t4 ligase enzyme  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    T4 DNA Ligase
    Description:
    T4 DNA Ligase is a ligation enzyme that can be used to join DNA fragments by catalyzing the formation of phosphodiester bonds between juxtaposed 5 phosphate and 3 hydroxyl termini in double stranded DNA using ATP as a coenzyme Both blunt and cohesive end DNA ligation as well as single stranded nick repair of DNA RNA and DNA RNA are possible using the T4 DNA ligase
    Catalog Number:
    2011b
    Price:
    None
    Size:
    125 000 Units
    Category:
    T4 DNA Ligase Ligation enzymes Cloning
    Buy from Supplier


    Structured Review

    TaKaRa t4 ligase enzyme
    T4 DNA Ligase is a ligation enzyme that can be used to join DNA fragments by catalyzing the formation of phosphodiester bonds between juxtaposed 5 phosphate and 3 hydroxyl termini in double stranded DNA using ATP as a coenzyme Both blunt and cohesive end DNA ligation as well as single stranded nick repair of DNA RNA and DNA RNA are possible using the T4 DNA ligase
    https://www.bioz.com/result/t4 ligase enzyme/product/TaKaRa
    Average 90 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    t4 ligase enzyme - by Bioz Stars, 2020-02
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Linc-smad7 promotes myoblast differentiation and muscle regeneration via sponging miR-125b
    Article Snippet: .. Wild type and mutant partial length sequences (containing miR-125b seed sequence target sites) of Linc-smad7 and smad7 3′UTR were cloned into the psi-Check2 vector with T4 DNA ligase (TakaRa), and confirmed by sequencing (Sangon Biotech) . .. These plasmids and miR-125b mimic were co-transfected into 293T cells separately.

    Article Title: Identification of Fatty Acid Desaturase 6 in Golden Pompano Trachinotus Ovatus (Linnaeus 1758) and Its Regulation by the PPARαb Transcription Factor
    Article Snippet: Paragraph title: 4.7. Cloning of the Fads6 Promoter and Construction of Deletion Mutants ... All purified PCR products and a pGL3-basic (Promega, USA) vector were digested with Hind III and Xho I, and concentrated by T4 DNA ligase (Takara, Japan) overnight at 16 °C.

    Article Title: Functional Analysis of Genes Involved in the Biosynthesis of Enterocin NKR-5-3B, a Novel Circular Bacteriocin
    Article Snippet: .. Briefly, the total genome DNA of E. faecium NKR-5-3 was extracted, physically digested by sonication into fragments of approximately 40 kb in length, and cloned into the CopyControl pCC1FOS vector (Epicentre, WI, USA) using T4 DNA ligase (TaKaRa, Osaka, Japan). .. Subsequent plasmids were packed into phage particles using an in vitro packaging system (MaxPlax Lambda packaging extract; Epicentre) to prepare the NKR-5-3 phage library solution.

    Article Title: Emergence of Fosfomycin-Resistant Isolates of Shiga-Like Toxin-Producing Escherichia coli O26
    Article Snippet: Restriction endonucleases and T4 DNA ligase were supplied by Takara Biomedicals (Ohtsu, Japan) and were used as recommended by the manufacturer. .. To obtain clones containing the murA gene (encoding UDP-GlcNAc enolpyruvoyl transferase) derived from STEC NGY47 and NGY60, partially Sau 3AI-digested fragments of chromosomal DNA from these isolates were ligated into the Bam HI site of a high-copy-number vector, pHSG398.

    Article Title: Staphylococcus sciuri Exfoliative Toxin C (ExhC) is a Necrosis-Inducer for Mammalian Cells
    Article Snippet: Paragraph title: Construction of cloning and expression plasmids with ExhC ... The Linearized ExhC and pET28a(+) were ligated with T4 DNA ligase (Takara) before sequencing analysis.

    Article Title: CYP1A1 Relieves Lipopolysaccharide-Induced Inflammatory Responses in Bovine Mammary Epithelial Cells
    Article Snippet: The product with added polyA was further collected using a StarPrep Gel Extraction Kit (GenStar BioSolutions) and connected to a pMD19-T vector (TakaRa) by using T4 DNA Ligase (TakaRa) at 4°C for 12 h. Finally, the plasmids from the transformants of Trans5 α containing the sequence for the molecular cloning of full-length bovine CYP1A1 gene were collected using a TIANprep Rapid Mini Plasmid Kit (TIANGEN, Shanghai, China) and sequenced by BIG Tech (Shenzhen, China) to verify the correct DNA sequence. .. To efficiently transfect the plasmid into the epithelium, the widely used lentiviral expression vector pCDH-CMV-MCS-EF1-copGFP-T2A-Puro plasmid (SBI plasmid, CD513B-1) was chosen as the basic target plasmid, and the full-length bovine CYP1A1 cDNAs were cloned into this target plasmid.

    Article Title: Identification of the involvement of LOXL4 in generation of keratocystic odontogenic tumors by RNA-Seq analysis
    Article Snippet: .. Construction of expression plasmid LOXL4 Human LOXL4 cDNA was purchased from Sino Biological and cloned in pCMV/hygro (CV004; Sino Biological, Beijng, China) for transient overexpression with a DNA Ligation Kit (2011A; TAKARA, Kyoto, Japan). .. Western blot analysis Total protein lysates from human umbilical vein endothelial cells (HUVECs) were resolved on 8% sodium dodecyl sulfate-polyacrylamide gel eletrophoresis (SDS–PAGE), then transferred to nitrocellulose membrane or polyvinylidene fluoride membrane, and underwent immunoblotting with LOXL4 antibody (1∶2000; ab88186; Abcam, Cambridge, UK).

    Article Title: Construction of a trifunctional cellulase and expression in Saccharomyces cerevisiae using a fusion protein
    Article Snippet: Three amplified cellulase DNA products were ligated together using T4 DNA ligase (TaKaRa, Dalian, China) as per manufacturer’s instructions. .. The fusion gene was then amplified from the ligation product by PCR using primers bg- Sna BI-F and eg- Eco 81I-R, digested with Sna BI and Eco 81I (TaKaRa, Dalian, China), and then cloned into pHBM368-pgk to generate plasmid pHBM368-pgk-bce.

    Centrifugation:

    Article Title: The Eleanor ncRNAs activate the topological domain of the ESR1 locus to balance against apoptosis
    Article Snippet: In brief, at least 107 MCF7 or LTED cells were harvested and crosslinked with 1% formaldehyde for 5 min with rotation at room temperature, followed by quenching with a final concentration of 125 mM glycine and centrifugation for 10 min at 400 × g and 4 °C. .. Nuclei were digested overnight with the first restriction enzyme at 37 °C, followed by proximity ligation with T4DNA ligase (TaKaRa, 2011A) for 4 h at 16 °C and then kept for 30 min at room temperature.

    Luciferase:

    Article Title: Linc-smad7 promotes myoblast differentiation and muscle regeneration via sponging miR-125b
    Article Snippet: Paragraph title: Dual luciferase reporter assay ... Wild type and mutant partial length sequences (containing miR-125b seed sequence target sites) of Linc-smad7 and smad7 3′UTR were cloned into the psi-Check2 vector with T4 DNA ligase (TakaRa), and confirmed by sequencing (Sangon Biotech) .

    Reporter Assay:

    Article Title: Linc-smad7 promotes myoblast differentiation and muscle regeneration via sponging miR-125b
    Article Snippet: Paragraph title: Dual luciferase reporter assay ... Wild type and mutant partial length sequences (containing miR-125b seed sequence target sites) of Linc-smad7 and smad7 3′UTR were cloned into the psi-Check2 vector with T4 DNA ligase (TakaRa), and confirmed by sequencing (Sangon Biotech) .

    DNA Ligation:

    Article Title: Identification of the involvement of LOXL4 in generation of keratocystic odontogenic tumors by RNA-Seq analysis
    Article Snippet: .. Construction of expression plasmid LOXL4 Human LOXL4 cDNA was purchased from Sino Biological and cloned in pCMV/hygro (CV004; Sino Biological, Beijng, China) for transient overexpression with a DNA Ligation Kit (2011A; TAKARA, Kyoto, Japan). .. Western blot analysis Total protein lysates from human umbilical vein endothelial cells (HUVECs) were resolved on 8% sodium dodecyl sulfate-polyacrylamide gel eletrophoresis (SDS–PAGE), then transferred to nitrocellulose membrane or polyvinylidene fluoride membrane, and underwent immunoblotting with LOXL4 antibody (1∶2000; ab88186; Abcam, Cambridge, UK).

    Construct:

    Article Title: Identification of Fatty Acid Desaturase 6 in Golden Pompano Trachinotus Ovatus (Linnaeus 1758) and Its Regulation by the PPARαb Transcription Factor
    Article Snippet: All purified PCR products and a pGL3-basic (Promega, USA) vector were digested with Hind III and Xho I, and concentrated by T4 DNA ligase (Takara, Japan) overnight at 16 °C. .. Recombinant plasmids were extracted using EndoFree Plasmid Giga Kit (Tiangen, China), and constructs were confirmed by sequencing, as described above.

    Article Title: Soluble Expression of Humanized Anti-CD20 Single Chain Antibody in Escherichia coli by Cytoplasmic Chaperones Co-expression
    Article Snippet: Restriction enzyme and T4 DNA ligase were purchased from Takara Shuzo (Kyoto, Japan). .. The pUC-57-huscFv construct was obtained from V. Ahmadzadeh .

    SYBR Green Assay:

    Article Title: Restructured Lactococcus lactis strains with emergent properties constructed by a novel highly efficient screening system
    Article Snippet: DNA manipulations and chemicals DNA marker, T4 DNA ligase, restriction enzymes, and DNA gel extraction kit were purchased from Takara (Dalian, China). .. The PCR product purification kit, first-strand cDNA synthesis kit, and SYBR Green RT-qPCR kit were obtained from Thermo Fisher Scientific (Waltham, USA).

    Incubation:

    Article Title: Functional Analysis of Genes Involved in the Biosynthesis of Enterocin NKR-5-3B, a Novel Circular Bacteriocin
    Article Snippet: Briefly, the total genome DNA of E. faecium NKR-5-3 was extracted, physically digested by sonication into fragments of approximately 40 kb in length, and cloned into the CopyControl pCC1FOS vector (Epicentre, WI, USA) using T4 DNA ligase (TaKaRa, Osaka, Japan). .. A 1-μl aliquot of the phage solution was then added to 100 μl of an E. coli EPI-300 cell suspension previously cultivated in the LB broth (optical density at 600 nm [OD600 ], 0.7), supplemented with 10 mM MgSO4 and 0.2% (wt/vol) maltose, and incubated at 37°C for 1 h. Following the incubation, the cell suspension was plated on the LB agar medium containing 12.5 μg/ml chloramphenicol.

    Amplification:

    Article Title: Identification of Fatty Acid Desaturase 6 in Golden Pompano Trachinotus Ovatus (Linnaeus 1758) and Its Regulation by the PPARαb Transcription Factor
    Article Snippet: The truncated mutants were amplified using PrimeSTAR Master Mix (Takara, Japan). .. All purified PCR products and a pGL3-basic (Promega, USA) vector were digested with Hind III and Xho I, and concentrated by T4 DNA ligase (Takara, Japan) overnight at 16 °C.

    Article Title: Staphylococcus sciuri Exfoliative Toxin C (ExhC) is a Necrosis-Inducer for Mammalian Cells
    Article Snippet: PCR was performed with a program containing an initial step at 94°C for 4 min followed by 30 cycles for the amplification of ExhC , each cycle consisting of 94°C for 30 s, 50°C for 30 s, and 72°C for 60 s. The PCR products were purified before inserted into cloning plasmid pMD19-T simple vector (Takara), and the resulting plasmid, pMD19-T-ExhC, was used to transform E. coli DH5α. .. The Linearized ExhC and pET28a(+) were ligated with T4 DNA ligase (Takara) before sequencing analysis.

    Article Title: miR-365 inhibits duck myoblast proliferation by targeting IGF-I via PI3K/Akt pathway
    Article Snippet: .. The cyclin D1 (CCND1) 3′UTR sequence including the miRNA binding site was amplified using P3, these fragments were ligated into the psi-CHECK-2 dual-luciferase reporter vector (Promega, U.S.A.) using restriction enzymes Xho I and Not I (TaKaRa, Japan) and then ligated by T4 DNA ligase (TaKaRa, Japan), respectively. .. Isolation and culture of duck myoblasts For each experiment, Peking duck eggs which were incubated for 13 days were randomly selected, and the duck myoblasts that used were isolated from the leg muscles of embryos [ ].

    Article Title: Construction of a trifunctional cellulase and expression in Saccharomyces cerevisiae using a fusion protein
    Article Snippet: .. Three amplified cellulase DNA products were ligated together using T4 DNA ligase (TaKaRa, Dalian, China) as per manufacturer’s instructions. .. The fusion gene was then amplified from the ligation product by PCR using primers bg- Sna BI-F and eg- Eco 81I-R, digested with Sna BI and Eco 81I (TaKaRa, Dalian, China), and then cloned into pHBM368-pgk to generate plasmid pHBM368-pgk-bce.

    Expressing:

    Article Title: Soluble Expression of Humanized Anti-CD20 Single Chain Antibody in Escherichia coli by Cytoplasmic Chaperones Co-expression
    Article Snippet: E. coli DH5α, BL21 (DE3) and expression vector pET22b (+) were purchased from Novagen. .. Restriction enzyme and T4 DNA ligase were purchased from Takara Shuzo (Kyoto, Japan).

    Article Title: Staphylococcus sciuri Exfoliative Toxin C (ExhC) is a Necrosis-Inducer for Mammalian Cells
    Article Snippet: Paragraph title: Construction of cloning and expression plasmids with ExhC ... The Linearized ExhC and pET28a(+) were ligated with T4 DNA ligase (Takara) before sequencing analysis.

    Article Title: CYP1A1 Relieves Lipopolysaccharide-Induced Inflammatory Responses in Bovine Mammary Epithelial Cells
    Article Snippet: The product with added polyA was further collected using a StarPrep Gel Extraction Kit (GenStar BioSolutions) and connected to a pMD19-T vector (TakaRa) by using T4 DNA Ligase (TakaRa) at 4°C for 12 h. Finally, the plasmids from the transformants of Trans5 α containing the sequence for the molecular cloning of full-length bovine CYP1A1 gene were collected using a TIANprep Rapid Mini Plasmid Kit (TIANGEN, Shanghai, China) and sequenced by BIG Tech (Shenzhen, China) to verify the correct DNA sequence. .. To efficiently transfect the plasmid into the epithelium, the widely used lentiviral expression vector pCDH-CMV-MCS-EF1-copGFP-T2A-Puro plasmid (SBI plasmid, CD513B-1) was chosen as the basic target plasmid, and the full-length bovine CYP1A1 cDNAs were cloned into this target plasmid.

    Article Title: Identification of the involvement of LOXL4 in generation of keratocystic odontogenic tumors by RNA-Seq analysis
    Article Snippet: .. Construction of expression plasmid LOXL4 Human LOXL4 cDNA was purchased from Sino Biological and cloned in pCMV/hygro (CV004; Sino Biological, Beijng, China) for transient overexpression with a DNA Ligation Kit (2011A; TAKARA, Kyoto, Japan). .. Western blot analysis Total protein lysates from human umbilical vein endothelial cells (HUVECs) were resolved on 8% sodium dodecyl sulfate-polyacrylamide gel eletrophoresis (SDS–PAGE), then transferred to nitrocellulose membrane or polyvinylidene fluoride membrane, and underwent immunoblotting with LOXL4 antibody (1∶2000; ab88186; Abcam, Cambridge, UK).

    Over Expression:

    Article Title: CYP1A1 Relieves Lipopolysaccharide-Induced Inflammatory Responses in Bovine Mammary Epithelial Cells
    Article Snippet: Paragraph title: 2.4. Molecular Cloning of Full-Length Bovine CYP1A1 and Construction of CYP1A1 Overexpression Plasmids ... The product with added polyA was further collected using a StarPrep Gel Extraction Kit (GenStar BioSolutions) and connected to a pMD19-T vector (TakaRa) by using T4 DNA Ligase (TakaRa) at 4°C for 12 h. Finally, the plasmids from the transformants of Trans5 α containing the sequence for the molecular cloning of full-length bovine CYP1A1 gene were collected using a TIANprep Rapid Mini Plasmid Kit (TIANGEN, Shanghai, China) and sequenced by BIG Tech (Shenzhen, China) to verify the correct DNA sequence.

    Article Title: Identification of the involvement of LOXL4 in generation of keratocystic odontogenic tumors by RNA-Seq analysis
    Article Snippet: .. Construction of expression plasmid LOXL4 Human LOXL4 cDNA was purchased from Sino Biological and cloned in pCMV/hygro (CV004; Sino Biological, Beijng, China) for transient overexpression with a DNA Ligation Kit (2011A; TAKARA, Kyoto, Japan). .. Western blot analysis Total protein lysates from human umbilical vein endothelial cells (HUVECs) were resolved on 8% sodium dodecyl sulfate-polyacrylamide gel eletrophoresis (SDS–PAGE), then transferred to nitrocellulose membrane or polyvinylidene fluoride membrane, and underwent immunoblotting with LOXL4 antibody (1∶2000; ab88186; Abcam, Cambridge, UK).

    Derivative Assay:

    Article Title: Emergence of Fosfomycin-Resistant Isolates of Shiga-Like Toxin-Producing Escherichia coli O26
    Article Snippet: Restriction endonucleases and T4 DNA ligase were supplied by Takara Biomedicals (Ohtsu, Japan) and were used as recommended by the manufacturer. .. To obtain clones containing the murA gene (encoding UDP-GlcNAc enolpyruvoyl transferase) derived from STEC NGY47 and NGY60, partially Sau 3AI-digested fragments of chromosomal DNA from these isolates were ligated into the Bam HI site of a high-copy-number vector, pHSG398.

    Transfection:

    Article Title: Linc-smad7 promotes myoblast differentiation and muscle regeneration via sponging miR-125b
    Article Snippet: Wild type and mutant partial length sequences (containing miR-125b seed sequence target sites) of Linc-smad7 and smad7 3′UTR were cloned into the psi-Check2 vector with T4 DNA ligase (TakaRa), and confirmed by sequencing (Sangon Biotech) . .. Twenty-four hours after transfection, cells were lysed and luciferase report analysis performed using Dual-Luciferase® Reporter Assay System (Promega).

    Ligation:

    Article Title: The Eleanor ncRNAs activate the topological domain of the ESR1 locus to balance against apoptosis
    Article Snippet: .. Nuclei were digested overnight with the first restriction enzyme at 37 °C, followed by proximity ligation with T4DNA ligase (TaKaRa, 2011A) for 4 h at 16 °C and then kept for 30 min at room temperature. ..

    Article Title: Construction of a trifunctional cellulase and expression in Saccharomyces cerevisiae using a fusion protein
    Article Snippet: Three amplified cellulase DNA products were ligated together using T4 DNA ligase (TaKaRa, Dalian, China) as per manufacturer’s instructions. .. The fusion gene was then amplified from the ligation product by PCR using primers bg- Sna BI-F and eg- Eco 81I-R, digested with Sna BI and Eco 81I (TaKaRa, Dalian, China), and then cloned into pHBM368-pgk to generate plasmid pHBM368-pgk-bce.

    Article Title: The Eleanor ncRNAs activate the topological domain of the ESR1 locus to balance against apoptosis
    Article Snippet: .. After inactivating the restriction enzymes by heating at 65 °C for 20 min in the presence of 1.6% sodium dodecyl sulfate (SDS), proximity ligation was done in 7 mL total volume using 350 U T4DNA ligase (TaKaRa, 2011A) for 4 h at 16 °C and then kept for 30 min at room temperature. .. After de-crosslinking and RNase treatment, the DNA was purified by phenol–chloroform extraction and ethanol precipitation.

    Genomic Sequencing:

    Article Title: Identification of Fatty Acid Desaturase 6 in Golden Pompano Trachinotus Ovatus (Linnaeus 1758) and Its Regulation by the PPARαb Transcription Factor
    Article Snippet: The sequence upstream of the Fads6 gene was obtained from genomic sequencing data of T. ovatus . .. All purified PCR products and a pGL3-basic (Promega, USA) vector were digested with Hind III and Xho I, and concentrated by T4 DNA ligase (Takara, Japan) overnight at 16 °C.

    Generated:

    Article Title: miR-365 inhibits duck myoblast proliferation by targeting IGF-I via PI3K/Akt pathway
    Article Snippet: psi-CHECK-2 dual-luciferase reporter vector construction The IGF-I 3′UTR sequence including the miRNA binding site was amplified using P1, a mutagen in the miR-365 binding site of IGF-I 3′UTR was generated with a pair of mutagenic primers P2. .. The cyclin D1 (CCND1) 3′UTR sequence including the miRNA binding site was amplified using P3, these fragments were ligated into the psi-CHECK-2 dual-luciferase reporter vector (Promega, U.S.A.) using restriction enzymes Xho I and Not I (TaKaRa, Japan) and then ligated by T4 DNA ligase (TaKaRa, Japan), respectively.

    DNA Sequencing:

    Article Title: Staphylococcus sciuri Exfoliative Toxin C (ExhC) is a Necrosis-Inducer for Mammalian Cells
    Article Snippet: Transformants were grown on LB agar plates with ampicillin (100 µg ml−1 ) at 37°C and the colonies were screened by PCR and DNA sequencing analysis. .. The Linearized ExhC and pET28a(+) were ligated with T4 DNA ligase (Takara) before sequencing analysis.

    Polymerase Chain Reaction:

    Article Title: Identification of Fatty Acid Desaturase 6 in Golden Pompano Trachinotus Ovatus (Linnaeus 1758) and Its Regulation by the PPARαb Transcription Factor
    Article Snippet: .. All purified PCR products and a pGL3-basic (Promega, USA) vector were digested with Hind III and Xho I, and concentrated by T4 DNA ligase (Takara, Japan) overnight at 16 °C. .. Recombinant plasmids were extracted using EndoFree Plasmid Giga Kit (Tiangen, China), and constructs were confirmed by sequencing, as described above.

    Article Title: Functional Analysis of Genes Involved in the Biosynthesis of Enterocin NKR-5-3B, a Novel Circular Bacteriocin
    Article Snippet: Briefly, the total genome DNA of E. faecium NKR-5-3 was extracted, physically digested by sonication into fragments of approximately 40 kb in length, and cloned into the CopyControl pCC1FOS vector (Epicentre, WI, USA) using T4 DNA ligase (TaKaRa, Osaka, Japan). .. Positive colonies carrying the NKR-5-3 genome library were screened and identified using colony PCR with appropriate primers ( ).

    Article Title: Staphylococcus sciuri Exfoliative Toxin C (ExhC) is a Necrosis-Inducer for Mammalian Cells
    Article Snippet: Transformants were grown on LB agar plates with ampicillin (100 µg ml−1 ) at 37°C and the colonies were screened by PCR and DNA sequencing analysis. .. The Linearized ExhC and pET28a(+) were ligated with T4 DNA ligase (Takara) before sequencing analysis.

    Article Title: Investigation on the processing and improving the cleavage efficiency of furin cleavage sites in Pichia pastoris
    Article Snippet: .. Restriction enzymes, T4 DNA ligase, Taq DNA polymerase, polymerase chain reaction (PCR) reagent, Prime STAR polymerase, and PCR reagent were obtained from Takara Bio Inc. .. The Endo Hf was purchased from New England Biolabs, Inc. SDS-PAGE Protein Marker was supplied by Thermo Fisher Scientific.

    Article Title: CYP1A1 Relieves Lipopolysaccharide-Induced Inflammatory Responses in Bovine Mammary Epithelial Cells
    Article Snippet: The PCR products were separated using 1% sepharose gel and collected using a StarPrep Gel Extraction Kit (GenStar BioSolutions, Beijing, China). .. The product with added polyA was further collected using a StarPrep Gel Extraction Kit (GenStar BioSolutions) and connected to a pMD19-T vector (TakaRa) by using T4 DNA Ligase (TakaRa) at 4°C for 12 h. Finally, the plasmids from the transformants of Trans5 α containing the sequence for the molecular cloning of full-length bovine CYP1A1 gene were collected using a TIANprep Rapid Mini Plasmid Kit (TIANGEN, Shanghai, China) and sequenced by BIG Tech (Shenzhen, China) to verify the correct DNA sequence.

    Article Title: Construction of a trifunctional cellulase and expression in Saccharomyces cerevisiae using a fusion protein
    Article Snippet: The DNA fragment encoding the eg gene was amplified from pHBM368-pgk-eg by PCR using primers eg- Eco RI-F (5′-ATC GAATTC CAGTCGCTTTGCGACCAAT) and eg- Eco 81I-R (5′-ACT CCTGAGG CTAGTTGTTTTGTTGGGCGGA) which contain restriction sites (shown in bold) for Eco RI and Eco 81I, respectively. .. Three amplified cellulase DNA products were ligated together using T4 DNA ligase (TaKaRa, Dalian, China) as per manufacturer’s instructions.

    Article Title: Restructured Lactococcus lactis strains with emergent properties constructed by a novel highly efficient screening system
    Article Snippet: DNA manipulations and chemicals DNA marker, T4 DNA ligase, restriction enzymes, and DNA gel extraction kit were purchased from Takara (Dalian, China). .. The PCR product purification kit, first-strand cDNA synthesis kit, and SYBR Green RT-qPCR kit were obtained from Thermo Fisher Scientific (Waltham, USA).

    Sonication:

    Article Title: Functional Analysis of Genes Involved in the Biosynthesis of Enterocin NKR-5-3B, a Novel Circular Bacteriocin
    Article Snippet: .. Briefly, the total genome DNA of E. faecium NKR-5-3 was extracted, physically digested by sonication into fragments of approximately 40 kb in length, and cloned into the CopyControl pCC1FOS vector (Epicentre, WI, USA) using T4 DNA ligase (TaKaRa, Osaka, Japan). .. Subsequent plasmids were packed into phage particles using an in vitro packaging system (MaxPlax Lambda packaging extract; Epicentre) to prepare the NKR-5-3 phage library solution.

    Recombinant:

    Article Title: Identification of Fatty Acid Desaturase 6 in Golden Pompano Trachinotus Ovatus (Linnaeus 1758) and Its Regulation by the PPARαb Transcription Factor
    Article Snippet: All purified PCR products and a pGL3-basic (Promega, USA) vector were digested with Hind III and Xho I, and concentrated by T4 DNA ligase (Takara, Japan) overnight at 16 °C. .. Recombinant plasmids were extracted using EndoFree Plasmid Giga Kit (Tiangen, China), and constructs were confirmed by sequencing, as described above.

    Molecular Cloning:

    Article Title: CYP1A1 Relieves Lipopolysaccharide-Induced Inflammatory Responses in Bovine Mammary Epithelial Cells
    Article Snippet: .. The product with added polyA was further collected using a StarPrep Gel Extraction Kit (GenStar BioSolutions) and connected to a pMD19-T vector (TakaRa) by using T4 DNA Ligase (TakaRa) at 4°C for 12 h. Finally, the plasmids from the transformants of Trans5 α containing the sequence for the molecular cloning of full-length bovine CYP1A1 gene were collected using a TIANprep Rapid Mini Plasmid Kit (TIANGEN, Shanghai, China) and sequenced by BIG Tech (Shenzhen, China) to verify the correct DNA sequence. .. The plasmid of the pMD19-T vector connected with the correct sequence was digested by restriction enzymes Nhel and Notl (New England Biolabs, Ipswich, MA).

    Mutagenesis:

    Article Title: Linc-smad7 promotes myoblast differentiation and muscle regeneration via sponging miR-125b
    Article Snippet: .. Wild type and mutant partial length sequences (containing miR-125b seed sequence target sites) of Linc-smad7 and smad7 3′UTR were cloned into the psi-Check2 vector with T4 DNA ligase (TakaRa), and confirmed by sequencing (Sangon Biotech) . .. These plasmids and miR-125b mimic were co-transfected into 293T cells separately.

    Isolation:

    Article Title: Redistribution of Carbon Flux toward 2,3-Butanediol Production in Klebsiella pneumoniae by Metabolic Engineering
    Article Snippet: Restriction enzymes and T4 DNA ligase were purchased from Takara Shuzo. .. A gel extraction kit (Takara, A550) was used for large-scale isolation of plasmid DNA from gels.

    Article Title: Emergence of Fosfomycin-Resistant Isolates of Shiga-Like Toxin-Producing Escherichia coli O26
    Article Snippet: Restriction endonucleases and T4 DNA ligase were supplied by Takara Biomedicals (Ohtsu, Japan) and were used as recommended by the manufacturer. .. These recombinants were introduced into E. coli C600, and transformants resistant to both fosfomycin and chloramphenicol were isolated.

    Article Title: Restructured Lactococcus lactis strains with emergent properties constructed by a novel highly efficient screening system
    Article Snippet: DNA manipulations and chemicals DNA marker, T4 DNA ligase, restriction enzymes, and DNA gel extraction kit were purchased from Takara (Dalian, China). .. L. lactis plasmid DNA, chromosomal DNA, and total RNA were isolated by using Qiaprep spin kit (small scale) following manufacturer’s instructions.

    Purification:

    Article Title: Identification of Fatty Acid Desaturase 6 in Golden Pompano Trachinotus Ovatus (Linnaeus 1758) and Its Regulation by the PPARαb Transcription Factor
    Article Snippet: .. All purified PCR products and a pGL3-basic (Promega, USA) vector were digested with Hind III and Xho I, and concentrated by T4 DNA ligase (Takara, Japan) overnight at 16 °C. .. Recombinant plasmids were extracted using EndoFree Plasmid Giga Kit (Tiangen, China), and constructs were confirmed by sequencing, as described above.

    Article Title: Staphylococcus sciuri Exfoliative Toxin C (ExhC) is a Necrosis-Inducer for Mammalian Cells
    Article Snippet: PCR was performed with a program containing an initial step at 94°C for 4 min followed by 30 cycles for the amplification of ExhC , each cycle consisting of 94°C for 30 s, 50°C for 30 s, and 72°C for 60 s. The PCR products were purified before inserted into cloning plasmid pMD19-T simple vector (Takara), and the resulting plasmid, pMD19-T-ExhC, was used to transform E. coli DH5α. .. The Linearized ExhC and pET28a(+) were ligated with T4 DNA ligase (Takara) before sequencing analysis.

    Article Title: Investigation on the processing and improving the cleavage efficiency of furin cleavage sites in Pichia pastoris
    Article Snippet: Restriction enzymes, T4 DNA ligase, Taq DNA polymerase, polymerase chain reaction (PCR) reagent, Prime STAR polymerase, and PCR reagent were obtained from Takara Bio Inc. .. PCR Purification Kit was from Promega Corporation.

    Article Title: Restructured Lactococcus lactis strains with emergent properties constructed by a novel highly efficient screening system
    Article Snippet: DNA manipulations and chemicals DNA marker, T4 DNA ligase, restriction enzymes, and DNA gel extraction kit were purchased from Takara (Dalian, China). .. The PCR product purification kit, first-strand cDNA synthesis kit, and SYBR Green RT-qPCR kit were obtained from Thermo Fisher Scientific (Waltham, USA).

    Article Title: The Eleanor ncRNAs activate the topological domain of the ESR1 locus to balance against apoptosis
    Article Snippet: After inactivating the restriction enzymes by heating at 65 °C for 20 min in the presence of 1.6% sodium dodecyl sulfate (SDS), proximity ligation was done in 7 mL total volume using 350 U T4DNA ligase (TaKaRa, 2011A) for 4 h at 16 °C and then kept for 30 min at room temperature. .. After de-crosslinking and RNase treatment, the DNA was purified by phenol–chloroform extraction and ethanol precipitation.

    Sequencing:

    Article Title: Linc-smad7 promotes myoblast differentiation and muscle regeneration via sponging miR-125b
    Article Snippet: .. Wild type and mutant partial length sequences (containing miR-125b seed sequence target sites) of Linc-smad7 and smad7 3′UTR were cloned into the psi-Check2 vector with T4 DNA ligase (TakaRa), and confirmed by sequencing (Sangon Biotech) . .. These plasmids and miR-125b mimic were co-transfected into 293T cells separately.

    Article Title: Identification of Fatty Acid Desaturase 6 in Golden Pompano Trachinotus Ovatus (Linnaeus 1758) and Its Regulation by the PPARαb Transcription Factor
    Article Snippet: The sequence upstream of the Fads6 gene was obtained from genomic sequencing data of T. ovatus . .. All purified PCR products and a pGL3-basic (Promega, USA) vector were digested with Hind III and Xho I, and concentrated by T4 DNA ligase (Takara, Japan) overnight at 16 °C.

    Article Title: Staphylococcus sciuri Exfoliative Toxin C (ExhC) is a Necrosis-Inducer for Mammalian Cells
    Article Snippet: .. The Linearized ExhC and pET28a(+) were ligated with T4 DNA ligase (Takara) before sequencing analysis. .. Expression and purification of rExhC E. coli BL21 (DE3) competent cells were transformed with the fusion constructs or empty plasmids and grown overnight at 37°C in LB medium with kanamycin (50 µg ml∼1 ).

    Article Title: CYP1A1 Relieves Lipopolysaccharide-Induced Inflammatory Responses in Bovine Mammary Epithelial Cells
    Article Snippet: .. The product with added polyA was further collected using a StarPrep Gel Extraction Kit (GenStar BioSolutions) and connected to a pMD19-T vector (TakaRa) by using T4 DNA Ligase (TakaRa) at 4°C for 12 h. Finally, the plasmids from the transformants of Trans5 α containing the sequence for the molecular cloning of full-length bovine CYP1A1 gene were collected using a TIANprep Rapid Mini Plasmid Kit (TIANGEN, Shanghai, China) and sequenced by BIG Tech (Shenzhen, China) to verify the correct DNA sequence. .. The plasmid of the pMD19-T vector connected with the correct sequence was digested by restriction enzymes Nhel and Notl (New England Biolabs, Ipswich, MA).

    Article Title: miR-365 inhibits duck myoblast proliferation by targeting IGF-I via PI3K/Akt pathway
    Article Snippet: .. The cyclin D1 (CCND1) 3′UTR sequence including the miRNA binding site was amplified using P3, these fragments were ligated into the psi-CHECK-2 dual-luciferase reporter vector (Promega, U.S.A.) using restriction enzymes Xho I and Not I (TaKaRa, Japan) and then ligated by T4 DNA ligase (TaKaRa, Japan), respectively. .. Isolation and culture of duck myoblasts For each experiment, Peking duck eggs which were incubated for 13 days were randomly selected, and the duck myoblasts that used were isolated from the leg muscles of embryos [ ].

    Article Title: Construction of a trifunctional cellulase and expression in Saccharomyces cerevisiae using a fusion protein
    Article Snippet: The reverse coding sequences of (G4 S)3 (underlined in the primer sequence) were added in cbh-L- Eco RI-R. .. Three amplified cellulase DNA products were ligated together using T4 DNA ligase (TaKaRa, Dalian, China) as per manufacturer’s instructions.

    Quantitative RT-PCR:

    Article Title: Restructured Lactococcus lactis strains with emergent properties constructed by a novel highly efficient screening system
    Article Snippet: DNA manipulations and chemicals DNA marker, T4 DNA ligase, restriction enzymes, and DNA gel extraction kit were purchased from Takara (Dalian, China). .. The PCR product purification kit, first-strand cDNA synthesis kit, and SYBR Green RT-qPCR kit were obtained from Thermo Fisher Scientific (Waltham, USA).

    Gel Extraction:

    Article Title: Redistribution of Carbon Flux toward 2,3-Butanediol Production in Klebsiella pneumoniae by Metabolic Engineering
    Article Snippet: Restriction enzymes and T4 DNA ligase were purchased from Takara Shuzo. .. A gel extraction kit (Takara, A550) was used for large-scale isolation of plasmid DNA from gels.

    Article Title: CYP1A1 Relieves Lipopolysaccharide-Induced Inflammatory Responses in Bovine Mammary Epithelial Cells
    Article Snippet: .. The product with added polyA was further collected using a StarPrep Gel Extraction Kit (GenStar BioSolutions) and connected to a pMD19-T vector (TakaRa) by using T4 DNA Ligase (TakaRa) at 4°C for 12 h. Finally, the plasmids from the transformants of Trans5 α containing the sequence for the molecular cloning of full-length bovine CYP1A1 gene were collected using a TIANprep Rapid Mini Plasmid Kit (TIANGEN, Shanghai, China) and sequenced by BIG Tech (Shenzhen, China) to verify the correct DNA sequence. .. The plasmid of the pMD19-T vector connected with the correct sequence was digested by restriction enzymes Nhel and Notl (New England Biolabs, Ipswich, MA).

    Article Title: Restructured Lactococcus lactis strains with emergent properties constructed by a novel highly efficient screening system
    Article Snippet: .. DNA manipulations and chemicals DNA marker, T4 DNA ligase, restriction enzymes, and DNA gel extraction kit were purchased from Takara (Dalian, China). .. The PCR product purification kit, first-strand cDNA synthesis kit, and SYBR Green RT-qPCR kit were obtained from Thermo Fisher Scientific (Waltham, USA).

    SDS Page:

    Article Title: Investigation on the processing and improving the cleavage efficiency of furin cleavage sites in Pichia pastoris
    Article Snippet: Restriction enzymes, T4 DNA ligase, Taq DNA polymerase, polymerase chain reaction (PCR) reagent, Prime STAR polymerase, and PCR reagent were obtained from Takara Bio Inc. .. The Endo Hf was purchased from New England Biolabs, Inc. SDS-PAGE Protein Marker was supplied by Thermo Fisher Scientific.

    Plasmid Preparation:

    Article Title: Redistribution of Carbon Flux toward 2,3-Butanediol Production in Klebsiella pneumoniae by Metabolic Engineering
    Article Snippet: Restriction enzymes and T4 DNA ligase were purchased from Takara Shuzo. .. An Axy PrepTM kit (Axygen) was used to isolate bacterial plasmid DNA.

    Article Title: Linc-smad7 promotes myoblast differentiation and muscle regeneration via sponging miR-125b
    Article Snippet: .. Wild type and mutant partial length sequences (containing miR-125b seed sequence target sites) of Linc-smad7 and smad7 3′UTR were cloned into the psi-Check2 vector with T4 DNA ligase (TakaRa), and confirmed by sequencing (Sangon Biotech) . .. These plasmids and miR-125b mimic were co-transfected into 293T cells separately.

    Article Title: Identification of Fatty Acid Desaturase 6 in Golden Pompano Trachinotus Ovatus (Linnaeus 1758) and Its Regulation by the PPARαb Transcription Factor
    Article Snippet: .. All purified PCR products and a pGL3-basic (Promega, USA) vector were digested with Hind III and Xho I, and concentrated by T4 DNA ligase (Takara, Japan) overnight at 16 °C. .. Recombinant plasmids were extracted using EndoFree Plasmid Giga Kit (Tiangen, China), and constructs were confirmed by sequencing, as described above.

    Article Title: Soluble Expression of Humanized Anti-CD20 Single Chain Antibody in Escherichia coli by Cytoplasmic Chaperones Co-expression
    Article Snippet: E. coli DH5α, BL21 (DE3) and expression vector pET22b (+) were purchased from Novagen. .. Restriction enzyme and T4 DNA ligase were purchased from Takara Shuzo (Kyoto, Japan).

    Article Title: Functional Analysis of Genes Involved in the Biosynthesis of Enterocin NKR-5-3B, a Novel Circular Bacteriocin
    Article Snippet: .. Briefly, the total genome DNA of E. faecium NKR-5-3 was extracted, physically digested by sonication into fragments of approximately 40 kb in length, and cloned into the CopyControl pCC1FOS vector (Epicentre, WI, USA) using T4 DNA ligase (TaKaRa, Osaka, Japan). .. Subsequent plasmids were packed into phage particles using an in vitro packaging system (MaxPlax Lambda packaging extract; Epicentre) to prepare the NKR-5-3 phage library solution.

    Article Title: Emergence of Fosfomycin-Resistant Isolates of Shiga-Like Toxin-Producing Escherichia coli O26
    Article Snippet: The chromosomal DNA of E. coli NGY47 and NGY60 and plasmid DNA were extracted as described previously ( ). .. Restriction endonucleases and T4 DNA ligase were supplied by Takara Biomedicals (Ohtsu, Japan) and were used as recommended by the manufacturer.

    Article Title: Staphylococcus sciuri Exfoliative Toxin C (ExhC) is a Necrosis-Inducer for Mammalian Cells
    Article Snippet: PCR was performed with a program containing an initial step at 94°C for 4 min followed by 30 cycles for the amplification of ExhC , each cycle consisting of 94°C for 30 s, 50°C for 30 s, and 72°C for 60 s. The PCR products were purified before inserted into cloning plasmid pMD19-T simple vector (Takara), and the resulting plasmid, pMD19-T-ExhC, was used to transform E. coli DH5α. .. The Linearized ExhC and pET28a(+) were ligated with T4 DNA ligase (Takara) before sequencing analysis.

    Article Title: CYP1A1 Relieves Lipopolysaccharide-Induced Inflammatory Responses in Bovine Mammary Epithelial Cells
    Article Snippet: .. The product with added polyA was further collected using a StarPrep Gel Extraction Kit (GenStar BioSolutions) and connected to a pMD19-T vector (TakaRa) by using T4 DNA Ligase (TakaRa) at 4°C for 12 h. Finally, the plasmids from the transformants of Trans5 α containing the sequence for the molecular cloning of full-length bovine CYP1A1 gene were collected using a TIANprep Rapid Mini Plasmid Kit (TIANGEN, Shanghai, China) and sequenced by BIG Tech (Shenzhen, China) to verify the correct DNA sequence. .. The plasmid of the pMD19-T vector connected with the correct sequence was digested by restriction enzymes Nhel and Notl (New England Biolabs, Ipswich, MA).

    Article Title: miR-365 inhibits duck myoblast proliferation by targeting IGF-I via PI3K/Akt pathway
    Article Snippet: .. The cyclin D1 (CCND1) 3′UTR sequence including the miRNA binding site was amplified using P3, these fragments were ligated into the psi-CHECK-2 dual-luciferase reporter vector (Promega, U.S.A.) using restriction enzymes Xho I and Not I (TaKaRa, Japan) and then ligated by T4 DNA ligase (TaKaRa, Japan), respectively. .. Isolation and culture of duck myoblasts For each experiment, Peking duck eggs which were incubated for 13 days were randomly selected, and the duck myoblasts that used were isolated from the leg muscles of embryos [ ].

    Article Title: Identification of the involvement of LOXL4 in generation of keratocystic odontogenic tumors by RNA-Seq analysis
    Article Snippet: .. Construction of expression plasmid LOXL4 Human LOXL4 cDNA was purchased from Sino Biological and cloned in pCMV/hygro (CV004; Sino Biological, Beijng, China) for transient overexpression with a DNA Ligation Kit (2011A; TAKARA, Kyoto, Japan). .. Western blot analysis Total protein lysates from human umbilical vein endothelial cells (HUVECs) were resolved on 8% sodium dodecyl sulfate-polyacrylamide gel eletrophoresis (SDS–PAGE), then transferred to nitrocellulose membrane or polyvinylidene fluoride membrane, and underwent immunoblotting with LOXL4 antibody (1∶2000; ab88186; Abcam, Cambridge, UK).

    Article Title: Construction of a trifunctional cellulase and expression in Saccharomyces cerevisiae using a fusion protein
    Article Snippet: Paragraph title: Construction of the fusion-expression vector ... Three amplified cellulase DNA products were ligated together using T4 DNA ligase (TaKaRa, Dalian, China) as per manufacturer’s instructions.

    Article Title: Restructured Lactococcus lactis strains with emergent properties constructed by a novel highly efficient screening system
    Article Snippet: DNA manipulations and chemicals DNA marker, T4 DNA ligase, restriction enzymes, and DNA gel extraction kit were purchased from Takara (Dalian, China). .. L. lactis plasmid DNA, chromosomal DNA, and total RNA were isolated by using Qiaprep spin kit (small scale) following manufacturer’s instructions.

    Real-time Polymerase Chain Reaction:

    Article Title: The Eleanor ncRNAs activate the topological domain of the ESR1 locus to balance against apoptosis
    Article Snippet: Paragraph title: 3C quantitative PCR ... After inactivating the restriction enzymes by heating at 65 °C for 20 min in the presence of 1.6% sodium dodecyl sulfate (SDS), proximity ligation was done in 7 mL total volume using 350 U T4DNA ligase (TaKaRa, 2011A) for 4 h at 16 °C and then kept for 30 min at room temperature.

    Binding Assay:

    Article Title: miR-365 inhibits duck myoblast proliferation by targeting IGF-I via PI3K/Akt pathway
    Article Snippet: .. The cyclin D1 (CCND1) 3′UTR sequence including the miRNA binding site was amplified using P3, these fragments were ligated into the psi-CHECK-2 dual-luciferase reporter vector (Promega, U.S.A.) using restriction enzymes Xho I and Not I (TaKaRa, Japan) and then ligated by T4 DNA ligase (TaKaRa, Japan), respectively. .. Isolation and culture of duck myoblasts For each experiment, Peking duck eggs which were incubated for 13 days were randomly selected, and the duck myoblasts that used were isolated from the leg muscles of embryos [ ].

    In Vitro:

    Article Title: Functional Analysis of Genes Involved in the Biosynthesis of Enterocin NKR-5-3B, a Novel Circular Bacteriocin
    Article Snippet: Briefly, the total genome DNA of E. faecium NKR-5-3 was extracted, physically digested by sonication into fragments of approximately 40 kb in length, and cloned into the CopyControl pCC1FOS vector (Epicentre, WI, USA) using T4 DNA ligase (TaKaRa, Osaka, Japan). .. Subsequent plasmids were packed into phage particles using an in vitro packaging system (MaxPlax Lambda packaging extract; Epicentre) to prepare the NKR-5-3 phage library solution.

    Ethanol Precipitation:

    Article Title: The Eleanor ncRNAs activate the topological domain of the ESR1 locus to balance against apoptosis
    Article Snippet: After inactivating the restriction enzymes by heating at 65 °C for 20 min in the presence of 1.6% sodium dodecyl sulfate (SDS), proximity ligation was done in 7 mL total volume using 350 U T4DNA ligase (TaKaRa, 2011A) for 4 h at 16 °C and then kept for 30 min at room temperature. .. After de-crosslinking and RNase treatment, the DNA was purified by phenol–chloroform extraction and ethanol precipitation.

    Activation Assay:

    Article Title: CYP1A1 Relieves Lipopolysaccharide-Induced Inflammatory Responses in Bovine Mammary Epithelial Cells
    Article Snippet: The full-length CYP1A1 cDNA was obtained from bovine MAC-T cDNA by performing a two-step PCR as follows: activation at 95°C for 1 min; 32 cycles of denaturation at 95°C for 20 s, annealing at 57°C for 20 s, and extension at 72°C for 1 min; and a final extension at 72°C for 5 min. .. The product with added polyA was further collected using a StarPrep Gel Extraction Kit (GenStar BioSolutions) and connected to a pMD19-T vector (TakaRa) by using T4 DNA Ligase (TakaRa) at 4°C for 12 h. Finally, the plasmids from the transformants of Trans5 α containing the sequence for the molecular cloning of full-length bovine CYP1A1 gene were collected using a TIANprep Rapid Mini Plasmid Kit (TIANGEN, Shanghai, China) and sequenced by BIG Tech (Shenzhen, China) to verify the correct DNA sequence.

    Concentration Assay:

    Article Title: The Eleanor ncRNAs activate the topological domain of the ESR1 locus to balance against apoptosis
    Article Snippet: In brief, at least 107 MCF7 or LTED cells were harvested and crosslinked with 1% formaldehyde for 5 min with rotation at room temperature, followed by quenching with a final concentration of 125 mM glycine and centrifugation for 10 min at 400 × g and 4 °C. .. Nuclei were digested overnight with the first restriction enzyme at 37 °C, followed by proximity ligation with T4DNA ligase (TaKaRa, 2011A) for 4 h at 16 °C and then kept for 30 min at room temperature.

    DNA Purification:

    Article Title: Identification of Fatty Acid Desaturase 6 in Golden Pompano Trachinotus Ovatus (Linnaeus 1758) and Its Regulation by the PPARαb Transcription Factor
    Article Snippet: The program parameters were 95 °C for 4 min, followed by 30 cycles of 95 °C for 40 s, 56 °C for 40 s, and 72 °C for 1 min. A general DNA Purification Kit (Tiangen, China) was used to purify the PCR products. .. All purified PCR products and a pGL3-basic (Promega, USA) vector were digested with Hind III and Xho I, and concentrated by T4 DNA ligase (Takara, Japan) overnight at 16 °C.

    Marker:

    Article Title: Soluble Expression of Humanized Anti-CD20 Single Chain Antibody in Escherichia coli by Cytoplasmic Chaperones Co-expression
    Article Snippet: Restriction enzyme and T4 DNA ligase were purchased from Takara Shuzo (Kyoto, Japan). .. Also, the Raji cell line, Ni-NTA resin and protein size marker were obtained from Pasteur Institute of Iran, Qiagen and Fermentas, respectively.

    Article Title: Investigation on the processing and improving the cleavage efficiency of furin cleavage sites in Pichia pastoris
    Article Snippet: Restriction enzymes, T4 DNA ligase, Taq DNA polymerase, polymerase chain reaction (PCR) reagent, Prime STAR polymerase, and PCR reagent were obtained from Takara Bio Inc. .. The Endo Hf was purchased from New England Biolabs, Inc. SDS-PAGE Protein Marker was supplied by Thermo Fisher Scientific.

    Article Title: Restructured Lactococcus lactis strains with emergent properties constructed by a novel highly efficient screening system
    Article Snippet: .. DNA manipulations and chemicals DNA marker, T4 DNA ligase, restriction enzymes, and DNA gel extraction kit were purchased from Takara (Dalian, China). .. The PCR product purification kit, first-strand cDNA synthesis kit, and SYBR Green RT-qPCR kit were obtained from Thermo Fisher Scientific (Waltham, USA).

    Lysis:

    Article Title: The Eleanor ncRNAs activate the topological domain of the ESR1 locus to balance against apoptosis
    Article Snippet: Cells were lysed using NP-40 lysis buffer for 15 min at 4 °C. .. After inactivating the restriction enzymes by heating at 65 °C for 20 min in the presence of 1.6% sodium dodecyl sulfate (SDS), proximity ligation was done in 7 mL total volume using 350 U T4DNA ligase (TaKaRa, 2011A) for 4 h at 16 °C and then kept for 30 min at room temperature.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa t4 dna ligase
    Stimulation of DNA ligation by histone H1 and deletion mutants. The 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 1–15 nM ( left to right ) histone H1 (fl) or deletion mutants within the highly basic C-terminus, followed by ligation by <t>T4</t> DNA ligase. Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer.
    T4 Dna Ligase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 297 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/TaKaRa
    Average 90 stars, based on 297 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results


    Stimulation of DNA ligation by histone H1 and deletion mutants. The 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 1–15 nM ( left to right ) histone H1 (fl) or deletion mutants within the highly basic C-terminus, followed by ligation by T4 DNA ligase. Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer.

    Journal: PLoS ONE

    Article Title: Histone H1 Differentially Inhibits DNA Bending by Reduced and Oxidized HMGB1 Protein

    doi: 10.1371/journal.pone.0138774

    Figure Lengend Snippet: Stimulation of DNA ligation by histone H1 and deletion mutants. The 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 1–15 nM ( left to right ) histone H1 (fl) or deletion mutants within the highly basic C-terminus, followed by ligation by T4 DNA ligase. Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer.

    Article Snippet: In agreement with previous reports [ , ], histone H1 could stimulate formation of linear multimers by T4 DNA ligase at low H1-to-DNA ratios.

    Techniques: DNA Ligation, Labeling, Incubation, Ligation, Electrophoresis

    Histone H1 inhibits the ability of HMGB1 to bend DNA. A , formation of DNA circles by HMGB1 is inhibited by the full-length histone H1 (DNA circularization assay). The 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 5 nM HMGB1, followed by titration with increasing concentrations of H1 (0.2–15 nM, left to right ) and ligation by T4 DNA ligase. Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer. Panels B - E , DNA circularization assays in the presence of the full-length histone H1(fl) or peptides H1Δ24, H1Δ48 and H1Δ72. The percentage of DNA circles by reduced or oxidized HMGB1 or HMGB1ΔC (50 nM) in the presence of increasing concentrations of H1 or H1 peptides (1–15 nM, left to right ) is indicated. The percentage of the minicircles formed by HMGB1 or HMGB1ΔC in the absence of H1 or peptides was arbitrary set to 100%. Oxidized HMGB1 or HMGB1ΔC proteins are indicated in red.

    Journal: PLoS ONE

    Article Title: Histone H1 Differentially Inhibits DNA Bending by Reduced and Oxidized HMGB1 Protein

    doi: 10.1371/journal.pone.0138774

    Figure Lengend Snippet: Histone H1 inhibits the ability of HMGB1 to bend DNA. A , formation of DNA circles by HMGB1 is inhibited by the full-length histone H1 (DNA circularization assay). The 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 5 nM HMGB1, followed by titration with increasing concentrations of H1 (0.2–15 nM, left to right ) and ligation by T4 DNA ligase. Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer. Panels B - E , DNA circularization assays in the presence of the full-length histone H1(fl) or peptides H1Δ24, H1Δ48 and H1Δ72. The percentage of DNA circles by reduced or oxidized HMGB1 or HMGB1ΔC (50 nM) in the presence of increasing concentrations of H1 or H1 peptides (1–15 nM, left to right ) is indicated. The percentage of the minicircles formed by HMGB1 or HMGB1ΔC in the absence of H1 or peptides was arbitrary set to 100%. Oxidized HMGB1 or HMGB1ΔC proteins are indicated in red.

    Article Snippet: In agreement with previous reports [ , ], histone H1 could stimulate formation of linear multimers by T4 DNA ligase at low H1-to-DNA ratios.

    Techniques: Labeling, Incubation, Titration, Ligation, Electrophoresis

    The effect of oxidization and mutation of Cys22/Cys44 or Phe37 of HMGB1ΔC on DNA bending. A , the 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 2, 5, 10, 15, 25, 50 and 100 nM of HMGB1 lacking the acidic C-tail (HMGB1ΔC, left to right ), followed by ligation by T4 DNA ligase (DNA circularization assay). Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer. B , percentage of DNA circles formed by reduced (black triangle) or oxidized (empty triangle) HMGB1ΔC, as compared to DNA circles formed under the same conditions by reduced (black circles) or oxidized (empty circles) full-length HMGB1. The percentage of the minicircles formed at 100 nM HMGB1 was arbitrary set to 100% (each of the curves represent an average of three independent experiments). C , representative circularization assay using reduced HMGB1ΔC, oxidized HMGB1ΔC, and HMGB1ΔC(F37A). Concentrations of proteins were 5, 10, 25, 50 and 100 nM ( left to right ).

    Journal: PLoS ONE

    Article Title: Histone H1 Differentially Inhibits DNA Bending by Reduced and Oxidized HMGB1 Protein

    doi: 10.1371/journal.pone.0138774

    Figure Lengend Snippet: The effect of oxidization and mutation of Cys22/Cys44 or Phe37 of HMGB1ΔC on DNA bending. A , the 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was pre-incubated with 2, 5, 10, 15, 25, 50 and 100 nM of HMGB1 lacking the acidic C-tail (HMGB1ΔC, left to right ), followed by ligation by T4 DNA ligase (DNA circularization assay). Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer. B , percentage of DNA circles formed by reduced (black triangle) or oxidized (empty triangle) HMGB1ΔC, as compared to DNA circles formed under the same conditions by reduced (black circles) or oxidized (empty circles) full-length HMGB1. The percentage of the minicircles formed at 100 nM HMGB1 was arbitrary set to 100% (each of the curves represent an average of three independent experiments). C , representative circularization assay using reduced HMGB1ΔC, oxidized HMGB1ΔC, and HMGB1ΔC(F37A). Concentrations of proteins were 5, 10, 25, 50 and 100 nM ( left to right ).

    Article Snippet: In agreement with previous reports [ , ], histone H1 could stimulate formation of linear multimers by T4 DNA ligase at low H1-to-DNA ratios.

    Techniques: Mutagenesis, Labeling, Incubation, Ligation, Electrophoresis

    The effect of oxidization and mutation of Cys22/Cys44 or Phe37 of HMGB1 on DNA bending. A , the 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was preincubated with 2, 5, 10, 15, 25, 50 and 100 nM HMGB1 proteins ( left to right ), followed by ligation by T4 DNA ligase (DNA circularization assay). Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer. B , percentage of DNA circles formed by reduced HMGB1, oxidized HMGB1 or HMGB1(Cys22A/Cys44A) mutant. The percentage of the minicircles formed at 100 nM HMGB1 was arbitrary set to 100% (each of the curves represent an average of three independent experiments). C , representative circularization assay using reduced HMGB1 and HMGB1(F37A) mutant (5, 20, 50 and 100 nM HMGB1, left to right ). C22/C44, HMGB1(Cys22A/Cys44A) mutant.

    Journal: PLoS ONE

    Article Title: Histone H1 Differentially Inhibits DNA Bending by Reduced and Oxidized HMGB1 Protein

    doi: 10.1371/journal.pone.0138774

    Figure Lengend Snippet: The effect of oxidization and mutation of Cys22/Cys44 or Phe37 of HMGB1 on DNA bending. A , the 5´-end 32 P-labeled 123-bp DNA fragment (~1 nM) was preincubated with 2, 5, 10, 15, 25, 50 and 100 nM HMGB1 proteins ( left to right ), followed by ligation by T4 DNA ligase (DNA circularization assay). Deproteinised DNA samples were separated by electrophoresis on 5% non-denaturing polyacrylamide gels in 0.5x TBE buffer. B , percentage of DNA circles formed by reduced HMGB1, oxidized HMGB1 or HMGB1(Cys22A/Cys44A) mutant. The percentage of the minicircles formed at 100 nM HMGB1 was arbitrary set to 100% (each of the curves represent an average of three independent experiments). C , representative circularization assay using reduced HMGB1 and HMGB1(F37A) mutant (5, 20, 50 and 100 nM HMGB1, left to right ). C22/C44, HMGB1(Cys22A/Cys44A) mutant.

    Article Snippet: In agreement with previous reports [ , ], histone H1 could stimulate formation of linear multimers by T4 DNA ligase at low H1-to-DNA ratios.

    Techniques: Mutagenesis, Labeling, Ligation, Electrophoresis

    Ligation assay by T4 DNA ligase. Time scan curves of liga tion catalyzed by various concentrations of T4 DNA ligase. The curves from top to bottom are those obtained with different T4 DNA ligase concentrations: 2.3, 0.23, 0.115, 6.9 × 10 –2 , 2.3 × 10 –2 , 1.2 × 10 –2 , 6.9 × 10 –3 , 2.3 × 10 –3 , 1.2 × 10 –3 and 2.3 × 10 –4 U/ml. (Insert) The initial ligation velocity is plotted as a function of the concentration of T4 DNA ligase.

    Journal: Nucleic Acids Research

    Article Title: Real-time monitoring of nucleic acid ligation in homogenous solutions using molecular beacons

    doi: 10.1093/nar/gng146

    Figure Lengend Snippet: Ligation assay by T4 DNA ligase. Time scan curves of liga tion catalyzed by various concentrations of T4 DNA ligase. The curves from top to bottom are those obtained with different T4 DNA ligase concentrations: 2.3, 0.23, 0.115, 6.9 × 10 –2 , 2.3 × 10 –2 , 1.2 × 10 –2 , 6.9 × 10 –3 , 2.3 × 10 –3 , 1.2 × 10 –3 and 2.3 × 10 –4 U/ml. (Insert) The initial ligation velocity is plotted as a function of the concentration of T4 DNA ligase.

    Article Snippet: Two samples containing 10 µl reaction solutions were moved from each sample before adding T4 DNA ligase, and after the ligation process had taken place for 360 s with the addition of ligase.

    Techniques: Ligation, Concentration Assay

    Real-time fluorescence scans and corresponding gel electrophoresis. (Left) Curve A is a time scan of fluorescence intensity of MB with N1; B is of MB with N2 and N4; C is of MB with N2 and N3; curve D is of MB itself. t 0 is the time when T4 DNA ligase is added into the MB/oligo solution. (Right) Gel electrophoresis images. Lanes 1 and 2 are for sample D; 3 and 4 for sample C; 5 and 6 for sample B; and 7 and 8 for sample A. Lanes 1, 3, 5 and 7 represent samples D, C, B and A before the addition of T4 DNA ligase, while lanes 2, 4, 6 and 8 represent corresponding samples obtained at 360 s after the addition of ligase. There is a major difference between lanes 5 and 6, while there is basically no difference for all the other pairs.

    Journal: Nucleic Acids Research

    Article Title: Real-time monitoring of nucleic acid ligation in homogenous solutions using molecular beacons

    doi: 10.1093/nar/gng146

    Figure Lengend Snippet: Real-time fluorescence scans and corresponding gel electrophoresis. (Left) Curve A is a time scan of fluorescence intensity of MB with N1; B is of MB with N2 and N4; C is of MB with N2 and N3; curve D is of MB itself. t 0 is the time when T4 DNA ligase is added into the MB/oligo solution. (Right) Gel electrophoresis images. Lanes 1 and 2 are for sample D; 3 and 4 for sample C; 5 and 6 for sample B; and 7 and 8 for sample A. Lanes 1, 3, 5 and 7 represent samples D, C, B and A before the addition of T4 DNA ligase, while lanes 2, 4, 6 and 8 represent corresponding samples obtained at 360 s after the addition of ligase. There is a major difference between lanes 5 and 6, while there is basically no difference for all the other pairs.

    Article Snippet: Two samples containing 10 µl reaction solutions were moved from each sample before adding T4 DNA ligase, and after the ligation process had taken place for 360 s with the addition of ligase.

    Techniques: Fluorescence, Nucleic Acid Electrophoresis

    15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: 15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

    Article Snippet: These results of CIAP treatments might perhaps give us at least 3 messages: (i) CIAP treatments of linkers A–B could block, but not completely, the ligation of linkers A–B, indicating that some of linkers A–B could still be joined by T4 DNA ligase even after CIAP treatment; (ii) the ligation of linkers A–B could be recovered after CIAP was inactivated at 85°C for 30–90 min, perhaps suggesting that some of linkers A–B could spontaneously delete one or more nucleotide(s) at their 5′-ends and generate some 5′-phosphate ends when the linkers were incubated at 85°C for 30–90 min; and (iii) these results of CIAP treatments again indicated that band 5 in was the ligation products of linkers A–B.

    Techniques: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

    12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

    Article Snippet: These results of CIAP treatments might perhaps give us at least 3 messages: (i) CIAP treatments of linkers A–B could block, but not completely, the ligation of linkers A–B, indicating that some of linkers A–B could still be joined by T4 DNA ligase even after CIAP treatment; (ii) the ligation of linkers A–B could be recovered after CIAP was inactivated at 85°C for 30–90 min, perhaps suggesting that some of linkers A–B could spontaneously delete one or more nucleotide(s) at their 5′-ends and generate some 5′-phosphate ends when the linkers were incubated at 85°C for 30–90 min; and (iii) these results of CIAP treatments again indicated that band 5 in was the ligation products of linkers A–B.

    Techniques: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Positive Control, Negative Control

    12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

    Article Snippet: These results of CIAP treatments might perhaps give us at least 3 messages: (i) CIAP treatments of linkers A–B could block, but not completely, the ligation of linkers A–B, indicating that some of linkers A–B could still be joined by T4 DNA ligase even after CIAP treatment; (ii) the ligation of linkers A–B could be recovered after CIAP was inactivated at 85°C for 30–90 min, perhaps suggesting that some of linkers A–B could spontaneously delete one or more nucleotide(s) at their 5′-ends and generate some 5′-phosphate ends when the linkers were incubated at 85°C for 30–90 min; and (iii) these results of CIAP treatments again indicated that band 5 in was the ligation products of linkers A–B.

    Techniques: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

    The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

    Article Snippet: These results of CIAP treatments might perhaps give us at least 3 messages: (i) CIAP treatments of linkers A–B could block, but not completely, the ligation of linkers A–B, indicating that some of linkers A–B could still be joined by T4 DNA ligase even after CIAP treatment; (ii) the ligation of linkers A–B could be recovered after CIAP was inactivated at 85°C for 30–90 min, perhaps suggesting that some of linkers A–B could spontaneously delete one or more nucleotide(s) at their 5′-ends and generate some 5′-phosphate ends when the linkers were incubated at 85°C for 30–90 min; and (iii) these results of CIAP treatments again indicated that band 5 in was the ligation products of linkers A–B.

    Techniques: Polyacrylamide Gel Electrophoresis, Electrophoresis, Negative Control, Positive Control