat flea, Xenopsylla cheopis, from two sympatric host species
Article Snippet: Adaptors containing EcoR I and Mse I sites were ligated onto the fragments using T4 ligase (Roche, Basel, Switzerland). .. Enriched DNA was PCR-amplified and cloned using the pMD18-T Vector System Kit (TaKaRa, Tokyo, Japan).

Article Title: Recovery of recombinant Mycobacterium tuberculosis antigens fused with cell wall-anchoring motif (LysM) from inclusion bodies using non-denaturing reagent (N-laurylsarcosine)
Article Snippet: Paragraph title: Construction and expression of plasmid pRSF:ARL ... The PCR reactions were carried based on these parameters; denaturation step at 95 °C for 5 min and amplification in 25 cycles of 1 min at 95 °C, 30 s at optimum annealing temperature, which was determined by gradient temperature ranging from 45 to 60 °C, and 1 min at 72 °C followed by one cycle at 72 °C for 10 min. Gel purified PCR products of AR and lys M were digested with Pst I, purified and ligated together at a 1:1 ratio using T4 ligase (Roche, Germany) to produce ligated product of the ARL gene.

Article Title: Cross-Reacting Antibacterial Auto-Antibodies Are Produced within Coronary Atherosclerotic Plaques of Acute Coronary Syndrome Patients
Article Snippet: Production and Purification of Klebsiella pneumoniae OmpK36 and Proteus mirabilis OmpF OmpK36, and OmpF were amplified from Klebsiella pneumoniae and Proteus mirabilis lysates respectively and cloned into a pET-28b expression vector (Novagen) by using the following primer pairs containing two distinct 5′ restriction endonuclease sequences: OmpK36NcoIFW: GCGCTAGTATGccatgggcATGAAAGTTAAAGTACTGT and OmpK36XhoIRW: GCGCTTCCTCGATACCTCGAGCTAGAACTGGTAAA ; OmpK36BamHIFW: GCGCTAGTCTGggatccgATGAAAGTTAAAGTACTGTC and OmpK36XhoIRW: TTCCTCGATACCTCGAGCTAGAACTGGTAAACCAG ; OmpF-Pr-BamHI TGATCGATCGAAATGggatccgATGATGAAGCGCAATAT and OmpF-Pr-XhoI GTA CCT AAT CCAGCAACGctcgagGAACTGATAAGT. .. The corresponding digested amplicons were overnight ligated by using 10 units of T4 ligase (Roche).

Software:

Article Title: Polymerase Mu Is a DNA-Directed DNA/RNA Polymerase
Article Snippet: Experiments in Fig. were supplemented with 0.1 mM ATP and 0.05 U of T4 ligase (Roche). .. Experiments in Table were performed as for Fig. , except that a mix of all eight nucleotides at the concentrations noted in Table was added , MgCl2 was added to 10 mM, and the reaction time was 5 min. All detection and quantification of radiolabeled DNA were performed with a PhosphorImager and ImageQuanNT software (Molecular Dynamics).

Positron Emission Tomography:

Article Title: Cross-Reacting Antibacterial Auto-Antibodies Are Produced within Coronary Atherosclerotic Plaques of Acute Coronary Syndrome Patients
Article Snippet: Production and Purification of Klebsiella pneumoniae OmpK36 and Proteus mirabilis OmpF OmpK36, and OmpF were amplified from Klebsiella pneumoniae and Proteus mirabilis lysates respectively and cloned into a pET-28b expression vector (Novagen) by using the following primer pairs containing two distinct 5′ restriction endonuclease sequences: OmpK36NcoIFW: GCGCTAGTATGccatgggcATGAAAGTTAAAGTACTGT and OmpK36XhoIRW: GCGCTTCCTCGATACCTCGAGCTAGAACTGGTAAA ; OmpK36BamHIFW: GCGCTAGTCTGggatccgATGAAAGTTAAAGTACTGTC and OmpK36XhoIRW: TTCCTCGATACCTCGAGCTAGAACTGGTAAACCAG ; OmpF-Pr-BamHI TGATCGATCGAAATGggatccgATGATGAAGCGCAATAT and OmpF-Pr-XhoI GTA CCT AAT CCAGCAACGctcgagGAACTGATAAGT. .. The corresponding digested amplicons were overnight ligated by using 10 units of T4 ligase (Roche).

Agarose Gel Electrophoresis:

Article Title: Cross-Reacting Antibacterial Auto-Antibodies Are Produced within Coronary Atherosclerotic Plaques of Acute Coronary Syndrome Patients
Article Snippet: The amplification products and the pET28b vectors were double digested for 4 hours with the following couples of restriction endonucleases: NcoI/XhoI (New England Biolabs) or BamHI/XhoI (New England Biolabs) for OmpK36 and only BamHI/XhoI for OmpF, loaded onto a 1% agarose gel and purified by using Qiagen Gel Extraction kit. .. The corresponding digested amplicons were overnight ligated by using 10 units of T4 ligase (Roche).

Ethanol Precipitation:

Article Title: Hereditary mixed polyposis syndrome is caused by a 40kb upstream duplication that leads to increased and ectopic expression of the BMP antagonist GREM1
Article Snippet: The ligation reaction used a 10X higher volume to favour ligation events between cross-linked DNA strands using 50 U T4 Ligase (Roche, 5U/μl) and incubation at 16°C over 1-2 nights. .. After phenol extraction and ethanol precipitation the samples were recovered in 500 μl TE.

Concentration Assay:

Article Title: Laminopathies disrupt epigenomic developmental programs and cell fate
Article Snippet: The gDNA was ethanol-precipitated overnight at −20°C and dissolved in tris-EDTA (pH 7.5) to a concentration of 1 μg/μl. gDNA (2.5 μl) was digested with 0.5 μl of Dpn I (New England Biolabs; 20 U/μl) at 37°C overnight, and Dpn I was inactivated by heating to 80°C for 20 min. Dpn I–digested gDNA was ligated to the adaptor AdR [slowly annealed AdR-top (5′-CTAATACGACTCACTATAGGGCAGCGTGGTCGCGGCCGAGGA-3′) and AdR-bottom (5′-TCCTCGGCCG-3′)]. .. The ligation reaction was performed at 16°C for 2 hours using T4 Ligase (Roche; 5 U/μl).

Article Title: Cross-Reacting Antibacterial Auto-Antibodies Are Produced within Coronary Atherosclerotic Plaques of Acute Coronary Syndrome Patients
Article Snippet: The corresponding digested amplicons were overnight ligated by using 10 units of T4 ligase (Roche). .. OMP Expression was performed following manufacturer instructions (pET System Manual - Novagen), using a final IPTG concentration of 1 mM to induce the expression of OMPs.

Gel Extraction:

Article Title: Detection and expression analysis of tet(B) in Streptococcus oralis
Article Snippet: PCR products were purified using the E.Z.N.A.® Gel extraction Kit and digested with Nde I and Hind III (New England Biolabs Inc., Ipswich, MA, USA). .. Digested fragments were ligated using T4 ligase (Roche Diagnostics, Mannheim, Germany) according to the manufacturer’s instructions.

Article Title: Cross-Reacting Antibacterial Auto-Antibodies Are Produced within Coronary Atherosclerotic Plaques of Acute Coronary Syndrome Patients
Article Snippet: The amplification products and the pET28b vectors were double digested for 4 hours with the following couples of restriction endonucleases: NcoI/XhoI (New England Biolabs) or BamHI/XhoI (New England Biolabs) for OmpK36 and only BamHI/XhoI for OmpF, loaded onto a 1% agarose gel and purified by using Qiagen Gel Extraction kit. .. The corresponding digested amplicons were overnight ligated by using 10 units of T4 ligase (Roche).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Roche t4 dna ligase
    AFM images of DNA-DNA crossings. (a) Bare DNA (3.8 kbp). (b) and (c) DNA with <t>T4</t> DNA ligase andATP. Solid arrows indicate higher crossings consistent with ligase binding, outlined arrows indicateshallower crossings consistent with bare DNA.
    T4 Dna Ligase, supplied by Roche, used in various techniques. Bioz Stars score: 97/100, based on 278 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/Roche
    Average 97 stars, based on 278 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-01
    97/100 stars
      Buy from Supplier

    Image Search Results


    AFM images of DNA-DNA crossings. (a) Bare DNA (3.8 kbp). (b) and (c) DNA with T4 DNA ligase andATP. Solid arrows indicate higher crossings consistent with ligase binding, outlined arrows indicateshallower crossings consistent with bare DNA.

    Journal: Biomicrofluidics

    Article Title: Probing transient protein-mediated DNA linkages using nanoconfinement

    doi: 10.1063/1.4882775

    Figure Lengend Snippet: AFM images of DNA-DNA crossings. (a) Bare DNA (3.8 kbp). (b) and (c) DNA with T4 DNA ligase andATP. Solid arrows indicate higher crossings consistent with ligase binding, outlined arrows indicateshallower crossings consistent with bare DNA.

    Article Snippet: For measurements with T4 DNA ligase and ATP, the respective finalconcentrations were 5 URoche /ml (Roche) and 1 mM, respectively.

    Techniques: Binding Assay

    Mean aligned DNA molecule loop lengths as function of time for 22 molecules per dataset withtheir linear fits. Bare λ-DNA (blue), λ-DNA with T4 DNA ligase (green), and λ-DNA with T4 DNA ligaseand ATP (red).

    Journal: Biomicrofluidics

    Article Title: Probing transient protein-mediated DNA linkages using nanoconfinement

    doi: 10.1063/1.4882775

    Figure Lengend Snippet: Mean aligned DNA molecule loop lengths as function of time for 22 molecules per dataset withtheir linear fits. Bare λ-DNA (blue), λ-DNA with T4 DNA ligase (green), and λ-DNA with T4 DNA ligaseand ATP (red).

    Article Snippet: For measurements with T4 DNA ligase and ATP, the respective finalconcentrations were 5 URoche /ml (Roche) and 1 mM, respectively.

    Techniques:

    Histogram of end-to-end lengths of extended DNA molecules, bare λ-DNA (solid bars), λ-DNA with T4DNA ligase (gray bars), and λ-DNA with T4 DNA ligase and ATP (white bars). A Gaussian was fit toeach distribution to determine the

    Journal: Biomicrofluidics

    Article Title: Probing transient protein-mediated DNA linkages using nanoconfinement

    doi: 10.1063/1.4882775

    Figure Lengend Snippet: Histogram of end-to-end lengths of extended DNA molecules, bare λ-DNA (solid bars), λ-DNA with T4DNA ligase (gray bars), and λ-DNA with T4 DNA ligase and ATP (white bars). A Gaussian was fit toeach distribution to determine the

    Article Snippet: For measurements with T4 DNA ligase and ATP, the respective finalconcentrations were 5 URoche /ml (Roche) and 1 mM, respectively.

    Techniques:

    Histograms of heights of DNA-DNA crossings. (a) Bare DNA (N = 41). (b) DNA with T4 DNA ligase andATP (N = 174). The red dotted line corresponds to unoccupied crossings, the blue dashed line tooccupied crossings, and the

    Journal: Biomicrofluidics

    Article Title: Probing transient protein-mediated DNA linkages using nanoconfinement

    doi: 10.1063/1.4882775

    Figure Lengend Snippet: Histograms of heights of DNA-DNA crossings. (a) Bare DNA (N = 41). (b) DNA with T4 DNA ligase andATP (N = 174). The red dotted line corresponds to unoccupied crossings, the blue dashed line tooccupied crossings, and the

    Article Snippet: For measurements with T4 DNA ligase and ATP, the respective finalconcentrations were 5 URoche /ml (Roche) and 1 mM, respectively.

    Techniques:

    ( A ) Schematic of the device. ( B,C ) Kymographs showing the fluorescent intensity along nanochannel axis as a function of time for bare λ -DNA ( B ) and λ -DNA with T4 DNA ligase in a catalytically active buffer ( C ), respectively. ( D ) Center of mass of the molecules in ( B ) (red, diamonds) and ( C ) (blue, circles) as function of time.

    Journal: Scientific Reports

    Article Title: Motor-like DNA motion due to an ATP-hydrolyzing protein under nanoconfinement

    doi: 10.1038/s41598-018-28278-0

    Figure Lengend Snippet: ( A ) Schematic of the device. ( B,C ) Kymographs showing the fluorescent intensity along nanochannel axis as a function of time for bare λ -DNA ( B ) and λ -DNA with T4 DNA ligase in a catalytically active buffer ( C ), respectively. ( D ) Center of mass of the molecules in ( B ) (red, diamonds) and ( C ) (blue, circles) as function of time.

    Article Snippet: This solution was incubated for 1 hour at 16 °C to allow full equilibrization of Mg2+ , ATP, and T4 DNA ligase.

    Techniques:

    Average mean-square displacement curves calculated from the center of mass position for 20 molecules for each condition. Blue circles correspond to data DNA with T4 DNA ligase in the presence of its cofactors, while red diamonds indicate bare DNA. Error bars are the standard deviation between molecules of the experimental set, and are depicted only for select data points to illustrate the trend. The continuous and dashed curves correspond to the fits for the conditions as described in the text.

    Journal: Scientific Reports

    Article Title: Motor-like DNA motion due to an ATP-hydrolyzing protein under nanoconfinement

    doi: 10.1038/s41598-018-28278-0

    Figure Lengend Snippet: Average mean-square displacement curves calculated from the center of mass position for 20 molecules for each condition. Blue circles correspond to data DNA with T4 DNA ligase in the presence of its cofactors, while red diamonds indicate bare DNA. Error bars are the standard deviation between molecules of the experimental set, and are depicted only for select data points to illustrate the trend. The continuous and dashed curves correspond to the fits for the conditions as described in the text.

    Article Snippet: This solution was incubated for 1 hour at 16 °C to allow full equilibrization of Mg2+ , ATP, and T4 DNA ligase.

    Techniques: Standard Deviation