Structured Review

Promega t4 ligase
Schematic drawing of major ligation factors and evaluation of T4 ligase activity. ( a ) A schematic of DNA sewing material preparation. Each overhang sequence of WY-, EY- and CY-DNA blocks is ligated by T4 ligase. ( b ) Depiction of the ligation mechanism and three major ligation factors. These major factors were characterized by impact on ligation efficiency. ( c ) Various molar concentrations of Y-DNAs were tested with fixed amounts of adenosine triphosphate (1 mM) and T4 ligase (30 Weiss units). ( d ) Molar ratios of EY-DNA were changed under the fixed amount of WY-CY, which means the mixed solution of WY-DNA and CY-DNA in determined molar ratio. The concentration of WY-CY was fixed to 6 μM in ligation solution. The ratios of WY-CY to EY-DNA were 1:0.5, 1:1, 1:2 and 1:4 in sequence. Blue, red and green bars represent T-DNA, partial T-DNA and unreacted Y-DNA, respectively. ( e ) Various salt concentrations (15, 50, 100, 200 and 400 mM) were tested. Each data point represents the mean of triplicate experiments; error bars represent the SD.
T4 Ligase, supplied by Promega, used in various techniques. Bioz Stars score: 95/100, based on 62 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 ligase/product/Promega
Average 95 stars, based on 62 article reviews
Price from $9.99 to $1999.99
t4 ligase - by Bioz Stars, 2019-12
95/100 stars

Images

1) Product Images from "Enzyme-guided DNA Sewing Architecture"

Article Title: Enzyme-guided DNA Sewing Architecture

Journal: Scientific Reports

doi: 10.1038/srep17722

Schematic drawing of major ligation factors and evaluation of T4 ligase activity. ( a ) A schematic of DNA sewing material preparation. Each overhang sequence of WY-, EY- and CY-DNA blocks is ligated by T4 ligase. ( b ) Depiction of the ligation mechanism and three major ligation factors. These major factors were characterized by impact on ligation efficiency. ( c ) Various molar concentrations of Y-DNAs were tested with fixed amounts of adenosine triphosphate (1 mM) and T4 ligase (30 Weiss units). ( d ) Molar ratios of EY-DNA were changed under the fixed amount of WY-CY, which means the mixed solution of WY-DNA and CY-DNA in determined molar ratio. The concentration of WY-CY was fixed to 6 μM in ligation solution. The ratios of WY-CY to EY-DNA were 1:0.5, 1:1, 1:2 and 1:4 in sequence. Blue, red and green bars represent T-DNA, partial T-DNA and unreacted Y-DNA, respectively. ( e ) Various salt concentrations (15, 50, 100, 200 and 400 mM) were tested. Each data point represents the mean of triplicate experiments; error bars represent the SD.
Figure Legend Snippet: Schematic drawing of major ligation factors and evaluation of T4 ligase activity. ( a ) A schematic of DNA sewing material preparation. Each overhang sequence of WY-, EY- and CY-DNA blocks is ligated by T4 ligase. ( b ) Depiction of the ligation mechanism and three major ligation factors. These major factors were characterized by impact on ligation efficiency. ( c ) Various molar concentrations of Y-DNAs were tested with fixed amounts of adenosine triphosphate (1 mM) and T4 ligase (30 Weiss units). ( d ) Molar ratios of EY-DNA were changed under the fixed amount of WY-CY, which means the mixed solution of WY-DNA and CY-DNA in determined molar ratio. The concentration of WY-CY was fixed to 6 μM in ligation solution. The ratios of WY-CY to EY-DNA were 1:0.5, 1:1, 1:2 and 1:4 in sequence. Blue, red and green bars represent T-DNA, partial T-DNA and unreacted Y-DNA, respectively. ( e ) Various salt concentrations (15, 50, 100, 200 and 400 mM) were tested. Each data point represents the mean of triplicate experiments; error bars represent the SD.

Techniques Used: Ligation, Activity Assay, Sequencing, Concentration Assay

2) Product Images from "Rapid single step subcloning procedure by combined action of type II and type IIs endonucleases with ligase"

Article Title: Rapid single step subcloning procedure by combined action of type II and type IIs endonucleases with ligase

Journal: Journal of Biological Engineering

doi: 10.1186/1754-1611-1-7

Schematic overview of the subcloning procedure . The upper box contains the two vectors the reaction starts with, i.e. the entry vector with its two key elements flanking an insert and the destination vector with its NheI recognition site. By the enzymatic action (arrows) of Esp3I and NheI these vectors are linearized to form linear intermediate products as shown in the central box. These intermediates are subject to T4 ligase activity and can be ligated to yield a range of products: the initial vectors (upper box), circular intermediate products (lower box) and the desired product vector. Note that all circular intermediate products are again substrate for Esp3I and thus again linearized. There is a sole stable product in this reaction system, which is the desired product vector (circular products only shown if carrying at least one resistance marker). Shaded boxes termed KEY: key element as shown in Fig. 1.
Figure Legend Snippet: Schematic overview of the subcloning procedure . The upper box contains the two vectors the reaction starts with, i.e. the entry vector with its two key elements flanking an insert and the destination vector with its NheI recognition site. By the enzymatic action (arrows) of Esp3I and NheI these vectors are linearized to form linear intermediate products as shown in the central box. These intermediates are subject to T4 ligase activity and can be ligated to yield a range of products: the initial vectors (upper box), circular intermediate products (lower box) and the desired product vector. Note that all circular intermediate products are again substrate for Esp3I and thus again linearized. There is a sole stable product in this reaction system, which is the desired product vector (circular products only shown if carrying at least one resistance marker). Shaded boxes termed KEY: key element as shown in Fig. 1.

Techniques Used: Subcloning, Plasmid Preparation, Activity Assay, Marker

3) Product Images from "Rapid single step subcloning procedure by combined action of type II and type IIs endonucleases with ligase"

Article Title: Rapid single step subcloning procedure by combined action of type II and type IIs endonucleases with ligase

Journal: Journal of Biological Engineering

doi: 10.1186/1754-1611-1-7

Schematic overview of the subcloning procedure . The upper box contains the two vectors the reaction starts with, i.e. the entry vector with its two key elements flanking an insert and the destination vector with its NheI recognition site. By the enzymatic action (arrows) of Esp3I and NheI these vectors are linearized to form linear intermediate products as shown in the central box. These intermediates are subject to T4 ligase activity and can be ligated to yield a range of products: the initial vectors (upper box), circular intermediate products (lower box) and the desired product vector. Note that all circular intermediate products are again substrate for Esp3I and thus again linearized. There is a sole stable product in this reaction system, which is the desired product vector (circular products only shown if carrying at least one resistance marker). Shaded boxes termed KEY: key element as shown in Fig. 1.
Figure Legend Snippet: Schematic overview of the subcloning procedure . The upper box contains the two vectors the reaction starts with, i.e. the entry vector with its two key elements flanking an insert and the destination vector with its NheI recognition site. By the enzymatic action (arrows) of Esp3I and NheI these vectors are linearized to form linear intermediate products as shown in the central box. These intermediates are subject to T4 ligase activity and can be ligated to yield a range of products: the initial vectors (upper box), circular intermediate products (lower box) and the desired product vector. Note that all circular intermediate products are again substrate for Esp3I and thus again linearized. There is a sole stable product in this reaction system, which is the desired product vector (circular products only shown if carrying at least one resistance marker). Shaded boxes termed KEY: key element as shown in Fig. 1.

Techniques Used: Subcloning, Plasmid Preparation, Activity Assay, Marker

4) Product Images from ""

Article Title:

Journal:

doi: 10.1074/jbc.M109.010413

Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.
Figure Legend Snippet: Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.

Techniques Used: Ligation

Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.
Figure Legend Snippet: Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.

Techniques Used: Activity Assay, Ligation

5) Product Images from "Enzyme-guided DNA Sewing Architecture"

Article Title: Enzyme-guided DNA Sewing Architecture

Journal: Scientific Reports

doi: 10.1038/srep17722

Schematic drawing of major ligation factors and evaluation of T4 ligase activity. ( a ) A schematic of DNA sewing material preparation. Each overhang sequence of WY-, EY- and CY-DNA blocks is ligated by T4 ligase. ( b ) Depiction of the ligation mechanism and three major ligation factors. These major factors were characterized by impact on ligation efficiency. ( c ) Various molar concentrations of Y-DNAs were tested with fixed amounts of adenosine triphosphate (1 mM) and T4 ligase (30 Weiss units). ( d ) Molar ratios of EY-DNA were changed under the fixed amount of WY-CY, which means the mixed solution of WY-DNA and CY-DNA in determined molar ratio. The concentration of WY-CY was fixed to 6 μM in ligation solution. The ratios of WY-CY to EY-DNA were 1:0.5, 1:1, 1:2 and 1:4 in sequence. Blue, red and green bars represent T-DNA, partial T-DNA and unreacted Y-DNA, respectively. ( e ) Various salt concentrations (15, 50, 100, 200 and 400 mM) were tested. Each data point represents the mean of triplicate experiments; error bars represent the SD.
Figure Legend Snippet: Schematic drawing of major ligation factors and evaluation of T4 ligase activity. ( a ) A schematic of DNA sewing material preparation. Each overhang sequence of WY-, EY- and CY-DNA blocks is ligated by T4 ligase. ( b ) Depiction of the ligation mechanism and three major ligation factors. These major factors were characterized by impact on ligation efficiency. ( c ) Various molar concentrations of Y-DNAs were tested with fixed amounts of adenosine triphosphate (1 mM) and T4 ligase (30 Weiss units). ( d ) Molar ratios of EY-DNA were changed under the fixed amount of WY-CY, which means the mixed solution of WY-DNA and CY-DNA in determined molar ratio. The concentration of WY-CY was fixed to 6 μM in ligation solution. The ratios of WY-CY to EY-DNA were 1:0.5, 1:1, 1:2 and 1:4 in sequence. Blue, red and green bars represent T-DNA, partial T-DNA and unreacted Y-DNA, respectively. ( e ) Various salt concentrations (15, 50, 100, 200 and 400 mM) were tested. Each data point represents the mean of triplicate experiments; error bars represent the SD.

Techniques Used: Ligation, Activity Assay, Sequencing, Concentration Assay

6) Product Images from "Enzyme-guided DNA Sewing Architecture"

Article Title: Enzyme-guided DNA Sewing Architecture

Journal: Scientific Reports

doi: 10.1038/srep17722

Schematic drawing of major ligation factors and evaluation of T4 ligase activity. ( a ) A schematic of DNA sewing material preparation. Each overhang sequence of WY-, EY- and CY-DNA blocks is ligated by T4 ligase. ( b ) Depiction of the ligation mechanism and three major ligation factors. These major factors were characterized by impact on ligation efficiency. ( c ) Various molar concentrations of Y-DNAs were tested with fixed amounts of adenosine triphosphate (1 mM) and T4 ligase (30 Weiss units). ( d ) Molar ratios of EY-DNA were changed under the fixed amount of WY-CY, which means the mixed solution of WY-DNA and CY-DNA in determined molar ratio. The concentration of WY-CY was fixed to 6 μM in ligation solution. The ratios of WY-CY to EY-DNA were 1:0.5, 1:1, 1:2 and 1:4 in sequence. Blue, red and green bars represent T-DNA, partial T-DNA and unreacted Y-DNA, respectively. ( e ) Various salt concentrations (15, 50, 100, 200 and 400 mM) were tested. Each data point represents the mean of triplicate experiments; error bars represent the SD.
Figure Legend Snippet: Schematic drawing of major ligation factors and evaluation of T4 ligase activity. ( a ) A schematic of DNA sewing material preparation. Each overhang sequence of WY-, EY- and CY-DNA blocks is ligated by T4 ligase. ( b ) Depiction of the ligation mechanism and three major ligation factors. These major factors were characterized by impact on ligation efficiency. ( c ) Various molar concentrations of Y-DNAs were tested with fixed amounts of adenosine triphosphate (1 mM) and T4 ligase (30 Weiss units). ( d ) Molar ratios of EY-DNA were changed under the fixed amount of WY-CY, which means the mixed solution of WY-DNA and CY-DNA in determined molar ratio. The concentration of WY-CY was fixed to 6 μM in ligation solution. The ratios of WY-CY to EY-DNA were 1:0.5, 1:1, 1:2 and 1:4 in sequence. Blue, red and green bars represent T-DNA, partial T-DNA and unreacted Y-DNA, respectively. ( e ) Various salt concentrations (15, 50, 100, 200 and 400 mM) were tested. Each data point represents the mean of triplicate experiments; error bars represent the SD.

Techniques Used: Ligation, Activity Assay, Sequencing, Concentration Assay

Related Articles

Clone Assay:

Article Title: BRG1-SWI/SNF-dependent regulation of the Wt1 transcriptional landscape mediates epicardial activity during heart development and disease
Article Snippet: The PCR product was digested with EcoRI and BamHI and ligated into pEGFP-N3 using T4 ligase (Promega). .. Wt1767 -luc/pGL2 Basic – a 767 bp sequence of the mouse Wt1 promoter spanning −513 to +254 nucleotides relative to the transcription initiation site was provided by Holger Scholz (Berlin).

Article Title: Chromatin Accessibility-Based Characterization of the Gene Regulatory Network Underlying Plasmodium falciparum Blood-Stage Development
Article Snippet: Paragraph title: Plasmid DNA Cloning ... The orientation of the 5′cam-snf7-gfp-3′hsp86 cassette was reversed using the primers ‘5′Pfcam-F’ and ‘3′hsp86-R’, PstI/Apa I digestion and ligation by the T4 ligase (Promega, #M1804) resulting in plasmid pOM1.

Article Title: Binding affinity of five PBPs to Ostrinia sex pheromones
Article Snippet: The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C. .. The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C.

Article Title: Molecular analyses of H3N2 canine influenza viruses isolated from Korea during 2013–2014
Article Snippet: Paragraph title: RT-PCR, cloning, and sequencing of the two Korean CIV isolates ... The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions.

Article Title: Combinatory Microarray and SuperSAGE Analyses Identify Pairing-Dependently Transcribed Genes in Schistosoma mansoni Males, Including Follistatin
Article Snippet: Extracted fragments were cloned into pDrive (Qiagen) and later regained by restriction-digestion to be again checked for correct size on a 1.0% agarose gel and extracted. .. Finally, fragments were ligated into pBridge and pACT2, respectively, using T4 Ligase (Promega).

Amplification:

Article Title: BRG1-SWI/SNF-dependent regulation of the Wt1 transcriptional landscape mediates epicardial activity during heart development and disease
Article Snippet: The PCR product was digested with EcoRI and BamHI and ligated into pEGFP-N3 using T4 ligase (Promega). .. Wt1767 -luc/pGL2 Basic – a 767 bp sequence of the mouse Wt1 promoter spanning −513 to +254 nucleotides relative to the transcription initiation site was provided by Holger Scholz (Berlin).

Article Title: Chromatin Accessibility-Based Characterization of the Gene Regulatory Network Underlying Plasmodium falciparum Blood-Stage Development
Article Snippet: The orientation of the 5′cam-snf7-gfp-3′hsp86 cassette was reversed using the primers ‘5′Pfcam-F’ and ‘3′hsp86-R’, PstI/Apa I digestion and ligation by the T4 ligase (Promega, #M1804) resulting in plasmid pOM1. .. Finally, the 5′cam was replaced by the kahrp minimal promoter ( ) using the primers ‘kahrp-F’ and ‘kahrp-R’, digestion by Avr II/Age I and T4 ligation resulting in plasmid att P(+)_ minkahrp .

Article Title: Molecular analyses of H3N2 canine influenza viruses isolated from Korea during 2013–2014
Article Snippet: For the reverse transcription and PCR amplification reactions for sequencing, a One-Step RT-PCR kit (QIAGEN, USA) was used. .. The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions.

Synthesized:

Article Title: Prokaryotic expression and characterization of the heterodimeric construction of ZnT8 and its application for autoantibodies detection in diabetes mellitus
Article Snippet: Restriction enzymes, Pfu polymerase and T4 ligase were from Promega (Madison, WI, USA). .. The coding sequence of dimeric C-terminal domain of human ZnT8 consisting of amino acids 268–369 [Arg325] and amino acids 268–369 [Trp325] were optimized for prokaryotic expression.

TA Cloning:

Article Title: Rapid single step subcloning procedure by combined action of type II and type IIs endonucleases with ligase
Article Snippet: A blunt end cutting enzyme to Taq-generate T overhangs for TA cloning of PCR products or any other means to insert a fragment of choice are of course feasible as well. .. We combined entry vector, destination vector, Esp3I (Fermentas), NheI (Fermentas) and T4 ligase (Promega) in a buffer allowing all three enzyme actions (**) and incubated at room temperature for 1 hour (Figure ).

Article Title: Genetic Engineering and Chemical Conjugation of Potato Virus X
Article Snippet: T4 ligase (Promega). .. Gel purification kit (e.g., QIAquick Gel Extraction Kit Qiagen).

Blocking Assay:

Article Title: Enzyme-guided DNA Sewing Architecture
Article Snippet: To synthesize a Y-DNA block, three different oligonucleotides were designed and manufactured. demonstrates the T-DNA and Y-DNA sequence information. .. To construct T-DNA, sequences were formed via a complementary hybridization of each base, followed by T4 ligase (Promega, Madison, WI).

Electrophoresis:

Article Title: Genetic Engineering and Chemical Conjugation of Potato Virus X
Article Snippet: T4 ligase (Promega). .. T4 ligase (Promega).

Incubation:

Article Title: Rapid single step subcloning procedure by combined action of type II and type IIs endonucleases with ligase
Article Snippet: It is essential to design the key element restriction site in a way that the bases directly adjacent to the single stranded overhang are different from those in a NheI recognition site (compare Figure and ). .. We combined entry vector, destination vector, Esp3I (Fermentas), NheI (Fermentas) and T4 ligase (Promega) in a buffer allowing all three enzyme actions (**) and incubated at room temperature for 1 hour (Figure ). .. We transformed 2 μl of the resulting solution into DH5α chemically competent E. coli (Invitrogen) and plated on two plates either containing kanamycin or ampicillin.

Article Title: Targeting Mycobacterium tuberculosis Tumor Necrosis Factor Alpha-Downregulating Genes for the Development of Antituberculous Vaccines
Article Snippet: The genomic DNA was partially digested with Sau3A for 1 h at 37°C to obtain DNA fragments of around 20 to 30 kbp in size and then ligated overnight at 4°C to the pYUB412-derived 3,789-bp and 4,773-bp fragments using T4 ligase (Promega). .. The genomic DNA was partially digested with Sau3A for 1 h at 37°C to obtain DNA fragments of around 20 to 30 kbp in size and then ligated overnight at 4°C to the pYUB412-derived 3,789-bp and 4,773-bp fragments using T4 ligase (Promega).

Article Title: Binding affinity of five PBPs to Ostrinia sex pheromones
Article Snippet: The pGEM plasmid inserts were excised using Bam HI and Hind III double digestion, excised from a 1% agarose gel and fragments purified using Nucleic Acid Purification Kit (Axygen, USA). .. The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C. .. Recombinant pET30a(+) vectors containing inserts derived from the five pheromone binding proteins (Ofur PBP1-Ofur PBP5) were used to transform BL21(DE3) Escherichia coli cells by electroporation, and cells allowed to recover in SOC medium for 1 h at 37 °C.

Expressing:

Article Title: Chromatin Accessibility-Based Characterization of the Gene Regulatory Network Underlying Plasmodium falciparum Blood-Stage Development
Article Snippet: The orientation of the 5′cam-snf7-gfp-3′hsp86 cassette was reversed using the primers ‘5′Pfcam-F’ and ‘3′hsp86-R’, PstI/Apa I digestion and ligation by the T4 ligase (Promega, #M1804) resulting in plasmid pOM1. .. Accessible or control regions located upstream of the genes PF3D7_0719000, PF3D7_1200700 and PF3D7_1222700 or the accessible region upstream of PF3D7_1372200 were amplified and inserted upstream of the kahrp minimal promoter using their respective primers listed in and BglII/Not I digestion and ligation by the T4 ligase.

Article Title: Binding affinity of five PBPs to Ostrinia sex pheromones
Article Snippet: Paragraph title: Prokaryotic expression and purification ... The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C.

Article Title: Prokaryotic expression and characterization of the heterodimeric construction of ZnT8 and its application for autoantibodies detection in diabetes mellitus
Article Snippet: Paragraph title: Expression vector ... Restriction enzymes, Pfu polymerase and T4 ligase were from Promega (Madison, WI, USA).

Article Title: An immunoaffinity-based method for isolating ultrapure adult astrocytes based on ATP1B2 targeting by the ACSA-2 antibody
Article Snippet: Paragraph title: Ligation into the pCAGIG expression vector ... Ligation with amplicons was performed using T4 ligase (Promega), according to standard protocols.

Modification:

Article Title: Rapid single step subcloning procedure by combined action of type II and type IIs endonucleases with ligase
Article Snippet: To test our method we accordingly modified the plasmid pGEM-T easy and included a BglII site to be able to insert a DNA fragment between these elements. .. We combined entry vector, destination vector, Esp3I (Fermentas), NheI (Fermentas) and T4 ligase (Promega) in a buffer allowing all three enzyme actions (**) and incubated at room temperature for 1 hour (Figure ).

Article Title: Targeting Mycobacterium tuberculosis Tumor Necrosis Factor Alpha-Downregulating Genes for the Development of Antituberculous Vaccines
Article Snippet: M. tuberculosis H37Rv genomic DNA was prepared from a 20-ml culture (OD600 , ~3) grown in Middlebrook 7H9 supplemented with 10% OADC, 0.2% glycerol, and 0.05% Tween 80 as previously described , with the following modification: the genomic DNA, once precipitated in isopropanol, was spooled and immersed in ethanol and was then air-dried instead of being spun down. .. The genomic DNA was partially digested with Sau3A for 1 h at 37°C to obtain DNA fragments of around 20 to 30 kbp in size and then ligated overnight at 4°C to the pYUB412-derived 3,789-bp and 4,773-bp fragments using T4 ligase (Promega).

Article Title: Chromatin Accessibility-Based Characterization of the Gene Regulatory Network Underlying Plasmodium falciparum Blood-Stage Development
Article Snippet: To generate the specific att P-plasmids, the pDC2 plasmid ( ) was modified on several points. (All primers used for cloning, integration checking and RT-qPCR are listed in ). .. The orientation of the 5′cam-snf7-gfp-3′hsp86 cassette was reversed using the primers ‘5′Pfcam-F’ and ‘3′hsp86-R’, PstI/Apa I digestion and ligation by the T4 ligase (Promega, #M1804) resulting in plasmid pOM1.

Transformation Assay:

Article Title: Binding affinity of five PBPs to Ostrinia sex pheromones
Article Snippet: The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C. .. Recombinant pET30a(+) vectors containing inserts derived from the five pheromone binding proteins (Ofur PBP1-Ofur PBP5) were used to transform BL21(DE3) Escherichia coli cells by electroporation, and cells allowed to recover in SOC medium for 1 h at 37 °C.

Article Title: Combinatory Microarray and SuperSAGE Analyses Identify Pairing-Dependently Transcribed Genes in Schistosoma mansoni Males, Including Follistatin
Article Snippet: Finally, fragments were ligated into pBridge and pACT2, respectively, using T4 Ligase (Promega). .. Finally, fragments were ligated into pBridge and pACT2, respectively, using T4 Ligase (Promega).

Gel Purification:

Article Title: Genetic Engineering and Chemical Conjugation of Potato Virus X
Article Snippet: T4 ligase (Promega). .. Electrophoresis: 1.2 % (w/v) agarose gel in 1× TAE buffer.

Sequencing:

Article Title: Enzyme-guided DNA Sewing Architecture
Article Snippet: To synthesize a Y-DNA block, three different oligonucleotides were designed and manufactured. demonstrates the T-DNA and Y-DNA sequence information. .. To construct T-DNA, sequences were formed via a complementary hybridization of each base, followed by T4 ligase (Promega, Madison, WI).

Article Title: Rapid single step subcloning procedure by combined action of type II and type IIs endonucleases with ligase
Article Snippet: Both of the two identical key elements comprise a recognition sequence for a type IIs restriction endonuclease – Esp3I in our case – and a restriction site (Figure ). .. We combined entry vector, destination vector, Esp3I (Fermentas), NheI (Fermentas) and T4 ligase (Promega) in a buffer allowing all three enzyme actions (**) and incubated at room temperature for 1 hour (Figure ).

Article Title: BRG1-SWI/SNF-dependent regulation of the Wt1 transcriptional landscape mediates epicardial activity during heart development and disease
Article Snippet: Tβ4-EGFP-N3: using a full-length cDNA of Tβ4 in pcDNA3.1 as template DNA, PCR was performed using primers that added a Kozak sequence and EcoRI site to the 5′ end and a flexible glycine-serine linker and BamHI site to the 3′ end of the Tβ4 open-reading frame (ORF). .. The PCR product was digested with EcoRI and BamHI and ligated into pEGFP-N3 using T4 ligase (Promega).

Article Title: Prokaryotic expression and characterization of the heterodimeric construction of ZnT8 and its application for autoantibodies detection in diabetes mellitus
Article Snippet: Restriction enzymes, Pfu polymerase and T4 ligase were from Promega (Madison, WI, USA). .. The coding sequence of dimeric C-terminal domain of human ZnT8 consisting of amino acids 268–369 [Arg325] and amino acids 268–369 [Trp325] were optimized for prokaryotic expression.

Article Title: Molecular analyses of H3N2 canine influenza viruses isolated from Korea during 2013–2014
Article Snippet: Paragraph title: RT-PCR, cloning, and sequencing of the two Korean CIV isolates ... The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions.

Article Title: EZH2 enhances the differentiation of fibroblasts into myofibroblasts in idiopathic pulmonary fibrosis. EZH2 enhances the differentiation of fibroblasts into myofibroblasts in idiopathic pulmonary fibrosis
Article Snippet: The final sequence was AATTCAAAAAGCAGCTTTCTGTTCAACTTGATCTCTTGAATCAAGTTGAACAGAAAGCTGG. .. The annealed oligo was then ligated to the digested pGreenPuro vector using T4 ligase (Promega).

Article Title: Combinatory Microarray and SuperSAGE Analyses Identify Pairing-Dependently Transcribed Genes in Schistosoma mansoni Males, Including Follistatin
Article Snippet: Due to its large size, the sequence for SmBMP was split into four sub-fragments, which were separately cloned into pACT2. .. Finally, fragments were ligated into pBridge and pACT2, respectively, using T4 Ligase (Promega).

Inverse PCR:

Article Title: A long noncoding RNA promotes cellulase expression in Trichoderma reesei
Article Snippet: Paragraph title: Inverse PCR ... After heat inactivation, 2 µl of T4 Ligase (Promega, 1–3 U/µl) and the corresponding buffer were added and ligation was performed at 18 °C for 90 min.

Ligation:

Article Title: Chromatin Accessibility-Based Characterization of the Gene Regulatory Network Underlying Plasmodium falciparum Blood-Stage Development
Article Snippet: To generate the specific att P-plasmids, the pDC2 plasmid ( ) was modified on several points. (All primers used for cloning, integration checking and RT-qPCR are listed in ). .. The orientation of the 5′cam-snf7-gfp-3′hsp86 cassette was reversed using the primers ‘5′Pfcam-F’ and ‘3′hsp86-R’, PstI/Apa I digestion and ligation by the T4 ligase (Promega, #M1804) resulting in plasmid pOM1. .. The snf7-gfp element was replaced by the gfp-luc sequence from the MV163 plasmid ( ) using the primers ‘GFPLuc-F’ and ‘GFPLuc-R’, Avr II/Xho I digestion and ligation by the T4 ligase resulting in plasmid pOM2.

Article Title: A long noncoding RNA promotes cellulase expression in Trichoderma reesei
Article Snippet: 20 µg of chromosomal DNA were digested with either Acc 65I or Not I (Thermo Scientific) at a final concentration of 1 U/µl in a total reaction volume of 20 µl according to the manufacturer’s instructions. .. After heat inactivation, 2 µl of T4 Ligase (Promega, 1–3 U/µl) and the corresponding buffer were added and ligation was performed at 18 °C for 90 min. .. Subsequently, the ligation was stopped by heat inactivation and 1 µl was applied as template in a 25 µl inverse PCR reaction, initially using the primers amdS inv for and amdS inv rev.

Article Title: An immunoaffinity-based method for isolating ultrapure adult astrocytes based on ATP1B2 targeting by the ACSA-2 antibody
Article Snippet: The pCAGIG vector was obtained from Addgene and was cut using appropriate restriction enzymes ( ). .. Ligation with amplicons was performed using T4 ligase (Promega), according to standard protocols. .. Amplicons were mixed with linearized vector in a 3:1 molar ratio (not exceeding 10 ng/μl DNA concentration).

Article Title: Regulation of miR-200c/141 expression by intergenic DNA-looping and transcriptional read-through
Article Snippet: The restriction enzyme was chosen in order to investigate the short-range chromatin interaction with a high-resolution capacity in our region of interest. .. Ligation in diluted conditions (total of 80 ml) was performed at 16 °C for 4 h followed by 30 min at room temperature using T4 ligase from Promega (# M1794). .. After overnight reverse crosslink at 65 °C with proteinase K (Roche, #03 115 836 001), DNA was extracted with phenol and chloroform and precipitated in ethanol.

Cell Culture:

Article Title: Binding affinity of five PBPs to Ostrinia sex pheromones
Article Snippet: The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C. .. The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C.

Generated:

Article Title: Chromatin Accessibility-Based Characterization of the Gene Regulatory Network Underlying Plasmodium falciparum Blood-Stage Development
Article Snippet: To examine the regulatory potential of the identified accessible several parasite lines were generated: four parasite lines with an integrated plasmid containing an accessible region detected by ATAC-seq upstream of a minimal kahrp promoter and a gfp-luc reporter gene ( A and A), two parasite lines with a not-accessible, control region instead of the accessible region (a third line did not show successful integration) and one parasite with an integrated plasmid containing the minimal promoter followed by the reporter gene. .. The orientation of the 5′cam-snf7-gfp-3′hsp86 cassette was reversed using the primers ‘5′Pfcam-F’ and ‘3′hsp86-R’, PstI/Apa I digestion and ligation by the T4 ligase (Promega, #M1804) resulting in plasmid pOM1.

other:

Article Title: Rapid single step subcloning procedure by combined action of type II and type IIs endonucleases with ligase
Article Snippet: Enzyme amounts: 7.5 units Esp3I, 10 units NheI, 3 weiss units T4 ligase.

Article Title: Enzyme-guided DNA Sewing Architecture
Article Snippet: Different amounts of Y-DNAs (0.3 μM, 0.6 μM, 1.2 μM and 1.5 μM) were combined with T4 ligase (2 μl) and 10× ligase buffer(5 μl) in a total volume of 50 μl.

Polymerase Chain Reaction:

Article Title: Rapid single step subcloning procedure by combined action of type II and type IIs endonucleases with ligase
Article Snippet: A blunt end cutting enzyme to Taq-generate T overhangs for TA cloning of PCR products or any other means to insert a fragment of choice are of course feasible as well. .. We combined entry vector, destination vector, Esp3I (Fermentas), NheI (Fermentas) and T4 ligase (Promega) in a buffer allowing all three enzyme actions (**) and incubated at room temperature for 1 hour (Figure ).

Article Title: BRG1-SWI/SNF-dependent regulation of the Wt1 transcriptional landscape mediates epicardial activity during heart development and disease
Article Snippet: PCR was carried out using Pfu polymerase (Promega). .. The PCR product was digested with EcoRI and BamHI and ligated into pEGFP-N3 using T4 ligase (Promega). .. For NLS-Tβ4-myc/pcDNA3: NLS-Tβ4-myc was synthesized by Eurofins MWG Operon and inserted into pcDNA3.

Article Title: Molecular analyses of H3N2 canine influenza viruses isolated from Korea during 2013–2014
Article Snippet: All of the PCR reactions were performed in a BiometraT3000 thermal cycler (Biometra, the Netherlands) and then were analyzed on 1–1.5 % SeaKem LE agarose gel (Lonza, USA) containing RedSafe™ Nucleic Acid Staining Solution (iNtRon Biotechnology, South Korea), in 0.5X Tris–acetate-EDTA (TAE) buffer (BIOSESANG Inc., South Korea). .. The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions.

Article Title: Combinatory Microarray and SuperSAGE Analyses Identify Pairing-Dependently Transcribed Genes in Schistosoma mansoni Males, Including Follistatin
Article Snippet: Finally, fragments were ligated into pBridge and pACT2, respectively, using T4 Ligase (Promega). .. Finally, fragments were ligated into pBridge and pACT2, respectively, using T4 Ligase (Promega).

Recombinant:

Article Title: Molecular analyses of H3N2 canine influenza viruses isolated from Korea during 2013–2014
Article Snippet: The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions. .. After transformation of the ligated products into DH5α chemically competent E. coli (Enzynomics, South Korea), the transformed bacteria were left for 1 hour in S.O.C. medium (Invitrogen, USA) at 37 °C for recovery, and later, 200 µL of the transformation culture were plated onto an LB agar plate containing ampicillin (AMRESCO Inc., USA) (100 mg/mL), IPTG (Bioneer Corp., South Korea) (1 M) and X-gal (iNtRon Biotechnology, Korea) (20 mg/mL), which was cultured overnight at 37 °C.

Nucleic Acid Purification:

Article Title: Binding affinity of five PBPs to Ostrinia sex pheromones
Article Snippet: The pGEM plasmid inserts were excised using Bam HI and Hind III double digestion, excised from a 1% agarose gel and fragments purified using Nucleic Acid Purification Kit (Axygen, USA). .. The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C.

Isolation:

Article Title: Binding affinity of five PBPs to Ostrinia sex pheromones
Article Snippet: The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C. .. The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C.

Article Title: Molecular analyses of H3N2 canine influenza viruses isolated from Korea during 2013–2014
Article Snippet: The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions. .. After transformation of the ligated products into DH5α chemically competent E. coli (Enzynomics, South Korea), the transformed bacteria were left for 1 hour in S.O.C. medium (Invitrogen, USA) at 37 °C for recovery, and later, 200 µL of the transformation culture were plated onto an LB agar plate containing ampicillin (AMRESCO Inc., USA) (100 mg/mL), IPTG (Bioneer Corp., South Korea) (1 M) and X-gal (iNtRon Biotechnology, Korea) (20 mg/mL), which was cultured overnight at 37 °C.

Article Title: EZH2 enhances the differentiation of fibroblasts into myofibroblasts in idiopathic pulmonary fibrosis. EZH2 enhances the differentiation of fibroblasts into myofibroblasts in idiopathic pulmonary fibrosis
Article Snippet: The annealed oligo was then ligated to the digested pGreenPuro vector using T4 ligase (Promega). .. The plasmids were transformed and amplified in competent cells (E. coli ST3).

Subcloning:

Article Title: Targeting Mycobacterium tuberculosis Tumor Necrosis Factor Alpha-Downregulating Genes for the Development of Antituberculous Vaccines
Article Snippet: Paragraph title: M. tuberculosis cosmid library construction and subcloning analysis of TNF-downregulating hits. ... The genomic DNA was partially digested with Sau3A for 1 h at 37°C to obtain DNA fragments of around 20 to 30 kbp in size and then ligated overnight at 4°C to the pYUB412-derived 3,789-bp and 4,773-bp fragments using T4 ligase (Promega).

Article Title: Genetic Engineering and Chemical Conjugation of Potato Virus X
Article Snippet: T4 ligase (Promega). .. Gel purification kit (e.g., QIAquick Gel Extraction Kit Qiagen).

Purification:

Article Title: Mechanism of FACT removal from transcribed genes by anticancer drugs curaxins
Article Snippet: In short, the ECs were assembled using purified yeast Pol II and DNA/RNA oligonucleotides. .. ECs and nucleosomal templates (or corresponding DNA fragments) were ligated by T4 ligase (Promega).

Article Title: Binding affinity of five PBPs to Ostrinia sex pheromones
Article Snippet: Paragraph title: Prokaryotic expression and purification ... The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C.

Article Title: Prokaryotic expression and characterization of the heterodimeric construction of ZnT8 and its application for autoantibodies detection in diabetes mellitus
Article Snippet: Restriction enzymes, Pfu polymerase and T4 ligase were from Promega (Madison, WI, USA). .. The synthesized construct (682 bp) was obtained from GenScript in plasmid pUC57 and maintained in E. coli strain JM109 (Promega, Madison, WI, USA).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Molecular analyses of H3N2 canine influenza viruses isolated from Korea during 2013–2014
Article Snippet: All of the PCR reactions were performed in a BiometraT3000 thermal cycler (Biometra, the Netherlands) and then were analyzed on 1–1.5 % SeaKem LE agarose gel (Lonza, USA) containing RedSafe™ Nucleic Acid Staining Solution (iNtRon Biotechnology, South Korea), in 0.5X Tris–acetate-EDTA (TAE) buffer (BIOSESANG Inc., South Korea). .. The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions. .. After transformation of the ligated products into DH5α chemically competent E. coli (Enzynomics, South Korea), the transformed bacteria were left for 1 hour in S.O.C. medium (Invitrogen, USA) at 37 °C for recovery, and later, 200 µL of the transformation culture were plated onto an LB agar plate containing ampicillin (AMRESCO Inc., USA) (100 mg/mL), IPTG (Bioneer Corp., South Korea) (1 M) and X-gal (iNtRon Biotechnology, Korea) (20 mg/mL), which was cultured overnight at 37 °C.

shRNA:

Article Title: EZH2 enhances the differentiation of fibroblasts into myofibroblasts in idiopathic pulmonary fibrosis. EZH2 enhances the differentiation of fibroblasts into myofibroblasts in idiopathic pulmonary fibrosis
Article Snippet: Paragraph title: Construction of the shRNA vector ... The annealed oligo was then ligated to the digested pGreenPuro vector using T4 ligase (Promega).

Quantitative RT-PCR:

Article Title: Chromatin Accessibility-Based Characterization of the Gene Regulatory Network Underlying Plasmodium falciparum Blood-Stage Development
Article Snippet: To generate the specific att P-plasmids, the pDC2 plasmid ( ) was modified on several points. (All primers used for cloning, integration checking and RT-qPCR are listed in ). .. The orientation of the 5′cam-snf7-gfp-3′hsp86 cassette was reversed using the primers ‘5′Pfcam-F’ and ‘3′hsp86-R’, PstI/Apa I digestion and ligation by the T4 ligase (Promega, #M1804) resulting in plasmid pOM1.

Polyacrylamide Gel Electrophoresis:

Article Title: Mechanism of FACT removal from transcribed genes by anticancer drugs curaxins
Article Snippet: ECs and nucleosomal templates (or corresponding DNA fragments) were ligated by T4 ligase (Promega). .. ECs and nucleosomal templates (or corresponding DNA fragments) were ligated by T4 ligase (Promega).

Staining:

Article Title:
Article Snippet: Unless otherwise stated, reactions (10 μl) contained 10 n m (molecules) DNA substrate in 20 m m HEPES-NaOH, pH 7.5, 100 μg/ml bovine serum albumin, 10% glycerol, 5 m m MgCl2 , 4 m m ATP, 4 μ m [α-32 P]dCTP (∼60 Ci/mmol), and the following proteins as indicated: UL2 (200 n m ), E. coli UDG (1 unit), APE (1.25 units), UL30 (100 n m ), UL42 (100 n m ), T4 ligase (Promega), ligase I (50 n m ), ligase IIIα-XRCC1 (50 n m ), Pol β (100 n m ), Pol δ (400 n m ), or exonuclease-deficient Klenow Pol (1 unit). .. Unless otherwise stated, reactions (10 μl) contained 10 n m (molecules) DNA substrate in 20 m m HEPES-NaOH, pH 7.5, 100 μg/ml bovine serum albumin, 10% glycerol, 5 m m MgCl2 , 4 m m ATP, 4 μ m [α-32 P]dCTP (∼60 Ci/mmol), and the following proteins as indicated: UL2 (200 n m ), E. coli UDG (1 unit), APE (1.25 units), UL30 (100 n m ), UL42 (100 n m ), T4 ligase (Promega), ligase I (50 n m ), ligase IIIα-XRCC1 (50 n m ), Pol β (100 n m ), Pol δ (400 n m ), or exonuclease-deficient Klenow Pol (1 unit).

Article Title: Molecular analyses of H3N2 canine influenza viruses isolated from Korea during 2013–2014
Article Snippet: All of the PCR reactions were performed in a BiometraT3000 thermal cycler (Biometra, the Netherlands) and then were analyzed on 1–1.5 % SeaKem LE agarose gel (Lonza, USA) containing RedSafe™ Nucleic Acid Staining Solution (iNtRon Biotechnology, South Korea), in 0.5X Tris–acetate-EDTA (TAE) buffer (BIOSESANG Inc., South Korea). .. The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions.

IA:

Article Title: Enzyme-guided DNA Sewing Architecture
Article Snippet: To construct T-DNA, sequences were formed via a complementary hybridization of each base, followed by T4 ligase (Promega, Madison, WI). .. To construct T-DNA, sequences were formed via a complementary hybridization of each base, followed by T4 ligase (Promega, Madison, WI).

Chromatin Immunoprecipitation:

Article Title: BRG1-SWI/SNF-dependent regulation of the Wt1 transcriptional landscape mediates epicardial activity during heart development and disease
Article Snippet: The PCR product was digested with EcoRI and BamHI and ligated into pEGFP-N3 using T4 ligase (Promega). .. Wt1767 -luc/pGL2 Basic – a 767 bp sequence of the mouse Wt1 promoter spanning −513 to +254 nucleotides relative to the transcription initiation site was provided by Holger Scholz (Berlin).

Plasmid Preparation:

Article Title: Rapid single step subcloning procedure by combined action of type II and type IIs endonucleases with ligase
Article Snippet: It is essential to design the key element restriction site in a way that the bases directly adjacent to the single stranded overhang are different from those in a NheI recognition site (compare Figure and ). .. We combined entry vector, destination vector, Esp3I (Fermentas), NheI (Fermentas) and T4 ligase (Promega) in a buffer allowing all three enzyme actions (**) and incubated at room temperature for 1 hour (Figure ). .. We transformed 2 μl of the resulting solution into DH5α chemically competent E. coli (Invitrogen) and plated on two plates either containing kanamycin or ampicillin.

Article Title: Targeting Mycobacterium tuberculosis Tumor Necrosis Factor Alpha-Downregulating Genes for the Development of Antituberculous Vaccines
Article Snippet: The plasmid pYUB412 was linearized with XbaI, dephosphorylated with shrimp alkaline phosphatase (Promega), and then digested with BclI to obtain 3,789-bp and 4,773-bp fragments. .. The genomic DNA was partially digested with Sau3A for 1 h at 37°C to obtain DNA fragments of around 20 to 30 kbp in size and then ligated overnight at 4°C to the pYUB412-derived 3,789-bp and 4,773-bp fragments using T4 ligase (Promega).

Article Title: Chromatin Accessibility-Based Characterization of the Gene Regulatory Network Underlying Plasmodium falciparum Blood-Stage Development
Article Snippet: To generate the specific att P-plasmids, the pDC2 plasmid ( ) was modified on several points. (All primers used for cloning, integration checking and RT-qPCR are listed in ). .. The orientation of the 5′cam-snf7-gfp-3′hsp86 cassette was reversed using the primers ‘5′Pfcam-F’ and ‘3′hsp86-R’, PstI/Apa I digestion and ligation by the T4 ligase (Promega, #M1804) resulting in plasmid pOM1. .. The snf7-gfp element was replaced by the gfp-luc sequence from the MV163 plasmid ( ) using the primers ‘GFPLuc-F’ and ‘GFPLuc-R’, Avr II/Xho I digestion and ligation by the T4 ligase resulting in plasmid pOM2.

Article Title: Binding affinity of five PBPs to Ostrinia sex pheromones
Article Snippet: The pGEM plasmid inserts were excised using Bam HI and Hind III double digestion, excised from a 1% agarose gel and fragments purified using Nucleic Acid Purification Kit (Axygen, USA). .. The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C. .. Recombinant pET30a(+) vectors containing inserts derived from the five pheromone binding proteins (Ofur PBP1-Ofur PBP5) were used to transform BL21(DE3) Escherichia coli cells by electroporation, and cells allowed to recover in SOC medium for 1 h at 37 °C.

Article Title: Prokaryotic expression and characterization of the heterodimeric construction of ZnT8 and its application for autoantibodies detection in diabetes mellitus
Article Snippet: Paragraph title: Expression vector ... Restriction enzymes, Pfu polymerase and T4 ligase were from Promega (Madison, WI, USA).

Article Title: An immunoaffinity-based method for isolating ultrapure adult astrocytes based on ATP1B2 targeting by the ACSA-2 antibody
Article Snippet: Paragraph title: Ligation into the pCAGIG expression vector ... Ligation with amplicons was performed using T4 ligase (Promega), according to standard protocols.

Article Title: Molecular analyses of H3N2 canine influenza viruses isolated from Korea during 2013–2014
Article Snippet: The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions. .. The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions.

Article Title: EZH2 enhances the differentiation of fibroblasts into myofibroblasts in idiopathic pulmonary fibrosis. EZH2 enhances the differentiation of fibroblasts into myofibroblasts in idiopathic pulmonary fibrosis
Article Snippet: The pGreenPuro vector (System Biosciences, Mountain View, CA) was first double‐digested using BamH1 and EcoR1 restriction enzymes. .. The annealed oligo was then ligated to the digested pGreenPuro vector using T4 ligase (Promega). .. The plasmids were transformed and amplified in competent cells (E. coli ST3).

Article Title: Combinatory Microarray and SuperSAGE Analyses Identify Pairing-Dependently Transcribed Genes in Schistosoma mansoni Males, Including Follistatin
Article Snippet: Finally, fragments were ligated into pBridge and pACT2, respectively, using T4 Ligase (Promega). .. Finally, fragments were ligated into pBridge and pACT2, respectively, using T4 Ligase (Promega).

Software:

Article Title:
Article Snippet: Unless otherwise stated, reactions (10 μl) contained 10 n m (molecules) DNA substrate in 20 m m HEPES-NaOH, pH 7.5, 100 μg/ml bovine serum albumin, 10% glycerol, 5 m m MgCl2 , 4 m m ATP, 4 μ m [α-32 P]dCTP (∼60 Ci/mmol), and the following proteins as indicated: UL2 (200 n m ), E. coli UDG (1 unit), APE (1.25 units), UL30 (100 n m ), UL42 (100 n m ), T4 ligase (Promega), ligase I (50 n m ), ligase IIIα-XRCC1 (50 n m ), Pol β (100 n m ), Pol δ (400 n m ), or exonuclease-deficient Klenow Pol (1 unit). .. Unless otherwise stated, reactions (10 μl) contained 10 n m (molecules) DNA substrate in 20 m m HEPES-NaOH, pH 7.5, 100 μg/ml bovine serum albumin, 10% glycerol, 5 m m MgCl2 , 4 m m ATP, 4 μ m [α-32 P]dCTP (∼60 Ci/mmol), and the following proteins as indicated: UL2 (200 n m ), E. coli UDG (1 unit), APE (1.25 units), UL30 (100 n m ), UL42 (100 n m ), T4 ligase (Promega), ligase I (50 n m ), ligase IIIα-XRCC1 (50 n m ), Pol β (100 n m ), Pol δ (400 n m ), or exonuclease-deficient Klenow Pol (1 unit).

Article Title: Molecular analyses of H3N2 canine influenza viruses isolated from Korea during 2013–2014
Article Snippet: The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions. .. The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions.

Hybridization:

Article Title: Enzyme-guided DNA Sewing Architecture
Article Snippet: Y-DNA (6 μM) was annealed in a buffer composed of 50 mM NaCl, 10 mM Tris-HCl (pH 8.0) and 0.1 mM EDTA. .. To construct T-DNA, sequences were formed via a complementary hybridization of each base, followed by T4 ligase (Promega, Madison, WI). .. To synthesize T-DNA, three Y-DNAs possessing 5′-cohesive ends were ligated with T4 ligases in 10× ligase buffer.

Selection:

Article Title: Combinatory Microarray and SuperSAGE Analyses Identify Pairing-Dependently Transcribed Genes in Schistosoma mansoni Males, Including Follistatin
Article Snippet: Finally, fragments were ligated into pBridge and pACT2, respectively, using T4 Ligase (Promega). .. The SmFst-containing plasmid was transformed in to yeast cells (AH109) together with either one of the other plasmids prepared for the interaction studies.

Agarose Gel Electrophoresis:

Article Title: Binding affinity of five PBPs to Ostrinia sex pheromones
Article Snippet: The pGEM plasmid inserts were excised using Bam HI and Hind III double digestion, excised from a 1% agarose gel and fragments purified using Nucleic Acid Purification Kit (Axygen, USA). .. The Bam HI and Hind III digestion products for Ofur PBP1 to Ofur PBP5 were then ligated individually into Bam HI and Hind III cut and dephosphorylated pET30a(+) vector by incubation with T4 Ligase (Promega) for 4 h at 16 °C.

Article Title: Molecular analyses of H3N2 canine influenza viruses isolated from Korea during 2013–2014
Article Snippet: All of the PCR reactions were performed in a BiometraT3000 thermal cycler (Biometra, the Netherlands) and then were analyzed on 1–1.5 % SeaKem LE agarose gel (Lonza, USA) containing RedSafe™ Nucleic Acid Staining Solution (iNtRon Biotechnology, South Korea), in 0.5X Tris–acetate-EDTA (TAE) buffer (BIOSESANG Inc., South Korea). .. The RT-PCR products were ligated to pGEM-T Easy Vectors with T4 ligase (Promega, USA), according to the manufacturer's instructions.

Article Title: Genetic Engineering and Chemical Conjugation of Potato Virus X
Article Snippet: T4 ligase (Promega). .. T4 ligase (Promega).

Article Title: Combinatory Microarray and SuperSAGE Analyses Identify Pairing-Dependently Transcribed Genes in Schistosoma mansoni Males, Including Follistatin
Article Snippet: Extracted fragments were cloned into pDrive (Qiagen) and later regained by restriction-digestion to be again checked for correct size on a 1.0% agarose gel and extracted. .. Finally, fragments were ligated into pBridge and pACT2, respectively, using T4 Ligase (Promega).

In Vitro:

Article Title: Mechanism of FACT removal from transcribed genes by anticancer drugs curaxins
Article Snippet: Paragraph title: In vitro transcription assay ... ECs and nucleosomal templates (or corresponding DNA fragments) were ligated by T4 ligase (Promega).

Ethanol Precipitation:

Article Title: Regulation of miR-200c/141 expression by intergenic DNA-looping and transcriptional read-through
Article Snippet: Ligation in diluted conditions (total of 80 ml) was performed at 16 °C for 4 h followed by 30 min at room temperature using T4 ligase from Promega (# M1794). .. Ligation in diluted conditions (total of 80 ml) was performed at 16 °C for 4 h followed by 30 min at room temperature using T4 ligase from Promega (# M1794).

Produced:

Article Title: EZH2 enhances the differentiation of fibroblasts into myofibroblasts in idiopathic pulmonary fibrosis. EZH2 enhances the differentiation of fibroblasts into myofibroblasts in idiopathic pulmonary fibrosis
Article Snippet: The annealed oligo was then ligated to the digested pGreenPuro vector using T4 ligase (Promega). .. The final plasmids were isolated using the QIAprep Spin Miniprep Kit (Qiagen, Valencia, CA).

Concentration Assay:

Article Title: Mechanism of FACT removal from transcribed genes by anticancer drugs curaxins
Article Snippet: ECs and nucleosomal templates (or corresponding DNA fragments) were ligated by T4 ligase (Promega). .. ECs and nucleosomal templates (or corresponding DNA fragments) were ligated by T4 ligase (Promega).

Article Title: A long noncoding RNA promotes cellulase expression in Trichoderma reesei
Article Snippet: 20 µg of chromosomal DNA were digested with either Acc 65I or Not I (Thermo Scientific) at a final concentration of 1 U/µl in a total reaction volume of 20 µl according to the manufacturer’s instructions. .. After heat inactivation, 2 µl of T4 Ligase (Promega, 1–3 U/µl) and the corresponding buffer were added and ligation was performed at 18 °C for 90 min.

Article Title: Regulation of miR-200c/141 expression by intergenic DNA-looping and transcriptional read-through
Article Snippet: DNA was digested overnight with the restriction enzyme Nco I (New England BioLabs) in a buffer containing final concentration of 1% Triton X-100 and 0.1% SDS. .. Ligation in diluted conditions (total of 80 ml) was performed at 16 °C for 4 h followed by 30 min at room temperature using T4 ligase from Promega (# M1794).

Construct:

Article Title: Enzyme-guided DNA Sewing Architecture
Article Snippet: Y-DNA (6 μM) was annealed in a buffer composed of 50 mM NaCl, 10 mM Tris-HCl (pH 8.0) and 0.1 mM EDTA. .. To construct T-DNA, sequences were formed via a complementary hybridization of each base, followed by T4 ligase (Promega, Madison, WI). .. To synthesize T-DNA, three Y-DNAs possessing 5′-cohesive ends were ligated with T4 ligases in 10× ligase buffer.

Article Title: BRG1-SWI/SNF-dependent regulation of the Wt1 transcriptional landscape mediates epicardial activity during heart development and disease
Article Snippet: Paragraph title: DNA constructs and plasmids ... The PCR product was digested with EcoRI and BamHI and ligated into pEGFP-N3 using T4 ligase (Promega).

Article Title: Prokaryotic expression and characterization of the heterodimeric construction of ZnT8 and its application for autoantibodies detection in diabetes mellitus
Article Snippet: Restriction enzymes, Pfu polymerase and T4 ligase were from Promega (Madison, WI, USA). .. Restriction enzymes, Pfu polymerase and T4 ligase were from Promega (Madison, WI, USA).

Marker:

Article Title: A long noncoding RNA promotes cellulase expression in Trichoderma reesei
Article Snippet: For the identification of the locus that was targeted by integration of the amdS marker in QM9414_Dhax1 strains, an inverse PCR was performed as follows. .. After heat inactivation, 2 µl of T4 Ligase (Promega, 1–3 U/µl) and the corresponding buffer were added and ligation was performed at 18 °C for 90 min.

Gel Extraction:

Article Title: Genetic Engineering and Chemical Conjugation of Potato Virus X
Article Snippet: T4 ligase (Promega). .. Electrophoresis: 1.2 % (w/v) agarose gel in 1× TAE buffer.

Article Title: Combinatory Microarray and SuperSAGE Analyses Identify Pairing-Dependently Transcribed Genes in Schistosoma mansoni Males, Including Follistatin
Article Snippet: The amplicons were cut out from the gel, and the DNA extracted using the PeqGold Gel Extraction Kit (Peqlab) following the manufacturer's protocol. .. Finally, fragments were ligated into pBridge and pACT2, respectively, using T4 Ligase (Promega).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Promega t4 rna ligase
    Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) T4 RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5  dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with  E. coli  poly (A) polymerase or  Schizosaccharomyces pombe  poly (U) polymerase.A total of 4000 dpm RNA (10 5  dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.
    T4 Rna Ligase, supplied by Promega, used in various techniques. Bioz Stars score: 94/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase/product/Promega
    Average 94 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase - by Bioz Stars, 2019-12
    94/100 stars
      Buy from Supplier

    89
    Promega t4 dna ligase buffer
    DNA transactions by recombinant AaHMGB1 proteins. (A) Preferential binding of AaHMGB1 protein to supercoiled DNA. An equimolar mixture of supercoiled and linearized plasmid pTZ19R (∼10 nM) was pre-incubated with increasing amounts of AaHMGB1 (0.5–1 µM) and the DNA–protein complexes were resolved on a 1% agarose gel, followed by staining of the gel with ethidium bromide. Form I, supercoiled DNA; L, Linear DNA; Form II, relaxed circular DNA; (B) DNA supercoiling by AaHMGB1 and its truncated forms. Circular relaxed plasmid pTZ19R DNA was incubated in the presence of topoisomerase I (Topo I) and AaHMGB1 recombinant proteins (7–14 µM). Deproteinized DNA topoisomers were resolved on 1% agarose gels, followed by staining of the gel with ethidium bromide. Form I, supercoiled DNA; Form II, relaxed circular DNA. (C) DNA bending by AaHMGB1 and its truncated forms. A  32 P-labeled 123-bp DNA fragment (∼1 nM) was pre-incubated with recombinant proteins (25–50 nM) followed by ligation with T4 DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Lm: linear multimers. Exo III, exonuclease III. These experiments were repeated three to five times each.
    T4 Dna Ligase Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 89/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase buffer/product/Promega
    Average 89 stars, based on 13 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase buffer - by Bioz Stars, 2019-12
    89/100 stars
      Buy from Supplier

    Image Search Results


    Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) T4 RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5  dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with  E. coli  poly (A) polymerase or  Schizosaccharomyces pombe  poly (U) polymerase.A total of 4000 dpm RNA (10 5  dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.

    Journal: Nucleic Acids Research

    Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation

    doi: 10.1093/nar/gkr822

    Figure Lengend Snippet: Enzymatic determination of the new 3′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) T4 RNA ligase treatment of gel-purified HCV RNA 1–130 (left panel) and CSFV RNA 1–218 (right panel) cleavage product band B2. B2 RNAs [4000 dpm (10 5  dpm/µg)] were incubated with T4 RNA ligase and [5′- 32 P]pCp. Lane 1: control reaction with B2 RNA incubated in SAP phosphatase buffer, then in ligase buffer and [5′- 32 P]pCp in the absence of any enzyme; Lane 2: control reaction of B2 RNA treated the same as in lane 1 but incubated with the phosphatase; Lane 3: B2 RNA incubated with T4 RNA ligase without previous dephosphorylation; Lane 4: complete reaction of B2 RNA incubated with the ligase after being treated with the phosphatase. ( b ) Addition of [ 32 P]-labeled poly (A) or poly (U) to bands B2 of HCV (left panel) and CSFV (right panel) with E. coli poly (A) polymerase or Schizosaccharomyces pombe poly (U) polymerase.A total of 4000 dpm RNA (10 5  dpm/µg) was used for both viral RNAs. A total of 20 µCi of the labeled nucleotide (ATP or UTP) was distributed for the four reactions. Lanes 1 and 2: B2 RNA incubated with the poly (A) polymerase after being treated or not with shrimp alkaline phosphatase, respectively. Lanes 3 and 4: control reactions of B2 RNA treated or not with the phosphatase but without incubation with the polymerase. Lanes 1′ 2′ 3′ and 4′ same as above, but using poly (U) polymerase. MW is a molecular weight marker.

    Article Snippet: RNA ligase was used to treat cleavage product bands, either previously phosphatase treated or not, as follows: RNAs were incubated at 4°C for 4 days in a buffer containing 10 mM MgCl2 , 50 mM HEPES, pH 8.3, 5 mM DTT, 0.12 mM ATP, 4 U of T4 RNA ligase (Promega) and [5′-32 P]pCp (Perkin-Elmer) ( , ).

    Techniques: Produced, Purification, Incubation, De-Phosphorylation Assay, Labeling, Molecular Weight, Marker

    Characterization of UV-C cleavage of viral RNAs by fingerprinting and electrophoretic methods. ( a ) The RNA fingerprints of internally [α- 32 P] HCV (panels 1–3) and CSFV RNA (panels 4–6). Labeled SM, band B1 and band B2 were exhaustively digested with RNase T1 and the products subjected to 2D separation. ( 1 ) RNA fingerprint of HCV 1–249. A total of 500 000 dpm of HCV SM was fingerprinted. Spot 1: the HCV oligonucleotide 5′ 78 UCUAG 82 3′ within which cleavage takes place; Spot 2: this has the characteristic mobility of the 5′-terminal nucleotide 5′pppGp3′. ( 2 ) RNA fingerprint of HCV B1. A total of 300 000 dpm of RNA was fingerprinted as above. Spot 1 has disappeared, while the absence of the 5′-end (spot 2) shows that HCV B1 contains the 3′-portion of SM. ( 3 ) Fingerprint of HCV B2 (100 000 dpm). ‘1’ indicates the loss of spot 1, while the presence of the HCV 5′-end (‘2’) shows that HCV B2 contains the 5′-portion of SM. ( 4–6 ): RNA fingerprints of CSFV 1-218. SM (500 000 dpm), B1 (300 000 dpm) and B2 (100 000 dpm, transcribed with all four [α- 32 P]-labeled rNTPs. ‘1’: the CSFV oligonucleotide 5′ 38 AUACACUAAAUUUCG 52 3′, which is present in SM but absent from B1 and B2; ‘X’ (a new CSFV B1 oligonucleotide) and ‘Y’ (the other new CSFV oligonucleotide) arise from cleavage within spot 1 (see text) .  ‘2’: the 5′-end of CSFV, present in SM and B2, but not B1. Numbering according to Wang  et al.  (  62 ) for HCV genotype 1b and Gene Bank J04358 for CSFV Alfort Isolate. The sequence of the spot numbered as 1 was identified by secondary RNase analysis and high voltage electrophoresis on DEAE and Whatmann paper by Hugh D. Robertson (data not available), as well as by superposition with previously resolved HCV fingerprints using secondary analysis and on the basis of the rules for RNA oligonucleotide mobility during 2D TLC. Briefly, these rules are: the larger the oligonucleotide, the slower the migration of the corresponding spot to the bottom. As far as composition is concerned, Us displace the spot to the left, Cs to the right, and As cause a slight delay, thus meaning that several As in the same oligo may cause it to behave as an oligo containing one or even two additional bases (  37 ). As far as sequence is concerned, as HCV RNA was transcribed in the presence of [α- 32 P]GTP here, those T1 oligonucleotides in the original sequence that are followed by a (pG) carry a double label. In the case of HCV RNA several RNase T1 oligonucelotides are indicated as mobility reference: a: UCCUUUCUUGp(G); b: UCUUCAGp(C) 61:68; c: CUCAAUGp(G) 211–217; d: AUUUGp(G) 225–229. Spot 1 locates in the border of the triangle that can be formed by spots i, f and g. In CSFV, spot 1 is the slow migrating spot, and thus corresponded to the largest RNase T1 oligonucleotide. In both HCV and CSFV, band B2 contains the original 5′-terminal nucleotide, pppGp, of the substrate RNA transcript (indicated by ‘2’). The disappearance of spot 1 from both product band fingerprints (see   Figure 1 a, images 2, 3 and images 5, 6) suggests that self-cleavage occurs within this oligonucleotide and that this event is specific. Moreover, in the case of CSFV RNA two smaller oligomers (X and Y) that represent the fragment products of spot 1 are observed within the fingerprints of both product bands (B1 and B2) for CSFV. Indicated at the bottom is the sequence surrounding RNase T1 cleavage sites. ( b ) Electrophoresis analysis: Autoradiogram showing a parallel run of HCV RNA 1–130 and CSFV RNA 1–218 UV-cleavage reaction, with RNase T1 treated samples and control reactions for transcripts labeled at either the 5′-extreme with [γ- 32 P]GTP during transcription or the 3′-extreme with [5′- 32 P]pCp and T4 RNA ligase. HCV (lanes 1–6) and CSFV (lanes 1–9). HCV: Lanes 1 and 1′: RNAs incubated in standard buffer; lanes 2 and 2′: RNAs treated with RNase T1 under denaturing conditions; lanes 3 and 3′: RNA irradiated with UV-C light for 180 s. CSFV: Lanes 1 and 1′: RNAs incubated under standard conditions; lanes 2, 3 and 4′: RNA treated with RNase T1; lanes 4 and 3′: RNA irradiated with UV-C light: Lanes 5 and 2′ RNAs partially degraded with alkali. ‘G’ positions of a relevant size are indicated on either side of the gels. Lines indicate SM, and products B1 and B2.

    Journal: Nucleic Acids Research

    Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation

    doi: 10.1093/nar/gkr822

    Figure Lengend Snippet: Characterization of UV-C cleavage of viral RNAs by fingerprinting and electrophoretic methods. ( a ) The RNA fingerprints of internally [α- 32 P] HCV (panels 1–3) and CSFV RNA (panels 4–6). Labeled SM, band B1 and band B2 were exhaustively digested with RNase T1 and the products subjected to 2D separation. ( 1 ) RNA fingerprint of HCV 1–249. A total of 500 000 dpm of HCV SM was fingerprinted. Spot 1: the HCV oligonucleotide 5′ 78 UCUAG 82 3′ within which cleavage takes place; Spot 2: this has the characteristic mobility of the 5′-terminal nucleotide 5′pppGp3′. ( 2 ) RNA fingerprint of HCV B1. A total of 300 000 dpm of RNA was fingerprinted as above. Spot 1 has disappeared, while the absence of the 5′-end (spot 2) shows that HCV B1 contains the 3′-portion of SM. ( 3 ) Fingerprint of HCV B2 (100 000 dpm). ‘1’ indicates the loss of spot 1, while the presence of the HCV 5′-end (‘2’) shows that HCV B2 contains the 5′-portion of SM. ( 4–6 ): RNA fingerprints of CSFV 1-218. SM (500 000 dpm), B1 (300 000 dpm) and B2 (100 000 dpm, transcribed with all four [α- 32 P]-labeled rNTPs. ‘1’: the CSFV oligonucleotide 5′ 38 AUACACUAAAUUUCG 52 3′, which is present in SM but absent from B1 and B2; ‘X’ (a new CSFV B1 oligonucleotide) and ‘Y’ (the other new CSFV oligonucleotide) arise from cleavage within spot 1 (see text) . ‘2’: the 5′-end of CSFV, present in SM and B2, but not B1. Numbering according to Wang et al. ( 62 ) for HCV genotype 1b and Gene Bank J04358 for CSFV Alfort Isolate. The sequence of the spot numbered as 1 was identified by secondary RNase analysis and high voltage electrophoresis on DEAE and Whatmann paper by Hugh D. Robertson (data not available), as well as by superposition with previously resolved HCV fingerprints using secondary analysis and on the basis of the rules for RNA oligonucleotide mobility during 2D TLC. Briefly, these rules are: the larger the oligonucleotide, the slower the migration of the corresponding spot to the bottom. As far as composition is concerned, Us displace the spot to the left, Cs to the right, and As cause a slight delay, thus meaning that several As in the same oligo may cause it to behave as an oligo containing one or even two additional bases ( 37 ). As far as sequence is concerned, as HCV RNA was transcribed in the presence of [α- 32 P]GTP here, those T1 oligonucleotides in the original sequence that are followed by a (pG) carry a double label. In the case of HCV RNA several RNase T1 oligonucelotides are indicated as mobility reference: a: UCCUUUCUUGp(G); b: UCUUCAGp(C) 61:68; c: CUCAAUGp(G) 211–217; d: AUUUGp(G) 225–229. Spot 1 locates in the border of the triangle that can be formed by spots i, f and g. In CSFV, spot 1 is the slow migrating spot, and thus corresponded to the largest RNase T1 oligonucleotide. In both HCV and CSFV, band B2 contains the original 5′-terminal nucleotide, pppGp, of the substrate RNA transcript (indicated by ‘2’). The disappearance of spot 1 from both product band fingerprints (see Figure 1 a, images 2, 3 and images 5, 6) suggests that self-cleavage occurs within this oligonucleotide and that this event is specific. Moreover, in the case of CSFV RNA two smaller oligomers (X and Y) that represent the fragment products of spot 1 are observed within the fingerprints of both product bands (B1 and B2) for CSFV. Indicated at the bottom is the sequence surrounding RNase T1 cleavage sites. ( b ) Electrophoresis analysis: Autoradiogram showing a parallel run of HCV RNA 1–130 and CSFV RNA 1–218 UV-cleavage reaction, with RNase T1 treated samples and control reactions for transcripts labeled at either the 5′-extreme with [γ- 32 P]GTP during transcription or the 3′-extreme with [5′- 32 P]pCp and T4 RNA ligase. HCV (lanes 1–6) and CSFV (lanes 1–9). HCV: Lanes 1 and 1′: RNAs incubated in standard buffer; lanes 2 and 2′: RNAs treated with RNase T1 under denaturing conditions; lanes 3 and 3′: RNA irradiated with UV-C light for 180 s. CSFV: Lanes 1 and 1′: RNAs incubated under standard conditions; lanes 2, 3 and 4′: RNA treated with RNase T1; lanes 4 and 3′: RNA irradiated with UV-C light: Lanes 5 and 2′ RNAs partially degraded with alkali. ‘G’ positions of a relevant size are indicated on either side of the gels. Lines indicate SM, and products B1 and B2.

    Article Snippet: RNA ligase was used to treat cleavage product bands, either previously phosphatase treated or not, as follows: RNAs were incubated at 4°C for 4 days in a buffer containing 10 mM MgCl2 , 50 mM HEPES, pH 8.3, 5 mM DTT, 0.12 mM ATP, 4 U of T4 RNA ligase (Promega) and [5′-32 P]pCp (Perkin-Elmer) ( , ).

    Techniques: Labeling, Sequencing, Electrophoresis, Thin Layer Chromatography, Migration, Incubation, Irradiation

    Enzymatic determination of the new 5′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) Phosphatase-dependent 5′-terminal labeling of both HCV RNA 1–130 cleavage product (B1) (left panel) and CSFV RNA 1–218 cleavage product (B1) (right panel) by polynucleotide kinase. Aliquots (10 000 dpm) of product bands (10 5  dpm/µg) were treated with polynucleotide kinase and [γ- 32 P]ATP, after treatment with Artic Phosphatase (lane 2) or without phosphatase pre-treatment (lane 1). ( b ) Cyclization of HCV (left panel) and CSFV (right panel) RNA product bands B1 by T4 RNA ligase [with 10 000 dpm (10 5  dpm/µg) RNA]. Lanes 1: HCV and CSFV B1 bands incubated without T4 RNA ligase; lanes 2: complete reaction (cyclized RNA: upper band). ( c ) Phosphatase treatment of singly labeled CSFV. Calf alkaline phosphatase was used to treat CSFV band B1 aliquots (50 000 dpm of 107 dpm/µg), followed by high-voltage electrophoresis at pH 1.9 on Whatman DE81 DEAE paper (  16 ). B1 RNA is at the bottom and free phosphate at the top. ‘U’, ‘A’, ‘C’ and ‘G’ indicate RNAs labeled with [α- 32 P]UTP, ATP, CTP or GTP, respectively, whereas ‘αGTP’ indicates a control containing 1000 dpm of pure [α- 32 P]GTP.

    Journal: Nucleic Acids Research

    Article Title: RNA self-cleavage activated by ultraviolet light-induced oxidation

    doi: 10.1093/nar/gkr822

    Figure Lengend Snippet: Enzymatic determination of the new 5′-end of HCV and CSFV RNA end-groups produced by UV-C-induced self-cleavage. ( a ) Phosphatase-dependent 5′-terminal labeling of both HCV RNA 1–130 cleavage product (B1) (left panel) and CSFV RNA 1–218 cleavage product (B1) (right panel) by polynucleotide kinase. Aliquots (10 000 dpm) of product bands (10 5  dpm/µg) were treated with polynucleotide kinase and [γ- 32 P]ATP, after treatment with Artic Phosphatase (lane 2) or without phosphatase pre-treatment (lane 1). ( b ) Cyclization of HCV (left panel) and CSFV (right panel) RNA product bands B1 by T4 RNA ligase [with 10 000 dpm (10 5  dpm/µg) RNA]. Lanes 1: HCV and CSFV B1 bands incubated without T4 RNA ligase; lanes 2: complete reaction (cyclized RNA: upper band). ( c ) Phosphatase treatment of singly labeled CSFV. Calf alkaline phosphatase was used to treat CSFV band B1 aliquots (50 000 dpm of 107 dpm/µg), followed by high-voltage electrophoresis at pH 1.9 on Whatman DE81 DEAE paper ( 16 ). B1 RNA is at the bottom and free phosphate at the top. ‘U’, ‘A’, ‘C’ and ‘G’ indicate RNAs labeled with [α- 32 P]UTP, ATP, CTP or GTP, respectively, whereas ‘αGTP’ indicates a control containing 1000 dpm of pure [α- 32 P]GTP.

    Article Snippet: RNA ligase was used to treat cleavage product bands, either previously phosphatase treated or not, as follows: RNAs were incubated at 4°C for 4 days in a buffer containing 10 mM MgCl2 , 50 mM HEPES, pH 8.3, 5 mM DTT, 0.12 mM ATP, 4 U of T4 RNA ligase (Promega) and [5′-32 P]pCp (Perkin-Elmer) ( , ).

    Techniques: Produced, Labeling, Incubation, Electrophoresis

    DNA transactions by recombinant AaHMGB1 proteins. (A) Preferential binding of AaHMGB1 protein to supercoiled DNA. An equimolar mixture of supercoiled and linearized plasmid pTZ19R (∼10 nM) was pre-incubated with increasing amounts of AaHMGB1 (0.5–1 µM) and the DNA–protein complexes were resolved on a 1% agarose gel, followed by staining of the gel with ethidium bromide. Form I, supercoiled DNA; L, Linear DNA; Form II, relaxed circular DNA; (B) DNA supercoiling by AaHMGB1 and its truncated forms. Circular relaxed plasmid pTZ19R DNA was incubated in the presence of topoisomerase I (Topo I) and AaHMGB1 recombinant proteins (7–14 µM). Deproteinized DNA topoisomers were resolved on 1% agarose gels, followed by staining of the gel with ethidium bromide. Form I, supercoiled DNA; Form II, relaxed circular DNA. (C) DNA bending by AaHMGB1 and its truncated forms. A  32 P-labeled 123-bp DNA fragment (∼1 nM) was pre-incubated with recombinant proteins (25–50 nM) followed by ligation with T4 DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Lm: linear multimers. Exo III, exonuclease III. These experiments were repeated three to five times each.

    Journal: PLoS ONE

    Article Title: The Dengue Vector Aedes aegypti Contains a Functional High Mobility Group Box 1 (HMGB1) Protein with a Unique Regulatory C-Terminus

    doi: 10.1371/journal.pone.0040192

    Figure Lengend Snippet: DNA transactions by recombinant AaHMGB1 proteins. (A) Preferential binding of AaHMGB1 protein to supercoiled DNA. An equimolar mixture of supercoiled and linearized plasmid pTZ19R (∼10 nM) was pre-incubated with increasing amounts of AaHMGB1 (0.5–1 µM) and the DNA–protein complexes were resolved on a 1% agarose gel, followed by staining of the gel with ethidium bromide. Form I, supercoiled DNA; L, Linear DNA; Form II, relaxed circular DNA; (B) DNA supercoiling by AaHMGB1 and its truncated forms. Circular relaxed plasmid pTZ19R DNA was incubated in the presence of topoisomerase I (Topo I) and AaHMGB1 recombinant proteins (7–14 µM). Deproteinized DNA topoisomers were resolved on 1% agarose gels, followed by staining of the gel with ethidium bromide. Form I, supercoiled DNA; Form II, relaxed circular DNA. (C) DNA bending by AaHMGB1 and its truncated forms. A 32 P-labeled 123-bp DNA fragment (∼1 nM) was pre-incubated with recombinant proteins (25–50 nM) followed by ligation with T4 DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Lm: linear multimers. Exo III, exonuclease III. These experiments were repeated three to five times each.

    Article Snippet: Briefly, a 32 P-labeled 123-bp DNA fragment (∼1 nM) with cohesive BamHI ends were pre-incubated on ice for 20 min with appropriate amounts of recombinant proteins (25–50 nM) or total protein extracts from adult mosquitos (4 µg) in 1× T4 DNA ligase buffer (30 mM Tris–HCl, pH 7.8, 10 mM MgCl2 , 10 mM dithiothreitol, and 0.5 mM ATP; Promega) in a final volume of 20 µL.

    Techniques: Recombinant, Binding Assay, Plasmid Preparation, Incubation, Agarose Gel Electrophoresis, Staining, Labeling, Ligation, DNA Ligation, Electrophoresis, Autoradiography

    DNA bending assays by posphorylated AaHMGB1. A  32 P-labelled 123-bp DNA fragment (∼1 nM) was pre-incubated with 50 ng of AaHMGB1 that were phosphorylated by PKA (panels A and B, lanes 5 and 2, respectively) or not (panels A and B, lanes 4 and 3, respectively), or by PKC (panels C and D, lanes 5 and 2, respectively) or not (panels C and D, lanes 4 and 3, respectively), followed by ligation with T4 DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Lm: linear multimers. These experiments were repeated five times.

    Journal: PLoS ONE

    Article Title: The Dengue Vector Aedes aegypti Contains a Functional High Mobility Group Box 1 (HMGB1) Protein with a Unique Regulatory C-Terminus

    doi: 10.1371/journal.pone.0040192

    Figure Lengend Snippet: DNA bending assays by posphorylated AaHMGB1. A 32 P-labelled 123-bp DNA fragment (∼1 nM) was pre-incubated with 50 ng of AaHMGB1 that were phosphorylated by PKA (panels A and B, lanes 5 and 2, respectively) or not (panels A and B, lanes 4 and 3, respectively), or by PKC (panels C and D, lanes 5 and 2, respectively) or not (panels C and D, lanes 4 and 3, respectively), followed by ligation with T4 DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Lm: linear multimers. These experiments were repeated five times.

    Article Snippet: Briefly, a 32 P-labeled 123-bp DNA fragment (∼1 nM) with cohesive BamHI ends were pre-incubated on ice for 20 min with appropriate amounts of recombinant proteins (25–50 nM) or total protein extracts from adult mosquitos (4 µg) in 1× T4 DNA ligase buffer (30 mM Tris–HCl, pH 7.8, 10 mM MgCl2 , 10 mM dithiothreitol, and 0.5 mM ATP; Promega) in a final volume of 20 µL.

    Techniques: Incubation, Ligation, DNA Ligation, Electrophoresis, Autoradiography