t4 ligase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    T4 DNA Ligase (2,000,000 units/ml)
    Description:

    Catalog Number:
    M0202T
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs t4 ligase
    Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with <t>T4</t> ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.

    https://www.bioz.com/result/t4 ligase/product/New England Biolabs
    Average 99 stars, based on 254 article reviews
    Price from $9.99 to $1999.99
    t4 ligase - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from ""

    Article Title:

    Journal:

    doi: 10.1074/jbc.M109.010413

    Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.
    Figure Legend Snippet: Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.

    Techniques Used: Ligation

    Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.
    Figure Legend Snippet: Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.

    Techniques Used: Activity Assay, Ligation

    2) Product Images from ""

    Article Title:

    Journal:

    doi: 10.1074/jbc.M109.010413

    Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.
    Figure Legend Snippet: Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.

    Techniques Used: Ligation

    Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.
    Figure Legend Snippet: Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.

    Techniques Used: Activity Assay, Ligation

    3) Product Images from ""

    Article Title:

    Journal:

    doi: 10.1074/jbc.M109.010413

    Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.
    Figure Legend Snippet: Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.

    Techniques Used: Ligation

    Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.
    Figure Legend Snippet: Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.

    Techniques Used: Activity Assay, Ligation

    4) Product Images from "An Allosteric-Probe for Detection of Alkaline Phosphatase Activity and Its Application in Immunoassay"

    Article Title: An Allosteric-Probe for Detection of Alkaline Phosphatase Activity and Its Application in Immunoassay

    Journal: Frontiers in Chemistry

    doi: 10.3389/fchem.2018.00618

    Response of the AP to ALP, thrombin, T4 ligase, lysozyme, HSA, proteinase K, trypsin, and de-activated ALP for specificity study. The concentration of ALP is 2 U/mL, and the concentration of other enzymes and proteins are 20 U/mL or 10 nM. Error bars indicate the standard deviations of three samples.
    Figure Legend Snippet: Response of the AP to ALP, thrombin, T4 ligase, lysozyme, HSA, proteinase K, trypsin, and de-activated ALP for specificity study. The concentration of ALP is 2 U/mL, and the concentration of other enzymes and proteins are 20 U/mL or 10 nM. Error bars indicate the standard deviations of three samples.

    Techniques Used: ALP Assay, Concentration Assay

    5) Product Images from "Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro"

    Article Title: Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro

    Journal:

    doi:

    Strategy for constructing nicked heteroduplexes. A mismatch-containing oligonucleotide duplex (Fig. 1) is ligated into a template plasmid molecule (1). Linearization of the plasmid (2) in the presence of the heteroduplex oligo, T4 ligase and restriction enzyme ( Bam HI) allows ligation of the small fragments onto each DNA end as a dead-end complex (3), because the Bam HI site is eliminated. Re-ligation of Bam HI-generated plasmid ends yields a molecule competent for a second digestion, returning them to the substrate pool. In the next step, digestion with Eco RI removes one ligation product and generates a ligation-competent DNA end (4). After removal of the smaller fragment, an intramolecular ligation reaction generates the nicked circular product (5). Unwanted linear molecules are removed by digestion with Exonuclease V (Materials and Methods).
    Figure Legend Snippet: Strategy for constructing nicked heteroduplexes. A mismatch-containing oligonucleotide duplex (Fig. 1) is ligated into a template plasmid molecule (1). Linearization of the plasmid (2) in the presence of the heteroduplex oligo, T4 ligase and restriction enzyme ( Bam HI) allows ligation of the small fragments onto each DNA end as a dead-end complex (3), because the Bam HI site is eliminated. Re-ligation of Bam HI-generated plasmid ends yields a molecule competent for a second digestion, returning them to the substrate pool. In the next step, digestion with Eco RI removes one ligation product and generates a ligation-competent DNA end (4). After removal of the smaller fragment, an intramolecular ligation reaction generates the nicked circular product (5). Unwanted linear molecules are removed by digestion with Exonuclease V (Materials and Methods).

    Techniques Used: Plasmid Preparation, Ligation, Generated

    6) Product Images from ""

    Article Title:

    Journal:

    doi: 10.1074/jbc.M109.010413

    Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.
    Figure Legend Snippet: Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.

    Techniques Used: Ligation

    Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.
    Figure Legend Snippet: Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.

    Techniques Used: Activity Assay, Ligation

    7) Product Images from "Human RECQ1 Interacts with Ku70/80 and Modulates DNA End-Joining of Double-Strand Breaks"

    Article Title: Human RECQ1 Interacts with Ku70/80 and Modulates DNA End-Joining of Double-Strand Breaks

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0062481

    RECQ1 modulates DNA end-joining. A.  RECQ1 affects DNA end-joining by T4 ligase. Comparison of ligation products of 5′-cohesive (left panel) or blunt (right panel) ended linear DNA after incubation with T4 ligase alone, or after pre-incubation with the increasing amount of RECQ1 (0–260 ng) or Ku70/80 (0–400 ng) as described in materials and methods. IgG (1µg) was included as unrelated protein in a control reaction. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. O.C., open circular. DNA size marker is shown in leftmost lane.  B.  RECQ1 antibody interferes with cell free extract mediated end-joining  in vitro . The effect of antibodies against human RECQ1 (1.5 and 3 µg) or Ku70/80 (1 and 2 µg) was tested in DNA end-joining reactions assembled with 5 µg HeLa cell free extract. Antibodies at the indicated amounts were incubated with cell free extract for 10 min at room temperature in NHEJ buffer without DNA and ATP. Subsequently, EcoRI-linearized pUC19 DNA and ATP were added to start the reaction followed by 2 h incubation at room temperature. Reaction products were purified and analyzed by SYBR Gold staining after resolution on agarose gel. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated.  C.  Immunodepletion of RECQ1 or Ku70/80 from cell extracts results in similarly reduced end-joining. DNA end joining reactions were performed using HeLa extract depleted either with anti-RECQ1 polyclonal antibody (upper panel) or with the anti-Ku70/80 monoclonal antibody (lower panel) as described. Mock-depleted extracts used preimmune rabbit or mouse IgG as control for RECQ1 or Ku70/80 depletion, respectively. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. Inverted image of a typical gel is shown. ImageJ was used to quantitate dimer product in each case, and the average from at least three independent experiments are indicated including SD. Western blot of control un-depleted, mock-depleted and RECQ1 or Ku70/80 depleted extracts used in the end-joining reaction is shown along with a loading control (actin) (right).
    Figure Legend Snippet: RECQ1 modulates DNA end-joining. A. RECQ1 affects DNA end-joining by T4 ligase. Comparison of ligation products of 5′-cohesive (left panel) or blunt (right panel) ended linear DNA after incubation with T4 ligase alone, or after pre-incubation with the increasing amount of RECQ1 (0–260 ng) or Ku70/80 (0–400 ng) as described in materials and methods. IgG (1µg) was included as unrelated protein in a control reaction. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. O.C., open circular. DNA size marker is shown in leftmost lane. B. RECQ1 antibody interferes with cell free extract mediated end-joining in vitro . The effect of antibodies against human RECQ1 (1.5 and 3 µg) or Ku70/80 (1 and 2 µg) was tested in DNA end-joining reactions assembled with 5 µg HeLa cell free extract. Antibodies at the indicated amounts were incubated with cell free extract for 10 min at room temperature in NHEJ buffer without DNA and ATP. Subsequently, EcoRI-linearized pUC19 DNA and ATP were added to start the reaction followed by 2 h incubation at room temperature. Reaction products were purified and analyzed by SYBR Gold staining after resolution on agarose gel. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. C. Immunodepletion of RECQ1 or Ku70/80 from cell extracts results in similarly reduced end-joining. DNA end joining reactions were performed using HeLa extract depleted either with anti-RECQ1 polyclonal antibody (upper panel) or with the anti-Ku70/80 monoclonal antibody (lower panel) as described. Mock-depleted extracts used preimmune rabbit or mouse IgG as control for RECQ1 or Ku70/80 depletion, respectively. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. Inverted image of a typical gel is shown. ImageJ was used to quantitate dimer product in each case, and the average from at least three independent experiments are indicated including SD. Western blot of control un-depleted, mock-depleted and RECQ1 or Ku70/80 depleted extracts used in the end-joining reaction is shown along with a loading control (actin) (right).

    Techniques Used: Ligation, Incubation, Marker, In Vitro, Non-Homologous End Joining, Purification, Staining, Agarose Gel Electrophoresis, Western Blot

    8) Product Images from "Human RECQ1 Interacts with Ku70/80 and Modulates DNA End-Joining of Double-Strand Breaks"

    Article Title: Human RECQ1 Interacts with Ku70/80 and Modulates DNA End-Joining of Double-Strand Breaks

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0062481

    RECQ1 modulates DNA end-joining. A.  RECQ1 affects DNA end-joining by T4 ligase. Comparison of ligation products of 5′-cohesive (left panel) or blunt (right panel) ended linear DNA after incubation with T4 ligase alone, or after pre-incubation with the increasing amount of RECQ1 (0–260 ng) or Ku70/80 (0–400 ng) as described in materials and methods. IgG (1µg) was included as unrelated protein in a control reaction. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. O.C., open circular. DNA size marker is shown in leftmost lane.  B.  RECQ1 antibody interferes with cell free extract mediated end-joining  in vitro . The effect of antibodies against human RECQ1 (1.5 and 3 µg) or Ku70/80 (1 and 2 µg) was tested in DNA end-joining reactions assembled with 5 µg HeLa cell free extract. Antibodies at the indicated amounts were incubated with cell free extract for 10 min at room temperature in NHEJ buffer without DNA and ATP. Subsequently, EcoRI-linearized pUC19 DNA and ATP were added to start the reaction followed by 2 h incubation at room temperature. Reaction products were purified and analyzed by SYBR Gold staining after resolution on agarose gel. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated.  C.  Immunodepletion of RECQ1 or Ku70/80 from cell extracts results in similarly reduced end-joining. DNA end joining reactions were performed using HeLa extract depleted either with anti-RECQ1 polyclonal antibody (upper panel) or with the anti-Ku70/80 monoclonal antibody (lower panel) as described. Mock-depleted extracts used preimmune rabbit or mouse IgG as control for RECQ1 or Ku70/80 depletion, respectively. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. Inverted image of a typical gel is shown. ImageJ was used to quantitate dimer product in each case, and the average from at least three independent experiments are indicated including SD. Western blot of control un-depleted, mock-depleted and RECQ1 or Ku70/80 depleted extracts used in the end-joining reaction is shown along with a loading control (actin) (right).
    Figure Legend Snippet: RECQ1 modulates DNA end-joining. A. RECQ1 affects DNA end-joining by T4 ligase. Comparison of ligation products of 5′-cohesive (left panel) or blunt (right panel) ended linear DNA after incubation with T4 ligase alone, or after pre-incubation with the increasing amount of RECQ1 (0–260 ng) or Ku70/80 (0–400 ng) as described in materials and methods. IgG (1µg) was included as unrelated protein in a control reaction. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. O.C., open circular. DNA size marker is shown in leftmost lane. B. RECQ1 antibody interferes with cell free extract mediated end-joining in vitro . The effect of antibodies against human RECQ1 (1.5 and 3 µg) or Ku70/80 (1 and 2 µg) was tested in DNA end-joining reactions assembled with 5 µg HeLa cell free extract. Antibodies at the indicated amounts were incubated with cell free extract for 10 min at room temperature in NHEJ buffer without DNA and ATP. Subsequently, EcoRI-linearized pUC19 DNA and ATP were added to start the reaction followed by 2 h incubation at room temperature. Reaction products were purified and analyzed by SYBR Gold staining after resolution on agarose gel. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. C. Immunodepletion of RECQ1 or Ku70/80 from cell extracts results in similarly reduced end-joining. DNA end joining reactions were performed using HeLa extract depleted either with anti-RECQ1 polyclonal antibody (upper panel) or with the anti-Ku70/80 monoclonal antibody (lower panel) as described. Mock-depleted extracts used preimmune rabbit or mouse IgG as control for RECQ1 or Ku70/80 depletion, respectively. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. Inverted image of a typical gel is shown. ImageJ was used to quantitate dimer product in each case, and the average from at least three independent experiments are indicated including SD. Western blot of control un-depleted, mock-depleted and RECQ1 or Ku70/80 depleted extracts used in the end-joining reaction is shown along with a loading control (actin) (right).

    Techniques Used: Ligation, Incubation, Marker, In Vitro, Non-Homologous End Joining, Purification, Staining, Agarose Gel Electrophoresis, Western Blot

    9) Product Images from "Human RECQ1 Interacts with Ku70/80 and Modulates DNA End-Joining of Double-Strand Breaks"

    Article Title: Human RECQ1 Interacts with Ku70/80 and Modulates DNA End-Joining of Double-Strand Breaks

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0062481

    RECQ1 modulates DNA end-joining. A.  RECQ1 affects DNA end-joining by T4 ligase. Comparison of ligation products of 5′-cohesive (left panel) or blunt (right panel) ended linear DNA after incubation with T4 ligase alone, or after pre-incubation with the increasing amount of RECQ1 (0–260 ng) or Ku70/80 (0–400 ng) as described in materials and methods. IgG (1µg) was included as unrelated protein in a control reaction. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. O.C., open circular. DNA size marker is shown in leftmost lane.  B.  RECQ1 antibody interferes with cell free extract mediated end-joining  in vitro . The effect of antibodies against human RECQ1 (1.5 and 3 µg) or Ku70/80 (1 and 2 µg) was tested in DNA end-joining reactions assembled with 5 µg HeLa cell free extract. Antibodies at the indicated amounts were incubated with cell free extract for 10 min at room temperature in NHEJ buffer without DNA and ATP. Subsequently, EcoRI-linearized pUC19 DNA and ATP were added to start the reaction followed by 2 h incubation at room temperature. Reaction products were purified and analyzed by SYBR Gold staining after resolution on agarose gel. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated.  C.  Immunodepletion of RECQ1 or Ku70/80 from cell extracts results in similarly reduced end-joining. DNA end joining reactions were performed using HeLa extract depleted either with anti-RECQ1 polyclonal antibody (upper panel) or with the anti-Ku70/80 monoclonal antibody (lower panel) as described. Mock-depleted extracts used preimmune rabbit or mouse IgG as control for RECQ1 or Ku70/80 depletion, respectively. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. Inverted image of a typical gel is shown. ImageJ was used to quantitate dimer product in each case, and the average from at least three independent experiments are indicated including SD. Western blot of control un-depleted, mock-depleted and RECQ1 or Ku70/80 depleted extracts used in the end-joining reaction is shown along with a loading control (actin) (right).
    Figure Legend Snippet: RECQ1 modulates DNA end-joining. A. RECQ1 affects DNA end-joining by T4 ligase. Comparison of ligation products of 5′-cohesive (left panel) or blunt (right panel) ended linear DNA after incubation with T4 ligase alone, or after pre-incubation with the increasing amount of RECQ1 (0–260 ng) or Ku70/80 (0–400 ng) as described in materials and methods. IgG (1µg) was included as unrelated protein in a control reaction. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. O.C., open circular. DNA size marker is shown in leftmost lane. B. RECQ1 antibody interferes with cell free extract mediated end-joining in vitro . The effect of antibodies against human RECQ1 (1.5 and 3 µg) or Ku70/80 (1 and 2 µg) was tested in DNA end-joining reactions assembled with 5 µg HeLa cell free extract. Antibodies at the indicated amounts were incubated with cell free extract for 10 min at room temperature in NHEJ buffer without DNA and ATP. Subsequently, EcoRI-linearized pUC19 DNA and ATP were added to start the reaction followed by 2 h incubation at room temperature. Reaction products were purified and analyzed by SYBR Gold staining after resolution on agarose gel. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. C. Immunodepletion of RECQ1 or Ku70/80 from cell extracts results in similarly reduced end-joining. DNA end joining reactions were performed using HeLa extract depleted either with anti-RECQ1 polyclonal antibody (upper panel) or with the anti-Ku70/80 monoclonal antibody (lower panel) as described. Mock-depleted extracts used preimmune rabbit or mouse IgG as control for RECQ1 or Ku70/80 depletion, respectively. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. Inverted image of a typical gel is shown. ImageJ was used to quantitate dimer product in each case, and the average from at least three independent experiments are indicated including SD. Western blot of control un-depleted, mock-depleted and RECQ1 or Ku70/80 depleted extracts used in the end-joining reaction is shown along with a loading control (actin) (right).

    Techniques Used: Ligation, Incubation, Marker, In Vitro, Non-Homologous End Joining, Purification, Staining, Agarose Gel Electrophoresis, Western Blot

    10) Product Images from ""

    Article Title:

    Journal:

    doi: 10.1074/jbc.M109.010413

    Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.
    Figure Legend Snippet: Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.

    Techniques Used: Ligation

    Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.
    Figure Legend Snippet: Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.

    Techniques Used: Activity Assay, Ligation

    11) Product Images from ""

    Article Title:

    Journal:

    doi: 10.1074/jbc.M109.010413

    Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.
    Figure Legend Snippet: Completion of BER; formation of ligation product. Reactions were performed as described under “Experimental Procedures” with the indicated proteins. Storage phosphorimage of reaction products obtained with UL2, APE, and UL30 ( lane 1 ) and identical reactions supplemented with T4 ligase (1.5 units) ( lane 2 ), ligase I ( lane 3 ), or ligase IIIα-XRCC1 ( lane 4 ) are shown. Lane 5 , DNA only; lane 6 , linear 100-mer. The positions of nicked product ( N ), ligated product ( L ), and of the 100-mer are as indicated. The values in italics below the lane numbers indicate the L/N ratios.

    Techniques Used: Ligation

    Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.
    Figure Legend Snippet: Time course of BER. 35-μl reactions were performed as described under “Experimental Procedures” with UL2, APE, and UL30 in the presence of either T4 ligase (0.001 units/μl) ( A ), ligase I ( B ), or ligase IIIα-XRCC1 ( C ). 5-μl aliquots were removed at the times indicated. Activity is expressed as the fraction of maximum for the nicked ( N ) (●) and ligation ( L ) (○) products. The insets in each panel show the relevant gel images.

    Techniques Used: Activity Assay, Ligation

    12) Product Images from "A Robust, Simple Genotyping-by-Sequencing (GBS) Approach for High Diversity Species"

    Article Title: A Robust, Simple Genotyping-by-Sequencing (GBS) Approach for High Diversity Species

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0019379

    Steps in GBS library construction. Note: Up to 96 DNA samples can be processed simultaneously. (1) DNA samples, barcode, and common adapter pairs are plated and dried; (2–3) samples are then digested with  Ape KI and adapters are ligated to the ends of genomic DNA fragments; (4) T4 ligase is inactivated by heating and an aliquot of each sample is pooled and applied to a size exclusion column to remove unreacted adapters; (5) appropriate primers with binding sites on the ligated adapters are added and PCR is performed to increase the fragment pool; (6–7) PCR products are cleaned up and fragment sizes of the resulting library are checked on a DNA analyzer(BioRad Experion® or similar instrument). Libraries without adapter dimers are retained for DNA sequencing.
    Figure Legend Snippet: Steps in GBS library construction. Note: Up to 96 DNA samples can be processed simultaneously. (1) DNA samples, barcode, and common adapter pairs are plated and dried; (2–3) samples are then digested with Ape KI and adapters are ligated to the ends of genomic DNA fragments; (4) T4 ligase is inactivated by heating and an aliquot of each sample is pooled and applied to a size exclusion column to remove unreacted adapters; (5) appropriate primers with binding sites on the ligated adapters are added and PCR is performed to increase the fragment pool; (6–7) PCR products are cleaned up and fragment sizes of the resulting library are checked on a DNA analyzer(BioRad Experion® or similar instrument). Libraries without adapter dimers are retained for DNA sequencing.

    Techniques Used: Binding Assay, Polymerase Chain Reaction, DNA Sequencing

    13) Product Images from "A Mammalian Cell Based FACS-Panning Platform for the Selection of HIV-1 Envelopes for Vaccine Development"

    Article Title: A Mammalian Cell Based FACS-Panning Platform for the Selection of HIV-1 Envelopes for Vaccine Development

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0109196

    Schematic overview of the QL cloning procedure. An envelope gene or an envelope library is amplified with primers to introduce flanking Esp3I restriction sites enabling the generation of a 5′ NcoI and a 3′ Xho sitey (A; top). The envelope gene or an envelope library is incubated together with pQL9/11 in a one-tube reaction with Esp3I and T4-Ligase. Compatible “sticky-ends” (equally colored) can be ligated successfully, direct proper orientation and mediating resistance for further cleavage (A). Following transformation of CcdB sensitive bacteria, only recipients bearing a plasmid without CcdB are able to form colonies in the presence of ampicillin. (B) The lentiviral vector construct pQL9 comprises (i) 5′LTR (Long terminal repeat), (ii) EF1α (human promotor), (iii) GFP (marker gene), (iv) an IRES (internal ribosome entry site), (v) a CcdB positive selection marker [58] , and (vi) a 3′LTR sequence.
    Figure Legend Snippet: Schematic overview of the QL cloning procedure. An envelope gene or an envelope library is amplified with primers to introduce flanking Esp3I restriction sites enabling the generation of a 5′ NcoI and a 3′ Xho sitey (A; top). The envelope gene or an envelope library is incubated together with pQL9/11 in a one-tube reaction with Esp3I and T4-Ligase. Compatible “sticky-ends” (equally colored) can be ligated successfully, direct proper orientation and mediating resistance for further cleavage (A). Following transformation of CcdB sensitive bacteria, only recipients bearing a plasmid without CcdB are able to form colonies in the presence of ampicillin. (B) The lentiviral vector construct pQL9 comprises (i) 5′LTR (Long terminal repeat), (ii) EF1α (human promotor), (iii) GFP (marker gene), (iv) an IRES (internal ribosome entry site), (v) a CcdB positive selection marker [58] , and (vi) a 3′LTR sequence.

    Techniques Used: Clone Assay, Amplification, Introduce, Incubation, Transformation Assay, Plasmid Preparation, Construct, Marker, Selection, Sequencing

    14) Product Images from "Human RECQ1 Interacts with Ku70/80 and Modulates DNA End-Joining of Double-Strand Breaks"

    Article Title: Human RECQ1 Interacts with Ku70/80 and Modulates DNA End-Joining of Double-Strand Breaks

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0062481

    RECQ1 modulates DNA end-joining. A.  RECQ1 affects DNA end-joining by T4 ligase. Comparison of ligation products of 5′-cohesive (left panel) or blunt (right panel) ended linear DNA after incubation with T4 ligase alone, or after pre-incubation with the increasing amount of RECQ1 (0–260 ng) or Ku70/80 (0–400 ng) as described in materials and methods. IgG (1µg) was included as unrelated protein in a control reaction. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. O.C., open circular. DNA size marker is shown in leftmost lane.  B.  RECQ1 antibody interferes with cell free extract mediated end-joining  in vitro . The effect of antibodies against human RECQ1 (1.5 and 3 µg) or Ku70/80 (1 and 2 µg) was tested in DNA end-joining reactions assembled with 5 µg HeLa cell free extract. Antibodies at the indicated amounts were incubated with cell free extract for 10 min at room temperature in NHEJ buffer without DNA and ATP. Subsequently, EcoRI-linearized pUC19 DNA and ATP were added to start the reaction followed by 2 h incubation at room temperature. Reaction products were purified and analyzed by SYBR Gold staining after resolution on agarose gel. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated.  C.  Immunodepletion of RECQ1 or Ku70/80 from cell extracts results in similarly reduced end-joining. DNA end joining reactions were performed using HeLa extract depleted either with anti-RECQ1 polyclonal antibody (upper panel) or with the anti-Ku70/80 monoclonal antibody (lower panel) as described. Mock-depleted extracts used preimmune rabbit or mouse IgG as control for RECQ1 or Ku70/80 depletion, respectively. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. Inverted image of a typical gel is shown. ImageJ was used to quantitate dimer product in each case, and the average from at least three independent experiments are indicated including SD. Western blot of control un-depleted, mock-depleted and RECQ1 or Ku70/80 depleted extracts used in the end-joining reaction is shown along with a loading control (actin) (right).
    Figure Legend Snippet: RECQ1 modulates DNA end-joining. A. RECQ1 affects DNA end-joining by T4 ligase. Comparison of ligation products of 5′-cohesive (left panel) or blunt (right panel) ended linear DNA after incubation with T4 ligase alone, or after pre-incubation with the increasing amount of RECQ1 (0–260 ng) or Ku70/80 (0–400 ng) as described in materials and methods. IgG (1µg) was included as unrelated protein in a control reaction. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. O.C., open circular. DNA size marker is shown in leftmost lane. B. RECQ1 antibody interferes with cell free extract mediated end-joining in vitro . The effect of antibodies against human RECQ1 (1.5 and 3 µg) or Ku70/80 (1 and 2 µg) was tested in DNA end-joining reactions assembled with 5 µg HeLa cell free extract. Antibodies at the indicated amounts were incubated with cell free extract for 10 min at room temperature in NHEJ buffer without DNA and ATP. Subsequently, EcoRI-linearized pUC19 DNA and ATP were added to start the reaction followed by 2 h incubation at room temperature. Reaction products were purified and analyzed by SYBR Gold staining after resolution on agarose gel. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. C. Immunodepletion of RECQ1 or Ku70/80 from cell extracts results in similarly reduced end-joining. DNA end joining reactions were performed using HeLa extract depleted either with anti-RECQ1 polyclonal antibody (upper panel) or with the anti-Ku70/80 monoclonal antibody (lower panel) as described. Mock-depleted extracts used preimmune rabbit or mouse IgG as control for RECQ1 or Ku70/80 depletion, respectively. Linear substrate DNA is indicated as monomer, and the end-joined products corresponding to dimer and trimer are indicated. Inverted image of a typical gel is shown. ImageJ was used to quantitate dimer product in each case, and the average from at least three independent experiments are indicated including SD. Western blot of control un-depleted, mock-depleted and RECQ1 or Ku70/80 depleted extracts used in the end-joining reaction is shown along with a loading control (actin) (right).

    Techniques Used: Ligation, Incubation, Marker, In Vitro, Non-Homologous End Joining, Purification, Staining, Agarose Gel Electrophoresis, Western Blot

    Related Articles

    Clone Assay:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs). .. Positive colonies were selected by colony PCR and correct insertion in the plasmid was confirmed by sequencing.

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: A similar format was used to introduce 5′-EcoR1 and 3′-Xho1 cloning ligation sites into the cDNA of the omalizumab-specific murine antibody variable light region cDNA (EcoR1-forward 5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACATTCACAAATTGTTATCACCCAGTCTC-3′ and Xho1-reverse 5′-CCGTTTTATCTCGAGCTTTGTCCCCGAGCCGAAC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The EGT gene sequence containing an upstream activation sequence (UAS) with Asc I and Xho I sites was synthesized by Takara Bio Corporation and cloned into the pMD19-T Simple plasmid to generate pMD19-T [UAS-EGT]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: Total pRV library plasmids were purified with an EndoFree Maxiprep Kit (Cat #12362; QIAGEN). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2]. .. Ligation reactions were concentrated by using ethanol precipitation, electroporated into SS320 electro-competent bacteria, and grown as described above.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were synthesized by Genewiz (South Plainfield, NJ, USA); the P. finnis and A. robustus FEX genes were codon optimized for expression in E. coli whereas the N. californiae FEX gene was synthesized both in a codon-optimized version and a non-codon optimized version. .. The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. In the pYC vector, the cloned gene is downstream of a GAL1 promoter and 3′-terminally fused to green fluorescent protein followed by a decahistidine tag.

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: Paragraph title: Generation of chimeric infectious clones ... The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA).

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr. .. The ligation product was then column purified and electroporated into E. coli DH10B cells.

    Centrifugation:

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs. .. After soaking overnight at room temperature, the residual gel powder was filtered off using a 0.45-mm filtration spin column.

    Amplification:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The ssDNA was gel- and column-purified. .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: For each primer-less PCR reassembly reaction, 500 ng of gel-extracted fragments was used and fully reassembled capsids were amplified in a second PCR with primers (Shuffling_Rescue-F: 5′-GTCGGAAAGCATATGCCGCG-3′, Shuffling_Rescue-R: 5′-GACGTCGCATGCAACTAGTAT-3′) binding the cap gene and carrying overlapping ends to pRV plasmids. .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. In a subset of pYC vectors, the gut fungal FEX gene is preceded by a 5′ Preproleader sequence, which, including a 3’ cloning scar, translates into the following peptide: MKVLIVLLAIFAALPLALAQPVISTTVGSAAEGSLDKREARPDV ( ).

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Filtration:

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs. .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs.

    De-Phosphorylation Assay:

    Article Title: The Cyclin-Dependent Kinase 5 Inhibitor Peptide Inhibits Herpes Simplex Virus Type 1 Replication
    Article Snippet: Digestion of pAAV-CFP-Neo was performed with AfeI (New England Biolabs, Ipswich, MA) for 2 h at 37 °C, followed by dephosphorylation of the 5′ and 3′ ends with Alkaline phosphatase (New England Biolabs, Ipswich, MA) for 20 minutes at 37 °C. .. The 7185 bp pAAV-CFP-Neo linearized fragment was ligated with the 385 bp CIP fragment or with the 406 bp nlsCIP fragment using T4 DNA Ligase (New England Biolabs, Ipswich, MA) for 14 hours at 16 °C.

    DNA Ligation:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The ssDNA was gel- and column-purified. .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Synthesized:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The EGT gene sequence containing an upstream activation sequence (UAS) with Asc I and Xho I sites was synthesized by Takara Bio Corporation and cloned into the pMD19-T Simple plasmid to generate pMD19-T [UAS-EGT]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were synthesized by Genewiz (South Plainfield, NJ, USA); the P. finnis and A. robustus FEX genes were codon optimized for expression in E. coli whereas the N. californiae FEX gene was synthesized both in a codon-optimized version and a non-codon optimized version. .. The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA).

    Construct:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: In brief, an EF1a basal promoter fragment was inserted into HindIII and NheI sites of the promoter-less pGL4.10 (Promega) to construct the pGL4.10EF1a vector, then the BamHI and SalI containing fragment (as the enhancer insertion site) was removed and re-inserted at the SpeI site located upstream of the synthetic poly(A) signal/transcriptional pause site to generate modified versions of pGL4.10EF1a vector. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Paragraph title: pPAL-LACK, pPAL-IL-12p35 and pPAL-IL-12p40 plasmid constructs ... The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA). .. Ligated fragments were transformed into One Shot OmniMAX cells (Invitrogen, Carlsbad, CA), and resulting colonies were screened and sequenced prior to cesium chloride (CsCl) plasmid DNA purification.

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: New sgRNA plasmids were then constructed using inverse PCR. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli .

    Real-time Polymerase Chain Reaction:

    Article Title: Therapeutic expression of human clotting factors IX and X following adeno-associated viral vector–mediated intrauterine gene transfer in early-gestation fetal macaques
    Article Snippet: AAV-inverted terminal repeats with the LP1 promoter were cut with Hin dIII/Mfe I, ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and heat shocked into competent Escherichia coli , which were grown at 37°C overnight ( ). .. Correct clones were identified after DNA extraction by digestion with Hin dIII/Pst I, Ahd I, and Bgl I. Plasmid expression of hFX expression was assessed by ELISA after transient transfection of HepG2 cells with Fugene (Roche, Basel, Switzerland), and clones were amplified with Megaprep (Qiagen, Limberg, The Netherlands). scAAV-LP1-hFIXco and scAAV-LP1-hFXco plasmids were used in adenovirus-free transient transfection of 293T cells to generate scAAV5 and scAAV8 pseudotypes, as described by Nakai et al . ( ).

    Incubation:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The ssDNA was gel- and column-purified. .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Samples were heated to 95°C for 5 min then 80°C for 5 min, cooled to 60°C (4 min/1°C), and finally slowly cooled to 4°C (6 min/1°C). .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs. .. After staining with ethidium bromide, the band of correctly assembled cages was cut out of the gel and grounded into a fine powder, by freezing with liquid nitrogen.

    Article Title: Shaping Rolling Circle Amplification Products into DNA Nanoparticles by Incorporation of Modified Nucleotides and Their Application to In Vitro and In Vivo Delivery of a Photosensitizer
    Article Snippet: The circular template for RCA reactions was prepared following the previous report [ ]. .. Briefly, 5′-phosphorylated linear template (Bioneer, Daejeon, Korea) (phosphate-CTCACCAGAGCCACCACCACCAACACCACCACCACCAAAAAAACCACCACCACCAACACCACCACCACCAAGTCCTGTC) (10 μM) was incubated with primer (15 μM, CTCTGGTGAGGACAGGACTT), 10× ligation buffer (1×) and T4 DNA ligase (400 units/μL) (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight. .. After ligation, the circular template was treated with Exonuclease I and III (New England Biolabs), and then purified by 10% denaturing PAGE followed by ethanol precipitation.

    Activity Assay:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: Paragraph title: Validating enhancer activity in HeLa S3 and neuroblastoma cells ... 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Introduce:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: A similar format was used to introduce 5′-EcoR1 and 3′-Xho1 cloning ligation sites into the cDNA of the omalizumab-specific murine antibody variable light region cDNA (EcoR1-forward 5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACATTCACAAATTGTTATCACCCAGTCTC-3′ and Xho1-reverse 5′-CCGTTTTATCTCGAGCTTTGTCCCCGAGCCGAAC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Expressing:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were synthesized by Genewiz (South Plainfield, NJ, USA); the P. finnis and A. robustus FEX genes were codon optimized for expression in E. coli whereas the N. californiae FEX gene was synthesized both in a codon-optimized version and a non-codon optimized version. .. The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA).

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: Paragraph title: Construction of plasmids for expression of sgRNAs. ... Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli .

    Modification:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: In brief, an EF1a basal promoter fragment was inserted into HindIII and NheI sites of the promoter-less pGL4.10 (Promega) to construct the pGL4.10EF1a vector, then the BamHI and SalI containing fragment (as the enhancer insertion site) was removed and re-inserted at the SpeI site located upstream of the synthetic poly(A) signal/transcriptional pause site to generate modified versions of pGL4.10EF1a vector. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4]. .. Similarly, a piggyBac vector with 3 × P3-DsRed as a screening marker was prepared as follows.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The vector was modified to remove a weak σ 70 binding site present 24 bp upstream of the GFP open reading frame (two point mutations, A → G and T → G, were introduced, changing the putative σ 70 binding site from TAGATT to TGGATG, with the consensus σ 70 binding site being TATAAT). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: The sheared DNA was subsequently purified on a QIAquick column and then processed using the Illumina Paired-End DNA Sample Prep Kit (PE-930-1001). .. DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions). .. The tubes were then incubated at 65 °C for 20 min. DNA molecules with sizes comprised between 400 and 800 pb were purified using the PippinPrep apparatus (SAGE science) and amplified using Phusion (Finnzymes).

    Transformation Assay:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: For mutants generated using AMT or biolistic transformation, inverse PCR was used to identify the genes hit by the insertions; when this was unsuccessful, splinkerette PCR was used. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. Ligation mixtures were used to transform the E . coli SURE strain (Agilent Technologies) following the manufacturer's instructions.

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr. .. The ligation product was then column purified and electroporated into E. coli DH10B cells.

    Derivative Assay:

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: The reciprocal version, IE/IAB, had the 5′ UTR and nonstructural protein gene region of IE 68U201 and structural protein gene region and 3′ UTR derived from IAB TrD. .. The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA).

    High Performance Liquid Chromatography:

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: All oligonucleotides (see , Oligonucleotide sequences section) were HPLC purified and purchased from Integrated DNA technologies (IDT) and IBA. .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs.

    Transfection:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs). .. Positive colonies were selected by colony PCR and correct insertion in the plasmid was confirmed by sequencing.

    Inverse PCR:

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: The DNA was eluted or resuspended in 30 µl of water. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077. .. Splinkerette PCR was performed as previously reported ( ).

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Ligation:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: A similar format was used to introduce 5′-EcoR1 and 3′-Xho1 cloning ligation sites into the cDNA of the omalizumab-specific murine antibody variable light region cDNA (EcoR1-forward 5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACATTCACAAATTGTTATCACCCAGTCTC-3′ and Xho1-reverse 5′-CCGTTTTATCTCGAGCTTTGTCCCCGAGCCGAAC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: Multiple RNA–RNA tertiary interactions are dispensable for formation of a functional U2/U6 RNA catalytic core in the spliceosome
    Article Snippet: MS2 actin pre-mRNA was purified as described ( ). .. Yeast U6 snRNAs containing N7-deaza modifications and abasic mutations were prepared by splinted ligation ( ) with T4 DNA ligase (NEB) and a U6(19–108) DNA splint that bridges three U6 snRNA fragments, with the desired mutations located in the central fragment ( ). .. To monitor ligation and recovery, the central U6 fragments were trace-labelled with γ-[32 P] ATP (Perkin Elmer) and polynucleotide kinase (NEB).

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Inserts and vectors were quantified by 260nm UV spectrophotometry and densitometry of 1% agarose gel electrophoretic runs. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. Ligation mixtures were used to transform the E . coli SURE strain (Agilent Technologies) following the manufacturer's instructions.

    Article Title: Shaping Rolling Circle Amplification Products into DNA Nanoparticles by Incorporation of Modified Nucleotides and Their Application to In Vitro and In Vivo Delivery of a Photosensitizer
    Article Snippet: The circular template for RCA reactions was prepared following the previous report [ ]. .. Briefly, 5′-phosphorylated linear template (Bioneer, Daejeon, Korea) (phosphate-CTCACCAGAGCCACCACCACCAACACCACCACCACCAAAAAAACCACCACCACCAACACCACCACCACCAAGTCCTGTC) (10 μM) was incubated with primer (15 μM, CTCTGGTGAGGACAGGACTT), 10× ligation buffer (1×) and T4 DNA ligase (400 units/μL) (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight. .. After ligation, the circular template was treated with Exonuclease I and III (New England Biolabs), and then purified by 10% denaturing PAGE followed by ethanol precipitation.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The vector was modified to remove a weak σ 70 binding site present 24 bp upstream of the GFP open reading frame (two point mutations, A → G and T → G, were introduced, changing the putative σ 70 binding site from TAGATT to TGGATG, with the consensus σ 70 binding site being TATAAT). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr. .. The ligation product was then column purified and electroporated into E. coli DH10B cells.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: The sheared DNA was subsequently purified on a QIAquick column and then processed using the Illumina Paired-End DNA Sample Prep Kit (PE-930-1001). .. DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions). .. The tubes were then incubated at 65 °C for 20 min. DNA molecules with sizes comprised between 400 and 800 pb were purified using the PippinPrep apparatus (SAGE science) and amplified using Phusion (Finnzymes).

    Cell Culture:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. 20 µL of competent cells were transformed with 2 µL of phagemid DNA ligation mix.

    Generated:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: Single-stranded DNA was generated using asymmetric production with 200 ng of purified dsDNA and 1 μM 5′-phosphorylated primer and Accustart HiFi polymerase (QuantaBio, Inc., Beverly, MA) in 1× Accustart HiFi buffer with 2 mM MgCl2 , and cycled 25 times, as previously described . .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: For mutants generated using AMT or biolistic transformation, inverse PCR was used to identify the genes hit by the insertions; when this was unsuccessful, splinkerette PCR was used. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077.

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: Initially, for each reciprocal chimera, two overlapping fragments that encompassed the fusion site of the two genomes were generated by PCR using a forward primer from within the nsP4 region (7041 F IAB AND 6509 F IE) with a reverse fusion primer (IAB/IE R and IE/IAB R) and reverse primer downstream of the junction site (8007 R IAB and 8312 R) paired with a forward fusion primer for each chimera (IAB/IE F and IE/IAB R) ( ). .. The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA).

    Sequencing:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The PCR reaction was performed in 50 μl reaction to amplify each sequence of interest from 100 ng of human cerebellum tissue gDNA using One Taq DNA polymerase Kit (New England Biolabs). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: This step was followed by a mammalian signal sequence and a 20-base pair overhang with the N-terminal mature sequence of the omalizumab-specific murine antibody (5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGC AACTGGAGTACATTCACAGGTTCAGCTGCAGCAGTC-3′) and a 3′-reverse oligonucleotide that introduced a Xho1 site at the 3′-end of the variable heavy region (5′-GATGGGGGTGTCGTTTTGGCACTCGAGACGGTGACTGTGGTTCC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: Double stranded DNA was generated by amplification of the synthetic gBlock f1 sequence with Phusion™ polymerase (New England Biolabs, Inc., Ipswitch, MA). .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The EGT gene sequence containing an upstream activation sequence (UAS) with Asc I and Xho I sites was synthesized by Takara Bio Corporation and cloned into the pMD19-T Simple plasmid to generate pMD19-T [UAS-EGT]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. In the pYC vector, the cloned gene is downstream of a GAL1 promoter and 3′-terminally fused to green fluorescent protein followed by a decahistidine tag.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: Paragraph title: Processing 3C libraries into 3C-seq libraries ready for sequencing ... DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions).

    Recombinant:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Isolation:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The pGL4.10_mod3_EF1α vector was also digested with BamHI and SalI, the double digested DNA (vector) was isolated and purified in the same way as insert. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. 10% of total transformation mixture volumes were plated onto LB-agar containing 5μM triclosan and grown at 37°C for 16h.

    Purification:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The pGL4.10_mod3_EF1α vector was also digested with BamHI and SalI, the double digested DNA (vector) was isolated and purified in the same way as insert. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S). .. The plasmid for anti-omalizumab IgE was used for transient expression (Roche Diagnostics, Fugene 6) of anti-omalizumab IgE from transfected 293s cells.

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The ssDNA was gel- and column-purified. .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Article Title: Multiple RNA–RNA tertiary interactions are dispensable for formation of a functional U2/U6 RNA catalytic core in the spliceosome
    Article Snippet: MS2 actin pre-mRNA was purified as described ( ). .. Yeast U6 snRNAs containing N7-deaza modifications and abasic mutations were prepared by splinted ligation ( ) with T4 DNA ligase (NEB) and a U6(19–108) DNA splint that bridges three U6 snRNA fragments, with the desired mutations located in the central fragment ( ).

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077.

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The following PCR profile was used to amplify target sequences: 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; and 72 °C for 10 min. Amplicons were gel purified and cloned into the pMD19-T Simple plasmid (Takara Bio, Otsu, Japan). .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: Total pRV library plasmids were purified with an EndoFree Maxiprep Kit (Cat #12362; QIAGEN). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: The Cyclin-Dependent Kinase 5 Inhibitor Peptide Inhibits Herpes Simplex Virus Type 1 Replication
    Article Snippet: CIP and nls-CIP PCR products were digested with AfeI and demethylated (DpnI) for 2 h at 37 °C and then purified. .. The 7185 bp pAAV-CFP-Neo linearized fragment was ligated with the 385 bp CIP fragment or with the 406 bp nlsCIP fragment using T4 DNA Ligase (New England Biolabs, Ipswich, MA) for 14 hours at 16 °C.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Once pGH-IL12-p40 and pPAL MluI digests were purified, the entire process was repeated with XbaI. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: All oligonucleotides (see , Oligonucleotide sequences section) were HPLC purified and purchased from Integrated DNA technologies (IDT) and IBA. .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: After column purification, sequences were ligated into a version of the low-copy plasmid pUA66, which contains a gfpmut2 open reading frame downstream of a strong ribosomal binding site ( ). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Article Title: ZBTB10 binds the telomeric variant repeat TTGGGG and interacts with TRF2
    Article Snippet: Twenty five microgram of forward and reverse oligonucleotides of telomeric, variant repeat or control sequences ( ) were denatured at 80°C and annealed by cooling. .. Double-stranded oligonucleotides were then polymerized using 50 U T4 polynucleotidekinase (Thermo Scientific) and 80 U T4 DNA ligase (NEB), biotinylated with desthiobiotin-dATP (Jena Bioscience) by Klenow fragment (Thermo Scientific) and purified using G-50 columns (GE Healthcare). .. Chemically synthesized DNA was immobilized on 0.5 mg streptavidin-coated magnetic beads (Dynabeads MyOne Streptavidin C1, Invitrogen) for 15 min at RT and incubated with 400–800 μg protein lysates diluted in PBB buffer (150 mM NaCl, 50 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 0.5% IGEPAL CA-630, 1 μM Pepstatin, 1 μg/ml Leupeptin and 0.5 mM PMSF) for 1.5 h on a rotation wheel at 4°C.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: The sheared DNA was subsequently purified on a QIAquick column and then processed using the Illumina Paired-End DNA Sample Prep Kit (PE-930-1001). .. DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions).

    Article Title: In vitro reconstitution of DNA replication initiated by genetic recombination: a T4 bacteriophage model for a type of DNA synthesis important for all cells
    Article Snippet: All restriction nucleases and most DNA-modifying enzymes (including T4 DNA ligase) were purchased from New England Biolabs in the early 1990s, when all of the reported experiments were performed. .. All restriction nucleases and most DNA-modifying enzymes (including T4 DNA ligase) were purchased from New England Biolabs in the early 1990s, when all of the reported experiments were performed.

    Polymerase Chain Reaction:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The PCR product was digested with BamHI and SalI (New England Biolabs), the restriction DNA fragment (insert) was isolated using agarose gel electrophoresis and purified by the MinElute Gel Extraction Kit (Qiagen). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S). .. The plasmid for anti-omalizumab IgE was used for transient expression (Roche Diagnostics, Fugene 6) of anti-omalizumab IgE from transfected 293s cells.

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: In each case, the PCR-amplified material was purified by ZymoClean agarose gel purification (Zymo Research, Inc., Irvine, CA) and column cleanup (Qiagen miniprep spin purification kit, Qiagen, Inc., Germany). .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: Lineage-specific RUNX2 super-enhancer activates MYC and promotes the development of blastic plasmacytoid dendritic cell neoplasm
    Article Snippet: Paragraph title: Chromosome conformation capture (3C)-quantitative PCR ... Nuclei samples were digested with EcoRI at 37 °C 16 h and then ligated using T4 DNA ligase (NEB) .

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: For mutants generated using AMT or biolistic transformation, inverse PCR was used to identify the genes hit by the insertions; when this was unsuccessful, splinkerette PCR was used. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077.

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The following PCR profile was used to amplify target sequences: 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; and 72 °C for 10 min. Amplicons were gel purified and cloned into the pMD19-T Simple plasmid (Takara Bio, Otsu, Japan). .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: A GA reaction was performed by mixing an equal volume of 2 × GA Master Mix (Cat #E2611L; NEB) with 1 pmoL PCR-amplified and DpnI-treated pRV (BB_GAR-F: 5′-ACTTGTTCACTTTGATGGCGAGG-3′, BB_GAR-R: 5′-CTGCACACGACATGACATCACG-3′) and 1 pmol of the recovered shuffled capsids, at 50°C for 30 min. DNA was ethanol precipitated and electroporated into SS320 electro-competent E. coli (Cat #60512-2; Lucigen). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. The gene encoding Fex1p was amplified from the S. cerevisiae genome using primers 1 and 2 ( ) and subcloned into pYC2/CT.

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: The two individual fragments were joined by a PCR reaction on both templates utilizing the outermost primer sets. .. The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA). .. Ligated fragments were transformed into One Shot OmniMAX cells (Invitrogen, Carlsbad, CA), and resulting colonies were screened and sequenced prior to cesium chloride (CsCl) plasmid DNA purification.

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: We gel-purified the double-stranded PCR product and double-digested it using BamHI and XhoI. .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions). .. The tubes were then incubated at 65 °C for 20 min. DNA molecules with sizes comprised between 400 and 800 pb were purified using the PippinPrep apparatus (SAGE science) and amplified using Phusion (Finnzymes).

    3C-Seq:

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: Paragraph title: Processing 3C libraries into 3C-seq libraries ready for sequencing ... DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions).

    Concentration Assay:

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Briefly, cages were assembled by combining equimolar amounts of each strand at a concentration of 1 μM in an assembly buffer containing 40 mM Tris-acetate (pH 8.0) and 15 mM MgCl2 . .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs.

    Agarose Gel Electrophoresis:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The PCR product was digested with BamHI and SalI (New England Biolabs), the restriction DNA fragment (insert) was isolated using agarose gel electrophoresis and purified by the MinElute Gel Extraction Kit (Qiagen). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: In each case, the PCR-amplified material was purified by ZymoClean agarose gel purification (Zymo Research, Inc., Irvine, CA) and column cleanup (Qiagen miniprep spin purification kit, Qiagen, Inc., Germany). .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Inserts and vectors were quantified by 260nm UV spectrophotometry and densitometry of 1% agarose gel electrophoretic runs. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Plasmid Preparation:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The pGL4.10_mod3_EF1α vector was also digested with BamHI and SalI, the double digested DNA (vector) was isolated and purified in the same way as insert. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs). .. 1 μl of ligation reaction was transformed to 100 μl of DH5α competent cells (Invitrogen).

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: Therapeutic expression of human clotting factors IX and X following adeno-associated viral vector–mediated intrauterine gene transfer in early-gestation fetal macaques
    Article Snippet: Paragraph title: Vector production ... AAV-inverted terminal repeats with the LP1 promoter were cut with Hin dIII/Mfe I, ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and heat shocked into competent Escherichia coli , which were grown at 37°C overnight ( ).

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: Paragraph title: Plasmid assembly by single-stranded DNA ... The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4]. .. Similarly, a piggyBac vector with 3 × P3-DsRed as a screening marker was prepared as follows.

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: Total pRV library plasmids were purified with an EndoFree Maxiprep Kit (Cat #12362; QIAGEN). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2]. .. Ligation reactions were concentrated by using ethanol precipitation, electroporated into SS320 electro-competent bacteria, and grown as described above.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Inserts and vectors were quantified by 260nm UV spectrophotometry and densitometry of 1% agarose gel electrophoretic runs. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. Ligation mixtures were used to transform the E . coli SURE strain (Agilent Technologies) following the manufacturer's instructions.

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were synthesized by Genewiz (South Plainfield, NJ, USA); the P. finnis and A. robustus FEX genes were codon optimized for expression in E. coli whereas the N. californiae FEX gene was synthesized both in a codon-optimized version and a non-codon optimized version. .. The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. In the pYC vector, the cloned gene is downstream of a GAL1 promoter and 3′-terminally fused to green fluorescent protein followed by a decahistidine tag.

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The vector was modified to remove a weak σ 70 binding site present 24 bp upstream of the GFP open reading frame (two point mutations, A → G and T → G, were introduced, changing the putative σ 70 binding site from TAGATT to TGGATG, with the consensus σ 70 binding site being TATAAT). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Functional Assay:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4]. .. Similarly, a piggyBac vector with 3 × P3-DsRed as a screening marker was prepared as follows.

    Binding Assay:

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: For each primer-less PCR reassembly reaction, 500 ng of gel-extracted fragments was used and fully reassembled capsids were amplified in a second PCR with primers (Shuffling_Rescue-F: 5′-GTCGGAAAGCATATGCCGCG-3′, Shuffling_Rescue-R: 5′-GACGTCGCATGCAACTAGTAT-3′) binding the cap gene and carrying overlapping ends to pRV plasmids. .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: Base-pairing sequences binding to the nontemplate DNA strand were selected. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli .

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The vector was modified to remove a weak σ 70 binding site present 24 bp upstream of the GFP open reading frame (two point mutations, A → G and T → G, were introduced, changing the putative σ 70 binding site from TAGATT to TGGATG, with the consensus σ 70 binding site being TATAAT). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Sample Prep:

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: The sheared DNA was subsequently purified on a QIAquick column and then processed using the Illumina Paired-End DNA Sample Prep Kit (PE-930-1001). .. DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions).

    Transgenic Assay:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: Paragraph title: Construction of piggyBac transgenic vectors ... The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Spectrophotometry:

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Inserts and vectors were quantified by 260nm UV spectrophotometry and densitometry of 1% agarose gel electrophoretic runs. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs. .. After soaking overnight at room temperature, the residual gel powder was filtered off using a 0.45-mm filtration spin column.

    Activation Assay:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The EGT gene sequence containing an upstream activation sequence (UAS) with Asc I and Xho I sites was synthesized by Takara Bio Corporation and cloned into the pMD19-T Simple plasmid to generate pMD19-T [UAS-EGT]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Produced:

    Article Title: Therapeutic expression of human clotting factors IX and X following adeno-associated viral vector–mediated intrauterine gene transfer in early-gestation fetal macaques
    Article Snippet: scAAV-LP1-hFIXco was produced as described by Nathwani et al . ( ). scAAV-LP1-hFXco was produced similarly, replacing the hFIXco with the codon-optimized hFX transgene (hFXco), from pAV-LP1-hFX with a truncated poly-A. .. AAV-inverted terminal repeats with the LP1 promoter were cut with Hin dIII/Mfe I, ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and heat shocked into competent Escherichia coli , which were grown at 37°C overnight ( ).

    Oligonucleotide Synthesis:

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr. .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Gel Extraction:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The PCR product was digested with BamHI and SalI (New England Biolabs), the restriction DNA fragment (insert) was isolated using agarose gel electrophoresis and purified by the MinElute Gel Extraction Kit (Qiagen). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The bands were excised and purified with QIAquick Gel Extraction Kit (Qiagen), and the 50μL eluate was diluted to 100μL with milliQ water and precipitated with 0.1 volume of 3M sodium acetate and 2.5 volumes of pre-chilled absolute ethanol at -20°C for 30 min. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Variant Assay:

    Article Title: ZBTB10 binds the telomeric variant repeat TTGGGG and interacts with TRF2
    Article Snippet: Double-stranded oligonucleotides were then polymerized using 50 U T4 polynucleotidekinase (Thermo Scientific) and 80 U T4 DNA ligase (NEB), biotinylated with desthiobiotin-dATP (Jena Bioscience) by Klenow fragment (Thermo Scientific) and purified using G-50 columns (GE Healthcare). .. Double-stranded oligonucleotides were then polymerized using 50 U T4 polynucleotidekinase (Thermo Scientific) and 80 U T4 DNA ligase (NEB), biotinylated with desthiobiotin-dATP (Jena Bioscience) by Klenow fragment (Thermo Scientific) and purified using G-50 columns (GE Healthcare).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs t4 rna ligase 2 truncated k227q
    Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    T4 Rna Ligase 2 Truncated K227q, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2 truncated k227q/product/New England Biolabs
    Average 99 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 truncated k227q - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs t4 rna ligase 2
    Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.
    T4 Rna Ligase 2, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase 2/product/New England Biolabs
    Average 99 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase 2 - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs t4 dna ligase ligation protocol
    Effect of Inhibiting dsDNA on Enzyme Self-Adenylylation Rate. The determined rates for self-adenylylation of an uninhibited reaction, 2.5 μM T4 DNA ligase (red) and 2.5 μM T4 DNA ligase and inhibited reactions 2.5 μM DNA (blue) and 10 μM DNA (green). The reactions were fit to a single exponential equation (  Eq 6 ) to determine the reaction rate. The uninhibited reaction was determined to have a single turnover rate of 20 s -1  ± 2 s -1 . While the 2.5 μM inhibited reaction had a single turnover rate of 2.8 s -1  ± 0.5 s -1 and the 10 μM inhibited reaction had a single turnover rate of 1.0 s -1  ± 1 s -1 . All reactions were performed a minimum of three times at 16°C. Error reported is the standard error for the replicates.
    T4 Dna Ligase Ligation Protocol, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase ligation protocol/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase ligation protocol - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    Image Search Results


    Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Labeling, Ligation, Binding Assay

    Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Incubation, Staining, Electrophoretic Mobility Shift Assay, Binding Assay

    Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4  RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4 RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Incubation, Staining, Ligation, Binding Assay

    Following AMP during ligation reactions with T4 RNA ligases .  (A)  22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4  RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes  32 P-phosphate.  (B)  Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes  32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA.  (C)  Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection.  (D)  Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4  RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes  32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Ligation, Labeling, Incubation, Acrylamide Gel Assay, Nucleic Acid Electrophoresis, Binding Assay

    Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4  RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4 RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Ligation, Incubation, Staining, Binding Assay

    Purification and activity of T4 RNA Ligase 2 truncated mutants .  (A)  Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left.  (B)  Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Purification and activity of T4 RNA Ligase 2 truncated mutants . (A) Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left. (B) Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Purification, Activity Assay, Staining, Marker, Incubation, Labeling, Binding Assay

    Effect of pH on ligase intermolecular strand-joining activity .  (A-D)  Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid.  (E-H)  Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Effect of pH on ligase intermolecular strand-joining activity . (A-D) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. (E-H) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Labeling, Ligation, Binding Assay

    Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Labeling, Ligation, Binding Assay

    Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Effect of PEG 8000 on ligase intermolecular strand-joining activity . Strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, ligase (13.8 pmol), and varying amounts of PEG 8000 for 1 hour at 25°C to assess the effect of PEG on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Labeling, Ligation, Binding Assay

    Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Deadenylation activity of T4 RNA ligase 2 truncated mutants . 5'-adenylated DNA adapters were incubated with an excess of ligase (13.8 pmol), and 12.5% PEG 8000 at 16°C overnight. Oligonucleotide substrates are depicted schematically above the gel. The contents of each sample were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold to visualize nucleic acid. Deadenylation of the DNA adapter (loss of 5'-App) is indicated by a band shift of ~1 nt towards the bottom of the gel. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Incubation, Staining, Electrophoretic Mobility Shift Assay, Binding Assay

    Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4  RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Assaying the formation of side products by T4 RNA ligases . Intermolecular strand-joining reactions containing 5'-adenylated adapters, 21-mer 5'-PO 4 RNA acceptors, and ligase (1 pmol) were incubated at 16°C overnight in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. Products of the reaction were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Ladder = size standard ladder, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Incubation, Staining, Ligation, Binding Assay

    Following AMP during ligation reactions with T4 RNA ligases .  (A)  22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4  RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes  32 P-phosphate.  (B)  Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes  32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA.  (C)  Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection.  (D)  Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4  RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes  32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Following AMP during ligation reactions with T4 RNA ligases . (A) 22-mer DNA adapters were 5'-adenylated with α- 32 P-labeled ATP (see materials and methods). Intermolecular strand-joining reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 21-mer 5'-PO 4 RNA acceptor, and ligase (1 pmol) were incubated overnight at 16°C in the presence of PEG 8000. Reaction products were resolved on a denaturing 15% acrylamide gel and radioactive molecules were visualized by exposure to Phosphor screens. The resulting products were either free AMP in solution (AMP*) or the adapter remaining adenylated (Ap*p-DNA). Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. (B) Determining the fate of AMP upon T4 RNA ligase-dependent deadenylation. Reactions containing radiolabeled DNA adapter (10 pmol) and ligase (14 pmol) were incubated overnight at 16°C in the presence of 12.5% PEG 8000. Oligonucleotide substrates are depicted schematically above the gel. P* denotes 32 P-phosphate. Reaction products were resolved and visualized as in (A). The resulting products were either free AMP in solution (AMP*), the adapter remaining adenylated (Ap*p-DNA), or AMP covalently bound to the ligase (AMP*-ligase). The lane labeled input contains only Ap*p-DNA. (C) Reactions identical to those in (B) were treated with Proteinase K prior to gel electrophoresis and detection. (D) Reactions containing 10 pmol radiolabeled DNA adapter, 5 pmol 28-mer [5'-PO 4 , 3'-blocked] RNA acceptor, and ligase (1 pmol) were incubated, resolved and detected as in (A). The resulting products were either free AMP in solution (AMP*), adenylated adapter (Ap*p-DNA), or Ap*p-28-mer RNA. The lane labeled RNA size control contains 5'- 32 PO 4 RNA, and the lane labeled input contains only Ap*p-DNA. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA. P* denotes 32 P-phosphate. In all panels, Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2 +MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Ligation, Labeling, Incubation, Acrylamide Gel Assay, Nucleic Acid Electrophoresis, Binding Assay

    Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4  RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Production of ligation side products by T4 RNA ligases . Intermolecular ligation reactions containing 5'-adenylated DNA adapters, 21-mer 5'-PO 4 RNA acceptors and ligase (1 pmol) were incubated at 16°C overnight with 12.5% PEG 8000. Products of the reactions were resolved on denaturing 15% acrylamide gels and stained with SYBR Gold. The bands corresponding to the input nucleic acids, the DNA adapter/RNA acceptor ligation product (39 bases), and larger side products are indicated. Rnl1 = T4 RNA ligase 1, Rnl2 = T4 RNA ligase 2, Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. Oligonucleotide substrates are depicted schematically above the gel. Grey lines represent RNA and black lines represent DNA.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Ligation, Incubation, Staining, Binding Assay

    Purification and activity of T4 RNA Ligase 2 truncated mutants .  (A)  Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left.  (B)  Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Purification and activity of T4 RNA Ligase 2 truncated mutants . (A) Aliquots of T4 RNA ligase 2 truncated and mutants were separated on 10-20% Tris-glycine SDS polyacrylamide gels and stained with Coomassie blue. The size (in kDa) of marker polypeptides are indicated on the left. (B) Intermolecular strand-joining activity of T4 RNA ligase 2 truncated mutants under multiple turnover conditions. 10 pmol 5'-adenylated 17-mer DNA was incubated for one hour at 25°C with 5 pmol 5'- FAM-labeled 31-mer RNA. 1 pmol of each ligase was added into reaction mixture. The reaction products were resolved on denaturing 15% acrylamide gels, scanned and quantified as described in the methods section. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments. * denotes difference in means p

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Purification, Activity Assay, Staining, Marker, Incubation, Labeling, Binding Assay

    Effect of pH on ligase intermolecular strand-joining activity .  (A-D)  Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid.  (E-H)  Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Effect of pH on ligase intermolecular strand-joining activity . (A-D) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. (E-H) Intermolecular strand-joining reactions were carried out with 10 pmol 5'-adenylated 17-mer DNA, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (13.8 pmol) for 1 hour at 25°C to assess the effect of pH on ligation efficiency. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Activity Assay, Labeling, Ligation, Binding Assay

    Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Journal: BMC Biotechnology

    Article Title: T4 RNA Ligase 2 truncated active site mutants: improved tools for RNA analysis

    doi: 10.1186/1472-6750-11-72

    Figure Lengend Snippet: Analysis of intermolecular strand-joining over time . Strand-joining reactions were carried out with 10 pmol 5'-adenylated adapter, 5 pmol 31-mer 5'-FAM-labeled RNA acceptor, and ligase (1 pmol) over a span of 24 hours at 25°C to assess the progress of ligation reactions. Ligation efficiency was determined by resolving the material in the reactions on denaturing 15% acrylamide gels and quantifying the amount of ligation product versus input nucleic acid. Rnl2tr = T4 RNA ligase 2 truncated, Rnl2tr + MBP = T4 RNA ligase 2 truncated attached to an N-terminal maltose binding protein tag. All mutations indicated are substitutions in T4 Rnl2tr + MBP. Data are shown as the mean +/- SEM of at least three independent experiments.

    Article Snippet: T4 RNA ligase 1, T4 RNA ligase 2, T4 RNA ligase 2 Truncated and, T4 RNA ligase 2 Truncated K227Q were obtained from New England Biolabs.

    Techniques: Labeling, Ligation, Binding Assay

    Effect of Inhibiting dsDNA on Enzyme Self-Adenylylation Rate. The determined rates for self-adenylylation of an uninhibited reaction, 2.5 μM T4 DNA ligase (red) and 2.5 μM T4 DNA ligase and inhibited reactions 2.5 μM DNA (blue) and 10 μM DNA (green). The reactions were fit to a single exponential equation (  Eq 6 ) to determine the reaction rate. The uninhibited reaction was determined to have a single turnover rate of 20 s -1  ± 2 s -1 . While the 2.5 μM inhibited reaction had a single turnover rate of 2.8 s -1  ± 0.5 s -1 and the 10 μM inhibited reaction had a single turnover rate of 1.0 s -1  ± 1 s -1 . All reactions were performed a minimum of three times at 16°C. Error reported is the standard error for the replicates.

    Journal: PLoS ONE

    Article Title: The Inhibitory Effect of Non-Substrate and Substrate DNA on the Ligation and Self-Adenylylation Reactions Catalyzed by T4 DNA Ligase

    doi: 10.1371/journal.pone.0150802

    Figure Lengend Snippet: Effect of Inhibiting dsDNA on Enzyme Self-Adenylylation Rate. The determined rates for self-adenylylation of an uninhibited reaction, 2.5 μM T4 DNA ligase (red) and 2.5 μM T4 DNA ligase and inhibited reactions 2.5 μM DNA (blue) and 10 μM DNA (green). The reactions were fit to a single exponential equation ( Eq 6 ) to determine the reaction rate. The uninhibited reaction was determined to have a single turnover rate of 20 s -1 ± 2 s -1 . While the 2.5 μM inhibited reaction had a single turnover rate of 2.8 s -1 ± 0.5 s -1 and the 10 μM inhibited reaction had a single turnover rate of 1.0 s -1 ± 1 s -1 . All reactions were performed a minimum of three times at 16°C. Error reported is the standard error for the replicates.

    Article Snippet: DsDNA inhibition likely also has an effect in commonly used molecular biology protocols, for example, the maximal recommended DNA concentration utilized in the ligation step for Next Generation Sequencing library preparation is ~20 ng/μL (NEB Ultra II), while the recommended DNA concentration in a standard sticky-end ligation is 4.38 ng/μL (NEB T4 DNA ligase ligation protocol).

    Techniques:

    T4 DNA Ligase Reaction Model. Modified reaction pathway to include the newly observed reactions in the previously described DNA ligation pathway that are inhibited by the presence of non-nicked dsDNA.  A . Non-nicked dsDNA can bind to the deadenylylated form of the enzyme inhibition formation of the adenylylated form of the enzyme.  B . Non-nicked dsDNA binds to the Lig-AMP form, preventing complexation with its preferred ds-nDNA substrate.

    Journal: PLoS ONE

    Article Title: The Inhibitory Effect of Non-Substrate and Substrate DNA on the Ligation and Self-Adenylylation Reactions Catalyzed by T4 DNA Ligase

    doi: 10.1371/journal.pone.0150802

    Figure Lengend Snippet: T4 DNA Ligase Reaction Model. Modified reaction pathway to include the newly observed reactions in the previously described DNA ligation pathway that are inhibited by the presence of non-nicked dsDNA. A . Non-nicked dsDNA can bind to the deadenylylated form of the enzyme inhibition formation of the adenylylated form of the enzyme. B . Non-nicked dsDNA binds to the Lig-AMP form, preventing complexation with its preferred ds-nDNA substrate.

    Article Snippet: DsDNA inhibition likely also has an effect in commonly used molecular biology protocols, for example, the maximal recommended DNA concentration utilized in the ligation step for Next Generation Sequencing library preparation is ~20 ng/μL (NEB Ultra II), while the recommended DNA concentration in a standard sticky-end ligation is 4.38 ng/μL (NEB T4 DNA ligase ligation protocol).

    Techniques: Modification, DNA Ligation, Enzyme Inhibition Assay

    Competition for ds-nDNA-Binding by dsDNA. Lane one contains 4 nM of the 75mer-ds-nDNA substrate alone, lanes 2–6 show shifting of the 4 nM substrate into a completely bound state as the concentration of T4 DNA ligase is increased from 100 nM– 1000 nM. Lanes 7–11 are of a titration of increasing concentrations of the unlabeled I-75-dsDNA oligo into a reaction containing 4 nM labeled nicked substrate and 1000 nM T4 DNA ligase. EMSA reactions were all performed and electrophoresed at room temperature (22°C).

    Journal: PLoS ONE

    Article Title: The Inhibitory Effect of Non-Substrate and Substrate DNA on the Ligation and Self-Adenylylation Reactions Catalyzed by T4 DNA Ligase

    doi: 10.1371/journal.pone.0150802

    Figure Lengend Snippet: Competition for ds-nDNA-Binding by dsDNA. Lane one contains 4 nM of the 75mer-ds-nDNA substrate alone, lanes 2–6 show shifting of the 4 nM substrate into a completely bound state as the concentration of T4 DNA ligase is increased from 100 nM– 1000 nM. Lanes 7–11 are of a titration of increasing concentrations of the unlabeled I-75-dsDNA oligo into a reaction containing 4 nM labeled nicked substrate and 1000 nM T4 DNA ligase. EMSA reactions were all performed and electrophoresed at room temperature (22°C).

    Article Snippet: DsDNA inhibition likely also has an effect in commonly used molecular biology protocols, for example, the maximal recommended DNA concentration utilized in the ligation step for Next Generation Sequencing library preparation is ~20 ng/μL (NEB Ultra II), while the recommended DNA concentration in a standard sticky-end ligation is 4.38 ng/μL (NEB T4 DNA ligase ligation protocol).

    Techniques: Binding Assay, Concentration Assay, Titration, Labeling

    Various Inhibitors Effects on Rate of Nick Sealing. Various concentrations of dsDNA substrates were utilized as potential inhibitors of the T4 DNA ligase steady state ligation reaction on 20 nM of the 75mer-ds-nDNA substrate. All reactions were performed in the presence of 25 pM of T4 DNA ligase, a minimum of three times at 16°C. Error reported is the standard deviation for the replicates.

    Journal: PLoS ONE

    Article Title: The Inhibitory Effect of Non-Substrate and Substrate DNA on the Ligation and Self-Adenylylation Reactions Catalyzed by T4 DNA Ligase

    doi: 10.1371/journal.pone.0150802

    Figure Lengend Snippet: Various Inhibitors Effects on Rate of Nick Sealing. Various concentrations of dsDNA substrates were utilized as potential inhibitors of the T4 DNA ligase steady state ligation reaction on 20 nM of the 75mer-ds-nDNA substrate. All reactions were performed in the presence of 25 pM of T4 DNA ligase, a minimum of three times at 16°C. Error reported is the standard deviation for the replicates.

    Article Snippet: DsDNA inhibition likely also has an effect in commonly used molecular biology protocols, for example, the maximal recommended DNA concentration utilized in the ligation step for Next Generation Sequencing library preparation is ~20 ng/μL (NEB Ultra II), while the recommended DNA concentration in a standard sticky-end ligation is 4.38 ng/μL (NEB T4 DNA ligase ligation protocol).

    Techniques: Ligation, Standard Deviation

    k cat /K m  Curve for T4 DNA Ligase. The data was obtained through titration of increasing concentrations of a 75mer-ds-nDNA substrate, reacted at 16°C to determine initial reaction rates. T4 DNA ligase concentrations used were 25 pM– 100 pM. The initial rates were plotted against their respective substrate concentrations and fit by:  A . a classical uncompetitive substrate inhibition model (  Eq 2 ), where k cat  and K m  Values of 0.44 s -1  ± 0.3 s -1  and 4 nM ± 1 nM respectively, were determined. The K i  value for substrate inhibition was calculated to be 590 nM ± 170 nM.  B . A competitive substrate inhibition for a Bi-Bi Ping-Pong mechanism (  Eq 3 ) k cat  and K m  values of 0.48 s -1  ± 0.3 s -1  and 4 nM ± 1 nM respectively, were determined. The K i  value for substrate inhibition was calculated to be 54 nM ± 15 nM. All data points are the average of at least three independent experiments, and the error reported is the standard deviation for the replicates.

    Journal: PLoS ONE

    Article Title: The Inhibitory Effect of Non-Substrate and Substrate DNA on the Ligation and Self-Adenylylation Reactions Catalyzed by T4 DNA Ligase

    doi: 10.1371/journal.pone.0150802

    Figure Lengend Snippet: k cat /K m Curve for T4 DNA Ligase. The data was obtained through titration of increasing concentrations of a 75mer-ds-nDNA substrate, reacted at 16°C to determine initial reaction rates. T4 DNA ligase concentrations used were 25 pM– 100 pM. The initial rates were plotted against their respective substrate concentrations and fit by: A . a classical uncompetitive substrate inhibition model ( Eq 2 ), where k cat and K m Values of 0.44 s -1 ± 0.3 s -1 and 4 nM ± 1 nM respectively, were determined. The K i value for substrate inhibition was calculated to be 590 nM ± 170 nM. B . A competitive substrate inhibition for a Bi-Bi Ping-Pong mechanism ( Eq 3 ) k cat and K m values of 0.48 s -1 ± 0.3 s -1 and 4 nM ± 1 nM respectively, were determined. The K i value for substrate inhibition was calculated to be 54 nM ± 15 nM. All data points are the average of at least three independent experiments, and the error reported is the standard deviation for the replicates.

    Article Snippet: DsDNA inhibition likely also has an effect in commonly used molecular biology protocols, for example, the maximal recommended DNA concentration utilized in the ligation step for Next Generation Sequencing library preparation is ~20 ng/μL (NEB Ultra II), while the recommended DNA concentration in a standard sticky-end ligation is 4.38 ng/μL (NEB T4 DNA ligase ligation protocol).

    Techniques: Titration, Inhibition, Standard Deviation