Structured Review

Promega t4 ligase buffer
T4 Ligase Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 ligase buffer/product/Promega
Average 99 stars, based on 3 article reviews
Price from $9.99 to $1999.99
t4 ligase buffer - by Bioz Stars, 2020-09
99/100 stars

Images

Related Articles

Centrifugation:

Article Title: Drosophila type XV/XVIII collagen mutants manifest integrin mediated mitochondrial dysfunction, which is improved by cyclosporin A and losartan.
Article Snippet: .. Vertebrate collagen types XV and XVIII are broadly distributed basement membrane components, classified into a structurally distinct subgroup called "multiplexin collagens". ..

Amplification:

Article Title: Bovine Leukemia Virus Structural Gene Vectors Are Immunogenic and Lack Pathogenicity in a Rabbit Model
Article Snippet: .. One microgram of PBMC total RNA was subjected to reverse transcription for 1 h at 48°C and PCR amplification in the single-buffer Access reverse transcription-PCR (RT-PCR) system (Promega) with BLV pol primers KB2341 and KB3175. .. Nested PCR with 1/50 of the primary PCR product was performed with BLV pol primers KB560 and KB561.

Incubation:

Article Title: DNA methylation subgroups and the CpG island methylator phenotype in gastric cancer: a comprehensive profiling approach
Article Snippet: .. The sections were incubated for 3 days at 55°C in 200 μl of digestion buffer (10 mM Tris-hydrochloric acid, pH8.3; 1 mM EDTA; 0.5% Tween 20) and 45 μl of Proteinase K (20 mg/ml, Promega, Madison, WI) without prior dewaxing. ..

Polymerase Chain Reaction:

Article Title: Bovine Leukemia Virus Structural Gene Vectors Are Immunogenic and Lack Pathogenicity in a Rabbit Model
Article Snippet: .. One microgram of PBMC total RNA was subjected to reverse transcription for 1 h at 48°C and PCR amplification in the single-buffer Access reverse transcription-PCR (RT-PCR) system (Promega) with BLV pol primers KB2341 and KB3175. .. Nested PCR with 1/50 of the primary PCR product was performed with BLV pol primers KB560 and KB561.

Random Hexamer Labeling:

Article Title: Quantifying the contribution of Fc-mediated effector functions to the antiviral activity of anti–HIV-1 IgG1 antibodies in vivo
Article Snippet: .. Viral RNA was reverse transcribed in 30 μL reactions containing 1 × TaqMan Buffer A (containing 50 mM KCl, 10 mM Tris⋅HCl, pH 8.3, 10 μM ethylenediaminetetraacetic acid [EDTA], 60 nM passive reference ROX) with 4.2 mM MgCl2 , 333 μM of each 2′-deoxynucleoside 5′-triphosphate (dNTP), 1.67 μM random hexamer, 20 U RNAsin (Promega), and 20 U SuperScript II reverse transcriptase (Life Technologies). .. Real-time PCR was performed by adding 20 μL of master mix to complementary DNA (cDNA) for a final volume of 50 μL containing a final concentration of 50 mM KCl, 10 mM Tris⋅HCl, pH 8.3, 10 μM EDTA, 60 nM passive reference ROX, 2.5 mM MgCl2, 200 μM of each dNTP, 400 nM forward primer (gag-3.2: 5′-TGG​AGA​ACA​AAG​AAG​GAT​GTC​AAA-3′), 400 nM reverse primer (gag-5.2: 5′-CAC​CAG​ATG​ACG​CAG​ACA​GTA​TTA​T-3′), 100 nM probe (Gag-Btaq.2: 56-FAM/TTGGCACTA/ZEN/ATGGAGCTAAGACCGAAAGTATT/3IABkFQ), and 1.25 U AmpliTaq Gold (Life Technologies).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Bovine Leukemia Virus Structural Gene Vectors Are Immunogenic and Lack Pathogenicity in a Rabbit Model
Article Snippet: .. One microgram of PBMC total RNA was subjected to reverse transcription for 1 h at 48°C and PCR amplification in the single-buffer Access reverse transcription-PCR (RT-PCR) system (Promega) with BLV pol primers KB2341 and KB3175. .. Nested PCR with 1/50 of the primary PCR product was performed with BLV pol primers KB560 and KB561.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Promega t4 dna ligase buffer
    DNA supercoiling and bending assays by phosphorylated SmHMGB1. (A) Circular relaxed plasmid pTZ19R DNA was incubated in the presence of topoisomerase I with 1 µg of recombinant SmHMGB1-FL or SmHMGB1-S172A/S174A that were phosphorylated (lanes 3–5) or not (lanes 6–8 and 9–11), by CK2. Deproteinized DNA topoisomers were resolved on 1% agarose gels, followed by staining of the gels with ethidium bromide. Form I, supercoiled DNA; form II, relaxed circular DNA. (B) Top panel: autoradiography; bottom panel: Coomassie staining. (C) A 32 P-labeled 123-bp DNA fragment (∼1 nM) was pre-incubated with 50 ng of recombinant proteins, that were phosphorylated (lanes 7–9) or not (lanes 4–6, 10–12, 13–15 and 16–18), followed by ligation with <t>T4</t> DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Controls are as follows: FL(c1): SmHMGB1-FL without CK2; FL(c2): SmHMGB1-FL without phosphate; FL(c3): SmHMGB1-FL without CK2 buffer. Linear: linear DNA; Lm: linear multimers. (D) Top panel: autoradiography; bottom panel: Coomassie staining. These experiments were repeated four times.
    T4 Dna Ligase Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 12 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase buffer/product/Promega
    Average 93 stars, based on 12 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase buffer - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    92
    Promega t4 ligase buffer
    DNA supercoiling and bending assays by phosphorylated SmHMGB1. (A) Circular relaxed plasmid pTZ19R DNA was incubated in the presence of topoisomerase I with 1 µg of recombinant SmHMGB1-FL or SmHMGB1-S172A/S174A that were phosphorylated (lanes 3–5) or not (lanes 6–8 and 9–11), by CK2. Deproteinized DNA topoisomers were resolved on 1% agarose gels, followed by staining of the gels with ethidium bromide. Form I, supercoiled DNA; form II, relaxed circular DNA. (B) Top panel: autoradiography; bottom panel: Coomassie staining. (C) A 32 P-labeled 123-bp DNA fragment (∼1 nM) was pre-incubated with 50 ng of recombinant proteins, that were phosphorylated (lanes 7–9) or not (lanes 4–6, 10–12, 13–15 and 16–18), followed by ligation with <t>T4</t> DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Controls are as follows: FL(c1): SmHMGB1-FL without CK2; FL(c2): SmHMGB1-FL without phosphate; FL(c3): SmHMGB1-FL without CK2 buffer. Linear: linear DNA; Lm: linear multimers. (D) Top panel: autoradiography; bottom panel: Coomassie staining. These experiments were repeated four times.
    T4 Ligase Buffer, supplied by Promega, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 ligase buffer/product/Promega
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    t4 ligase buffer - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    93
    Promega t4 rna ligase
    DNA supercoiling and bending assays by phosphorylated SmHMGB1. (A) Circular relaxed plasmid pTZ19R DNA was incubated in the presence of topoisomerase I with 1 µg of recombinant SmHMGB1-FL or SmHMGB1-S172A/S174A that were phosphorylated (lanes 3–5) or not (lanes 6–8 and 9–11), by CK2. Deproteinized DNA topoisomers were resolved on 1% agarose gels, followed by staining of the gels with ethidium bromide. Form I, supercoiled DNA; form II, relaxed circular DNA. (B) Top panel: autoradiography; bottom panel: Coomassie staining. (C) A 32 P-labeled 123-bp DNA fragment (∼1 nM) was pre-incubated with 50 ng of recombinant proteins, that were phosphorylated (lanes 7–9) or not (lanes 4–6, 10–12, 13–15 and 16–18), followed by ligation with <t>T4</t> DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Controls are as follows: FL(c1): SmHMGB1-FL without CK2; FL(c2): SmHMGB1-FL without phosphate; FL(c3): SmHMGB1-FL without CK2 buffer. Linear: linear DNA; Lm: linear multimers. (D) Top panel: autoradiography; bottom panel: Coomassie staining. These experiments were repeated four times.
    T4 Rna Ligase, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 63 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 rna ligase/product/Promega
    Average 93 stars, based on 63 article reviews
    Price from $9.99 to $1999.99
    t4 rna ligase - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    DNA supercoiling and bending assays by phosphorylated SmHMGB1. (A) Circular relaxed plasmid pTZ19R DNA was incubated in the presence of topoisomerase I with 1 µg of recombinant SmHMGB1-FL or SmHMGB1-S172A/S174A that were phosphorylated (lanes 3–5) or not (lanes 6–8 and 9–11), by CK2. Deproteinized DNA topoisomers were resolved on 1% agarose gels, followed by staining of the gels with ethidium bromide. Form I, supercoiled DNA; form II, relaxed circular DNA. (B) Top panel: autoradiography; bottom panel: Coomassie staining. (C) A 32 P-labeled 123-bp DNA fragment (∼1 nM) was pre-incubated with 50 ng of recombinant proteins, that were phosphorylated (lanes 7–9) or not (lanes 4–6, 10–12, 13–15 and 16–18), followed by ligation with T4 DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Controls are as follows: FL(c1): SmHMGB1-FL without CK2; FL(c2): SmHMGB1-FL without phosphate; FL(c3): SmHMGB1-FL without CK2 buffer. Linear: linear DNA; Lm: linear multimers. (D) Top panel: autoradiography; bottom panel: Coomassie staining. These experiments were repeated four times.

    Journal: PLoS ONE

    Article Title: CK2 Phosphorylation of Schistosoma mansoni HMGB1 Protein Regulates Its Cellular Traffic and Secretion but Not Its DNA Transactions

    doi: 10.1371/journal.pone.0023572

    Figure Lengend Snippet: DNA supercoiling and bending assays by phosphorylated SmHMGB1. (A) Circular relaxed plasmid pTZ19R DNA was incubated in the presence of topoisomerase I with 1 µg of recombinant SmHMGB1-FL or SmHMGB1-S172A/S174A that were phosphorylated (lanes 3–5) or not (lanes 6–8 and 9–11), by CK2. Deproteinized DNA topoisomers were resolved on 1% agarose gels, followed by staining of the gels with ethidium bromide. Form I, supercoiled DNA; form II, relaxed circular DNA. (B) Top panel: autoradiography; bottom panel: Coomassie staining. (C) A 32 P-labeled 123-bp DNA fragment (∼1 nM) was pre-incubated with 50 ng of recombinant proteins, that were phosphorylated (lanes 7–9) or not (lanes 4–6, 10–12, 13–15 and 16–18), followed by ligation with T4 DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Controls are as follows: FL(c1): SmHMGB1-FL without CK2; FL(c2): SmHMGB1-FL without phosphate; FL(c3): SmHMGB1-FL without CK2 buffer. Linear: linear DNA; Lm: linear multimers. (D) Top panel: autoradiography; bottom panel: Coomassie staining. These experiments were repeated four times.

    Article Snippet: Briefly, a 32 P-labeled-66-bp or a 32 P-labeled-123-bp DNA fragments (1 nM) with cohesive BamHI ends were pre-incubated on ice for 20 min with appropriate amounts of recombinant proteins (50 ng), total (10 µg), nuclear (4 µg) or cytoplasmic (4 µg) adult worm extracts, in 1× T4 DNA ligase buffer (30 mM Tris–HCl, pH 7.8, 10 mM MgCl2 , 10 mM dithiothreitol, and 0.5 mM ATP; Promega) in a final volume of 20 µl.

    Techniques: Plasmid Preparation, Incubation, Recombinant, Staining, Autoradiography, Labeling, Ligation, DNA Ligation, Electrophoresis

    DNA transactions by recombinant AaHMGB1 proteins. (A) Preferential binding of AaHMGB1 protein to supercoiled DNA. An equimolar mixture of supercoiled and linearized plasmid pTZ19R (∼10 nM) was pre-incubated with increasing amounts of AaHMGB1 (0.5–1 µM) and the DNA–protein complexes were resolved on a 1% agarose gel, followed by staining of the gel with ethidium bromide. Form I, supercoiled DNA; L, Linear DNA; Form II, relaxed circular DNA; (B) DNA supercoiling by AaHMGB1 and its truncated forms. Circular relaxed plasmid pTZ19R DNA was incubated in the presence of topoisomerase I (Topo I) and AaHMGB1 recombinant proteins (7–14 µM). Deproteinized DNA topoisomers were resolved on 1% agarose gels, followed by staining of the gel with ethidium bromide. Form I, supercoiled DNA; Form II, relaxed circular DNA. (C) DNA bending by AaHMGB1 and its truncated forms. A 32 P-labeled 123-bp DNA fragment (∼1 nM) was pre-incubated with recombinant proteins (25–50 nM) followed by ligation with T4 DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Lm: linear multimers. Exo III, exonuclease III. These experiments were repeated three to five times each.

    Journal: PLoS ONE

    Article Title: The Dengue Vector Aedes aegypti Contains a Functional High Mobility Group Box 1 (HMGB1) Protein with a Unique Regulatory C-Terminus

    doi: 10.1371/journal.pone.0040192

    Figure Lengend Snippet: DNA transactions by recombinant AaHMGB1 proteins. (A) Preferential binding of AaHMGB1 protein to supercoiled DNA. An equimolar mixture of supercoiled and linearized plasmid pTZ19R (∼10 nM) was pre-incubated with increasing amounts of AaHMGB1 (0.5–1 µM) and the DNA–protein complexes were resolved on a 1% agarose gel, followed by staining of the gel with ethidium bromide. Form I, supercoiled DNA; L, Linear DNA; Form II, relaxed circular DNA; (B) DNA supercoiling by AaHMGB1 and its truncated forms. Circular relaxed plasmid pTZ19R DNA was incubated in the presence of topoisomerase I (Topo I) and AaHMGB1 recombinant proteins (7–14 µM). Deproteinized DNA topoisomers were resolved on 1% agarose gels, followed by staining of the gel with ethidium bromide. Form I, supercoiled DNA; Form II, relaxed circular DNA. (C) DNA bending by AaHMGB1 and its truncated forms. A 32 P-labeled 123-bp DNA fragment (∼1 nM) was pre-incubated with recombinant proteins (25–50 nM) followed by ligation with T4 DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Lm: linear multimers. Exo III, exonuclease III. These experiments were repeated three to five times each.

    Article Snippet: Briefly, a 32 P-labeled 123-bp DNA fragment (∼1 nM) with cohesive BamHI ends were pre-incubated on ice for 20 min with appropriate amounts of recombinant proteins (25–50 nM) or total protein extracts from adult mosquitos (4 µg) in 1× T4 DNA ligase buffer (30 mM Tris–HCl, pH 7.8, 10 mM MgCl2 , 10 mM dithiothreitol, and 0.5 mM ATP; Promega) in a final volume of 20 µL.

    Techniques: Recombinant, Binding Assay, Plasmid Preparation, Incubation, Agarose Gel Electrophoresis, Staining, Labeling, Ligation, DNA Ligation, Electrophoresis, Autoradiography

    DNA bending assays by posphorylated AaHMGB1. A 32 P-labelled 123-bp DNA fragment (∼1 nM) was pre-incubated with 50 ng of AaHMGB1 that were phosphorylated by PKA (panels A and B, lanes 5 and 2, respectively) or not (panels A and B, lanes 4 and 3, respectively), or by PKC (panels C and D, lanes 5 and 2, respectively) or not (panels C and D, lanes 4 and 3, respectively), followed by ligation with T4 DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Lm: linear multimers. These experiments were repeated five times.

    Journal: PLoS ONE

    Article Title: The Dengue Vector Aedes aegypti Contains a Functional High Mobility Group Box 1 (HMGB1) Protein with a Unique Regulatory C-Terminus

    doi: 10.1371/journal.pone.0040192

    Figure Lengend Snippet: DNA bending assays by posphorylated AaHMGB1. A 32 P-labelled 123-bp DNA fragment (∼1 nM) was pre-incubated with 50 ng of AaHMGB1 that were phosphorylated by PKA (panels A and B, lanes 5 and 2, respectively) or not (panels A and B, lanes 4 and 3, respectively), or by PKC (panels C and D, lanes 5 and 2, respectively) or not (panels C and D, lanes 4 and 3, respectively), followed by ligation with T4 DNA ligase. Exonuclease III was used to verify the identity of DNA circles. The deproteinized DNA ligation products were subjected to electrophoresis on 6% non-denaturing polyacrylamide gels and visualized by autoradiography. Lm: linear multimers. These experiments were repeated five times.

    Article Snippet: Briefly, a 32 P-labeled 123-bp DNA fragment (∼1 nM) with cohesive BamHI ends were pre-incubated on ice for 20 min with appropriate amounts of recombinant proteins (25–50 nM) or total protein extracts from adult mosquitos (4 µg) in 1× T4 DNA ligase buffer (30 mM Tris–HCl, pH 7.8, 10 mM MgCl2 , 10 mM dithiothreitol, and 0.5 mM ATP; Promega) in a final volume of 20 µL.

    Techniques: Incubation, Ligation, DNA Ligation, Electrophoresis, Autoradiography