t4 dna ligase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher t4 dna ligase
    Construction of the knockdown vector pCB309-PFUFT. The FSH1 cDNA was ligated into pUC-PUT after DNA digestion by Xho I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with <t>T4</t> DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.
    T4 Dna Ligase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 382 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/Thermo Fisher
    Average 99 stars, based on 382 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-04
    99/100 stars

    Images

    1) Product Images from "FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis"

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis

    Journal: International Journal of Molecular Medicine

    doi: 10.3892/ijmm.2019.4355

    Construction of the knockdown vector pCB309-PFUFT. The FSH1 cDNA was ligated into pUC-PUT after DNA digestion by Xho I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.
    Figure Legend Snippet: Construction of the knockdown vector pCB309-PFUFT. The FSH1 cDNA was ligated into pUC-PUT after DNA digestion by Xho I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.

    Techniques Used: Plasmid Preparation, Construct

    2) Product Images from "FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis"

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis

    Journal: International Journal of Molecular Medicine

    doi: 10.3892/ijmm.2019.4355

    Construction of the knockdown vector pCB309-PFUFT. The FSH1 cDNA was ligated into pUC-PUT after DNA digestion by Xho I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.
    Figure Legend Snippet: Construction of the knockdown vector pCB309-PFUFT. The FSH1 cDNA was ligated into pUC-PUT after DNA digestion by Xho I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.

    Techniques Used: Plasmid Preparation, Construct

    3) Product Images from "A fast, efficient and sequence-independent method for flexible multiple segmental isotope labeling of RNA using ribozyme and RNase H cleavage"

    Article Title: A fast, efficient and sequence-independent method for flexible multiple segmental isotope labeling of RNA using ribozyme and RNase H cleavage

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkq756

    Principle, reaction efficiencies and NMR evidence for isotope labeling of each stem-loop of the RsmZ RNA separately. ( a ) Sequence-specific RNase H cleavages to obtain all four isotopically labeled stem-loop fragments. The yields of the cleavage reactions before HPLC purification are indicated, the values in brackets are expressing the yield after purification. The different stem-loops are colored (SL1: magenta, SL2: green, SL3: orange, SL4: cyan). ( b ) Splinted T4 DNA ligase mediated ligations of isotope labeled (in color) and unlabeled (in black) fragments. The unlabeled fragments were obtained in a similar way as the labeled fragments. ( c ) NMR evidence for the successful segmental isotope labeling of each stem-loop separately. 1 H- 15 N-HSQC NMR spectrum of the uniformly 15 N-labeled RsmZ RNA (left) and overlay of the 1 H- 15 N-HSQC NMR spectra of the four segmentally labeled RsmZ RNAs with each stem-loop labeled separately (right). The spectra were recorded on a Bruker 600 MHz spectrometer at 10°C.
    Figure Legend Snippet: Principle, reaction efficiencies and NMR evidence for isotope labeling of each stem-loop of the RsmZ RNA separately. ( a ) Sequence-specific RNase H cleavages to obtain all four isotopically labeled stem-loop fragments. The yields of the cleavage reactions before HPLC purification are indicated, the values in brackets are expressing the yield after purification. The different stem-loops are colored (SL1: magenta, SL2: green, SL3: orange, SL4: cyan). ( b ) Splinted T4 DNA ligase mediated ligations of isotope labeled (in color) and unlabeled (in black) fragments. The unlabeled fragments were obtained in a similar way as the labeled fragments. ( c ) NMR evidence for the successful segmental isotope labeling of each stem-loop separately. 1 H- 15 N-HSQC NMR spectrum of the uniformly 15 N-labeled RsmZ RNA (left) and overlay of the 1 H- 15 N-HSQC NMR spectra of the four segmentally labeled RsmZ RNAs with each stem-loop labeled separately (right). The spectra were recorded on a Bruker 600 MHz spectrometer at 10°C.

    Techniques Used: Nuclear Magnetic Resonance, Labeling, Sequencing, High Performance Liquid Chromatography, Purification, Expressing

    4) Product Images from "FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis"

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis

    Journal: International Journal of Molecular Medicine

    doi: 10.3892/ijmm.2019.4355

    Construction of the knockdown vector pCB309-PFUFT. The FSH1 cDNA was ligated into pUC-PUT after DNA digestion by Xho I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.
    Figure Legend Snippet: Construction of the knockdown vector pCB309-PFUFT. The FSH1 cDNA was ligated into pUC-PUT after DNA digestion by Xho I and Hin dIII to construct plasmid pUC-PFUFT. The two plasmids, pUC-PFUFT and pCB309 were digested by Spe I and Sac I and ligated with T4 DNA ligase to construct the final FSH1 double stranded RNA interference plasmid pCB309-PFUFT. FSH1, family of serine hydrolases 1.

    Techniques Used: Plasmid Preparation, Construct

    5) Product Images from "Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain"

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0039251

    15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.
    Figure Legend Snippet: 15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

    12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.
    Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Positive Control, Negative Control

    12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.
    Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

    The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.
    Figure Legend Snippet: The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Electrophoresis, Negative Control, Positive Control

    6) Product Images from "Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain"

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0039251

    15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.
    Figure Legend Snippet: 15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

    12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.
    Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Positive Control, Negative Control

    12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.
    Figure Legend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

    The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.
    Figure Legend Snippet: The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Electrophoresis, Negative Control, Positive Control

    Related Articles

    Clone Assay:

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: Construction of pCB309-PFUFT-FSH1 knockdown vector The pCB309 plasmid synthesized from pSilent-1 (Fungal Genetics Stock Center) was kindly provided by Zhang et al , and contained the Escherichia coli (E. coli ) hygromycin B phosphotransferase gene to select successfully-transformed fungi, a transcription promoter driven by the Aspergillus nidulans constitutive trpC promoter and two multiple cloning sites separated by an intron-containing spacer. .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: Paragraph title: 2.6. Cloning of SzeaOBPs and Construction of the Expression Vector ... Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction.

    Centrifugation:

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: The reaction solution was mixed evenly after gentle centrifugation and kept at 37 °C for 2–4 h. The target gene fragment was inserted into the expression vector to construct a recombinant prokaryotic expression vector containing the target gene sequence. .. Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction.

    Amplification:

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: The FSH1 forward inference sequence was amplified from the plasmid containing the full-length cDNA sequence of the FSH1 gene with the FSH1 primers presented in . .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

    Article Title: Electrostatic stabilization in a pre-organized polar active site: the catalytic role of Lys-80 in Candida tenuis xylose reductase (AKR2B5) probed by site-directed mutagenesis and functional complementation studies
    Article Snippet: .. The gel-purified amplification product was ligated with a T4 DNA ligase (MBI Fermentas). .. The ligated vector was desalted over a MF membrane filter (pore size 0.025 μm, diameter 13 mm) (Millipore) for 1 h before electroporation into competent Escherichia coli BL21(DE3) cells.

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction. .. The amplification products were purified by gel recovery with the MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (TaKaRa, Dalian, China).

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: Amplification was performed using PrimeSTAR GXL DNA polymerase (Takara, Dalian, China). .. The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11.

    Mass Spectrometry:

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain
    Article Snippet: .. A quality inspection report of T4 DNA ligase from Fermentas showed that T4 PNK could not be detected in their T4 DNA ligase ( ); (iii) PNK could not be detected in T4 DNA ligase (Fermentas) by using mass spectrometry (MS) analysis ( and ); (iv) PNK is abundant in mammalian cells but absent in E. coli cells . .. Therefore, the endogenous PNK should be absent in the host E. coli cells that carry plasmids enabling T4 or E. coli DNA ligase high expression; (v) The ligation of linkers A–B and E–F could not be significantly inhibited by (NH4 )2 SO4 , a strong inhibitor of T4 PNK ( , and ); and (vi) T4 PNK requires ATP for activity.

    Positive Control:

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain
    Article Snippet: The phosphorylation of oligo 11 by T4 DNA ligase was performed in 25 µl of phosphorylation mixture containing 40 mM Tris-HCl (pH 8.0), 10 mM MgCl2 , 10 mM DTT, 0.6 µCi/µl of [γ-32P] ATP, 4 µM of oligo 11, and 0.5 Weiss units/µl of T4 DNA ligase (Fermentas). .. The positive control was oligo 11 phosphorylated by T4 PNK.

    Synthesized:

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: The pUC-PUT plasmid was synthesized by Wuhan GeneCreate Biological Engineering Co., Ltd. A map of each construct is presented in . .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: To clone pIL-11, total cellular mRNA was isolated from the small intestine of the PEDV infection pig, and cDNA was synthesized using HiScript II Q RT SuperMix for qPCR (Vazyme, China) according to the manufacturer’s instructions. .. The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11.

    Construct:

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: To construct the final FSH1 double-stranded RNA interference (dsRNAi) plasmid pCB309-PFUFT, three steps of ligation were performed as follows. .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: .. Finally, the two plasmids, pUC-PFUFT and pCB309 were digested using Spe I and Sac I, purified using a Universal DNA Purification kit (Tiangen Biotech Co., Ltd.) and ligated using T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.) to construct the final FSH1 dsRNAi plasmid, pCB309-PFUFT. .. Intermediate and final vectors were propagated in E. coli DH5α cells (Beijing Huayueyang Biotechnology Co., Ltd.), purified by plasmid mini-preparations (Nucleospin Plasmid kit; Macherey-Nagel GmbH and Co. KG) and confirmed by a series of restriction enzyme digestions, followed by 1% agarose gel electrophoresis.

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: The reaction solution was mixed evenly after gentle centrifugation and kept at 37 °C for 2–4 h. The target gene fragment was inserted into the expression vector to construct a recombinant prokaryotic expression vector containing the target gene sequence. .. Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction.

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: A phylogenetic tree based on the amino acid sequence were constructed with the computer program MEGA version 5.0, utilizing the neighbor-joining method. .. The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11.

    Article Title: Design of a New [PSI+]-No-More Mutation in SUP35 With Strong Inhibitory Effect on the [PSI+] Prion Propagation
    Article Snippet: To construct the pRS315CUP-NM-GFP plasmid, we ligated the region with the CUP1 promoter, Sup35NM and GFP from pRS316CUP-NM-GFP (Serio et al., ) into the polylinker site of the pRS315 plasmid (Sikorski and Hieter, ). .. Sticky-end ligation was performed with T4 DNA-ligase according to Thermo Scientific protocol. pRS315CG was obtained analogously from pRS316CG (Serio et al., ) and pRS315. pR16CUP-NM-yTagRFP-T plasmid was obtained by insertion of the XhoI-XhoI fragment from pCUP-NM-His6 (Kiktev et al., ) in place of the XhoI-SalI fragment of pR16CUP-SFP1C-yTagRFP-T which in turn resulted from the substitution of the PstI-PstI fragment in pR16CUP-SFP1-Cerulean (Matveenko et al., ) for the PstI-PstI fragment from pIM35 (Malcova et al., ).

    Real-time Polymerase Chain Reaction:

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: To clone pIL-11, total cellular mRNA was isolated from the small intestine of the PEDV infection pig, and cDNA was synthesized using HiScript II Q RT SuperMix for qPCR (Vazyme, China) according to the manufacturer’s instructions. .. The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11.

    Incubation:

    Article Title: Glycosylases and AP-cleaving enzymes as a general tool for probe-directed cleavage of ssDNA targets
    Article Snippet: .. For ligation with T4 DNA ligase, the duplex was mixed with 0.1 U/μl T4 DNA ligase (Fermentas), 10 mM Tris–Acetate pH 7.5, 10 mM MgAc2 , 50 mM KAc, 1 mM ATP (Fermentas) and 0.1 μg/μl BSA for 2 min at 75°C, 1 min at 45°C, 2 min at 30°C, 30 min at 37°C and finally 10 min at 65°C (the T4 DNA ligase was added prior to the incubation at 37°C). ..

    Activity Assay:

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain
    Article Snippet: A quality inspection report of T4 DNA ligase from Fermentas showed that T4 PNK could not be detected in their T4 DNA ligase ( ); (iii) PNK could not be detected in T4 DNA ligase (Fermentas) by using mass spectrometry (MS) analysis ( and ); (iv) PNK is abundant in mammalian cells but absent in E. coli cells . .. Therefore, the endogenous PNK should be absent in the host E. coli cells that carry plasmids enabling T4 or E. coli DNA ligase high expression; (v) The ligation of linkers A–B and E–F could not be significantly inhibited by (NH4 )2 SO4 , a strong inhibitor of T4 PNK ( , and ); and (vi) T4 PNK requires ATP for activity.

    Cell Culture:

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction. .. After sequencing inoculate 3 mL bacterial solution to 300 mL LB medium containing corresponding antibiotics, the correct bacterial clones were cultured in large volumes, and recombinant plasmid extraction was carried out using a plasmid extraction kit (Axygen, Union City, CA, USA).

    Article Title: Mapping three-dimensional genome architecture through in situ DNase Hi-C
    Article Snippet: Pen/Strep Cocktail (Thermo Scientific 15140122) Fetal Bovine Serum (Thermo Scientific 10437-010) Cell culture medium: RPMI-1760 w/15% FBS (for GM12878; Thermo Scientific 11875-093) or DMEM w/10% FBS (for Patski; Thermo Scientific 11965118) Biotinylated Bridge Adaptor 5′: /5Phos/GCTGAGGGA/iBiodT/C (IDT) Bridge Adaptor 3′T: CCTCAGCT (IDT) Bridge Adaptor 5′: GCTGAGGGAC (IDT) Blunt Bridge Adaptor 3′: CCTCAGC (IDT) SeqAdapt_F: ACACTCTTTCCCTACACGACGCTCTTCCGATC*T (IDT) SeqAdapt_R: /5Phos/GATCGGAAGAGCACACGTCTGAACTCCAGTCAC (IDT) SeqPrimer_F: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (IDT) SeqPrimer_R: CAAGCAGAAGACGGCATACGAGAT[8 bp barcode] GTGACTGGAGTTCAGACGTGTGCT (IDT) 37% (vol/vol) Formaldehyde (Sigma Aldrich F8775) CAUTION! .. Glycine (Sigma-Aldrich 50046) NEBuffer 2 (NEB B7002S) 10% (wt/vol) UltraPure SDS (Life Tech 15553-027) DNase I, RNase-free (supplied with MnCl2 and reaction buffer) (1 U/μL) (Thermo Scientific EN0525) RNase A, DNase and protease-free (10 mg/ml) (Thermo Scientific EN0531) Klenow Fragment (10 U/μL) (Thermo Scientific EP0052) Klenow Fragment (exo– ) (5 U/μL) (Thermo Scientific EP0422) T4 DNA Polymerase (5 U/μL) (Thermo Scientific EP0062) T4 DNA Ligase (5 U/μL) provided with 50% PEG-4000 (Thermo Scientific EL0012) T4 Polynucleotide Kinase (10 U/μL) (Thermo Scientific EK0032) 10X T4 DNA Ligase Buffer w/ATP (NEB B0202S) Agencourt AMPure XP (Beckman Coulter ) 2X HotStart PCR ReadyMix (KAPA KK2601) Fast DNA End Repair Kit (Thermo Scientific K0771) Proteinase K (Thermo Scientific EO0492) FastDigest® BamHI (Thermo Scientific FERFD0504) Dynabeads® MyOne™ Streptavidin C1 (Life Tech 65001) dNTP Set (100 mM 4x 0.25ml) (Thermo Scientific FERR0181) 100 bp DNA ladder (Thermo Scientific SM0243) GlycoBlue (Ambion AM9516) 3 M Sodium acetate (pH 5.2) (Cellgro 46-033-CI) Ethanol (Decon Labs Inc. 2716) CAUTION!

    Expressing:

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: Paragraph title: 2.6. Cloning of SzeaOBPs and Construction of the Expression Vector ... Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction.

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: Paragraph title: Phylogenetic analysis and prokaryotic expression of pIL-11 ... The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11.

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain
    Article Snippet: A quality inspection report of T4 DNA ligase from Fermentas showed that T4 PNK could not be detected in their T4 DNA ligase ( ); (iii) PNK could not be detected in T4 DNA ligase (Fermentas) by using mass spectrometry (MS) analysis ( and ); (iv) PNK is abundant in mammalian cells but absent in E. coli cells . .. Therefore, the endogenous PNK should be absent in the host E. coli cells that carry plasmids enabling T4 or E. coli DNA ligase high expression; (v) The ligation of linkers A–B and E–F could not be significantly inhibited by (NH4 )2 SO4 , a strong inhibitor of T4 PNK ( , and ); and (vi) T4 PNK requires ATP for activity.

    Kinase Assay:

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain
    Article Snippet: Paragraph title: Kinase Assay for T4 DNA Ligase ... The phosphorylation of oligo 11 by T4 DNA ligase was performed in 25 µl of phosphorylation mixture containing 40 mM Tris-HCl (pH 8.0), 10 mM MgCl2 , 10 mM DTT, 0.6 µCi/µl of [γ-32P] ATP, 4 µM of oligo 11, and 0.5 Weiss units/µl of T4 DNA ligase (Fermentas).

    Transformation Assay:

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11. .. Finally, pET-32a-pIL-11 was transformed into BL21 (DE3), while the recombinant mpIL-11 was purified by a Ni–NTA column and removed Trx-tags by Enterokinase (EK) (Sangon Biotech, Shanghai, China).

    Article Title: Design of a New [PSI+]-No-More Mutation in SUP35 With Strong Inhibitory Effect on the [PSI+] Prion Propagation
    Article Snippet: Then, this solution was used for transformation of E. coli competent cells. .. Sticky-end ligation was performed with T4 DNA-ligase according to Thermo Scientific protocol. pRS315CG was obtained analogously from pRS316CG (Serio et al., ) and pRS315. pR16CUP-NM-yTagRFP-T plasmid was obtained by insertion of the XhoI-XhoI fragment from pCUP-NM-His6 (Kiktev et al., ) in place of the XhoI-SalI fragment of pR16CUP-SFP1C-yTagRFP-T which in turn resulted from the substitution of the PstI-PstI fragment in pR16CUP-SFP1-Cerulean (Matveenko et al., ) for the PstI-PstI fragment from pIM35 (Malcova et al., ).

    High Performance Liquid Chromatography:

    Article Title: A fast, efficient and sequence-independent method for flexible multiple segmental isotope labeling of RNA using ribozyme and RNase H cleavage
    Article Snippet: A typical large-scale ligation reaction using T4 DNA ligase was 10 μM in RNA fragments, 15 μM in DNA splint oligo, 10% PEG-4000 in 40 mM Tris–HCl pH = 7.8, 0.5 mM ATP, 10 mM MgCl2 , 10 mM DTT using 50 U T4 DNA ligase (fermentas) per nmol of RNA to be ligated or 2 μM final concentration of in-house produced T4 DNA ligase. .. The reactions were subjected to HPLC purification followed by n -butanol extraction and lyophilization.

    Electroporation:

    Article Title: Electrostatic stabilization in a pre-organized polar active site: the catalytic role of Lys-80 in Candida tenuis xylose reductase (AKR2B5) probed by site-directed mutagenesis and functional complementation studies
    Article Snippet: The gel-purified amplification product was ligated with a T4 DNA ligase (MBI Fermentas). .. The ligated vector was desalted over a MF membrane filter (pore size 0.025 μm, diameter 13 mm) (Millipore) for 1 h before electroporation into competent Escherichia coli BL21(DE3) cells.

    Inverse PCR:

    Article Title: Electrostatic stabilization in a pre-organized polar active site: the catalytic role of Lys-80 in Candida tenuis xylose reductase (AKR2B5) probed by site-directed mutagenesis and functional complementation studies
    Article Snippet: Production of the D46N K80A double mutant was achieved by inverse PCR [ ] using the plasmid vector pBEAct.1i [ ] with the K80A mutation as template. .. The gel-purified amplification product was ligated with a T4 DNA ligase (MBI Fermentas).

    DNA Ligation:

    Article Title: Mapping three-dimensional genome architecture through in situ DNase Hi-C
    Article Snippet: Glycine (Sigma-Aldrich 50046) NEBuffer 2 (NEB B7002S) 10% (wt/vol) UltraPure SDS (Life Tech 15553-027) DNase I, RNase-free (supplied with MnCl2 and reaction buffer) (1 U/μL) (Thermo Scientific EN0525) RNase A, DNase and protease-free (10 mg/ml) (Thermo Scientific EN0531) Klenow Fragment (10 U/μL) (Thermo Scientific EP0052) Klenow Fragment (exo– ) (5 U/μL) (Thermo Scientific EP0422) T4 DNA Polymerase (5 U/μL) (Thermo Scientific EP0062) T4 DNA Ligase (5 U/μL) provided with 50% PEG-4000 (Thermo Scientific EL0012) T4 Polynucleotide Kinase (10 U/μL) (Thermo Scientific EK0032) 10X T4 DNA Ligase Buffer w/ATP (NEB B0202S) Agencourt AMPure XP (Beckman Coulter ) 2X HotStart PCR ReadyMix (KAPA KK2601) Fast DNA End Repair Kit (Thermo Scientific K0771) Proteinase K (Thermo Scientific EO0492) FastDigest® BamHI (Thermo Scientific FERFD0504) Dynabeads® MyOne™ Streptavidin C1 (Life Tech 65001) dNTP Set (100 mM 4x 0.25ml) (Thermo Scientific FERR0181) 100 bp DNA ladder (Thermo Scientific SM0243) GlycoBlue (Ambion AM9516) 3 M Sodium acetate (pH 5.2) (Cellgro 46-033-CI) Ethanol (Decon Labs Inc. 2716) CAUTION! .. Isopropanol is flammable, and should be stored and handled under appropriate conditions 1M UltraPure Tris-HCl pH 8.0 (Life Tech 15568-025) 1M UltraPure Tris-HCl pH 7.5 (Life Tech 15567-027) Buffer EB (Qiagen 19086) PEG-8000 (Sigma-Aldrich 89510) 0.5 M EDTA (Cellgro 46-034-CI) Qubit dsDNA HS kit (Life Tech ) IGEPAL CA-630 (Sigma-Aldrich I8896-50ML) Triton X-100 (Sigma-Aldrich X100-5ML) 1X DPBS (Life Tech 14190-250) Protease Inhibitor Tablets ( e.g. Roche 04693116001) QIAquick PCR Purification Kit (Qiagen 28104) Rapid DNA Ligation Kit (Thermo Scientific K1422) 5M Sodium Chloride (NaCl) (S5150-1L) 0.25% Trypsin-EDTA (Thermo Scientific 25200056) Millipore Steriflip Filters (Millipore SCGP00525)

    Ligation:

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: To construct the final FSH1 double-stranded RNA interference (dsRNAi) plasmid pCB309-PFUFT, three steps of ligation were performed as follows. .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain
    Article Snippet: Kinase Assay for T4 DNA Ligase To explore the ligation mechanism of DNA linkers with 5′-OH ends, oligo 11 of linker F were phosphorylated by using [γ-32P] ATP and T4 DNA ligase. .. The phosphorylation of oligo 11 by T4 DNA ligase was performed in 25 µl of phosphorylation mixture containing 40 mM Tris-HCl (pH 8.0), 10 mM MgCl2 , 10 mM DTT, 0.6 µCi/µl of [γ-32P] ATP, 4 µM of oligo 11, and 0.5 Weiss units/µl of T4 DNA ligase (Fermentas).

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: .. Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction. .. The amplification products were purified by gel recovery with the MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (TaKaRa, Dalian, China).

    Article Title: Glycosylases and AP-cleaving enzymes as a general tool for probe-directed cleavage of ssDNA targets
    Article Snippet: .. For ligation with T4 DNA ligase, the duplex was mixed with 0.1 U/μl T4 DNA ligase (Fermentas), 10 mM Tris–Acetate pH 7.5, 10 mM MgAc2 , 50 mM KAc, 1 mM ATP (Fermentas) and 0.1 μg/μl BSA for 2 min at 75°C, 1 min at 45°C, 2 min at 30°C, 30 min at 37°C and finally 10 min at 65°C (the T4 DNA ligase was added prior to the incubation at 37°C). ..

    Article Title: A fast, efficient and sequence-independent method for flexible multiple segmental isotope labeling of RNA using ribozyme and RNase H cleavage
    Article Snippet: .. A typical large-scale ligation reaction using T4 DNA ligase was 10 μM in RNA fragments, 15 μM in DNA splint oligo, 10% PEG-4000 in 40 mM Tris–HCl pH = 7.8, 0.5 mM ATP, 10 mM MgCl2 , 10 mM DTT using 50 U T4 DNA ligase (fermentas) per nmol of RNA to be ligated or 2 μM final concentration of in-house produced T4 DNA ligase. .. The reactions were subjected to HPLC purification followed by n -butanol extraction and lyophilization.

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain
    Article Snippet: A quality inspection report of T4 DNA ligase from Fermentas showed that T4 PNK could not be detected in their T4 DNA ligase ( ); (iii) PNK could not be detected in T4 DNA ligase (Fermentas) by using mass spectrometry (MS) analysis ( and ); (iv) PNK is abundant in mammalian cells but absent in E. coli cells . .. Therefore, the endogenous PNK should be absent in the host E. coli cells that carry plasmids enabling T4 or E. coli DNA ligase high expression; (v) The ligation of linkers A–B and E–F could not be significantly inhibited by (NH4 )2 SO4 , a strong inhibitor of T4 PNK ( , and ); and (vi) T4 PNK requires ATP for activity.

    Protease Inhibitor:

    Article Title: Mapping three-dimensional genome architecture through in situ DNase Hi-C
    Article Snippet: Glycine (Sigma-Aldrich 50046) NEBuffer 2 (NEB B7002S) 10% (wt/vol) UltraPure SDS (Life Tech 15553-027) DNase I, RNase-free (supplied with MnCl2 and reaction buffer) (1 U/μL) (Thermo Scientific EN0525) RNase A, DNase and protease-free (10 mg/ml) (Thermo Scientific EN0531) Klenow Fragment (10 U/μL) (Thermo Scientific EP0052) Klenow Fragment (exo– ) (5 U/μL) (Thermo Scientific EP0422) T4 DNA Polymerase (5 U/μL) (Thermo Scientific EP0062) T4 DNA Ligase (5 U/μL) provided with 50% PEG-4000 (Thermo Scientific EL0012) T4 Polynucleotide Kinase (10 U/μL) (Thermo Scientific EK0032) 10X T4 DNA Ligase Buffer w/ATP (NEB B0202S) Agencourt AMPure XP (Beckman Coulter ) 2X HotStart PCR ReadyMix (KAPA KK2601) Fast DNA End Repair Kit (Thermo Scientific K0771) Proteinase K (Thermo Scientific EO0492) FastDigest® BamHI (Thermo Scientific FERFD0504) Dynabeads® MyOne™ Streptavidin C1 (Life Tech 65001) dNTP Set (100 mM 4x 0.25ml) (Thermo Scientific FERR0181) 100 bp DNA ladder (Thermo Scientific SM0243) GlycoBlue (Ambion AM9516) 3 M Sodium acetate (pH 5.2) (Cellgro 46-033-CI) Ethanol (Decon Labs Inc. 2716) CAUTION! .. Isopropanol is flammable, and should be stored and handled under appropriate conditions 1M UltraPure Tris-HCl pH 8.0 (Life Tech 15568-025) 1M UltraPure Tris-HCl pH 7.5 (Life Tech 15567-027) Buffer EB (Qiagen 19086) PEG-8000 (Sigma-Aldrich 89510) 0.5 M EDTA (Cellgro 46-034-CI) Qubit dsDNA HS kit (Life Tech ) IGEPAL CA-630 (Sigma-Aldrich I8896-50ML) Triton X-100 (Sigma-Aldrich X100-5ML) 1X DPBS (Life Tech 14190-250) Protease Inhibitor Tablets ( e.g. Roche 04693116001) QIAquick PCR Purification Kit (Qiagen 28104) Rapid DNA Ligation Kit (Thermo Scientific K1422) 5M Sodium Chloride (NaCl) (S5150-1L) 0.25% Trypsin-EDTA (Thermo Scientific 25200056) Millipore Steriflip Filters (Millipore SCGP00525)

    Infection:

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: To clone pIL-11, total cellular mRNA was isolated from the small intestine of the PEDV infection pig, and cDNA was synthesized using HiScript II Q RT SuperMix for qPCR (Vazyme, China) according to the manufacturer’s instructions. .. The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11.

    Sequencing:

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: The FSH1 forward inference sequence was amplified from the plasmid containing the full-length cDNA sequence of the FSH1 gene with the FSH1 primers presented in . .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

    Article Title: Electrostatic stabilization in a pre-organized polar active site: the catalytic role of Lys-80 in Candida tenuis xylose reductase (AKR2B5) probed by site-directed mutagenesis and functional complementation studies
    Article Snippet: The gel-purified amplification product was ligated with a T4 DNA ligase (MBI Fermentas). .. Plasmid miniprep DNA was subjected to dideoxy sequencing to verify the introduction of the desired mutations and that no misincorporations of nucleotides had occurred because of DNA polymerase errors.

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: The reaction solution was mixed evenly after gentle centrifugation and kept at 37 °C for 2–4 h. The target gene fragment was inserted into the expression vector to construct a recombinant prokaryotic expression vector containing the target gene sequence. .. Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction.

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: The sequence data for phylogenetic analysis were taken from the GenBank nucleotide sequence database with the following accession numbers: pig IL-11, XP_020950667.1; human IL-11, NP_000632.1; mouse IL-11, NP_032376.1; monkey IL-11, XP_007996343.1; bovine IL-11, XP_024835139.1; goat IL-11, XP_024835139.1 and chicken IL-11, XP_024998644.1. .. The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11.

    Recombinant:

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: The reaction solution was mixed evenly after gentle centrifugation and kept at 37 °C for 2–4 h. The target gene fragment was inserted into the expression vector to construct a recombinant prokaryotic expression vector containing the target gene sequence. .. Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction.

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: .. The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11. .. Finally, pET-32a-pIL-11 was transformed into BL21 (DE3), while the recombinant mpIL-11 was purified by a Ni–NTA column and removed Trx-tags by Enterokinase (EK) (Sangon Biotech, Shanghai, China).

    DNA Extraction:

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction. .. The amplification products were purified by gel recovery with the MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (TaKaRa, Dalian, China).

    Mutagenesis:

    Article Title: Electrostatic stabilization in a pre-organized polar active site: the catalytic role of Lys-80 in Candida tenuis xylose reductase (AKR2B5) probed by site-directed mutagenesis and functional complementation studies
    Article Snippet: Paragraph title: Site-directed mutagenesis ... The gel-purified amplification product was ligated with a T4 DNA ligase (MBI Fermentas).

    Isolation:

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: To clone pIL-11, total cellular mRNA was isolated from the small intestine of the PEDV infection pig, and cDNA was synthesized using HiScript II Q RT SuperMix for qPCR (Vazyme, China) according to the manufacturer’s instructions. .. The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11.

    Size-exclusion Chromatography:

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: The PCR mixture was as follows: 1.25U LA Taq (Takara Bio, Inc.), 1 µ l FSH1 plasmid (20 ng/µ l), 1 µ l FSH1-F primer, 1 µ l FSH1-R primer, 5 µ l 10X LA Taq Buffer, 4 µ l dNTP (2.5 mM), and ddH2 O up to a total volume of 50 µ l. The thermocycling conditions were as follows: Initial denaturation at 94°C for 1 min; followed by 30 cycles of 94°C for 30 sec, 55°C for 45 sec and 72°C for 30 sec, and a final extension 72°C for 10 min. PCR products were gel purified using a Universal DNA Purification kit (Tiangen Biotech Co., Ltd.). .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

    Labeling:

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain
    Article Snippet: The kinase assay for E. coli DNA ligase was not performed because NAD+ labeled with 32P was not available for us. .. The phosphorylation of oligo 11 by T4 DNA ligase was performed in 25 µl of phosphorylation mixture containing 40 mM Tris-HCl (pH 8.0), 10 mM MgCl2 , 10 mM DTT, 0.6 µCi/µl of [γ-32P] ATP, 4 µM of oligo 11, and 0.5 Weiss units/µl of T4 DNA ligase (Fermentas).

    Article Title: Glycosylases and AP-cleaving enzymes as a general tool for probe-directed cleavage of ssDNA targets
    Article Snippet: 5′-Ligation of oligonucleotide after MutY glycosylase and Endonuclease IV treatment The tracking oligo was created by adding 15 nM of the labeled track_relig1 with 15 nM track_relig2 and hybridizing to 15 nM probe_relig in a mixture of 0.2 U/μl Ampligase (Epicentre), 20 mM Tris–HCl pH 8.3, 25 mM KCl, 10 mM MgCl2 , 0.5 mM NAD, 0.01 % Triton X-100 and 0.1 μg/μl BSA for 2 min at 75°C, 1 min at 45°C, 2 min at 30°C and finally 2 min at 45°C. .. For ligation with T4 DNA ligase, the duplex was mixed with 0.1 U/μl T4 DNA ligase (Fermentas), 10 mM Tris–Acetate pH 7.5, 10 mM MgAc2 , 50 mM KAc, 1 mM ATP (Fermentas) and 0.1 μg/μl BSA for 2 min at 75°C, 1 min at 45°C, 2 min at 30°C, 30 min at 37°C and finally 10 min at 65°C (the T4 DNA ligase was added prior to the incubation at 37°C).

    Purification:

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.). ..

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: .. Finally, the two plasmids, pUC-PFUFT and pCB309 were digested using Spe I and Sac I, purified using a Universal DNA Purification kit (Tiangen Biotech Co., Ltd.) and ligated using T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.) to construct the final FSH1 dsRNAi plasmid, pCB309-PFUFT. .. Intermediate and final vectors were propagated in E. coli DH5α cells (Beijing Huayueyang Biotechnology Co., Ltd.), purified by plasmid mini-preparations (Nucleospin Plasmid kit; Macherey-Nagel GmbH and Co. KG) and confirmed by a series of restriction enzyme digestions, followed by 1% agarose gel electrophoresis.

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.). .. The FSH1 gene was then ligated into pUC-PFUT following digestion with Bgl II and Kpn I and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.) and this was called pUC-PFUFT.

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction. .. The amplification products were purified by gel recovery with the MiniBEST Agarose Gel DNA Extraction Kit Ver.4.0 (TaKaRa, Dalian, China).

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11. .. Finally, pET-32a-pIL-11 was transformed into BL21 (DE3), while the recombinant mpIL-11 was purified by a Ni–NTA column and removed Trx-tags by Enterokinase (EK) (Sangon Biotech, Shanghai, China).

    Article Title: A fast, efficient and sequence-independent method for flexible multiple segmental isotope labeling of RNA using ribozyme and RNase H cleavage
    Article Snippet: A typical large-scale ligation reaction using T4 DNA ligase was 10 μM in RNA fragments, 15 μM in DNA splint oligo, 10% PEG-4000 in 40 mM Tris–HCl pH = 7.8, 0.5 mM ATP, 10 mM MgCl2 , 10 mM DTT using 50 U T4 DNA ligase (fermentas) per nmol of RNA to be ligated or 2 μM final concentration of in-house produced T4 DNA ligase. .. The reactions were subjected to HPLC purification followed by n -butanol extraction and lyophilization.

    Article Title: Mapping three-dimensional genome architecture through in situ DNase Hi-C
    Article Snippet: Glycine (Sigma-Aldrich 50046) NEBuffer 2 (NEB B7002S) 10% (wt/vol) UltraPure SDS (Life Tech 15553-027) DNase I, RNase-free (supplied with MnCl2 and reaction buffer) (1 U/μL) (Thermo Scientific EN0525) RNase A, DNase and protease-free (10 mg/ml) (Thermo Scientific EN0531) Klenow Fragment (10 U/μL) (Thermo Scientific EP0052) Klenow Fragment (exo– ) (5 U/μL) (Thermo Scientific EP0422) T4 DNA Polymerase (5 U/μL) (Thermo Scientific EP0062) T4 DNA Ligase (5 U/μL) provided with 50% PEG-4000 (Thermo Scientific EL0012) T4 Polynucleotide Kinase (10 U/μL) (Thermo Scientific EK0032) 10X T4 DNA Ligase Buffer w/ATP (NEB B0202S) Agencourt AMPure XP (Beckman Coulter ) 2X HotStart PCR ReadyMix (KAPA KK2601) Fast DNA End Repair Kit (Thermo Scientific K0771) Proteinase K (Thermo Scientific EO0492) FastDigest® BamHI (Thermo Scientific FERFD0504) Dynabeads® MyOne™ Streptavidin C1 (Life Tech 65001) dNTP Set (100 mM 4x 0.25ml) (Thermo Scientific FERR0181) 100 bp DNA ladder (Thermo Scientific SM0243) GlycoBlue (Ambion AM9516) 3 M Sodium acetate (pH 5.2) (Cellgro 46-033-CI) Ethanol (Decon Labs Inc. 2716) CAUTION! .. Isopropanol is flammable, and should be stored and handled under appropriate conditions 1M UltraPure Tris-HCl pH 8.0 (Life Tech 15568-025) 1M UltraPure Tris-HCl pH 7.5 (Life Tech 15567-027) Buffer EB (Qiagen 19086) PEG-8000 (Sigma-Aldrich 89510) 0.5 M EDTA (Cellgro 46-034-CI) Qubit dsDNA HS kit (Life Tech ) IGEPAL CA-630 (Sigma-Aldrich I8896-50ML) Triton X-100 (Sigma-Aldrich X100-5ML) 1X DPBS (Life Tech 14190-250) Protease Inhibitor Tablets ( e.g. Roche 04693116001) QIAquick PCR Purification Kit (Qiagen 28104) Rapid DNA Ligation Kit (Thermo Scientific K1422) 5M Sodium Chloride (NaCl) (S5150-1L) 0.25% Trypsin-EDTA (Thermo Scientific 25200056) Millipore Steriflip Filters (Millipore SCGP00525)

    Polymerase Chain Reaction:

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.). ..

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.). .. Finally, the two plasmids, pUC-PFUFT and pCB309 were digested using Spe I and Sac I, purified using a Universal DNA Purification kit (Tiangen Biotech Co., Ltd.) and ligated using T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.) to construct the final FSH1 dsRNAi plasmid, pCB309-PFUFT.

    Article Title: Electrostatic stabilization in a pre-organized polar active site: the catalytic role of Lys-80 in Candida tenuis xylose reductase (AKR2B5) probed by site-directed mutagenesis and functional complementation studies
    Article Snippet: The plasmid was amplified with Pfu DNA polymerase (Promega) and two oligonucleotide primers (listed below with the mismatched bases underlined) which were phosphorylated by T4 polynucleotide kinase (Promega) before PCR: D46N K80A forward, 5′-AGATTGTTC A ACGGTGC T GA-3′, and D46N K80A reverse, 5′-GTAACCGGCCTTGAT T GCTT-3′. .. The gel-purified amplification product was ligated with a T4 DNA ligase (MBI Fermentas).

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: The 50 μL digestion reactions were prepared as follows: PCR product or expression vector (30 μL), FastDigest Green buffer (5 μL), enzyme 1 (2 μL), enzyme 2 (2 μL), ddH2 O (11 μL). .. Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction.

    Article Title: Mapping three-dimensional genome architecture through in situ DNase Hi-C
    Article Snippet: .. Glycine (Sigma-Aldrich 50046) NEBuffer 2 (NEB B7002S) 10% (wt/vol) UltraPure SDS (Life Tech 15553-027) DNase I, RNase-free (supplied with MnCl2 and reaction buffer) (1 U/μL) (Thermo Scientific EN0525) RNase A, DNase and protease-free (10 mg/ml) (Thermo Scientific EN0531) Klenow Fragment (10 U/μL) (Thermo Scientific EP0052) Klenow Fragment (exo– ) (5 U/μL) (Thermo Scientific EP0422) T4 DNA Polymerase (5 U/μL) (Thermo Scientific EP0062) T4 DNA Ligase (5 U/μL) provided with 50% PEG-4000 (Thermo Scientific EL0012) T4 Polynucleotide Kinase (10 U/μL) (Thermo Scientific EK0032) 10X T4 DNA Ligase Buffer w/ATP (NEB B0202S) Agencourt AMPure XP (Beckman Coulter ) 2X HotStart PCR ReadyMix (KAPA KK2601) Fast DNA End Repair Kit (Thermo Scientific K0771) Proteinase K (Thermo Scientific EO0492) FastDigest® BamHI (Thermo Scientific FERFD0504) Dynabeads® MyOne™ Streptavidin C1 (Life Tech 65001) dNTP Set (100 mM 4x 0.25ml) (Thermo Scientific FERR0181) 100 bp DNA ladder (Thermo Scientific SM0243) GlycoBlue (Ambion AM9516) 3 M Sodium acetate (pH 5.2) (Cellgro 46-033-CI) Ethanol (Decon Labs Inc. 2716) CAUTION! .. Ethanol is flammable, and should be stored and handled under appropriate conditions Isopropanol (Sigma-Aldrich 437522) CAUTION!

    Article Title: Design of a New [PSI+]-No-More Mutation in SUP35 With Strong Inhibitory Effect on the [PSI+] Prion Propagation
    Article Snippet: Next, the PCR mixture was treated with DpnI (Thermo Scientific) to remove the template DNA. .. Sticky-end ligation was performed with T4 DNA-ligase according to Thermo Scientific protocol. pRS315CG was obtained analogously from pRS316CG (Serio et al., ) and pRS315. pR16CUP-NM-yTagRFP-T plasmid was obtained by insertion of the XhoI-XhoI fragment from pCUP-NM-His6 (Kiktev et al., ) in place of the XhoI-SalI fragment of pR16CUP-SFP1C-yTagRFP-T which in turn resulted from the substitution of the PstI-PstI fragment in pR16CUP-SFP1-Cerulean (Matveenko et al., ) for the PstI-PstI fragment from pIM35 (Malcova et al., ).

    Plasmid Preparation:

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: Paragraph title: Construction of pCB309-PFUFT-FSH1 knockdown vector ... First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: .. Finally, the two plasmids, pUC-PFUFT and pCB309 were digested using Spe I and Sac I, purified using a Universal DNA Purification kit (Tiangen Biotech Co., Ltd.) and ligated using T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.) to construct the final FSH1 dsRNAi plasmid, pCB309-PFUFT. .. Intermediate and final vectors were propagated in E. coli DH5α cells (Beijing Huayueyang Biotechnology Co., Ltd.), purified by plasmid mini-preparations (Nucleospin Plasmid kit; Macherey-Nagel GmbH and Co. KG) and confirmed by a series of restriction enzyme digestions, followed by 1% agarose gel electrophoresis.

    Article Title: Electrostatic stabilization in a pre-organized polar active site: the catalytic role of Lys-80 in Candida tenuis xylose reductase (AKR2B5) probed by site-directed mutagenesis and functional complementation studies
    Article Snippet: The plasmid was amplified with Pfu DNA polymerase (Promega) and two oligonucleotide primers (listed below with the mismatched bases underlined) which were phosphorylated by T4 polynucleotide kinase (Promega) before PCR: D46N K80A forward, 5′-AGATTGTTC A ACGGTGC T GA-3′, and D46N K80A reverse, 5′-GTAACCGGCCTTGAT T GCTT-3′. .. The gel-purified amplification product was ligated with a T4 DNA ligase (MBI Fermentas).

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: Paragraph title: 2.6. Cloning of SzeaOBPs and Construction of the Expression Vector ... Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction.

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: .. The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11. .. Finally, pET-32a-pIL-11 was transformed into BL21 (DE3), while the recombinant mpIL-11 was purified by a Ni–NTA column and removed Trx-tags by Enterokinase (EK) (Sangon Biotech, Shanghai, China).

    Article Title: Design of a New [PSI+]-No-More Mutation in SUP35 With Strong Inhibitory Effect on the [PSI+] Prion Propagation
    Article Snippet: .. Sticky-end ligation was performed with T4 DNA-ligase according to Thermo Scientific protocol. pRS315CG was obtained analogously from pRS316CG (Serio et al., ) and pRS315. pR16CUP-NM-yTagRFP-T plasmid was obtained by insertion of the XhoI-XhoI fragment from pCUP-NM-His6 (Kiktev et al., ) in place of the XhoI-SalI fragment of pR16CUP-SFP1C-yTagRFP-T which in turn resulted from the substitution of the PstI-PstI fragment in pR16CUP-SFP1-Cerulean (Matveenko et al., ) for the PstI-PstI fragment from pIM35 (Malcova et al., ). ..

    Positron Emission Tomography:

    Article Title: Characterization of the Expression and Functions of Two Odorant-Binding Proteins of Sitophilus zeamais Motschulsky (Coleoptera: Curculionoidea)
    Article Snippet: The PCR protocol was as follows: initial denaturation at 98 °C for 30 s, followed by 40 cycles of 98 °C for 10 s, 58 °C for 15 s (pET-SzeaOBP1) or 57 °C for 15s (pET-SzeaOBP28), and 72 °C for 30 s, and a final extension at 72 °C for 5 min. .. Ligation was performed with T4 DNA ligase (Thermo Fisher Scientific, Waltham, MA, USA) in 25 μL reactions, which were kept at 22 °C for 2–4 h for completion of the reaction.

    Article Title: Antiviral activity of interleukin-11 as a response to porcine epidemic diarrhea virus infection
    Article Snippet: .. The cDNA fragment encoding the pIL-11 was inserted into vector pET-32a vector by T4 DNA ligase (Thermo Scientific) to generate the recombinant plasmid pET-32a-pIL-11. .. Finally, pET-32a-pIL-11 was transformed into BL21 (DE3), while the recombinant mpIL-11 was purified by a Ni–NTA column and removed Trx-tags by Enterokinase (EK) (Sangon Biotech, Shanghai, China).

    Article Title: Design of a New [PSI+]-No-More Mutation in SUP35 With Strong Inhibitory Effect on the [PSI+] Prion Propagation
    Article Snippet: The vectors pRSU1 (Volkov et al., ), pRSU2 (Volkov et al., ), pRS316CUP-NM-GFP (Serio et al., ), pRS315CUP-NM-GFP and pET-20b-SUP35NM-His6 (Allen et al., ) were used as templates. .. Sticky-end ligation was performed with T4 DNA-ligase according to Thermo Scientific protocol. pRS315CG was obtained analogously from pRS316CG (Serio et al., ) and pRS315. pR16CUP-NM-yTagRFP-T plasmid was obtained by insertion of the XhoI-XhoI fragment from pCUP-NM-His6 (Kiktev et al., ) in place of the XhoI-SalI fragment of pR16CUP-SFP1C-yTagRFP-T which in turn resulted from the substitution of the PstI-PstI fragment in pR16CUP-SFP1-Cerulean (Matveenko et al., ) for the PstI-PstI fragment from pIM35 (Malcova et al., ).

    Agarose Gel Electrophoresis:

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: Finally, the two plasmids, pUC-PFUFT and pCB309 were digested using Spe I and Sac I, purified using a Universal DNA Purification kit (Tiangen Biotech Co., Ltd.) and ligated using T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.) to construct the final FSH1 dsRNAi plasmid, pCB309-PFUFT. .. Intermediate and final vectors were propagated in E. coli DH5α cells (Beijing Huayueyang Biotechnology Co., Ltd.), purified by plasmid mini-preparations (Nucleospin Plasmid kit; Macherey-Nagel GmbH and Co. KG) and confirmed by a series of restriction enzyme digestions, followed by 1% agarose gel electrophoresis.

    Colony Assay:

    Article Title: Electrostatic stabilization in a pre-organized polar active site: the catalytic role of Lys-80 in Candida tenuis xylose reductase (AKR2B5) probed by site-directed mutagenesis and functional complementation studies
    Article Snippet: To facilitate colony screening, the BshNI restriction site in the forward primer was deleted by introducing a silent mutation (marked in bold). .. The gel-purified amplification product was ligated with a T4 DNA ligase (MBI Fermentas).

    Produced:

    Article Title: A fast, efficient and sequence-independent method for flexible multiple segmental isotope labeling of RNA using ribozyme and RNase H cleavage
    Article Snippet: .. A typical large-scale ligation reaction using T4 DNA ligase was 10 μM in RNA fragments, 15 μM in DNA splint oligo, 10% PEG-4000 in 40 mM Tris–HCl pH = 7.8, 0.5 mM ATP, 10 mM MgCl2 , 10 mM DTT using 50 U T4 DNA ligase (fermentas) per nmol of RNA to be ligated or 2 μM final concentration of in-house produced T4 DNA ligase. .. The reactions were subjected to HPLC purification followed by n -butanol extraction and lyophilization.

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain
    Article Snippet: When these manufacturers were questioned, they stated that their T4 DNA ligases had very high quality and it was very unlikely that there would be PNK in their ligases because their ligases were produced by using E. coli cells and production lines that were different from those for T4 PNK. .. A quality inspection report of T4 DNA ligase from Fermentas showed that T4 PNK could not be detected in their T4 DNA ligase ( ); (iii) PNK could not be detected in T4 DNA ligase (Fermentas) by using mass spectrometry (MS) analysis ( and ); (iv) PNK is abundant in mammalian cells but absent in E. coli cells .

    Concentration Assay:

    Article Title: A fast, efficient and sequence-independent method for flexible multiple segmental isotope labeling of RNA using ribozyme and RNase H cleavage
    Article Snippet: .. A typical large-scale ligation reaction using T4 DNA ligase was 10 μM in RNA fragments, 15 μM in DNA splint oligo, 10% PEG-4000 in 40 mM Tris–HCl pH = 7.8, 0.5 mM ATP, 10 mM MgCl2 , 10 mM DTT using 50 U T4 DNA ligase (fermentas) per nmol of RNA to be ligated or 2 μM final concentration of in-house produced T4 DNA ligase. .. The reactions were subjected to HPLC purification followed by n -butanol extraction and lyophilization.

    DNA Purification:

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: The PCR mixture was as follows: 1.25U LA Taq (Takara Bio, Inc.), 1 µ l FSH1 plasmid (20 ng/µ l), 1 µ l FSH1-F primer, 1 µ l FSH1-R primer, 5 µ l 10X LA Taq Buffer, 4 µ l dNTP (2.5 mM), and ddH2 O up to a total volume of 50 µ l. The thermocycling conditions were as follows: Initial denaturation at 94°C for 1 min; followed by 30 cycles of 94°C for 30 sec, 55°C for 45 sec and 72°C for 30 sec, and a final extension 72°C for 10 min. PCR products were gel purified using a Universal DNA Purification kit (Tiangen Biotech Co., Ltd.). .. First, the purified product of PCR for the FSH1 gene was ligated into pUC-PUT following DNA digestion with Xho I and Hin dIII, and ligated by T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.).

    Article Title: FSH1 regulates the phenotype and pathogenicity of the pathogenic dermatophyte Microsporum canis
    Article Snippet: .. Finally, the two plasmids, pUC-PFUFT and pCB309 were digested using Spe I and Sac I, purified using a Universal DNA Purification kit (Tiangen Biotech Co., Ltd.) and ligated using T4 DNA ligase (Invitrogen; Thermo Fisher Scientific, Inc.) to construct the final FSH1 dsRNAi plasmid, pCB309-PFUFT. .. Intermediate and final vectors were propagated in E. coli DH5α cells (Beijing Huayueyang Biotechnology Co., Ltd.), purified by plasmid mini-preparations (Nucleospin Plasmid kit; Macherey-Nagel GmbH and Co. KG) and confirmed by a series of restriction enzyme digestions, followed by 1% agarose gel electrophoresis.

    Hood:

    Article Title: Mapping three-dimensional genome architecture through in situ DNase Hi-C
    Article Snippet: Formaldehyde should be handled using appropriate protective equipment, and be handled in a chemical fume hood. .. Glycine (Sigma-Aldrich 50046) NEBuffer 2 (NEB B7002S) 10% (wt/vol) UltraPure SDS (Life Tech 15553-027) DNase I, RNase-free (supplied with MnCl2 and reaction buffer) (1 U/μL) (Thermo Scientific EN0525) RNase A, DNase and protease-free (10 mg/ml) (Thermo Scientific EN0531) Klenow Fragment (10 U/μL) (Thermo Scientific EP0052) Klenow Fragment (exo– ) (5 U/μL) (Thermo Scientific EP0422) T4 DNA Polymerase (5 U/μL) (Thermo Scientific EP0062) T4 DNA Ligase (5 U/μL) provided with 50% PEG-4000 (Thermo Scientific EL0012) T4 Polynucleotide Kinase (10 U/μL) (Thermo Scientific EK0032) 10X T4 DNA Ligase Buffer w/ATP (NEB B0202S) Agencourt AMPure XP (Beckman Coulter ) 2X HotStart PCR ReadyMix (KAPA KK2601) Fast DNA End Repair Kit (Thermo Scientific K0771) Proteinase K (Thermo Scientific EO0492) FastDigest® BamHI (Thermo Scientific FERFD0504) Dynabeads® MyOne™ Streptavidin C1 (Life Tech 65001) dNTP Set (100 mM 4x 0.25ml) (Thermo Scientific FERR0181) 100 bp DNA ladder (Thermo Scientific SM0243) GlycoBlue (Ambion AM9516) 3 M Sodium acetate (pH 5.2) (Cellgro 46-033-CI) Ethanol (Decon Labs Inc. 2716) CAUTION!

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher t4 dna ligase
    Enzymatic ligation of T. cruzi cap‐4 spliced leader RNA using <t>T4</t> DNA ligase. A) RNA sequences and sequence of the 20‐nt DNA splint; B) HPLC analysis of a typical ligation reaction after 3 h reaction time; reaction conditions: 10 μ m RNA 10 , 12.5 μ m RNA 11 , 12.5 μ m splint; 0.5 m m ATP, 40 m m Tris ⋅ HCl (pH 7.8), 10 m m MgCl 2 , 10 m m DTT, 5 % ( w / v ) PEG 4000, 0.5 U μL −1 T4 DNA ligase; C) LC–ESI mass spectrum of the purified 39‐nt cap‐4 RNA ligation product.
    T4 Dna Ligase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 382 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/Thermo Fisher
    Average 99 stars, based on 382 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Enzymatic ligation of T. cruzi cap‐4 spliced leader RNA using T4 DNA ligase. A) RNA sequences and sequence of the 20‐nt DNA splint; B) HPLC analysis of a typical ligation reaction after 3 h reaction time; reaction conditions: 10 μ m RNA 10 , 12.5 μ m RNA 11 , 12.5 μ m splint; 0.5 m m ATP, 40 m m Tris ⋅ HCl (pH 7.8), 10 m m MgCl 2 , 10 m m DTT, 5 % ( w / v ) PEG 4000, 0.5 U μL −1 T4 DNA ligase; C) LC–ESI mass spectrum of the purified 39‐nt cap‐4 RNA ligation product.

    Journal: Chembiochem

    Article Title: Practical Synthesis of Cap‐4 RNA

    doi: 10.1002/cbic.201900590

    Figure Lengend Snippet: Enzymatic ligation of T. cruzi cap‐4 spliced leader RNA using T4 DNA ligase. A) RNA sequences and sequence of the 20‐nt DNA splint; B) HPLC analysis of a typical ligation reaction after 3 h reaction time; reaction conditions: 10 μ m RNA 10 , 12.5 μ m RNA 11 , 12.5 μ m splint; 0.5 m m ATP, 40 m m Tris ⋅ HCl (pH 7.8), 10 m m MgCl 2 , 10 m m DTT, 5 % ( w / v ) PEG 4000, 0.5 U μL −1 T4 DNA ligase; C) LC–ESI mass spectrum of the purified 39‐nt cap‐4 RNA ligation product.

    Article Snippet: The 38‐nt T. cruzi cap‐4 RNA was prepared by splinted enzymatic ligation of an 11‐nt cap‐4 RNA and a chemically synthesized 5′‐phosphorylated 27‐nt RNA by using T4 DNA ligase (Thermo Fisher) in analogy to ref. .

    Techniques: Ligation, Sequencing, High Performance Liquid Chromatography, Purification

    Single-stranded DNA ligation with T4 DNA ligase and CircLigase. A pool of 60 nt acceptor oligonucleotides (‘60N’) were ligated to 10 pmol of a 3΄ biotinylated donor oligonucleotide (CL78) using either T4 DNA ligase in the presence of a splinter oligonucleotide (TL38) or CircLigase. Ligation products were visualized on a 10% denaturing polyacrylamide gel stained with SybrGold. Band shifts from 60 nt to 80 nt indicate successful ligation. Schematic overviews of the reaction schemes are shown on top. The scheme developed by Kwok et al . ( 19 ) is shown for comparison. M: Single-stranded DNA size marker.

    Journal: Nucleic Acids Research

    Article Title: Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase

    doi: 10.1093/nar/gkx033

    Figure Lengend Snippet: Single-stranded DNA ligation with T4 DNA ligase and CircLigase. A pool of 60 nt acceptor oligonucleotides (‘60N’) were ligated to 10 pmol of a 3΄ biotinylated donor oligonucleotide (CL78) using either T4 DNA ligase in the presence of a splinter oligonucleotide (TL38) or CircLigase. Ligation products were visualized on a 10% denaturing polyacrylamide gel stained with SybrGold. Band shifts from 60 nt to 80 nt indicate successful ligation. Schematic overviews of the reaction schemes are shown on top. The scheme developed by Kwok et al . ( 19 ) is shown for comparison. M: Single-stranded DNA size marker.

    Article Snippet: Splinted end-to-end ligation of single-stranded DNA using T4 DNA ligase To explore the efficiency of splinted end-to-end ligation of single stranded DNA with T4 DNA ligase in the absence of hair-pin structures, we designed a ligation scheme where the splinter oligonucleotide is hybridized to a biotinylated adapter oligonucleotide (the donor), allowing for subsequent immobilization of ligation products on beads and removal of the splinter by mild heat treatment.

    Techniques: DNA Ligation, Ligation, Staining, Marker

    Library preparation methods for highly degraded DNA. ( A ) In the single-stranded library preparation method described here (ssDNA2.0), DNA fragments (black) are 5΄ and 3΄ dephosphorylated and separated into single strands by heat denaturation. 3΄ biotinylated adapter molecules (red) are attached to the 3΄ ends of the DNA fragments via hybridization to a stretch of six random nucleotides (marked as ‘N’) belonging to a splinter oligonucleotide complementary to the adapter and nick closure with T4 DNA ligase. Following the immobilization of the ligation products on streptavidin-coated beads, the splinter oligonucleotide is removed by bead wash at an elevated temperature. Synthesis of the second strand is carried out using the Klenow fragment of Escherichia coli DNA polymerase I and a primer with phosphorothioate backbone modifications (red stars) to prevent exonucleolytic degradation. Unincorporated primers are removed through a bead wash at an elevated temperature, preventing the formation of adapter dimers in the subsequent blunt-end ligation reaction, which is again catalyzed by T4 DNA ligase. Adapter self-ligation is prevented through a 3΄ dideoxy modification in the adapter. The final library strand is released from the beads by heat denaturation. ( B ) In the single-stranded library preparation method originally described in Gansauge and Meyer, ( 4 ), the first adapter was attached through true single-stranded DNA ligation using CircLigase. The large fragment of Bst DNA polymerase was used to copy the template strand, leaving overhanging 3΄ nucleotides, which had to be removed in a blunt-end repair reaction using T4 DNA polymerase. ( C ) The ‘454’ method of double-stranded library preparation in the implementation of Meyer and Kircher, ( 23 ), is based on non-directional blunt-end ligation of a mixture of two adapters to blunt-end repaired DNA fragments using T4 DNA ligase. To prevent adapter self-ligation, no phosphate groups are present at the 5΄ ends of the adapters, resulting in the ligation of the adapter strands only and necessitating subsequent nick fill-in with a strand-displacing polymerase. Intermittent DNA purification steps are required in-between enzymatic reactions. ( D ) The ‘Illumina’ method of double-stranded library preparation, shown here as implemented in New England Biolabs’ NEBNext Ultra II kit, requires the addition of A-overhangs (marked as ‘A’) to blunt-end repaired DNA fragments using a 3΄-5΄ exonuclease deletion mutant of the Klenow fragment of E. coli DNA polymerase I. Both adapter sequences are combined into one bell-shaped structure, which carries a 3΄ T overhang to allow sticky end ligation with T4 DNA ligase. Following ligation, adapter strands are separated by excision of uracil. Excess adapters and adapter dimers are removed through size-selective purification.

    Journal: Nucleic Acids Research

    Article Title: Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase

    doi: 10.1093/nar/gkx033

    Figure Lengend Snippet: Library preparation methods for highly degraded DNA. ( A ) In the single-stranded library preparation method described here (ssDNA2.0), DNA fragments (black) are 5΄ and 3΄ dephosphorylated and separated into single strands by heat denaturation. 3΄ biotinylated adapter molecules (red) are attached to the 3΄ ends of the DNA fragments via hybridization to a stretch of six random nucleotides (marked as ‘N’) belonging to a splinter oligonucleotide complementary to the adapter and nick closure with T4 DNA ligase. Following the immobilization of the ligation products on streptavidin-coated beads, the splinter oligonucleotide is removed by bead wash at an elevated temperature. Synthesis of the second strand is carried out using the Klenow fragment of Escherichia coli DNA polymerase I and a primer with phosphorothioate backbone modifications (red stars) to prevent exonucleolytic degradation. Unincorporated primers are removed through a bead wash at an elevated temperature, preventing the formation of adapter dimers in the subsequent blunt-end ligation reaction, which is again catalyzed by T4 DNA ligase. Adapter self-ligation is prevented through a 3΄ dideoxy modification in the adapter. The final library strand is released from the beads by heat denaturation. ( B ) In the single-stranded library preparation method originally described in Gansauge and Meyer, ( 4 ), the first adapter was attached through true single-stranded DNA ligation using CircLigase. The large fragment of Bst DNA polymerase was used to copy the template strand, leaving overhanging 3΄ nucleotides, which had to be removed in a blunt-end repair reaction using T4 DNA polymerase. ( C ) The ‘454’ method of double-stranded library preparation in the implementation of Meyer and Kircher, ( 23 ), is based on non-directional blunt-end ligation of a mixture of two adapters to blunt-end repaired DNA fragments using T4 DNA ligase. To prevent adapter self-ligation, no phosphate groups are present at the 5΄ ends of the adapters, resulting in the ligation of the adapter strands only and necessitating subsequent nick fill-in with a strand-displacing polymerase. Intermittent DNA purification steps are required in-between enzymatic reactions. ( D ) The ‘Illumina’ method of double-stranded library preparation, shown here as implemented in New England Biolabs’ NEBNext Ultra II kit, requires the addition of A-overhangs (marked as ‘A’) to blunt-end repaired DNA fragments using a 3΄-5΄ exonuclease deletion mutant of the Klenow fragment of E. coli DNA polymerase I. Both adapter sequences are combined into one bell-shaped structure, which carries a 3΄ T overhang to allow sticky end ligation with T4 DNA ligase. Following ligation, adapter strands are separated by excision of uracil. Excess adapters and adapter dimers are removed through size-selective purification.

    Article Snippet: Splinted end-to-end ligation of single-stranded DNA using T4 DNA ligase To explore the efficiency of splinted end-to-end ligation of single stranded DNA with T4 DNA ligase in the absence of hair-pin structures, we designed a ligation scheme where the splinter oligonucleotide is hybridized to a biotinylated adapter oligonucleotide (the donor), allowing for subsequent immobilization of ligation products on beads and removal of the splinter by mild heat treatment.

    Techniques: Hybridization, Ligation, Modification, DNA Ligation, DNA Purification, Mutagenesis, Purification

    Effects of single-stranded ligation schemes on library characteristics. ( A ) Informative sequence content of libraries prepared with CircLigase and T4 DNA ligase as a function of the input volume of ancient DNA extract used for library preparation. ( B ) Average GC content of the sequences obtained with the two ligation schemes. Note that the average GC content exceeds that of a typical mammalian genome because most sequences derive from microbial DNA, which is the dominant source of DNA in most ancient bones. ( C ) Fragment size distribution in the libraries as inferred from overlap-merged paired-end reads. Short artifacts in the library prepared from extremely little input DNA (corresponding to ∼1 mg bone) are mainly due to the incorporation of splinter fragments. ( D ) Frequencies of damage-induced C to T substitutions near the 5΄ and 3΄ ends of sequences.

    Journal: Nucleic Acids Research

    Article Title: Single-stranded DNA library preparation from highly degraded DNA using T4 DNA ligase

    doi: 10.1093/nar/gkx033

    Figure Lengend Snippet: Effects of single-stranded ligation schemes on library characteristics. ( A ) Informative sequence content of libraries prepared with CircLigase and T4 DNA ligase as a function of the input volume of ancient DNA extract used for library preparation. ( B ) Average GC content of the sequences obtained with the two ligation schemes. Note that the average GC content exceeds that of a typical mammalian genome because most sequences derive from microbial DNA, which is the dominant source of DNA in most ancient bones. ( C ) Fragment size distribution in the libraries as inferred from overlap-merged paired-end reads. Short artifacts in the library prepared from extremely little input DNA (corresponding to ∼1 mg bone) are mainly due to the incorporation of splinter fragments. ( D ) Frequencies of damage-induced C to T substitutions near the 5΄ and 3΄ ends of sequences.

    Article Snippet: Splinted end-to-end ligation of single-stranded DNA using T4 DNA ligase To explore the efficiency of splinted end-to-end ligation of single stranded DNA with T4 DNA ligase in the absence of hair-pin structures, we designed a ligation scheme where the splinter oligonucleotide is hybridized to a biotinylated adapter oligonucleotide (the donor), allowing for subsequent immobilization of ligation products on beads and removal of the splinter by mild heat treatment.

    Techniques: Ligation, Sequencing, Ancient DNA Assay

    DNA barcoding experimental scheme. Target DNA strands are immobilized on a microscope slide, and dye-labeled barcodes are introduced together with T4 DNA ligase in the microfluidic chamber (1). Complementary barcodes bind transiently to the target site (2), whereas mismatched barcodes bind on an even shorter timescale (2′). Successful ligation is observed for the complementary barcodes (3) but not for the mismatched barcodes (3′). Ligation product shows stable binding to the target DNA (4), whereas mismatched barcodes dissociate and are washed away before imaging. To see this figure in color, go online.

    Journal: Biophysical Journal

    Article Title: Multiplex Single-Molecule DNA Barcoding Using an Oligonucleotide Ligation Assay

    doi: 10.1016/j.bpj.2018.08.013

    Figure Lengend Snippet: DNA barcoding experimental scheme. Target DNA strands are immobilized on a microscope slide, and dye-labeled barcodes are introduced together with T4 DNA ligase in the microfluidic chamber (1). Complementary barcodes bind transiently to the target site (2), whereas mismatched barcodes bind on an even shorter timescale (2′). Successful ligation is observed for the complementary barcodes (3) but not for the mismatched barcodes (3′). Ligation product shows stable binding to the target DNA (4), whereas mismatched barcodes dissociate and are washed away before imaging. To see this figure in color, go online.

    Article Snippet: For ligation, T4 DNA ligase was used in standard conditions (25°C, 10 mM MgCl2 ), and the GC content of the target site was ∼50%.

    Techniques: Microscopy, Labeling, Ligation, Binding Assay, Imaging

    Principles of library preparation methods for whole genome bisulphite sequencing. In the conventional workflow (MethylC-seq) methylated adapters are ligated to double stranded sheared DNA fragments. The constructs are then bisulphite converted prior to amplification with a uracil reading PCR polymerase. The Accel-NGS Methyl-Seq uses the proprietary Adaptase™ technology to attach a low complexity sequence tail to the 3΄-termini of pre-sheared and bisulphite-converted DNA, and an adapter sequence. After an extension step a second adapter is ligated and the libraries are PCR amplified. The TruSeq DNA Methylation method (formerly EpiGnome) uses random hexamer tagged oligonucleotides to simultaneously copy the bisulphite-converted strand and add a 5΄-terminal adaptor sequence. In a subsequent step, a 3΄-terminal adapter is tagged, also by using a random sequence oligonucleotide. In the SPLAT protocol adapters with a protruding random hexamer are annealed to the 3΄-termini of the single stranded DNA. The random hexamer acts as a ‘splint’ and the adapter sequence is ligated to the 3΄-termini of single stranded DNA using standard T4 DNA ligation. A modification of the last 3΄- residue of the random hexamer is required to prevent self-ligation of the adapter. In a second step, adapters with a 5΄-terminal random hexamer overhang is annealed to ligate the 5΄-termini of the single stranded DNA, also using T4 DNA ligase. Finally the SPLAT libraries are PCR amplified using a uracil reading polymerase.

    Journal: Nucleic Acids Research

    Article Title: SPlinted Ligation Adapter Tagging (SPLAT), a novel library preparation method for whole genome bisulphite sequencing

    doi: 10.1093/nar/gkw1110

    Figure Lengend Snippet: Principles of library preparation methods for whole genome bisulphite sequencing. In the conventional workflow (MethylC-seq) methylated adapters are ligated to double stranded sheared DNA fragments. The constructs are then bisulphite converted prior to amplification with a uracil reading PCR polymerase. The Accel-NGS Methyl-Seq uses the proprietary Adaptase™ technology to attach a low complexity sequence tail to the 3΄-termini of pre-sheared and bisulphite-converted DNA, and an adapter sequence. After an extension step a second adapter is ligated and the libraries are PCR amplified. The TruSeq DNA Methylation method (formerly EpiGnome) uses random hexamer tagged oligonucleotides to simultaneously copy the bisulphite-converted strand and add a 5΄-terminal adaptor sequence. In a subsequent step, a 3΄-terminal adapter is tagged, also by using a random sequence oligonucleotide. In the SPLAT protocol adapters with a protruding random hexamer are annealed to the 3΄-termini of the single stranded DNA. The random hexamer acts as a ‘splint’ and the adapter sequence is ligated to the 3΄-termini of single stranded DNA using standard T4 DNA ligation. A modification of the last 3΄- residue of the random hexamer is required to prevent self-ligation of the adapter. In a second step, adapters with a 5΄-terminal random hexamer overhang is annealed to ligate the 5΄-termini of the single stranded DNA, also using T4 DNA ligase. Finally the SPLAT libraries are PCR amplified using a uracil reading polymerase.

    Article Snippet: After bisulphite conversion, short double stranded adapters (20 nucleotides) comprising a random 3΄ overhang are annealed to the 3΄ ends of the ssDNA and ligated using T4 DNA ligase.

    Techniques: Bisulfite Sequencing, Methylation, Construct, Amplification, Polymerase Chain Reaction, Next-Generation Sequencing, Sequencing, DNA Methylation Assay, Random Hexamer Labeling, DNA Ligation, Modification, Ligation