t4 ligase buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    T4 DNA Ligase Reaction Buffer
    Description:

    Catalog Number:
    B0202S
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs t4 ligase buffer
    Strategy for constructing nicked heteroduplexes. A mismatch-containing oligonucleotide duplex (Fig. 1) is ligated into a template plasmid molecule (1). Linearization of the plasmid (2) in the presence of the heteroduplex oligo, <t>T4</t> ligase and restriction enzyme ( Bam HI) allows ligation of the small fragments onto each DNA end as a dead-end complex (3), because the Bam HI site is eliminated. Re-ligation of Bam HI-generated plasmid ends yields a molecule competent for a second digestion, returning them to the substrate pool. In the next step, digestion with Eco RI removes one ligation product and generates a ligation-competent DNA end (4). After removal of the smaller fragment, an intramolecular ligation reaction generates the nicked circular product (5). Unwanted linear molecules are removed by digestion with Exonuclease V (Materials and Methods).

    https://www.bioz.com/result/t4 ligase buffer/product/New England Biolabs
    Average 99 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    t4 ligase buffer - by Bioz Stars, 2019-12
    99/100 stars

    Images

    1) Product Images from "Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro"

    Article Title: Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro

    Journal:

    doi:

    Strategy for constructing nicked heteroduplexes. A mismatch-containing oligonucleotide duplex (Fig. 1) is ligated into a template plasmid molecule (1). Linearization of the plasmid (2) in the presence of the heteroduplex oligo, T4 ligase and restriction enzyme ( Bam HI) allows ligation of the small fragments onto each DNA end as a dead-end complex (3), because the Bam HI site is eliminated. Re-ligation of Bam HI-generated plasmid ends yields a molecule competent for a second digestion, returning them to the substrate pool. In the next step, digestion with Eco RI removes one ligation product and generates a ligation-competent DNA end (4). After removal of the smaller fragment, an intramolecular ligation reaction generates the nicked circular product (5). Unwanted linear molecules are removed by digestion with Exonuclease V (Materials and Methods).
    Figure Legend Snippet: Strategy for constructing nicked heteroduplexes. A mismatch-containing oligonucleotide duplex (Fig. 1) is ligated into a template plasmid molecule (1). Linearization of the plasmid (2) in the presence of the heteroduplex oligo, T4 ligase and restriction enzyme ( Bam HI) allows ligation of the small fragments onto each DNA end as a dead-end complex (3), because the Bam HI site is eliminated. Re-ligation of Bam HI-generated plasmid ends yields a molecule competent for a second digestion, returning them to the substrate pool. In the next step, digestion with Eco RI removes one ligation product and generates a ligation-competent DNA end (4). After removal of the smaller fragment, an intramolecular ligation reaction generates the nicked circular product (5). Unwanted linear molecules are removed by digestion with Exonuclease V (Materials and Methods).

    Techniques Used: Plasmid Preparation, Ligation, Generated

    2) Product Images from "Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro"

    Article Title: Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro

    Journal:

    doi:

    Strategy for constructing nicked heteroduplexes. A mismatch-containing oligonucleotide duplex (Fig. 1) is ligated into a template plasmid molecule (1). Linearization of the plasmid (2) in the presence of the heteroduplex oligo, T4 ligase and restriction enzyme ( Bam HI) allows ligation of the small fragments onto each DNA end as a dead-end complex (3), because the Bam HI site is eliminated. Re-ligation of Bam HI-generated plasmid ends yields a molecule competent for a second digestion, returning them to the substrate pool. In the next step, digestion with Eco RI removes one ligation product and generates a ligation-competent DNA end (4). After removal of the smaller fragment, an intramolecular ligation reaction generates the nicked circular product (5). Unwanted linear molecules are removed by digestion with Exonuclease V (Materials and Methods).
    Figure Legend Snippet: Strategy for constructing nicked heteroduplexes. A mismatch-containing oligonucleotide duplex (Fig. 1) is ligated into a template plasmid molecule (1). Linearization of the plasmid (2) in the presence of the heteroduplex oligo, T4 ligase and restriction enzyme ( Bam HI) allows ligation of the small fragments onto each DNA end as a dead-end complex (3), because the Bam HI site is eliminated. Re-ligation of Bam HI-generated plasmid ends yields a molecule competent for a second digestion, returning them to the substrate pool. In the next step, digestion with Eco RI removes one ligation product and generates a ligation-competent DNA end (4). After removal of the smaller fragment, an intramolecular ligation reaction generates the nicked circular product (5). Unwanted linear molecules are removed by digestion with Exonuclease V (Materials and Methods).

    Techniques Used: Plasmid Preparation, Ligation, Generated

    Related Articles

    Clone Assay:

    Article Title: Genetic screen in myeloid cells identifies TNF-α autocrine secretion as a factor increasing MDSC suppressive activity via Nos2 up-regulation
    Article Snippet: Paragraph title: Cloning strategy ... For the ligation we incubated 1 µl phosphorylated oligos (0.5 µM) with 50 ng BbsI-linearized plasmid, 1 µl 10 × T4 DNA ligase (New England Biolabs, B0202S), 0.5 µl T4 DNA ligase (New England Biolabs, M0202L) and 7 µl water for 1 h at room temperature and 10 min at 65 °C.

    Article Title: New Generation of Artificial MicroRNA and Synthetic Trans-Acting Small Interfering RNA Vectors for Efficient Gene Silencing in Arabidopsis
    Article Snippet: Paragraph title: and Oligonucleotide Design and Cloning ... A 10-μL digestion-ligation reaction was incubated for 5 min at 37°C, and included 1 μL of the annealed and diluted oligonucleotides (0.3 μ m ), 50 ng of the corresponding B/c vector, 1 μL of 10× T4 DNA ligase buffer (New England Biolabs), 1 μL of T4 DNA ligase (400 units μL−1 ; New England Biolabs), and 1 μL of Bsa I (10 units μL−1 ; New England Biolabs).

    Article Title: Mouse Genome Editing using CRISPR/Cas System
    Article Snippet: 3b Heat the oligonucleotides 95°C 5 min, let cool down 10 min at RT. .. 4b Set up golden gate cloning reaction: 200ng circular MLM3636 plasmid 2µl of the annealed oligonucleotide mix 2µl 10× T4 DNA ligase buffer (NEB) 1µl 20mM DTT 1µl T4 DNA ligase (NEB) 1µl Esp3I (Thermo Scientific) H20 up to 20µl 5b Incubate in a thermocycler with the following cycling program: 37°C for 5 min; 16°C for 10 min (5 times) 6b Transform 1–2 µl of the final product by electroporation into TOP 10 electrocompetent cells and plate transformant on LB-Agar plates supplemented with 50µg/ml Ampicillin. .. Because of its short size, sgRNA can also be synthesized directly from a double stranded DNA template obtained by annealing two oligonucleotides that contain T7 promoter sequence on 5’ end of sgRNA target sequence and therefore cloning sgRNA sequences into a plasmid vector is not absolutely necessary.

    Centrifugation:

    Article Title: Zinc Finger Transcription Factors Displaced SREBP Proteins as the Major Sterol Regulators during Saccharomycotina Evolution
    Article Snippet: Adapters were ligated by mixing 25 µl of 2× Quick DNA Ligase Buffer (NEB), 1 µl (15 µM) of the specific adaptor mix, and 3 µl Quick T4 DNA Ligase with library samples. .. Adapters were ligated by mixing 25 µl of 2× Quick DNA Ligase Buffer (NEB), 1 µl (15 µM) of the specific adaptor mix, and 3 µl Quick T4 DNA Ligase with library samples.

    Amplification:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

    Article Title: Large-scale methylation domains mark a functional subset of neuronally expressed genes
    Article Snippet: To create the sequencing libraries, 5 μg of DNA was end-repaired using 1× T4 DNA ligase buffer, 400 μM dNTPs, 15 U T4 DNA polymerase (NEB), and 50 U PNK (NEB) for 30 min at 20°C. .. After a final PCR purification, 500 ng of library was bisulfite converted using Zymo's EZ DNA Methylation-Direct kit according to the manufacturer's instructions.

    Article Title: Genetic Mapping and Biochemical Basis of Yellow Feather Pigmentation in Budgerigars
    Article Snippet: An 11-fold molar excess of BglII sequencing adaptor (2 pmol), relative to the estimated amount of BglII 5′ overhangs per 200 ng digested budgerigar DNA (assuming a genome molecular weight of 6.78 × 1011 g/mol and 3.33 × 105 BglII sites per genome) and an 11-fold excess of DdeI sequencing adaptor (30 pmol) were added to the samples, and ligated by 400 U T4 DNA ligase in 40 ul 1x NEB T4 DNA ligase buffer for 2 hr at room temperature. .. The ligation reaction was stopped by a 10 min incubation at 65°C, followed by cleanup by SPRI (sample:beads ratio of 1:1.8).

    Article Title: Whole Genome Amplification of Plasma-Circulating DNA Enables Expanded Screening for Allelic Imbalance in Plasma
    Article Snippet: Briefly, 2 to 4.5 μl of plasma DNA (∼2 to 5 ng total)) was blunted with 0.3 U of T4 DNA polymerase (New England Biolabs, Beverly, MA) at 12°C for 15 minutes in 5 μl of 1× T4 DNA ligase buffer (New England Biolabs), supplemented with dNTP (Applied Biosystems, Foster City, CA) at a final concentration 100 μmol/L. .. Briefly, 2 to 4.5 μl of plasma DNA (∼2 to 5 ng total)) was blunted with 0.3 U of T4 DNA polymerase (New England Biolabs, Beverly, MA) at 12°C for 15 minutes in 5 μl of 1× T4 DNA ligase buffer (New England Biolabs), supplemented with dNTP (Applied Biosystems, Foster City, CA) at a final concentration 100 μmol/L.

    Article Title: A versatile assay for detection of aberrant DNA methylation in bladder cancer
    Article Snippet: Paragraph title: 2.3. MIRA enrichment and PCR amplification ... T4 DNA polymerase, 10x NEB 2 buffer, T4 DNA ligase and 10x T4 DNA ligase buffer (New England Biolabs, Ipswich, MA).

    Article Title: The presence of multiple introns is essential for ERECTA expression in Arabidopsis
    Article Snippet: One microgram of total RNA was heat denatured for 7 min at 65°C in the presence of 20 ng of the phosphorylated oligo-dT primer (NEB), and then the ligation reaction was performed for 30 min at 42°C using the following conditions: 1× Reverse Transcriptase Reaction Buffer (NEB), 1 mM DDT, 2 mM dNTPs, 0.1 mM ATP, and 10 U T4 DNA ligase (NEB). .. The first-strand cDNA was synthesized for 1 h at 42°C with 10 U of MuLV-RT (NEB).

    Whole Genome Amplification:

    Article Title: Whole Genome Amplification of Plasma-Circulating DNA Enables Expanded Screening for Allelic Imbalance in Plasma
    Article Snippet: Paragraph title: Blunt End Ligation-Mediated Whole Genome Amplification (BL-WGA) ... Briefly, 2 to 4.5 μl of plasma DNA (∼2 to 5 ng total)) was blunted with 0.3 U of T4 DNA polymerase (New England Biolabs, Beverly, MA) at 12°C for 15 minutes in 5 μl of 1× T4 DNA ligase buffer (New England Biolabs), supplemented with dNTP (Applied Biosystems, Foster City, CA) at a final concentration 100 μmol/L.

    Synthesized:

    Article Title: The presence of multiple introns is essential for ERECTA expression in Arabidopsis
    Article Snippet: One microgram of total RNA was heat denatured for 7 min at 65°C in the presence of 20 ng of the phosphorylated oligo-dT primer (NEB), and then the ligation reaction was performed for 30 min at 42°C using the following conditions: 1× Reverse Transcriptase Reaction Buffer (NEB), 1 mM DDT, 2 mM dNTPs, 0.1 mM ATP, and 10 U T4 DNA ligase (NEB). .. The ligation was continued for 2 h at 12°C in the presence of 200 ng of the oligo-dT anchor primer (Invitorgen).

    Lambda DNA Preparation:

    Article Title: Sequence-specific fluorescent labeling of double-stranded DNA observed at the single molecule level
    Article Snippet: For some experiments, the DNA fragments had to be ligated to the linear or stem–loop TFOs before any contact with lambda DNA. .. For this purpose, 100 nM of the fragment was mixed with 200 nM of the stem–loop TFO or with 200 nM of the linear TFO and 400 nM of the 8mer adapter in 50 µl of T4 DNA ligase buffer (NEB), heated to 65°C and slowly cooled to room temperature.

    SYBR Green Assay:

    Article Title: A versatile assay for detection of aberrant DNA methylation in bladder cancer
    Article Snippet: T4 DNA polymerase, 10x NEB 2 buffer, T4 DNA ligase and 10x T4 DNA ligase buffer (New England Biolabs, Ipswich, MA). .. Taq DNA polymerase, 10x PCR buffer, 5x Q solution (Qiagen, Valencia, CA).

    Incubation:

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S). .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB.

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: For sequencing library preparation, the beads were resuspended in 32 μl ddH2 O, transferred to a fresh tube and prepared essentially according to the NEBNext® ChIP-Seq Library Prep Reagent Set for Illumina® protocol. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. Blunted, A-tailed, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer, once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, and resuspended in 20 μl ddH2 0.

    Article Title: Genetic screen in myeloid cells identifies TNF-α autocrine secretion as a factor increasing MDSC suppressive activity via Nos2 up-regulation
    Article Snippet: The sample was run on an agarose gel, eluted from the gel and DNA concentration determined. .. For the ligation we incubated 1 µl phosphorylated oligos (0.5 µM) with 50 ng BbsI-linearized plasmid, 1 µl 10 × T4 DNA ligase (New England Biolabs, B0202S), 0.5 µl T4 DNA ligase (New England Biolabs, M0202L) and 7 µl water for 1 h at room temperature and 10 min at 65 °C. .. The ligation mix was then used for transformation of Stbl3 cells (Thermo Fisher Scientific GmbH, C737303).

    Article Title: New Generation of Artificial MicroRNA and Synthetic Trans-Acting Small Interfering RNA Vectors for Efficient Gene Silencing in Arabidopsis
    Article Snippet: The annealed oligonucleotides were diluted in deionized water to a final concentration of 0.3 μ m . .. A 10-μL digestion-ligation reaction was incubated for 5 min at 37°C, and included 1 μL of the annealed and diluted oligonucleotides (0.3 μ m ), 50 ng of the corresponding B/c vector, 1 μL of 10× T4 DNA ligase buffer (New England Biolabs), 1 μL of T4 DNA ligase (400 units μL−1 ; New England Biolabs), and 1 μL of Bsa I (10 units μL−1 ; New England Biolabs). .. Alternatively, Bsa I digestion of the B/c vector and subsequent ligation of the oligonucleotide insert can be done in separate reactions.

    Article Title: IS-seq: a novel high throughput survey of in vivo IS6110 transposition in multiple Mycobacterium tuberculosis genomes
    Article Snippet: To remove unused dNTPs, 11U of SAP (Promega) were added to each sample and incubated 30 min at 37°C followed by 30 min at 80°C to inactivate the phosphatase. .. Addition of a 3’ terminus adenine to the fragments was done in 30 μl using 21 μl of the previous reaction, 0.1 mM dATP, 10 U of Klenow exo minus (Epicentre) and 3 μl of 1x T4 DNA Ligase buffer; the reaction was incubated for 30 min at 37°C and then 20 min at 75°C. .. Adapters were annealed by combining 25 picomoles of the forward and reverse adapters (Adapter F: P –B’AGATCGGAAGAGCGGTTCAGCAGGAATGCCGAG and Adapter R: ACACTCTTTCCCTACACGACGCTCTTCCGATCTBT [Illumina; Oligonucleotide sequences © 2007–2009 Illumina, Inc. All rights reserved], where B indicates the barcode position (Additional file Table S ) and B’ the reverse complement, P designates a phosphate) in 2.5X T4 DNA ligase buffer in a final volume of 20 μl.

    Article Title: Gut DNA viromes of Malawian twins discordant for severe acute malnutrition
    Article Snippet: For end repair and A-tailing, 20 µL of sonicated DNA was added to 5 µL of a mixture containing 2.5 µL of 10× T4 DNA ligase buffer (NEB), 1 µL of 1 mM dNTPs (NEB), and 0.5 µL of each of the following enzymes: T4 polymerase (3 U/µL; NEB), T4 polynucleotide kinase (10 U/µL; NEB), and Taq polymerase (5 U/µL; Life Technologies). .. For end repair and A-tailing, 20 µL of sonicated DNA was added to 5 µL of a mixture containing 2.5 µL of 10× T4 DNA ligase buffer (NEB), 1 µL of 1 mM dNTPs (NEB), and 0.5 µL of each of the following enzymes: T4 polymerase (3 U/µL; NEB), T4 polynucleotide kinase (10 U/µL; NEB), and Taq polymerase (5 U/µL; Life Technologies).

    Article Title: Transposase mediated construction of RNA-seq libraries
    Article Snippet: The 11 μL of purified DNA was mixed with 4 μL of Replacement Oligo (Epicentre, beta test material) and 4 μl of Fill-in Reaction Buffer (Epicentre, beta test material) and incubated at 45°C for 1 min, then 37°C for 30 min. A 1-μL aliquot of Gap Filling Enzyme (Epicentre, beta test material) was added and incubated at 37°C for an additional 30 min. .. To digest the second strand of cDNA, the 26-μL purified DNA was added to 3 μL of T4 DNA Ligase buffer (NEB) and 1 μL of USER enzyme mix (1 U/μL, NEB).

    Article Title: IS-seq: a novel high throughput survey of in vivo IS6110 transposition in multiple Mycobacterium tuberculosis genomes
    Article Snippet: End repair of the DNA was done in a final volume of 20 μl using 10 μl of sonicated DNA, 0.05 mM dNTPs, 1x T4 DNA ligase buffer (NEB), 5 U of Klenow DNA Polymerase (NEB) and 10 U of T4 PNK (NEB). .. To remove unused dNTPs, 11U of SAP (Promega) were added to each sample and incubated 30 min at 37°C followed by 30 min at 80°C to inactivate the phosphatase.

    Article Title: Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro
    Article Snippet: The choice of 15 µg was dictated by the amount of plasmid DNA that could be retained reliably by one High Pure DNA binding membrane, which retains plasmid DNA but poorly binds fragments < 100 bp in length. .. The reaction was incubated for 10 min at 37°C in T4 ligase buffer (New England Biolabs) containing 100 µg/ml bovine serum albumin, 75 mM KCl and the heteroduplex oligo recovered after Dpn II digestion (estimated to be a ∼100-fold molar excess over the plasmid ends). .. The reaction was then cooled on ice, whereupon 100 cohesive end ligation units of T4 ligase per microgram of plasmid (1500 U in this example) were added and the reaction incubated at 16°C overnight.

    Expressing:

    Article Title: Mouse Genome Editing using CRISPR/Cas System
    Article Snippet: A diagram illustrating the Golden Gate Cloning to build sgRNA expression vectors is shown in . .. 4b Set up golden gate cloning reaction: 200ng circular MLM3636 plasmid 2µl of the annealed oligonucleotide mix 2µl 10× T4 DNA ligase buffer (NEB) 1µl 20mM DTT 1µl T4 DNA ligase (NEB) 1µl Esp3I (Thermo Scientific) H20 up to 20µl 5b Incubate in a thermocycler with the following cycling program: 37°C for 5 min; 16°C for 10 min (5 times) 6b Transform 1–2 µl of the final product by electroporation into TOP 10 electrocompetent cells and plate transformant on LB-Agar plates supplemented with 50µg/ml Ampicillin.

    Modification:

    Article Title: Genetic Mapping and Biochemical Basis of Yellow Feather Pigmentation in Budgerigars
    Article Snippet: Paragraph title: Modified ddRAD sequencing ... An 11-fold molar excess of BglII sequencing adaptor (2 pmol), relative to the estimated amount of BglII 5′ overhangs per 200 ng digested budgerigar DNA (assuming a genome molecular weight of 6.78 × 1011 g/mol and 3.33 × 105 BglII sites per genome) and an 11-fold excess of DdeI sequencing adaptor (30 pmol) were added to the samples, and ligated by 400 U T4 DNA ligase in 40 ul 1x NEB T4 DNA ligase buffer for 2 hr at room temperature.

    Transformation Assay:

    Article Title: Genetic screen in myeloid cells identifies TNF-α autocrine secretion as a factor increasing MDSC suppressive activity via Nos2 up-regulation
    Article Snippet: For the ligation we incubated 1 µl phosphorylated oligos (0.5 µM) with 50 ng BbsI-linearized plasmid, 1 µl 10 × T4 DNA ligase (New England Biolabs, B0202S), 0.5 µl T4 DNA ligase (New England Biolabs, M0202L) and 7 µl water for 1 h at room temperature and 10 min at 65 °C. .. The ligation mix was then used for transformation of Stbl3 cells (Thermo Fisher Scientific GmbH, C737303).

    Electroporation:

    Article Title: Mouse Genome Editing using CRISPR/Cas System
    Article Snippet: 3b Heat the oligonucleotides 95°C 5 min, let cool down 10 min at RT. .. 4b Set up golden gate cloning reaction: 200ng circular MLM3636 plasmid 2µl of the annealed oligonucleotide mix 2µl 10× T4 DNA ligase buffer (NEB) 1µl 20mM DTT 1µl T4 DNA ligase (NEB) 1µl Esp3I (Thermo Scientific) H20 up to 20µl 5b Incubate in a thermocycler with the following cycling program: 37°C for 5 min; 16°C for 10 min (5 times) 6b Transform 1–2 µl of the final product by electroporation into TOP 10 electrocompetent cells and plate transformant on LB-Agar plates supplemented with 50µg/ml Ampicillin. .. Because of its short size, sgRNA can also be synthesized directly from a double stranded DNA template obtained by annealing two oligonucleotides that contain T7 promoter sequence on 5’ end of sgRNA target sequence and therefore cloning sgRNA sequences into a plasmid vector is not absolutely necessary.

    Sequencing:

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Libraries for paired-end Illumina HiSeq 2000 sequencing were prepared as follows. .. Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S). .. Each of the two adapters for a given barcode were present at 40 μM; annealing conditions were 94°C for 5 min, then 70°C, 60°C, 50°C, 40°C, 30°C, and 25°C, each for 1 min. A total of 3–5 μg of genomic DNA were sheared to ∼500 bp in a COVARIS sonicator; 1.5–2 μg of the sheared DNA was end repaired in a 50-μL reaction (1× T4 DNA ligase buffer, 0.8 μM dNTPs [NEB #N0447S], using 2.5 μL of T4 DNA polymerase [NEB #M0203L], 0.5 μL Klenow [large fragment] [NEB #M0210L], and 2.5 μL of T4 PNK [NEB #M0201L], with incubation at 20°C for 30 min. End-repaired DNA was purified using a Qiaquick PCR purification column, eluting in 33 μL of buffer EB.

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: Paragraph title: Preparation of sequencing libraries ... Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

    Article Title: Genetic screen in myeloid cells identifies TNF-α autocrine secretion as a factor increasing MDSC suppressive activity via Nos2 up-regulation
    Article Snippet: For the ligation we incubated 1 µl phosphorylated oligos (0.5 µM) with 50 ng BbsI-linearized plasmid, 1 µl 10 × T4 DNA ligase (New England Biolabs, B0202S), 0.5 µl T4 DNA ligase (New England Biolabs, M0202L) and 7 µl water for 1 h at room temperature and 10 min at 65 °C. .. The ligation mix was then used for transformation of Stbl3 cells (Thermo Fisher Scientific GmbH, C737303).

    Article Title: Transposase mediated construction of RNA-seq libraries
    Article Snippet: To add sequencing adapters to the double-stranded cDNA, 15 μL of cDNA product, 4 μL of TA buffer (33 mM Tris-acetate at pH 7.5, 66 mM potassium acetate, 10 mM magnesium acetate, and 0.5 mM DTT), and 1 μL of directional Tn–RNA-seq Enzyme mix (Epicentre, beta test material) were mixed together on ice. .. To digest the second strand of cDNA, the 26-μL purified DNA was added to 3 μL of T4 DNA Ligase buffer (NEB) and 1 μL of USER enzyme mix (1 U/μL, NEB).

    Article Title: Large-scale methylation domains mark a functional subset of neuronally expressed genes
    Article Snippet: DNA from the SH-SY5Y cells and frozen human cerebral cortex was purified using Qiagen's Puregene kit and fragmented to ∼300 bp using Diagenode's Bioruptor. .. To create the sequencing libraries, 5 μg of DNA was end-repaired using 1× T4 DNA ligase buffer, 400 μM dNTPs, 15 U T4 DNA polymerase (NEB), and 50 U PNK (NEB) for 30 min at 20°C. .. After PCR purifying (Qiagen), adenine bases were appended to the ends using 1× NEB 2 buffer, 200 μM dATP, and 15 U Klenow Fragment (3′ to 5′ exo-, NEB) for 30 min at 37°C.

    Article Title: Genetic Mapping and Biochemical Basis of Yellow Feather Pigmentation in Budgerigars
    Article Snippet: The digested DNA was cleaned up by SPRI with Agencourt AMPure XP beads (sample:beads ratio of 1:1.8). .. An 11-fold molar excess of BglII sequencing adaptor (2 pmol), relative to the estimated amount of BglII 5′ overhangs per 200 ng digested budgerigar DNA (assuming a genome molecular weight of 6.78 × 1011 g/mol and 3.33 × 105 BglII sites per genome) and an 11-fold excess of DdeI sequencing adaptor (30 pmol) were added to the samples, and ligated by 400 U T4 DNA ligase in 40 ul 1x NEB T4 DNA ligase buffer for 2 hr at room temperature. .. The ligation reaction was stopped by a 10 min incubation at 65°C, followed by cleanup by SPRI (sample:beads ratio of 1:1.8).

    Article Title: Zinc Finger Transcription Factors Displaced SREBP Proteins as the Major Sterol Regulators during Saccharomycotina Evolution
    Article Snippet: Adapters were ligated by mixing 25 µl of 2× Quick DNA Ligase Buffer (NEB), 1 µl (15 µM) of the specific adaptor mix, and 3 µl Quick T4 DNA Ligase with library samples. .. Adapters were ligated by mixing 25 µl of 2× Quick DNA Ligase Buffer (NEB), 1 µl (15 µM) of the specific adaptor mix, and 3 µl Quick T4 DNA Ligase with library samples.

    Ligation:

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S). .. Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S).

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: For sequencing library preparation, the beads were resuspended in 32 μl ddH2 O, transferred to a fresh tube and prepared essentially according to the NEBNext® ChIP-Seq Library Prep Reagent Set for Illumina® protocol. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. Blunted, A-tailed, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer, once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, and resuspended in 20 μl ddH2 0.

    Article Title: Genetic screen in myeloid cells identifies TNF-α autocrine secretion as a factor increasing MDSC suppressive activity via Nos2 up-regulation
    Article Snippet: The sample was run on an agarose gel, eluted from the gel and DNA concentration determined. .. For the ligation we incubated 1 µl phosphorylated oligos (0.5 µM) with 50 ng BbsI-linearized plasmid, 1 µl 10 × T4 DNA ligase (New England Biolabs, B0202S), 0.5 µl T4 DNA ligase (New England Biolabs, M0202L) and 7 µl water for 1 h at room temperature and 10 min at 65 °C. .. The ligation mix was then used for transformation of Stbl3 cells (Thermo Fisher Scientific GmbH, C737303).

    Article Title: U1 snRNA Directly Interacts with Polypyrimidine Tract Binding Protein During Splicing Repression
    Article Snippet: This mix was then ethanol precipitated. .. Ligation was carried out at 25 °C for 3–12 hrs in a 15 μl reaction containing 1.5 μl of T4 DNA ligase (400,000 units/ml), 0.5 μl of RNAguard, and 1x T4 DNA ligase buffer (NEB). .. Ligated RNA was separated and extracted using urea-PAGE.

    Article Title: New Generation of Artificial MicroRNA and Synthetic Trans-Acting Small Interfering RNA Vectors for Efficient Gene Silencing in Arabidopsis
    Article Snippet: A 10-μL digestion-ligation reaction was incubated for 5 min at 37°C, and included 1 μL of the annealed and diluted oligonucleotides (0.3 μ m ), 50 ng of the corresponding B/c vector, 1 μL of 10× T4 DNA ligase buffer (New England Biolabs), 1 μL of T4 DNA ligase (400 units μL−1 ; New England Biolabs), and 1 μL of Bsa I (10 units μL−1 ; New England Biolabs). .. Alternatively, Bsa I digestion of the B/c vector and subsequent ligation of the oligonucleotide insert can be done in separate reactions.

    Article Title: Gut DNA viromes of Malawian twins discordant for severe acute malnutrition
    Article Snippet: For end repair and A-tailing, 20 µL of sonicated DNA was added to 5 µL of a mixture containing 2.5 µL of 10× T4 DNA ligase buffer (NEB), 1 µL of 1 mM dNTPs (NEB), and 0.5 µL of each of the following enzymes: T4 polymerase (3 U/µL; NEB), T4 polynucleotide kinase (10 U/µL; NEB), and Taq polymerase (5 U/µL; Life Technologies). .. For end repair and A-tailing, 20 µL of sonicated DNA was added to 5 µL of a mixture containing 2.5 µL of 10× T4 DNA ligase buffer (NEB), 1 µL of 1 mM dNTPs (NEB), and 0.5 µL of each of the following enzymes: T4 polymerase (3 U/µL; NEB), T4 polynucleotide kinase (10 U/µL; NEB), and Taq polymerase (5 U/µL; Life Technologies).

    Article Title: Protein Engineering of the 4-Methyl-5-Nitrocatechol Monooxygenase from Burkholderia sp. Strain DNT for Enhanced Degradation of Nitroaromatics
    Article Snippet: Ligation reactions were performed at 16°C for 20 h ( ) with a 3-to-1 molar ratio (insert-vector). .. T4 DNA ligase and 10× T4 DNA ligase buffer were from New England Biolabs, Inc. (Beverly, MA).

    Article Title: Genetic Mapping and Biochemical Basis of Yellow Feather Pigmentation in Budgerigars
    Article Snippet: An 11-fold molar excess of BglII sequencing adaptor (2 pmol), relative to the estimated amount of BglII 5′ overhangs per 200 ng digested budgerigar DNA (assuming a genome molecular weight of 6.78 × 1011 g/mol and 3.33 × 105 BglII sites per genome) and an 11-fold excess of DdeI sequencing adaptor (30 pmol) were added to the samples, and ligated by 400 U T4 DNA ligase in 40 ul 1x NEB T4 DNA ligase buffer for 2 hr at room temperature. .. The ligation reaction was stopped by a 10 min incubation at 65°C, followed by cleanup by SPRI (sample:beads ratio of 1:1.8).

    Article Title: Whole Genome Amplification of Plasma-Circulating DNA Enables Expanded Screening for Allelic Imbalance in Plasma
    Article Snippet: Paragraph title: Blunt End Ligation-Mediated Whole Genome Amplification (BL-WGA) ... Briefly, 2 to 4.5 μl of plasma DNA (∼2 to 5 ng total)) was blunted with 0.3 U of T4 DNA polymerase (New England Biolabs, Beverly, MA) at 12°C for 15 minutes in 5 μl of 1× T4 DNA ligase buffer (New England Biolabs), supplemented with dNTP (Applied Biosystems, Foster City, CA) at a final concentration 100 μmol/L.

    Article Title: Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro
    Article Snippet: The reaction was incubated for 10 min at 37°C in T4 ligase buffer (New England Biolabs) containing 100 µg/ml bovine serum albumin, 75 mM KCl and the heteroduplex oligo recovered after Dpn II digestion (estimated to be a ∼100-fold molar excess over the plasmid ends). .. The reaction was incubated for 10 min at 37°C in T4 ligase buffer (New England Biolabs) containing 100 µg/ml bovine serum albumin, 75 mM KCl and the heteroduplex oligo recovered after Dpn II digestion (estimated to be a ∼100-fold molar excess over the plasmid ends).

    Article Title: The presence of multiple introns is essential for ERECTA expression in Arabidopsis
    Article Snippet: The LM-PAT assay was performed according the method described by . .. One microgram of total RNA was heat denatured for 7 min at 65°C in the presence of 20 ng of the phosphorylated oligo-dT primer (NEB), and then the ligation reaction was performed for 30 min at 42°C using the following conditions: 1× Reverse Transcriptase Reaction Buffer (NEB), 1 mM DDT, 2 mM dNTPs, 0.1 mM ATP, and 10 U T4 DNA ligase (NEB). .. The ligation was continued for 2 h at 12°C in the presence of 200 ng of the oligo-dT anchor primer (Invitorgen).

    Magnetic Beads:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: 20 μl Magna ChIP™ Protein A Magnetic Beads (Millipore, cat. # 16-661) were added and incubated for 1.5 h at 4 °C rotating. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

    Generated:

    Article Title: Zinc Finger Transcription Factors Displaced SREBP Proteins as the Major Sterol Regulators during Saccharomycotina Evolution
    Article Snippet: 18 strand-specific libraries ( ) were generated by incorporation of dUTP as described in Guida et al , except that several samples were combined in one lane by multiplexing. .. Adapters were ligated by mixing 25 µl of 2× Quick DNA Ligase Buffer (NEB), 1 µl (15 µM) of the specific adaptor mix, and 3 µl Quick T4 DNA Ligase with library samples.

    other:

    Article Title: Nucleotide-resolution DNA double-strand breaks mapping by next-generation sequencing
    Article Snippet: Afterwards, we washed nuclei twice in 1× NEBuffer 2 supplemented with 0.1% Triton X-100, once in 1× T4 ligase buffer supplemented with 0.1% Triton X-100, and once in 1× T4 ligase buffer.

    Polymerase Chain Reaction:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

    Article Title: Gut DNA viromes of Malawian twins discordant for severe acute malnutrition
    Article Snippet: For each library, 100 µL of total DNA in Tris-EDTA (TE) buffer (pH 7.0; 5 ng/µL) was fragmented by sonication in thin-walled 0.2-mL eight-strip PCR tubes using a BioruptorXL multisample sonicator (Diagenode) set on “high”; sonication occurred over the course of 8 min using successive cycles of 30 s “on” followed by 30 s “off.” Sonicated samples were subsequently cleaned using the MinElute 96 UF PCR Purification Kit (Qiagen) according to the manufacturer’s instructions. .. For end repair and A-tailing, 20 µL of sonicated DNA was added to 5 µL of a mixture containing 2.5 µL of 10× T4 DNA ligase buffer (NEB), 1 µL of 1 mM dNTPs (NEB), and 0.5 µL of each of the following enzymes: T4 polymerase (3 U/µL; NEB), T4 polynucleotide kinase (10 U/µL; NEB), and Taq polymerase (5 U/µL; Life Technologies).

    Article Title: Transposase mediated construction of RNA-seq libraries
    Article Snippet: To digest the second strand of cDNA, the 26-μL purified DNA was added to 3 μL of T4 DNA Ligase buffer (NEB) and 1 μL of USER enzyme mix (1 U/μL, NEB). .. The reaction was incubated at 37°C for 30 min and the cDNA was purified with 54 μL of AMPure beads according to the manufacturer's instructions and eluted in 25 μL of EB.

    Article Title: Large-scale methylation domains mark a functional subset of neuronally expressed genes
    Article Snippet: To create the sequencing libraries, 5 μg of DNA was end-repaired using 1× T4 DNA ligase buffer, 400 μM dNTPs, 15 U T4 DNA polymerase (NEB), and 50 U PNK (NEB) for 30 min at 20°C. .. After PCR purifying (Qiagen), adenine bases were appended to the ends using 1× NEB 2 buffer, 200 μM dATP, and 15 U Klenow Fragment (3′ to 5′ exo-, NEB) for 30 min at 37°C.

    Article Title: Genetic Mapping and Biochemical Basis of Yellow Feather Pigmentation in Budgerigars
    Article Snippet: An 11-fold molar excess of BglII sequencing adaptor (2 pmol), relative to the estimated amount of BglII 5′ overhangs per 200 ng digested budgerigar DNA (assuming a genome molecular weight of 6.78 × 1011 g/mol and 3.33 × 105 BglII sites per genome) and an 11-fold excess of DdeI sequencing adaptor (30 pmol) were added to the samples, and ligated by 400 U T4 DNA ligase in 40 ul 1x NEB T4 DNA ligase buffer for 2 hr at room temperature. .. The ligation reaction was stopped by a 10 min incubation at 65°C, followed by cleanup by SPRI (sample:beads ratio of 1:1.8).

    Article Title: Sequence-specific fluorescent labeling of double-stranded DNA observed at the single molecule level
    Article Snippet: Unlabeled fragments were prepared in the same way except that the PCR was carried out using 200 µM of each unmodified dNTP and the elongation step was maintained at 1 min at 72°C for all the cycles. .. For this purpose, 100 nM of the fragment was mixed with 200 nM of the stem–loop TFO or with 200 nM of the linear TFO and 400 nM of the 8mer adapter in 50 µl of T4 DNA ligase buffer (NEB), heated to 65°C and slowly cooled to room temperature.

    Article Title: A versatile assay for detection of aberrant DNA methylation in bladder cancer
    Article Snippet: Paragraph title: 2.3. MIRA enrichment and PCR amplification ... T4 DNA polymerase, 10x NEB 2 buffer, T4 DNA ligase and 10x T4 DNA ligase buffer (New England Biolabs, Ipswich, MA).

    Sonication:

    Article Title: Gut DNA viromes of Malawian twins discordant for severe acute malnutrition
    Article Snippet: Each sonicated DNA sample in each well of the 96-well plate was eluted with 22 µL of nuclease-free sterile water. .. For end repair and A-tailing, 20 µL of sonicated DNA was added to 5 µL of a mixture containing 2.5 µL of 10× T4 DNA ligase buffer (NEB), 1 µL of 1 mM dNTPs (NEB), and 0.5 µL of each of the following enzymes: T4 polymerase (3 U/µL; NEB), T4 polynucleotide kinase (10 U/µL; NEB), and Taq polymerase (5 U/µL; Life Technologies). .. A total of 24 independent adapters were synthesized containing 24 different multiplex identifier (MID) barcodes.

    Article Title: A versatile assay for detection of aberrant DNA methylation in bladder cancer
    Article Snippet: Purified GST-tagged MBD2b and His-tagged MBD3L1 proteins (~1 μg each) Sonicated DNA from JM110 bacterial strain ( see ). .. T4 DNA polymerase, 10x NEB 2 buffer, T4 DNA ligase and 10x T4 DNA ligase buffer (New England Biolabs, Ipswich, MA).

    Article Title: IS-seq: a novel high throughput survey of in vivo IS6110 transposition in multiple Mycobacterium tuberculosis genomes
    Article Snippet: Four hundred nanograms of each DNA were diluted in 10 μl of sterile water and sonicated at maximum power for 1 min (XL 2020 Sonicator, Misonix) to yield fragments with an average size between 200–400 bp. .. End repair of the DNA was done in a final volume of 20 μl using 10 μl of sonicated DNA, 0.05 mM dNTPs, 1x T4 DNA ligase buffer (NEB), 5 U of Klenow DNA Polymerase (NEB) and 10 U of T4 PNK (NEB). .. To remove unused dNTPs, 11U of SAP (Promega) were added to each sample and incubated 30 min at 37°C followed by 30 min at 80°C to inactivate the phosphatase.

    Binding Assay:

    Article Title: A versatile assay for detection of aberrant DNA methylation in bladder cancer
    Article Snippet: 10x MIRA binding buffer; 100 mM Tris-HCl, pH 7.9, 500 mM NaCl, 100 mM MgCl2 , 10 mM DL-Dithiothreitol (DTT), 1% (v/v) Triton X-100 ( see ). .. T4 DNA polymerase, 10x NEB 2 buffer, T4 DNA ligase and 10x T4 DNA ligase buffer (New England Biolabs, Ipswich, MA).

    Article Title: Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro
    Article Snippet: The choice of 15 µg was dictated by the amount of plasmid DNA that could be retained reliably by one High Pure DNA binding membrane, which retains plasmid DNA but poorly binds fragments < 100 bp in length. .. The reaction was incubated for 10 min at 37°C in T4 ligase buffer (New England Biolabs) containing 100 µg/ml bovine serum albumin, 75 mM KCl and the heteroduplex oligo recovered after Dpn II digestion (estimated to be a ∼100-fold molar excess over the plasmid ends).

    ChIP-sequencing:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: For sequencing library preparation, the beads were resuspended in 32 μl ddH2 O, transferred to a fresh tube and prepared essentially according to the NEBNext® ChIP-Seq Library Prep Reagent Set for Illumina® protocol. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

    Multiplexing:

    Article Title: Zinc Finger Transcription Factors Displaced SREBP Proteins as the Major Sterol Regulators during Saccharomycotina Evolution
    Article Snippet: Adapters were ligated by mixing 25 µl of 2× Quick DNA Ligase Buffer (NEB), 1 µl (15 µM) of the specific adaptor mix, and 3 µl Quick T4 DNA Ligase with library samples. .. Adapters were ligated by mixing 25 µl of 2× Quick DNA Ligase Buffer (NEB), 1 µl (15 µM) of the specific adaptor mix, and 3 µl Quick T4 DNA Ligase with library samples.

    RNA Sequencing Assay:

    Article Title: Zinc Finger Transcription Factors Displaced SREBP Proteins as the Major Sterol Regulators during Saccharomycotina Evolution
    Article Snippet: Paragraph title: RNA-seq analysis ... Adapters were ligated by mixing 25 µl of 2× Quick DNA Ligase Buffer (NEB), 1 µl (15 µM) of the specific adaptor mix, and 3 µl Quick T4 DNA Ligase with library samples.

    Methylation:

    Article Title: Large-scale methylation domains mark a functional subset of neuronally expressed genes
    Article Snippet: To create the sequencing libraries, 5 μg of DNA was end-repaired using 1× T4 DNA ligase buffer, 400 μM dNTPs, 15 U T4 DNA polymerase (NEB), and 50 U PNK (NEB) for 30 min at 20°C. .. To create the sequencing libraries, 5 μg of DNA was end-repaired using 1× T4 DNA ligase buffer, 400 μM dNTPs, 15 U T4 DNA polymerase (NEB), and 50 U PNK (NEB) for 30 min at 20°C.

    Isolation:

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Genomic DNA was isolated from 10–20 mL of YPD-grown cells using Qiagen Genomic-tip 100/G columns as described by the manufacturer. .. Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S).

    Article Title: Protein Engineering of the 4-Methyl-5-Nitrocatechol Monooxygenase from Burkholderia sp. Strain DNT for Enhanced Degradation of Nitroaromatics
    Article Snippet: DNA fragments were isolated from agarose gels using a QIAquick Gel Extraction Kit (QIAGEN, Inc., Valencia, CA). .. T4 DNA ligase and 10× T4 DNA ligase buffer were from New England Biolabs, Inc. (Beverly, MA).

    Subcloning:

    Article Title: Genetic screen in myeloid cells identifies TNF-α autocrine secretion as a factor increasing MDSC suppressive activity via Nos2 up-regulation
    Article Snippet: For the sub-cloning process the primer were diluted to 0.5 µM. .. For the ligation we incubated 1 µl phosphorylated oligos (0.5 µM) with 50 ng BbsI-linearized plasmid, 1 µl 10 × T4 DNA ligase (New England Biolabs, B0202S), 0.5 µl T4 DNA ligase (New England Biolabs, M0202L) and 7 µl water for 1 h at room temperature and 10 min at 65 °C.

    Labeling:

    Article Title: U1 snRNA Directly Interacts with Polypyrimidine Tract Binding Protein During Splicing Repression
    Article Snippet: Paragraph title: Site specific labeling ... Ligation was carried out at 25 °C for 3–12 hrs in a 15 μl reaction containing 1.5 μl of T4 DNA ligase (400,000 units/ml), 0.5 μl of RNAguard, and 1x T4 DNA ligase buffer (NEB).

    Article Title: Sequence-specific fluorescent labeling of double-stranded DNA observed at the single molecule level
    Article Snippet: For this purpose, 100 nM of the fragment was mixed with 200 nM of the stem–loop TFO or with 200 nM of the linear TFO and 400 nM of the 8mer adapter in 50 µl of T4 DNA ligase buffer (NEB), heated to 65°C and slowly cooled to room temperature. .. For this purpose, 100 nM of the fragment was mixed with 200 nM of the stem–loop TFO or with 200 nM of the linear TFO and 400 nM of the 8mer adapter in 50 µl of T4 DNA ligase buffer (NEB), heated to 65°C and slowly cooled to room temperature.

    Purification:

    Article Title: Analysis of the Saccharomyces cerevisiae pan-genome reveals a pool of copy number variants distributed in diverse yeast strains from differing industrial environments
    Article Snippet: Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S). .. Twelve pairs of Illumina adapters (for paired-end sequencing; purchased from Integrated DNA Technologies), with each pair containing a different 6-bp barcode, were pre-annealed in a 50-μL reaction containing 1x T4 DNA ligase buffer (NEB #B0202S).

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: For sequencing library preparation, the beads were resuspended in 32 μl ddH2 O, transferred to a fresh tube and prepared essentially according to the NEBNext® ChIP-Seq Library Prep Reagent Set for Illumina® protocol. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. Blunted, A-tailed, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer, once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, and resuspended in 20 μl ddH2 0.

    Article Title: Gut DNA viromes of Malawian twins discordant for severe acute malnutrition
    Article Snippet: For each library, 100 µL of total DNA in Tris-EDTA (TE) buffer (pH 7.0; 5 ng/µL) was fragmented by sonication in thin-walled 0.2-mL eight-strip PCR tubes using a BioruptorXL multisample sonicator (Diagenode) set on “high”; sonication occurred over the course of 8 min using successive cycles of 30 s “on” followed by 30 s “off.” Sonicated samples were subsequently cleaned using the MinElute 96 UF PCR Purification Kit (Qiagen) according to the manufacturer’s instructions. .. For end repair and A-tailing, 20 µL of sonicated DNA was added to 5 µL of a mixture containing 2.5 µL of 10× T4 DNA ligase buffer (NEB), 1 µL of 1 mM dNTPs (NEB), and 0.5 µL of each of the following enzymes: T4 polymerase (3 U/µL; NEB), T4 polynucleotide kinase (10 U/µL; NEB), and Taq polymerase (5 U/µL; Life Technologies).

    Article Title: Transposase mediated construction of RNA-seq libraries
    Article Snippet: The reaction was cleaned up with 36 μL of AMPure beads according to the manufacturer's instructions and eluted in 26 μL of EB. .. To digest the second strand of cDNA, the 26-μL purified DNA was added to 3 μL of T4 DNA Ligase buffer (NEB) and 1 μL of USER enzyme mix (1 U/μL, NEB). .. The reaction was incubated at 37°C for 30 min and the cDNA was purified with 54 μL of AMPure beads according to the manufacturer's instructions and eluted in 25 μL of EB.

    Article Title: Large-scale methylation domains mark a functional subset of neuronally expressed genes
    Article Snippet: DNA from the SH-SY5Y cells and frozen human cerebral cortex was purified using Qiagen's Puregene kit and fragmented to ∼300 bp using Diagenode's Bioruptor. .. To create the sequencing libraries, 5 μg of DNA was end-repaired using 1× T4 DNA ligase buffer, 400 μM dNTPs, 15 U T4 DNA polymerase (NEB), and 50 U PNK (NEB) for 30 min at 20°C.

    Article Title: Sequence-specific fluorescent labeling of double-stranded DNA observed at the single molecule level
    Article Snippet: For this purpose, 100 nM of the fragment was mixed with 200 nM of the stem–loop TFO or with 200 nM of the linear TFO and 400 nM of the 8mer adapter in 50 µl of T4 DNA ligase buffer (NEB), heated to 65°C and slowly cooled to room temperature. .. 400 U of T4 DNA ligase (NEB) were added and the sample was incubated overnight at 20°C.

    Article Title: A versatile assay for detection of aberrant DNA methylation in bladder cancer
    Article Snippet: Qiaquick PCR purification kit (Qiagen, Valencia, CA). .. T4 DNA polymerase, 10x NEB 2 buffer, T4 DNA ligase and 10x T4 DNA ligase buffer (New England Biolabs, Ipswich, MA).

    Article Title: Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro
    Article Snippet: The reaction was incubated for 10 min at 37°C in T4 ligase buffer (New England Biolabs) containing 100 µg/ml bovine serum albumin, 75 mM KCl and the heteroduplex oligo recovered after Dpn II digestion (estimated to be a ∼100-fold molar excess over the plasmid ends). .. The reaction was incubated for 10 min at 37°C in T4 ligase buffer (New England Biolabs) containing 100 µg/ml bovine serum albumin, 75 mM KCl and the heteroduplex oligo recovered after Dpn II digestion (estimated to be a ∼100-fold molar excess over the plasmid ends).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: The presence of multiple introns is essential for ERECTA expression in Arabidopsis
    Article Snippet: One microgram of total RNA was heat denatured for 7 min at 65°C in the presence of 20 ng of the phosphorylated oligo-dT primer (NEB), and then the ligation reaction was performed for 30 min at 42°C using the following conditions: 1× Reverse Transcriptase Reaction Buffer (NEB), 1 mM DDT, 2 mM dNTPs, 0.1 mM ATP, and 10 U T4 DNA ligase (NEB). .. The amplification reaction was done with the Rluc891 and PAT.rc primers.

    Spectroscopy:

    Article Title: Sequence-specific fluorescent labeling of double-stranded DNA observed at the single molecule level
    Article Snippet: For this purpose, 100 nM of the fragment was mixed with 200 nM of the stem–loop TFO or with 200 nM of the linear TFO and 400 nM of the 8mer adapter in 50 µl of T4 DNA ligase buffer (NEB), heated to 65°C and slowly cooled to room temperature. .. For this purpose, 100 nM of the fragment was mixed with 200 nM of the stem–loop TFO or with 200 nM of the linear TFO and 400 nM of the 8mer adapter in 50 µl of T4 DNA ligase buffer (NEB), heated to 65°C and slowly cooled to room temperature.

    Article Title: IS-seq: a novel high throughput survey of in vivo IS6110 transposition in multiple Mycobacterium tuberculosis genomes
    Article Snippet: The DNA from each sample was quantified by spectroscopy (NanoDrop®, ThermoScientific). .. End repair of the DNA was done in a final volume of 20 μl using 10 μl of sonicated DNA, 0.05 mM dNTPs, 1x T4 DNA ligase buffer (NEB), 5 U of Klenow DNA Polymerase (NEB) and 10 U of T4 PNK (NEB).

    Gel Extraction:

    Article Title: Protein Engineering of the 4-Methyl-5-Nitrocatechol Monooxygenase from Burkholderia sp. Strain DNT for Enhanced Degradation of Nitroaromatics
    Article Snippet: DNA fragments were isolated from agarose gels using a QIAquick Gel Extraction Kit (QIAGEN, Inc., Valencia, CA). .. T4 DNA ligase and 10× T4 DNA ligase buffer were from New England Biolabs, Inc. (Beverly, MA).

    Chromatin Immunoprecipitation:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: 20 μl Magna ChIP™ Protein A Magnetic Beads (Millipore, cat. # 16-661) were added and incubated for 1.5 h at 4 °C rotating. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

    Plasmid Preparation:

    Article Title: Genetic screen in myeloid cells identifies TNF-α autocrine secretion as a factor increasing MDSC suppressive activity via Nos2 up-regulation
    Article Snippet: The sample was run on an agarose gel, eluted from the gel and DNA concentration determined. .. For the ligation we incubated 1 µl phosphorylated oligos (0.5 µM) with 50 ng BbsI-linearized plasmid, 1 µl 10 × T4 DNA ligase (New England Biolabs, B0202S), 0.5 µl T4 DNA ligase (New England Biolabs, M0202L) and 7 µl water for 1 h at room temperature and 10 min at 65 °C. .. The ligation mix was then used for transformation of Stbl3 cells (Thermo Fisher Scientific GmbH, C737303).

    Article Title: New Generation of Artificial MicroRNA and Synthetic Trans-Acting Small Interfering RNA Vectors for Efficient Gene Silencing in Arabidopsis
    Article Snippet: The annealed oligonucleotides were diluted in deionized water to a final concentration of 0.3 μ m . .. A 10-μL digestion-ligation reaction was incubated for 5 min at 37°C, and included 1 μL of the annealed and diluted oligonucleotides (0.3 μ m ), 50 ng of the corresponding B/c vector, 1 μL of 10× T4 DNA ligase buffer (New England Biolabs), 1 μL of T4 DNA ligase (400 units μL−1 ; New England Biolabs), and 1 μL of Bsa I (10 units μL−1 ; New England Biolabs). .. Alternatively, Bsa I digestion of the B/c vector and subsequent ligation of the oligonucleotide insert can be done in separate reactions.

    Article Title: Mouse Genome Editing using CRISPR/Cas System
    Article Snippet: 3b Heat the oligonucleotides 95°C 5 min, let cool down 10 min at RT. .. 4b Set up golden gate cloning reaction: 200ng circular MLM3636 plasmid 2µl of the annealed oligonucleotide mix 2µl 10× T4 DNA ligase buffer (NEB) 1µl 20mM DTT 1µl T4 DNA ligase (NEB) 1µl Esp3I (Thermo Scientific) H20 up to 20µl 5b Incubate in a thermocycler with the following cycling program: 37°C for 5 min; 16°C for 10 min (5 times) 6b Transform 1–2 µl of the final product by electroporation into TOP 10 electrocompetent cells and plate transformant on LB-Agar plates supplemented with 50µg/ml Ampicillin. .. Because of its short size, sgRNA can also be synthesized directly from a double stranded DNA template obtained by annealing two oligonucleotides that contain T7 promoter sequence on 5’ end of sgRNA target sequence and therefore cloning sgRNA sequences into a plasmid vector is not absolutely necessary.

    Article Title: Protein Engineering of the 4-Methyl-5-Nitrocatechol Monooxygenase from Burkholderia sp. Strain DNT for Enhanced Degradation of Nitroaromatics
    Article Snippet: Plasmid DNA was isolated using a Midi or Mini Kit (QIAGEN, Inc., Valencia, CA) and digested by the restriction enzymes from New England Biolabs, Inc. (Beverly, MA). .. T4 DNA ligase and 10× T4 DNA ligase buffer were from New England Biolabs, Inc. (Beverly, MA).

    Article Title: Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro
    Article Snippet: The choice of 15 µg was dictated by the amount of plasmid DNA that could be retained reliably by one High Pure DNA binding membrane, which retains plasmid DNA but poorly binds fragments < 100 bp in length. .. The reaction was incubated for 10 min at 37°C in T4 ligase buffer (New England Biolabs) containing 100 µg/ml bovine serum albumin, 75 mM KCl and the heteroduplex oligo recovered after Dpn II digestion (estimated to be a ∼100-fold molar excess over the plasmid ends). .. The reaction was then cooled on ice, whereupon 100 cohesive end ligation units of T4 ligase per microgram of plasmid (1500 U in this example) were added and the reaction incubated at 16°C overnight.

    RNA Extraction:

    Article Title: Zinc Finger Transcription Factors Displaced SREBP Proteins as the Major Sterol Regulators during Saccharomycotina Evolution
    Article Snippet: Adapters were ligated by mixing 25 µl of 2× Quick DNA Ligase Buffer (NEB), 1 µl (15 µM) of the specific adaptor mix, and 3 µl Quick T4 DNA Ligase with library samples. .. Adapters were ligated by mixing 25 µl of 2× Quick DNA Ligase Buffer (NEB), 1 µl (15 µM) of the specific adaptor mix, and 3 µl Quick T4 DNA Ligase with library samples.

    Agarose Gel Electrophoresis:

    Article Title: Genetic screen in myeloid cells identifies TNF-α autocrine secretion as a factor increasing MDSC suppressive activity via Nos2 up-regulation
    Article Snippet: The sample was run on an agarose gel, eluted from the gel and DNA concentration determined. .. For the ligation we incubated 1 µl phosphorylated oligos (0.5 µM) with 50 ng BbsI-linearized plasmid, 1 µl 10 × T4 DNA ligase (New England Biolabs, B0202S), 0.5 µl T4 DNA ligase (New England Biolabs, M0202L) and 7 µl water for 1 h at room temperature and 10 min at 65 °C.

    Concentration Assay:

    Article Title: Genomic nucleosome organization reconstituted with pure proteins
    Article Snippet: Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C. .. Briefly, the purified DNA was end-repaired with Klenow (1 U, M0210L, NEB), T4 DNA polymerase (3 U, M0203L, NEB), and T4-PNK (10 U, M0210L, NEB) in 50 μl 1x ligation buffer (B0202S NEB) shaking at 20 °C for 30 min. Blunted, bead bound nucleosomes were washed once with 800 μl FA-high salt buffer and once with 800 μl Tris-HCl, pH 8 plus 0.2x Roche cOmplete EDTA-free, resuspended in 50 μl A-tailing reaction (5 U Klenow Fragment (3’ to 5’ exo-), M0210L, NEB, 1x NEBuffer 2, B7002S, NEB), and incubated shaking for 30 min at 37 °C.

    Article Title: Genetic screen in myeloid cells identifies TNF-α autocrine secretion as a factor increasing MDSC suppressive activity via Nos2 up-regulation
    Article Snippet: The sample was run on an agarose gel, eluted from the gel and DNA concentration determined. .. For the ligation we incubated 1 µl phosphorylated oligos (0.5 µM) with 50 ng BbsI-linearized plasmid, 1 µl 10 × T4 DNA ligase (New England Biolabs, B0202S), 0.5 µl T4 DNA ligase (New England Biolabs, M0202L) and 7 µl water for 1 h at room temperature and 10 min at 65 °C.

    Article Title: New Generation of Artificial MicroRNA and Synthetic Trans-Acting Small Interfering RNA Vectors for Efficient Gene Silencing in Arabidopsis
    Article Snippet: A 10-μL digestion-ligation reaction was incubated for 5 min at 37°C, and included 1 μL of the annealed and diluted oligonucleotides (0.3 μ m ), 50 ng of the corresponding B/c vector, 1 μL of 10× T4 DNA ligase buffer (New England Biolabs), 1 μL of T4 DNA ligase (400 units μL−1 ; New England Biolabs), and 1 μL of Bsa I (10 units μL−1 ; New England Biolabs). .. A 10-μL digestion-ligation reaction was incubated for 5 min at 37°C, and included 1 μL of the annealed and diluted oligonucleotides (0.3 μ m ), 50 ng of the corresponding B/c vector, 1 μL of 10× T4 DNA ligase buffer (New England Biolabs), 1 μL of T4 DNA ligase (400 units μL−1 ; New England Biolabs), and 1 μL of Bsa I (10 units μL−1 ; New England Biolabs).

    Article Title: Mouse Genome Editing using CRISPR/Cas System
    Article Snippet: 1b Design two oligonucleotides carrying the N20 nucleotides (identified as indicated in Basic Protocol 1) flanked by Esp3I- compatible overhangs as follows: Fw oligonucleotide ACACC-N20 -G and Rv oligonucleotide AAAAC-(RC)N20 -G. 2b Prepare a 100µl solution of the 2 oligonucleotides at a final concentration of 10µM, in ddH20. .. 4b Set up golden gate cloning reaction: 200ng circular MLM3636 plasmid 2µl of the annealed oligonucleotide mix 2µl 10× T4 DNA ligase buffer (NEB) 1µl 20mM DTT 1µl T4 DNA ligase (NEB) 1µl Esp3I (Thermo Scientific) H20 up to 20µl 5b Incubate in a thermocycler with the following cycling program: 37°C for 5 min; 16°C for 10 min (5 times) 6b Transform 1–2 µl of the final product by electroporation into TOP 10 electrocompetent cells and plate transformant on LB-Agar plates supplemented with 50µg/ml Ampicillin.

    Article Title: Transposase mediated construction of RNA-seq libraries
    Article Snippet: To digest the second strand of cDNA, the 26-μL purified DNA was added to 3 μL of T4 DNA Ligase buffer (NEB) and 1 μL of USER enzyme mix (1 U/μL, NEB). .. The PCR amplicons were purified with 97 μL of AMPure beads according to the manufacturer's instructions and eluted in 32 μL of EB.

    Article Title: Genetic Mapping and Biochemical Basis of Yellow Feather Pigmentation in Budgerigars
    Article Snippet: An 11-fold molar excess of BglII sequencing adaptor (2 pmol), relative to the estimated amount of BglII 5′ overhangs per 200 ng digested budgerigar DNA (assuming a genome molecular weight of 6.78 × 1011 g/mol and 3.33 × 105 BglII sites per genome) and an 11-fold excess of DdeI sequencing adaptor (30 pmol) were added to the samples, and ligated by 400 U T4 DNA ligase in 40 ul 1x NEB T4 DNA ligase buffer for 2 hr at room temperature. .. An 11-fold molar excess of BglII sequencing adaptor (2 pmol), relative to the estimated amount of BglII 5′ overhangs per 200 ng digested budgerigar DNA (assuming a genome molecular weight of 6.78 × 1011 g/mol and 3.33 × 105 BglII sites per genome) and an 11-fold excess of DdeI sequencing adaptor (30 pmol) were added to the samples, and ligated by 400 U T4 DNA ligase in 40 ul 1x NEB T4 DNA ligase buffer for 2 hr at room temperature.

    Article Title: Whole Genome Amplification of Plasma-Circulating DNA Enables Expanded Screening for Allelic Imbalance in Plasma
    Article Snippet: A single tube whole genome amplification protocol was developed. .. Briefly, 2 to 4.5 μl of plasma DNA (∼2 to 5 ng total)) was blunted with 0.3 U of T4 DNA polymerase (New England Biolabs, Beverly, MA) at 12°C for 15 minutes in 5 μl of 1× T4 DNA ligase buffer (New England Biolabs), supplemented with dNTP (Applied Biosystems, Foster City, CA) at a final concentration 100 μmol/L. .. The T4 DNA polymerase was then heat-inactivated at 75°C for 20 minutes.

    Article Title: Sequence-specific fluorescent labeling of double-stranded DNA observed at the single molecule level
    Article Snippet: For this purpose, 100 nM of the fragment was mixed with 200 nM of the stem–loop TFO or with 200 nM of the linear TFO and 400 nM of the 8mer adapter in 50 µl of T4 DNA ligase buffer (NEB), heated to 65°C and slowly cooled to room temperature. .. For this purpose, 100 nM of the fragment was mixed with 200 nM of the stem–loop TFO or with 200 nM of the linear TFO and 400 nM of the 8mer adapter in 50 µl of T4 DNA ligase buffer (NEB), heated to 65°C and slowly cooled to room temperature.

    Article Title: Construction and characterization of mismatch-containing circular DNA molecules competent for assessment of nick-directed human mismatch repair in vitro
    Article Snippet: Plasmid pET11aΔH, typically 15 µg (4.2 pmol) at a concentration of 200 ng/µl, was linearized with Bam HI (2 U/µg DNA). .. The reaction was incubated for 10 min at 37°C in T4 ligase buffer (New England Biolabs) containing 100 µg/ml bovine serum albumin, 75 mM KCl and the heteroduplex oligo recovered after Dpn II digestion (estimated to be a ∼100-fold molar excess over the plasmid ends).

    Molecular Weight:

    Article Title: Genetic Mapping and Biochemical Basis of Yellow Feather Pigmentation in Budgerigars
    Article Snippet: The digested DNA was cleaned up by SPRI with Agencourt AMPure XP beads (sample:beads ratio of 1:1.8). .. An 11-fold molar excess of BglII sequencing adaptor (2 pmol), relative to the estimated amount of BglII 5′ overhangs per 200 ng digested budgerigar DNA (assuming a genome molecular weight of 6.78 × 1011 g/mol and 3.33 × 105 BglII sites per genome) and an 11-fold excess of DdeI sequencing adaptor (30 pmol) were added to the samples, and ligated by 400 U T4 DNA ligase in 40 ul 1x NEB T4 DNA ligase buffer for 2 hr at room temperature. .. The ligation reaction was stopped by a 10 min incubation at 65°C, followed by cleanup by SPRI (sample:beads ratio of 1:1.8).

    DNA Purification:

    Article Title: Large-scale methylation domains mark a functional subset of neuronally expressed genes
    Article Snippet: To create the sequencing libraries, 5 μg of DNA was end-repaired using 1× T4 DNA ligase buffer, 400 μM dNTPs, 15 U T4 DNA polymerase (NEB), and 50 U PNK (NEB) for 30 min at 20°C. .. After PCR purifying (Qiagen), adenine bases were appended to the ends using 1× NEB 2 buffer, 200 μM dATP, and 15 U Klenow Fragment (3′ to 5′ exo-, NEB) for 30 min at 37°C.

    Staining:

    Article Title: A versatile assay for detection of aberrant DNA methylation in bladder cancer
    Article Snippet: T4 DNA polymerase, 10x NEB 2 buffer, T4 DNA ligase and 10x T4 DNA ligase buffer (New England Biolabs, Ipswich, MA). .. Taq DNA polymerase, 10x PCR buffer, 5x Q solution (Qiagen, Valencia, CA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs t4 dna ligase buffer
    Estimation of Michaelis–Menten parameters for the ligation of DNA splinted by RNA for ( A ) T4 DNA ligase and ( B ) PBCV-1 DNA ligase. Reactions were carried out in ligase assay buffer with 1 mM ATP at 25°C. Initial reaction velocity for the consumption of substrate was measured through fits to the linear region of the reaction (generally the first ∼15% of reaction) with error bars taking into account the uncertainty in the linear fits and initial substrate and enzyme concentrations. Kinetic parameters were determined through fitting the Michaelis–Menten equation to the data by non-linear regression as described in Materials and Methods. For (A), in all reactions the only detected product was AppDNA, and the determined parameters for substrate consumption were k cat  = 2.2 ± 0.2 × 10 −4  s −1  and K M  = 300 ± 70 nM. For (B), the reaction products were a ∼ 3:1 mixture of ligated DNA to AppDNA, and the observed V 0 /[E] 0  was independent of substrate concentration over the range 0.5 nM–100 nM. The approximate k cat  is 8 × 10 −3  s −1  with an upper threshold for the K M  estimated to be 1 nM.
    T4 Dna Ligase Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 136 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase buffer/product/New England Biolabs
    Average 99 stars, based on 136 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase buffer - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs t4 dna ligase
    Reaction of T4 DNA ligase with substrate 1 ( A ) and adenylylated substrate 1A ( B ) under single turnover conditions.  Each reaction was run with 500 n m  ligase and 100 n m  substrate in the standard ATP-free assay buffer. Ligase that was  > 95% adenylylated was used for  A , and
    T4 Dna Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2019-12
    99/100 stars
      Buy from Supplier


    Image Search Results


    Estimation of Michaelis–Menten parameters for the ligation of DNA splinted by RNA for ( A ) T4 DNA ligase and ( B ) PBCV-1 DNA ligase. Reactions were carried out in ligase assay buffer with 1 mM ATP at 25°C. Initial reaction velocity for the consumption of substrate was measured through fits to the linear region of the reaction (generally the first ∼15% of reaction) with error bars taking into account the uncertainty in the linear fits and initial substrate and enzyme concentrations. Kinetic parameters were determined through fitting the Michaelis–Menten equation to the data by non-linear regression as described in Materials and Methods. For (A), in all reactions the only detected product was AppDNA, and the determined parameters for substrate consumption were k cat  = 2.2 ± 0.2 × 10 −4  s −1  and K M  = 300 ± 70 nM. For (B), the reaction products were a ∼ 3:1 mixture of ligated DNA to AppDNA, and the observed V 0 /[E] 0  was independent of substrate concentration over the range 0.5 nM–100 nM. The approximate k cat  is 8 × 10 −3  s −1  with an upper threshold for the K M  estimated to be 1 nM.

    Journal: Nucleic Acids Research

    Article Title: Efficient DNA ligation in DNA-RNA hybrid helices by Chlorella virus DNA ligase

    doi: 10.1093/nar/gkt1032

    Figure Lengend Snippet: Estimation of Michaelis–Menten parameters for the ligation of DNA splinted by RNA for ( A ) T4 DNA ligase and ( B ) PBCV-1 DNA ligase. Reactions were carried out in ligase assay buffer with 1 mM ATP at 25°C. Initial reaction velocity for the consumption of substrate was measured through fits to the linear region of the reaction (generally the first ∼15% of reaction) with error bars taking into account the uncertainty in the linear fits and initial substrate and enzyme concentrations. Kinetic parameters were determined through fitting the Michaelis–Menten equation to the data by non-linear regression as described in Materials and Methods. For (A), in all reactions the only detected product was AppDNA, and the determined parameters for substrate consumption were k cat = 2.2 ± 0.2 × 10 −4 s −1 and K M = 300 ± 70 nM. For (B), the reaction products were a ∼ 3:1 mixture of ligated DNA to AppDNA, and the observed V 0 /[E] 0 was independent of substrate concentration over the range 0.5 nM–100 nM. The approximate k cat is 8 × 10 −3 s −1 with an upper threshold for the K M estimated to be 1 nM.

    Article Snippet: T4 DNA ligase buffer (50 mM Tris pH 7.5 @ 25°C, 10 mM MgCl2 , 10 mM DTT, 1 mM ATP) was obtained as a 10× stock from New England BioLabs, Inc. (NEB, Ipswich, MA).

    Techniques: Ligation, Concentration Assay

    Ligation of DNA splinted by RNA. (Left) Outline of the ligation assay: a 5′-phosphorylated, 3′-FAM labelled DNA ‘donor’ oligonucleotide and an unmodified DNA ‘acceptor’ oligonucleotide are annealed to a complementary RNA or DNA splint. This substrate was reacted with a ligase to form a mixture of unreacted starting material, adenylylated DNA and ligated product. The products were denatured, separated on CE, and detected by fluorescence. (Right) ligation of the standard RNA-splinted substrate in ligase assay buffer for 15 min at 25°C with ( A ) no enzyme, ( B ) 1 µM T4 DNA ligase and 10 µM ATP, ( C ) 1 µM T4 DNA ligase and 1 mM ATP, ( D ) 100 nM PBCV-1 DNA ligase and 10 µM ATP, and ( E ) 100 nM PBCV-1 DNA ligase and 1 mM ATP. Indicated peaks correspond to starting pDNA (I), AppDNA (II) and ligated product (III) as determined by coelution with synthetically prepared standards.

    Journal: Nucleic Acids Research

    Article Title: Efficient DNA ligation in DNA-RNA hybrid helices by Chlorella virus DNA ligase

    doi: 10.1093/nar/gkt1032

    Figure Lengend Snippet: Ligation of DNA splinted by RNA. (Left) Outline of the ligation assay: a 5′-phosphorylated, 3′-FAM labelled DNA ‘donor’ oligonucleotide and an unmodified DNA ‘acceptor’ oligonucleotide are annealed to a complementary RNA or DNA splint. This substrate was reacted with a ligase to form a mixture of unreacted starting material, adenylylated DNA and ligated product. The products were denatured, separated on CE, and detected by fluorescence. (Right) ligation of the standard RNA-splinted substrate in ligase assay buffer for 15 min at 25°C with ( A ) no enzyme, ( B ) 1 µM T4 DNA ligase and 10 µM ATP, ( C ) 1 µM T4 DNA ligase and 1 mM ATP, ( D ) 100 nM PBCV-1 DNA ligase and 10 µM ATP, and ( E ) 100 nM PBCV-1 DNA ligase and 1 mM ATP. Indicated peaks correspond to starting pDNA (I), AppDNA (II) and ligated product (III) as determined by coelution with synthetically prepared standards.

    Article Snippet: T4 DNA ligase buffer (50 mM Tris pH 7.5 @ 25°C, 10 mM MgCl2 , 10 mM DTT, 1 mM ATP) was obtained as a 10× stock from New England BioLabs, Inc. (NEB, Ipswich, MA).

    Techniques: Ligation, Fluorescence

    Detection of defined amounts of luciferase mRNA from a mixture with Jurkat total RNA through ligation of specific DNA probes (Probe set A) and detection by qPCR. RNA/DNA probe mixtures were annealed then incubated with either T4 DNA ligase (open circle) or PBCV-1 DNA ligase (×). The qPCR C q  for each experiment was recorded, with lower C q  indicating higher concentration of ligated probes. ( A ) Ligation time course with either 1 (solid line) or 0.01 ng (dotted line) of luciferase mRNA target, 0–8 h ligation time. ( B ) Dependence of C q  after probe ligation with target luciferase mRNA present over a 7 log concentration range using a 2 h ligation time. NTC = no template control. The error bars show one standard deviation of the average of a minimum of three replicates.

    Journal: Nucleic Acids Research

    Article Title: Efficient DNA ligation in DNA-RNA hybrid helices by Chlorella virus DNA ligase

    doi: 10.1093/nar/gkt1032

    Figure Lengend Snippet: Detection of defined amounts of luciferase mRNA from a mixture with Jurkat total RNA through ligation of specific DNA probes (Probe set A) and detection by qPCR. RNA/DNA probe mixtures were annealed then incubated with either T4 DNA ligase (open circle) or PBCV-1 DNA ligase (×). The qPCR C q for each experiment was recorded, with lower C q indicating higher concentration of ligated probes. ( A ) Ligation time course with either 1 (solid line) or 0.01 ng (dotted line) of luciferase mRNA target, 0–8 h ligation time. ( B ) Dependence of C q after probe ligation with target luciferase mRNA present over a 7 log concentration range using a 2 h ligation time. NTC = no template control. The error bars show one standard deviation of the average of a minimum of three replicates.

    Article Snippet: T4 DNA ligase buffer (50 mM Tris pH 7.5 @ 25°C, 10 mM MgCl2 , 10 mM DTT, 1 mM ATP) was obtained as a 10× stock from New England BioLabs, Inc. (NEB, Ipswich, MA).

    Techniques: Luciferase, Ligation, Real-time Polymerase Chain Reaction, Incubation, Concentration Assay, Standard Deviation

    Ligation of RNA-splinted DNA substrates by PBCV-1 and T4 DNA ligases under general reaction conditions. The 16 RNA-splinted DNA substrates, representing all possible base pairs at the ligation junction, were reacted and the extent of ligation and abortive adenylylation measured. The bases listed on the X axis (dN/pdN) refer to the identity of the base of the DNA acceptor at the ligation junction (dN) and the identity of the phosphorylated base on the donor at the ligation junction (pdN). For all substrates, the correct Watson–Crick base-pairing partner was present in the RNA splint. All reactions were incubated at 37°C in 50 mM Tris pH 7.5, 10 mM MgCl 2 , 10 mM DTT, 100 nM RNA-splinted DNA substrate and ( A ) 100 nM PBCV-1 DNA ligase and 1 mM ATP for 15 min; ( B ) 100 nM PBCV-1 DNA ligase and 10 µM ATP for 15 min; ( C ) 1 µM PBCV-1 DNA ligase and 1 mM ATP for 15 min; ( D ) 1 µM PBCV-1 DNA ligase and 10 µM ATP for 15 min; ( E ) 1 µM T4 DNA ligase and 10 µM ATP for 15 min; and ( F ) 1 µM T4 DNA ligase and 10 µM ATP for 4 h. Here the total height of the bar indicates the fraction of starting material converted to products, with the solid portion indicating ligation product yield and the hashed portion indicating AppDNA yield.

    Journal: Nucleic Acids Research

    Article Title: Efficient DNA ligation in DNA-RNA hybrid helices by Chlorella virus DNA ligase

    doi: 10.1093/nar/gkt1032

    Figure Lengend Snippet: Ligation of RNA-splinted DNA substrates by PBCV-1 and T4 DNA ligases under general reaction conditions. The 16 RNA-splinted DNA substrates, representing all possible base pairs at the ligation junction, were reacted and the extent of ligation and abortive adenylylation measured. The bases listed on the X axis (dN/pdN) refer to the identity of the base of the DNA acceptor at the ligation junction (dN) and the identity of the phosphorylated base on the donor at the ligation junction (pdN). For all substrates, the correct Watson–Crick base-pairing partner was present in the RNA splint. All reactions were incubated at 37°C in 50 mM Tris pH 7.5, 10 mM MgCl 2 , 10 mM DTT, 100 nM RNA-splinted DNA substrate and ( A ) 100 nM PBCV-1 DNA ligase and 1 mM ATP for 15 min; ( B ) 100 nM PBCV-1 DNA ligase and 10 µM ATP for 15 min; ( C ) 1 µM PBCV-1 DNA ligase and 1 mM ATP for 15 min; ( D ) 1 µM PBCV-1 DNA ligase and 10 µM ATP for 15 min; ( E ) 1 µM T4 DNA ligase and 10 µM ATP for 15 min; and ( F ) 1 µM T4 DNA ligase and 10 µM ATP for 4 h. Here the total height of the bar indicates the fraction of starting material converted to products, with the solid portion indicating ligation product yield and the hashed portion indicating AppDNA yield.

    Article Snippet: T4 DNA ligase buffer (50 mM Tris pH 7.5 @ 25°C, 10 mM MgCl2 , 10 mM DTT, 1 mM ATP) was obtained as a 10× stock from New England BioLabs, Inc. (NEB, Ipswich, MA).

    Techniques: Ligation, Dominant Negative Mutation, Incubation

    Reaction of T4 DNA ligase with substrate 1 ( A ) and adenylylated substrate 1A ( B ) under single turnover conditions.  Each reaction was run with 500 n m  ligase and 100 n m  substrate in the standard ATP-free assay buffer. Ligase that was  > 95% adenylylated was used for  A , and

    Journal: The Journal of Biological Chemistry

    Article Title:

    doi: 10.1074/jbc.M111.284992

    Figure Lengend Snippet: Reaction of T4 DNA ligase with substrate 1 ( A ) and adenylylated substrate 1A ( B ) under single turnover conditions. Each reaction was run with 500 n m ligase and 100 n m substrate in the standard ATP-free assay buffer. Ligase that was > 95% adenylylated was used for A , and

    Article Snippet: T4 DNA ligase buffer (50 mm Tris, pH 7.5, at 25 °C, 10 mm MgCl2 , 10 mm DTT, 1 mm ATP) was obtained as a 10× stock from New England Biolabs, Inc. ATP-free T4 DNA ligase buffer (50 mm Tris, pH 7.5, at 25 °C, 10 mm MgCl2 , 10 mm DTT) was prepared from 1 m stocks of each salt from Amresco or New England Biolabs.

    Techniques:

    Pre-steady state reactions of 30 n m  (♦) and 50 n m  (■) T4 DNA ligase with 100 n m  substrate 1.  Reactions were run in the standard assay buffer. Each time point represents the average of three experiments, and the  error bars  represent one S.D. The  dashed lines  represent fits by simulation using the chemical rates determined from single turnover reaction of substrate  1 , literature values for Step 1 rates, and diffusion-limited binding of DNA and allowing the rate of product release ( k off ) and the amplitude ( a ) to vary. The best fit was obtained with  a  = 0.51 and  k off  = 0.58 s −1 .

    Journal: The Journal of Biological Chemistry

    Article Title:

    doi: 10.1074/jbc.M111.284992

    Figure Lengend Snippet: Pre-steady state reactions of 30 n m (♦) and 50 n m (■) T4 DNA ligase with 100 n m substrate 1. Reactions were run in the standard assay buffer. Each time point represents the average of three experiments, and the error bars represent one S.D. The dashed lines represent fits by simulation using the chemical rates determined from single turnover reaction of substrate 1 , literature values for Step 1 rates, and diffusion-limited binding of DNA and allowing the rate of product release ( k off ) and the amplitude ( a ) to vary. The best fit was obtained with a = 0.51 and k off = 0.58 s −1 .

    Article Snippet: T4 DNA ligase buffer (50 mm Tris, pH 7.5, at 25 °C, 10 mm MgCl2 , 10 mm DTT, 1 mm ATP) was obtained as a 10× stock from New England Biolabs, Inc. ATP-free T4 DNA ligase buffer (50 mm Tris, pH 7.5, at 25 °C, 10 mm MgCl2 , 10 mm DTT) was prepared from 1 m stocks of each salt from Amresco or New England Biolabs.

    Techniques: Diffusion-based Assay, Binding Assay

    Determination of  k cat  and  k cat / K m  for T4 DNA ligase and nicked substrates.  Shown is reaction of 1 n m  T4 DNA ligase with 1 n m  (○), 2 n m  (*), 5 n m  (×), 10 n m  (△), 20 n m  (♢), and 50 n m  (□) substrate  1  in standard assay buffer at 16 °C ( A ) and 1 n m  T4 DNA ligase (

    Journal: The Journal of Biological Chemistry

    Article Title:

    doi: 10.1074/jbc.M111.284992

    Figure Lengend Snippet: Determination of k cat and k cat / K m for T4 DNA ligase and nicked substrates. Shown is reaction of 1 n m T4 DNA ligase with 1 n m (○), 2 n m (*), 5 n m (×), 10 n m (△), 20 n m (♢), and 50 n m (□) substrate 1 in standard assay buffer at 16 °C ( A ) and 1 n m T4 DNA ligase (

    Article Snippet: T4 DNA ligase buffer (50 mm Tris, pH 7.5, at 25 °C, 10 mm MgCl2 , 10 mm DTT, 1 mm ATP) was obtained as a 10× stock from New England Biolabs, Inc. ATP-free T4 DNA ligase buffer (50 mm Tris, pH 7.5, at 25 °C, 10 mm MgCl2 , 10 mm DTT) was prepared from 1 m stocks of each salt from Amresco or New England Biolabs.

    Techniques:

    Ligation of cyclic signal transducer and activator of transcription 3 (STAT3) decoy (CS3D) is unaffected by biotinylation. ( A ) Structures of parental and biotinylated STAT3 decoy (S3D) and CS3D. ( B ) CS3D and biotinylated CS3D were incubated with T4 DNA ligase overnight, followed by electrophoresis on a urea/polyacrylamide gel and staining with SYBR Gold.

    Journal: International Journal of Molecular Sciences

    Article Title: Biochemical Properties of a Decoy Oligodeoxynucleotide Inhibitor of STAT3 Transcription Factor

    doi: 10.3390/ijms19061608

    Figure Lengend Snippet: Ligation of cyclic signal transducer and activator of transcription 3 (STAT3) decoy (CS3D) is unaffected by biotinylation. ( A ) Structures of parental and biotinylated STAT3 decoy (S3D) and CS3D. ( B ) CS3D and biotinylated CS3D were incubated with T4 DNA ligase overnight, followed by electrophoresis on a urea/polyacrylamide gel and staining with SYBR Gold.

    Article Snippet: 15 μL of single-stranded oligodeoxynucleotides (ODNs) were incubated with 3 μL of T4 DNA ligase (400,000 U/mL; New England BioLabs, Ipswich, MA, USA, M0202S) and 2 μL of 10X T4 DNA ligase reaction buffer (New England BioLabs, B0202S) overnight at room temperature.

    Techniques: Ligation, Incubation, Electrophoresis, Staining

    Efficient ligation of cyclic signal transducer and activator of transcription 3 (STAT3) decoy (CS3D). ( A ) Schematic representation of CS3D ligation with T4 DNA ligase. The complementary segments of the single-stranded decoy molecule spontaneously self-anneal. Enzymatic ligation with T4 DNA ligase was used to complete cyclization. ( B ) Incubations were performed in the absence or presence of T4 DNA ligase overnight. Multiple identical ligations ( n  = 5) were simultaneously performed. Samples from each reaction were then electrophoresed on a urea/polyacrylamide gel, stained with SYBR Gold, and quantified by densitometry.

    Journal: International Journal of Molecular Sciences

    Article Title: Biochemical Properties of a Decoy Oligodeoxynucleotide Inhibitor of STAT3 Transcription Factor

    doi: 10.3390/ijms19061608

    Figure Lengend Snippet: Efficient ligation of cyclic signal transducer and activator of transcription 3 (STAT3) decoy (CS3D). ( A ) Schematic representation of CS3D ligation with T4 DNA ligase. The complementary segments of the single-stranded decoy molecule spontaneously self-anneal. Enzymatic ligation with T4 DNA ligase was used to complete cyclization. ( B ) Incubations were performed in the absence or presence of T4 DNA ligase overnight. Multiple identical ligations ( n = 5) were simultaneously performed. Samples from each reaction were then electrophoresed on a urea/polyacrylamide gel, stained with SYBR Gold, and quantified by densitometry.

    Article Snippet: 15 μL of single-stranded oligodeoxynucleotides (ODNs) were incubated with 3 μL of T4 DNA ligase (400,000 U/mL; New England BioLabs, Ipswich, MA, USA, M0202S) and 2 μL of 10X T4 DNA ligase reaction buffer (New England BioLabs, B0202S) overnight at room temperature.

    Techniques: Ligation, Staining

    Reaction of T4 DNA ligase with substrate 1 ( A ) and adenylylated substrate 1A ( B ) under single turnover conditions.  Each reaction was run with 500 n m  ligase and 100 n m  substrate in the standard ATP-free assay buffer. Ligase that was  > 95% adenylylated was used for  A , and

    Journal: The Journal of Biological Chemistry

    Article Title:

    doi: 10.1074/jbc.M111.284992

    Figure Lengend Snippet: Reaction of T4 DNA ligase with substrate 1 ( A ) and adenylylated substrate 1A ( B ) under single turnover conditions. Each reaction was run with 500 n m ligase and 100 n m substrate in the standard ATP-free assay buffer. Ligase that was > 95% adenylylated was used for A , and

    Article Snippet: The RQF was utilized as above with T4 DNA ligase (5 μm , < 5% adenylyated in ATP-free buffer) in syringe A and ATP (2 mm ATP added to 1× ATP-free buffer containing 200 μCi of [α-32 P]ATP/ml solution) in syringe B.

    Techniques:

    Pre-steady state reactions of 30 n m  (♦) and 50 n m  (■) T4 DNA ligase with 100 n m  substrate 1.  Reactions were run in the standard assay buffer. Each time point represents the average of three experiments, and the  error bars  represent one S.D. The  dashed lines  represent fits by simulation using the chemical rates determined from single turnover reaction of substrate  1 , literature values for Step 1 rates, and diffusion-limited binding of DNA and allowing the rate of product release ( k off ) and the amplitude ( a ) to vary. The best fit was obtained with  a  = 0.51 and  k off  = 0.58 s −1 .

    Journal: The Journal of Biological Chemistry

    Article Title:

    doi: 10.1074/jbc.M111.284992

    Figure Lengend Snippet: Pre-steady state reactions of 30 n m (♦) and 50 n m (■) T4 DNA ligase with 100 n m substrate 1. Reactions were run in the standard assay buffer. Each time point represents the average of three experiments, and the error bars represent one S.D. The dashed lines represent fits by simulation using the chemical rates determined from single turnover reaction of substrate 1 , literature values for Step 1 rates, and diffusion-limited binding of DNA and allowing the rate of product release ( k off ) and the amplitude ( a ) to vary. The best fit was obtained with a = 0.51 and k off = 0.58 s −1 .

    Article Snippet: The RQF was utilized as above with T4 DNA ligase (5 μm , < 5% adenylyated in ATP-free buffer) in syringe A and ATP (2 mm ATP added to 1× ATP-free buffer containing 200 μCi of [α-32 P]ATP/ml solution) in syringe B.

    Techniques: Diffusion-based Assay, Binding Assay

    Determination of  k cat  and  k cat / K m  for T4 DNA ligase and nicked substrates.  Shown is reaction of 1 n m  T4 DNA ligase with 1 n m  (○), 2 n m  (*), 5 n m  (×), 10 n m  (△), 20 n m  (♢), and 50 n m  (□) substrate  1  in standard assay buffer at 16 °C ( A ) and 1 n m  T4 DNA ligase (

    Journal: The Journal of Biological Chemistry

    Article Title:

    doi: 10.1074/jbc.M111.284992

    Figure Lengend Snippet: Determination of k cat and k cat / K m for T4 DNA ligase and nicked substrates. Shown is reaction of 1 n m T4 DNA ligase with 1 n m (○), 2 n m (*), 5 n m (×), 10 n m (△), 20 n m (♢), and 50 n m (□) substrate 1 in standard assay buffer at 16 °C ( A ) and 1 n m T4 DNA ligase (

    Article Snippet: The RQF was utilized as above with T4 DNA ligase (5 μm , < 5% adenylyated in ATP-free buffer) in syringe A and ATP (2 mm ATP added to 1× ATP-free buffer containing 200 μCi of [α-32 P]ATP/ml solution) in syringe B.

    Techniques: