Structured Review

Fisher Scientific t4 ligase
T4 Ligase, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 ligase/product/Fisher Scientific
Average 93 stars, based on 3 article reviews
Price from $9.99 to $1999.99
t4 ligase - by Bioz Stars, 2020-05
93/100 stars

Images

Related Articles

Clone Assay:

Article Title: Insight into the Lytic Functions of the Lactococcal Prophage TP712
Article Snippet: .. Ligations of the fragments into the cloning vectors were carried out with T4 ligase (Fisher Scientific, Waltham, MA, USA) at a final volume of 20 μL; reactions were incubated for 14 h at 16 °C. .. All the constructions were checked by DNA sequencing (Macrogen, Madrid, Spain).

Incubation:

Article Title: Insight into the Lytic Functions of the Lactococcal Prophage TP712
Article Snippet: .. Ligations of the fragments into the cloning vectors were carried out with T4 ligase (Fisher Scientific, Waltham, MA, USA) at a final volume of 20 μL; reactions were incubated for 14 h at 16 °C. .. All the constructions were checked by DNA sequencing (Macrogen, Madrid, Spain).

Selection:

Article Title: Telomere Transcripts Target Telomerase in Human Cancer Cells
Article Snippet: .. Plasmids were ligated by T4 ligase (Fermentas—Thermo Fisher Scientific, Vienna, Austria), transformed in TOP10 Chemically Competent Escherichia coli strain (Invitrogen) and grown under kanamycin or ampicillin (Sigma-Aldrich, Vienna, Austria) antibiotic selection pressure. .. The oligonucleotides for construction of pENTR shRNA were sense 5′-GGCCAGTG GAATTC GAGACCAGCTTCAAGAGAGCTGGTCTC GAATTC CACTTTTTTT-3′ and antisense 5′-AATTAAAAAAAGTG GAATTC GAGACCAGCTCTCTTGAAGCTGGTCTC GAATTC CACT-3′ targeting eukaryotic translation initiation factor 4A3 (EIF4A3 , alternatively termed NMP265 [ ]) with sequences as published for small interfering RNA (siRNA) [ ].

Transformation Assay:

Article Title: Telomere Transcripts Target Telomerase in Human Cancer Cells
Article Snippet: .. Plasmids were ligated by T4 ligase (Fermentas—Thermo Fisher Scientific, Vienna, Austria), transformed in TOP10 Chemically Competent Escherichia coli strain (Invitrogen) and grown under kanamycin or ampicillin (Sigma-Aldrich, Vienna, Austria) antibiotic selection pressure. .. The oligonucleotides for construction of pENTR shRNA were sense 5′-GGCCAGTG GAATTC GAGACCAGCTTCAAGAGAGCTGGTCTC GAATTC CACTTTTTTT-3′ and antisense 5′-AATTAAAAAAAGTG GAATTC GAGACCAGCTCTCTTGAAGCTGGTCTC GAATTC CACT-3′ targeting eukaryotic translation initiation factor 4A3 (EIF4A3 , alternatively termed NMP265 [ ]) with sequences as published for small interfering RNA (siRNA) [ ].

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Fisher Scientific t4 dna ligase
    The Golden Gate principle. A) Type IIS restriction endonucleases, such as Bsa I, have a distinct, non-palindromic recognition site (red) and asymmetrically cut at a precisely defined distance regardless of the local sequence (green). Bsa I for instance creates a four base 5′-overhang starting from the second nucleotide downstream of the recognition site. B) A Golden Gate style cloning system requires two types of components, a destination vector and entry vectors containing the modules to be assembled. Each vector carries two recognition sites for the type IIS endonuclease (red) flanking the counter-selective marker on the destination vector and the modules on the entry vectors, respectively. Destination and entry vectors confer different markers for bacterial selection. The sequences in purple, blue and green represent the cutting sites. C) The orientation and position of the recognition sites is such that after digestion they remain with the backbone of the entry vectors, but are excised from the destination vector along with the counter-selectable marker ( ccdB ). D) The single stranded overhangs generated by the endonuclease can anneal to complementary sequences and be covalently linked by <t>T4</t> DNA ligase. During the Golden Gate reaction in the presence of endonuclease and ligase the desired final product, but also the original vectors or a plethora of side-products (one of them shown at the bottom) can be created. However, only the desired final product is resistant to further endonucleolytic cleavage, whereas all other molecules will be cut again and again and thus will disappear from the reaction over time.
    T4 Dna Ligase, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/Fisher Scientific
    Average 93 stars, based on 10 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-05
    93/100 stars
      Buy from Supplier

    Image Search Results


    The Golden Gate principle. A) Type IIS restriction endonucleases, such as Bsa I, have a distinct, non-palindromic recognition site (red) and asymmetrically cut at a precisely defined distance regardless of the local sequence (green). Bsa I for instance creates a four base 5′-overhang starting from the second nucleotide downstream of the recognition site. B) A Golden Gate style cloning system requires two types of components, a destination vector and entry vectors containing the modules to be assembled. Each vector carries two recognition sites for the type IIS endonuclease (red) flanking the counter-selective marker on the destination vector and the modules on the entry vectors, respectively. Destination and entry vectors confer different markers for bacterial selection. The sequences in purple, blue and green represent the cutting sites. C) The orientation and position of the recognition sites is such that after digestion they remain with the backbone of the entry vectors, but are excised from the destination vector along with the counter-selectable marker ( ccdB ). D) The single stranded overhangs generated by the endonuclease can anneal to complementary sequences and be covalently linked by T4 DNA ligase. During the Golden Gate reaction in the presence of endonuclease and ligase the desired final product, but also the original vectors or a plethora of side-products (one of them shown at the bottom) can be created. However, only the desired final product is resistant to further endonucleolytic cleavage, whereas all other molecules will be cut again and again and thus will disappear from the reaction over time.

    Journal: PLoS ONE

    Article Title: GreenGate - A Novel, Versatile, and Efficient Cloning System for Plant Transgenesis

    doi: 10.1371/journal.pone.0083043

    Figure Lengend Snippet: The Golden Gate principle. A) Type IIS restriction endonucleases, such as Bsa I, have a distinct, non-palindromic recognition site (red) and asymmetrically cut at a precisely defined distance regardless of the local sequence (green). Bsa I for instance creates a four base 5′-overhang starting from the second nucleotide downstream of the recognition site. B) A Golden Gate style cloning system requires two types of components, a destination vector and entry vectors containing the modules to be assembled. Each vector carries two recognition sites for the type IIS endonuclease (red) flanking the counter-selective marker on the destination vector and the modules on the entry vectors, respectively. Destination and entry vectors confer different markers for bacterial selection. The sequences in purple, blue and green represent the cutting sites. C) The orientation and position of the recognition sites is such that after digestion they remain with the backbone of the entry vectors, but are excised from the destination vector along with the counter-selectable marker ( ccdB ). D) The single stranded overhangs generated by the endonuclease can anneal to complementary sequences and be covalently linked by T4 DNA ligase. During the Golden Gate reaction in the presence of endonuclease and ligase the desired final product, but also the original vectors or a plethora of side-products (one of them shown at the bottom) can be created. However, only the desired final product is resistant to further endonucleolytic cleavage, whereas all other molecules will be cut again and again and thus will disappear from the reaction over time.

    Article Snippet: PCR products and intermediate plasmids were cut by conventional restriction endonucleases (obtained from Fisher Scientific - Germany GmbH, Schwerte, Germany) and ligated with T4 DNA ligase (Fisher Scientific - Germany GmbH, Schwerte, Germany).

    Techniques: Sequencing, Clone Assay, Plasmid Preparation, Marker, Selection, Generated