Structured Review

Roche t4 ligase buffer
T4 Ligase Buffer, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 ligase buffer/product/Roche
Average 91 stars, based on 3 article reviews
Price from $9.99 to $1999.99
t4 ligase buffer - by Bioz Stars, 2020-05
91/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Functional Analysis of the Gene Cluster Involved in Production of the Bacteriocin Circularin A by Clostridium beijerinckii ATCC 25752
Article Snippet: .. Each PCR product was kinase treated with T4 polynucleotide kinase (Amersham Pharmacia Biotech) in T4 ligase buffer (Roche Diagnostics GmbH) and subsequently self-ligated with T4 ligase, creating the plasmids pCirΔA, pCirΔB, pCirΔC, and pCirΔD. .. Derivatives of pCir with a deletion of cirE and a deletion of one of the other genes cirABCD , pCirΔAE, pCirΔBE, pCirΔCE, or pCirΔDE, were made by the same method with the primers 5′-CATATATTCTACTACCTTTC-3′ and 5′-GTAATTAAAGGCTCTAATAAG-3′ for ΔcirE and the plasmids carrying the respective single deletions as templates in the PCR.

Incubation:

Article Title: Caffeine suppresses homologous recombination through interference with RAD51-mediated joint molecule formation
Article Snippet: .. In all, 18.75 ng/µl of nicked plasmid was incubated in the presence of different concentrations of intercalating agents in 1× T4 ligase buffer (Roche) for 30 min at room temperature, after which the ligase was added, and ligation was performed at 16°C for 1 h. For topoisomer separation, the ligated plasmids were phenol:chloroform extracted and precipitated, dissolved in water and separated on 1.3% agarose gel prepared with running buffer (1× TBE, 0.3 µg/ml chloroquine) for 44 h at 4°C, 2.5 V/cm. .. Scanning force microscopy Three′-tailed DNA was made as previously described ( , ) using plasmid DR6 ( ) as a template DNA for PCR.

Agarose Gel Electrophoresis:

Article Title: Caffeine suppresses homologous recombination through interference with RAD51-mediated joint molecule formation
Article Snippet: .. In all, 18.75 ng/µl of nicked plasmid was incubated in the presence of different concentrations of intercalating agents in 1× T4 ligase buffer (Roche) for 30 min at room temperature, after which the ligase was added, and ligation was performed at 16°C for 1 h. For topoisomer separation, the ligated plasmids were phenol:chloroform extracted and precipitated, dissolved in water and separated on 1.3% agarose gel prepared with running buffer (1× TBE, 0.3 µg/ml chloroquine) for 44 h at 4°C, 2.5 V/cm. .. Scanning force microscopy Three′-tailed DNA was made as previously described ( , ) using plasmid DR6 ( ) as a template DNA for PCR.

Plasmid Preparation:

Article Title: Caffeine suppresses homologous recombination through interference with RAD51-mediated joint molecule formation
Article Snippet: .. In all, 18.75 ng/µl of nicked plasmid was incubated in the presence of different concentrations of intercalating agents in 1× T4 ligase buffer (Roche) for 30 min at room temperature, after which the ligase was added, and ligation was performed at 16°C for 1 h. For topoisomer separation, the ligated plasmids were phenol:chloroform extracted and precipitated, dissolved in water and separated on 1.3% agarose gel prepared with running buffer (1× TBE, 0.3 µg/ml chloroquine) for 44 h at 4°C, 2.5 V/cm. .. Scanning force microscopy Three′-tailed DNA was made as previously described ( , ) using plasmid DR6 ( ) as a template DNA for PCR.

Article Title: Construction of a Large Signature-Tagged Mini-Tn5 Transposon Library and Its Application to Mutagenesis of Sinorhizobium meliloti †
Article Snippet: .. For ligation, 3 to 5 ng of plasmid (0.5 μl) was mixed with 7.3 μl of the annealed tag solution, 0.5 μl of polyethylene glycol (nested deletion kit; Amersham), 0.7 μl of T4 DNA ligase (1 U/μl; Roche), and 1 μl of T4 ligase buffer (Roche). .. Transformation of E. coli strain DH5α was performed as described previously ( ).

Ligation:

Article Title: Long-range, high-throughput haplotype determination via haplotype-fusion PCR and ligation haplotyping
Article Snippet: .. For IRF5 we phosphorylated 1 μm ligation primers IRF5-5T (IDT; TGAGCATCACCAATGTGACCTATCCTATCCGTGCCAGCAAGATCCAATCTAGA-2′UOMe-2′UOMe-2′UOMe-2′UOMe) and IRF5-5C (CGAGCATCACCAATGTGACCGTGCCAGCAAGATCCAATCTAGA-2′UOMe-2′UOMe-2′UOMe-2′UOMe) and 2 μM IRF5FusF4, and for Yp 2 µM primer InvFusion R1 and 3Way5T (Operon; TTACTGGGTGCTGGACATGCTCTGGTGCCAGCAAGATCCAATCTAGA-2′UOMe-2′UOMe-2′UOMe-2′UOMe 3′), and 0.5 µM 3Way5G (Operon; GTACTGGGTGCTGGACATGCTCTGCTGATGTCCGGTGCCAGCAAGATCCAATCTAGA-2′UOMe-2′UOMe-2′UOMe-2′UOMe 3′) at the 5′ terminus by incubating for 30 min at 37°C in 1 × T4 ligase buffer (Roche; 66 mM Tris-HCl pH7.5, 5 mM MgCl2 , 5 mM DTT, 1 mM ATP) with 10 units of T4 polynucleotide kinase (Roche) in a total volume of 50 μl, after which we denatured the kinase by heating to 65°C for 20 min. For IRF5 we added 50 pmol of primers IRF5-3G (IDT; AmC6-GGGTTCCCTAAGGGTTGGAGAAAGCGAGCTCGGGG) and IRF5-3T (IDT; AmC6-GGGTTCCCTAAGGGTTGGATTTCGGAAAGCGAGCTCGGGT), and for Yp 50 pmol of primers 3Way3A (Operon; AmC6-dTGGGTTCCCTAAGGGTTGGACAGTGATTTCTGGGTAGCTACAATCATA 3′) and 3Way3G (Operon; AmC6-dT GGGTTCCCTAAGGGTTGGATACTTCAGTGATTTCTGGGTAGCTACAATCATG 3′), along with water to a total volume of 100 µl. .. The optimal concentration of oligos in the ligation reaction was determined empirically, so as to provide peaks after capillary electrophoresis with similar heights: the concentration of central bridging oligo was kept constant, and concentrations of all allele-specific oligos were titrated until uniform results were obtained.

Article Title: Caffeine suppresses homologous recombination through interference with RAD51-mediated joint molecule formation
Article Snippet: .. In all, 18.75 ng/µl of nicked plasmid was incubated in the presence of different concentrations of intercalating agents in 1× T4 ligase buffer (Roche) for 30 min at room temperature, after which the ligase was added, and ligation was performed at 16°C for 1 h. For topoisomer separation, the ligated plasmids were phenol:chloroform extracted and precipitated, dissolved in water and separated on 1.3% agarose gel prepared with running buffer (1× TBE, 0.3 µg/ml chloroquine) for 44 h at 4°C, 2.5 V/cm. .. Scanning force microscopy Three′-tailed DNA was made as previously described ( , ) using plasmid DR6 ( ) as a template DNA for PCR.

Article Title: Construction of a Large Signature-Tagged Mini-Tn5 Transposon Library and Its Application to Mutagenesis of Sinorhizobium meliloti †
Article Snippet: .. For ligation, 3 to 5 ng of plasmid (0.5 μl) was mixed with 7.3 μl of the annealed tag solution, 0.5 μl of polyethylene glycol (nested deletion kit; Amersham), 0.7 μl of T4 DNA ligase (1 U/μl; Roche), and 1 μl of T4 ligase buffer (Roche). .. Transformation of E. coli strain DH5α was performed as described previously ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Roche t4 dna ligase
    ISL probe and regular ISL labeling. ( a ) A regular ISL probe is a blunt-ended DNA fragment with 3′OH/5′OH at the ends. It can be tagged with either digoxigenin or fluorophores. The probe's actual sequence is unimportant for the regular ISL procedure. The probe can be used in the isothermal signal amplification procedure if it contains a single recognition site for a blunt-end restrictase (Sma I in this example). ( b ) In the regular ISL, probes are ligated to 5′PO 4 blunt-ended apoptotic DNA breaks in tissue sections. They cannot ligate to each other due to the absence of 5′PO 4 termini required by <t>T4</t> DNA ligase. Therefore, the regular ISL reaction stops when all DNA probes are ligated to 5′PO 4 breaks in apoptotic DNA
    T4 Dna Ligase, supplied by Roche, used in various techniques. Bioz Stars score: 95/100, based on 202 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/Roche
    Average 95 stars, based on 202 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-05
    95/100 stars
      Buy from Supplier

    90
    Roche t4 rna ligase buffer
    Analysis of wild-type and mutant virion RNA content by RNA end-labeling. RNA extracted from virions was end-labeled with <t>T4</t> RNA ligase and [ 32 P]pCp, and was analyzed on a denaturing 1% agarose gel. ( A ) RNAs extracted from the same number of wild-type (lane 1) and Ψ − (lane 2) virion particles or from a mock preparation (lane 3). ( B ) RNAs extracted from the same number of PR − (lane 4) and Ψ − PR − (lane 5) virion particles or from a mock preparation (lane 6). Lanes 1, 2, and 3 of B represent 2, 1, and 0.5 pmol of yeast tRNA, respectively, which were labeled by the same technique as the other RNA samples.
    T4 Rna Ligase Buffer, supplied by Roche, used in various techniques. Bioz Stars score: 90/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase buffer/product/Roche
    Average 90 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase buffer - by Bioz Stars, 2020-05
    90/100 stars
      Buy from Supplier

    91
    Roche t4 ligase buffer
    Analysis of wild-type and mutant virion RNA content by RNA end-labeling. RNA extracted from virions was end-labeled with <t>T4</t> RNA ligase and [ 32 P]pCp, and was analyzed on a denaturing 1% agarose gel. ( A ) RNAs extracted from the same number of wild-type (lane 1) and Ψ − (lane 2) virion particles or from a mock preparation (lane 3). ( B ) RNAs extracted from the same number of PR − (lane 4) and Ψ − PR − (lane 5) virion particles or from a mock preparation (lane 6). Lanes 1, 2, and 3 of B represent 2, 1, and 0.5 pmol of yeast tRNA, respectively, which were labeled by the same technique as the other RNA samples.
    T4 Ligase Buffer, supplied by Roche, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 ligase buffer/product/Roche
    Average 91 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    t4 ligase buffer - by Bioz Stars, 2020-05
    91/100 stars
      Buy from Supplier

    Image Search Results


    ISL probe and regular ISL labeling. ( a ) A regular ISL probe is a blunt-ended DNA fragment with 3′OH/5′OH at the ends. It can be tagged with either digoxigenin or fluorophores. The probe's actual sequence is unimportant for the regular ISL procedure. The probe can be used in the isothermal signal amplification procedure if it contains a single recognition site for a blunt-end restrictase (Sma I in this example). ( b ) In the regular ISL, probes are ligated to 5′PO 4 blunt-ended apoptotic DNA breaks in tissue sections. They cannot ligate to each other due to the absence of 5′PO 4 termini required by T4 DNA ligase. Therefore, the regular ISL reaction stops when all DNA probes are ligated to 5′PO 4 breaks in apoptotic DNA

    Journal: Methods in molecular biology (Clifton, N.J.)

    Article Title: Zebra Tail Amplification: Accelerated Detection of Apoptotic Blunt-Ended DNA Breaks by In Situ Ligation

    doi: 10.1007/978-1-4939-7187-9_15

    Figure Lengend Snippet: ISL probe and regular ISL labeling. ( a ) A regular ISL probe is a blunt-ended DNA fragment with 3′OH/5′OH at the ends. It can be tagged with either digoxigenin or fluorophores. The probe's actual sequence is unimportant for the regular ISL procedure. The probe can be used in the isothermal signal amplification procedure if it contains a single recognition site for a blunt-end restrictase (Sma I in this example). ( b ) In the regular ISL, probes are ligated to 5′PO 4 blunt-ended apoptotic DNA breaks in tissue sections. They cannot ligate to each other due to the absence of 5′PO 4 termini required by T4 DNA ligase. Therefore, the regular ISL reaction stops when all DNA probes are ligated to 5′PO 4 breaks in apoptotic DNA

    Article Snippet: 2 μL—10× buffer for T4 DNA ligase.

    Techniques: Labeling, Sequencing, Amplification

    Analysis of wild-type and mutant virion RNA content by RNA end-labeling. RNA extracted from virions was end-labeled with T4 RNA ligase and [ 32 P]pCp, and was analyzed on a denaturing 1% agarose gel. ( A ) RNAs extracted from the same number of wild-type (lane 1) and Ψ − (lane 2) virion particles or from a mock preparation (lane 3). ( B ) RNAs extracted from the same number of PR − (lane 4) and Ψ − PR − (lane 5) virion particles or from a mock preparation (lane 6). Lanes 1, 2, and 3 of B represent 2, 1, and 0.5 pmol of yeast tRNA, respectively, which were labeled by the same technique as the other RNA samples.

    Journal: Proceedings of the National Academy of Sciences of the United States of America

    Article Title: RNA is a structural element in retrovirus particles

    doi: 10.1073/pnas.091000398

    Figure Lengend Snippet: Analysis of wild-type and mutant virion RNA content by RNA end-labeling. RNA extracted from virions was end-labeled with T4 RNA ligase and [ 32 P]pCp, and was analyzed on a denaturing 1% agarose gel. ( A ) RNAs extracted from the same number of wild-type (lane 1) and Ψ − (lane 2) virion particles or from a mock preparation (lane 3). ( B ) RNAs extracted from the same number of PR − (lane 4) and Ψ − PR − (lane 5) virion particles or from a mock preparation (lane 6). Lanes 1, 2, and 3 of B represent 2, 1, and 0.5 pmol of yeast tRNA, respectively, which were labeled by the same technique as the other RNA samples.

    Article Snippet: RNA extracted from viral particles or BHK cells was dissolved in 10 μl of RNase-free water and mixed with 17 μl of a buffer containing 10% DMSO (Sigma), 1× T4 RNA ligase buffer (Roche), 4 units of recombinant RNasin (Promega), and 10 μg/ml BSA.

    Techniques: Mutagenesis, End Labeling, Labeling, Agarose Gel Electrophoresis

    ESCRT-II binds directly to RNA through Vps25 in Xenopus egg extracts. A , Western blotting of ESCRT-II IPs or mock IPs (nonspecific rabbit IgG) performed under native (−) or denaturing (+) conditions. Vps22 was not detectable by Western blotting with our ESCRT-II polyclonal antibody. H.C. , heavy chain. B , autoradiograph of a CLIP experiment from Xenopus egg extract under high RNase conditions (0.1 mg/ml). A radioactive band consistent with the molecular mass of Vps25 (denoted by the red asterisk ) is observed, but no bands at the molecular mass of Vps22 or Vps36 are apparent. The expected migrations of the ESCRT-II subunits are indicated to the left of the gel. T4 RNA ligase forms a covalent intermediate with pCp (used to radiolabel the RNA fragments) and appears in every lane. The bands above and below the Vps25 band (denoted by black asterisks ) are nonspecific, as they appeared in the IgG control in some replicates of this experiment. C , autoradiograph of a CLIP experiment from Xenopus egg extract performed as described in B , except under denaturing immunoprecipitation conditions. The same polyclonal ESCRT-II antibody was used for A– C , but under denaturing conditions this antibody only immunoprecipitates Vps25.

    Journal: The Journal of Biological Chemistry

    Article Title: The RNA-binding complex ESCRT-II in Xenopus laevis eggs recognizes purine-rich sequences through its subunit, Vps25

    doi: 10.1074/jbc.RA118.003718

    Figure Lengend Snippet: ESCRT-II binds directly to RNA through Vps25 in Xenopus egg extracts. A , Western blotting of ESCRT-II IPs or mock IPs (nonspecific rabbit IgG) performed under native (−) or denaturing (+) conditions. Vps22 was not detectable by Western blotting with our ESCRT-II polyclonal antibody. H.C. , heavy chain. B , autoradiograph of a CLIP experiment from Xenopus egg extract under high RNase conditions (0.1 mg/ml). A radioactive band consistent with the molecular mass of Vps25 (denoted by the red asterisk ) is observed, but no bands at the molecular mass of Vps22 or Vps36 are apparent. The expected migrations of the ESCRT-II subunits are indicated to the left of the gel. T4 RNA ligase forms a covalent intermediate with pCp (used to radiolabel the RNA fragments) and appears in every lane. The bands above and below the Vps25 band (denoted by black asterisks ) are nonspecific, as they appeared in the IgG control in some replicates of this experiment. C , autoradiograph of a CLIP experiment from Xenopus egg extract performed as described in B , except under denaturing immunoprecipitation conditions. The same polyclonal ESCRT-II antibody was used for A– C , but under denaturing conditions this antibody only immunoprecipitates Vps25.

    Article Snippet: The beads were then washed three times in PBS, transferred to a fresh tube, and then resuspended in 1× T4 RNA ligase buffer (50 m m Tris-HCl, 10 m m MgCl2 , and 10 m m DTT, pH 7.5) with 1 m m ATP, 0.02 mg/ml BSA, and 1 unit/μl RNase inhibitor (Roche Applied Science) and 3′-end–labeled by the addition of 1 μl of pCp (cytidine 3′-5′-(bis)phosphate, 5′-32 P, 3000 Ci/mmol, PerkinElmer) and 0.5 μl of T4 RNA ligase (Fermentas) per 20-μl reaction.

    Techniques: Western Blot, Autoradiography, Cross-linking Immunoprecipitation, Immunoprecipitation