Structured Review

TaKaRa t4 dna ligase
Dependence of the efficiency of DNA ligation using <t>T4</t> DNA ligase immobilized on ferromagnetic particles in the absence of a magnetic field on the ambient temperature. The ordinate axis represents the ligation efficiency, which is normalized by that at 16 °C. The standard deviations are obtained from 6 independent experiments.
T4 Dna Ligase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 297 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/t4 dna ligase/product/TaKaRa
Average 99 stars, based on 297 article reviews
Price from $9.99 to $1999.99
t4 dna ligase - by Bioz Stars, 2020-04
99/100 stars

Images

1) Product Images from "Efficient DNA ligation by selective heating of DNA ligase with a radio frequency alternating magnetic field"

Article Title: Efficient DNA ligation by selective heating of DNA ligase with a radio frequency alternating magnetic field

Journal: Biochemistry and Biophysics Reports

doi: 10.1016/j.bbrep.2016.10.006

Dependence of the efficiency of DNA ligation using T4 DNA ligase immobilized on ferromagnetic particles in the absence of a magnetic field on the ambient temperature. The ordinate axis represents the ligation efficiency, which is normalized by that at 16 °C. The standard deviations are obtained from 6 independent experiments.
Figure Legend Snippet: Dependence of the efficiency of DNA ligation using T4 DNA ligase immobilized on ferromagnetic particles in the absence of a magnetic field on the ambient temperature. The ordinate axis represents the ligation efficiency, which is normalized by that at 16 °C. The standard deviations are obtained from 6 independent experiments.

Techniques Used: DNA Ligation, Ligation

Dependence of the efficiency of DNA ligation using T4 DNA ligase immobilized on ferromagnetic particles under an ac magnetic field of 0.34 MHz on the amplitude of the magnetic field. The ambient temperature is 16 °C. The ordinate axis represents the ligation efficiency under an ac magnetic field, which is normalized by that in the absence of a magnetic field. The inset shows the ligation efficiency under the ac magnetic field as a function of the average surface temperature of ferromagnetic particles, noting that the surface temperature increases with an increase in the field amplitude. The standard deviations are obtained from 6 independent experiments.
Figure Legend Snippet: Dependence of the efficiency of DNA ligation using T4 DNA ligase immobilized on ferromagnetic particles under an ac magnetic field of 0.34 MHz on the amplitude of the magnetic field. The ambient temperature is 16 °C. The ordinate axis represents the ligation efficiency under an ac magnetic field, which is normalized by that in the absence of a magnetic field. The inset shows the ligation efficiency under the ac magnetic field as a function of the average surface temperature of ferromagnetic particles, noting that the surface temperature increases with an increase in the field amplitude. The standard deviations are obtained from 6 independent experiments.

Techniques Used: DNA Ligation, Ligation

Related Articles

Clone Assay:

Article Title: Genetic Analysis of Four Sexual Differentiation Process Proteins (isp4/SDPs) in Chaetomium thermophilum and Thermomyces lanuginosus Reveals Their Distinct Roles in Development
Article Snippet: PCR cloning and analyses were performed using high fidelity fusion polymerase (Fermentas). .. Restriction enzymes, T4 DNA ligase, SYBR Premix Ex Taq and other DNA-modifying enzymes were used as recommended by the suppliers (TaKaRa, Dalian).

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan). .. DNA sequencing of positive clones was performed by Shanghai Sangon Biotech (China).

Article Title: High-level expression of Thermomyces dupontii thermo-alkaline lipase in Pichia pastoris under the control of different promoters
Article Snippet: .. DNA polymerase (PrimeSTARTMHS ), restriction enzymes (EcoRI, NotI and SacI), in-fusion cloning kit and T4 -DNA ligase were purchased from Takara Biotechnology (Dalian, China). .. The gene of TDL (GenBank: ) without signal sequence was optimized according to the preference of P. pastoris and synthesized by the Genewiz (Suzhou, China).

Article Title: hsa-miR-155 targeted NCSTN 3’UTR mutation promotes the pathogenesis and development of acne inversa
Article Snippet: .. The PCR products were cloned downstream of the Renilla luciferase gene containing psiCHECK-2 vector, generating a psiCHECK-2-3’UTR-NCSNT (termed wt- NCSTN ), using T4 DNA Ligase (TaKaRa, Dalian, China, Cat. No. D2011A). .. On the following day, a single clone was randomly selected and a reconstructed plasmid was extracted (AXYGEN, California, USA, Cat. No. AP-MN-P-50) for digestion, PCR, and identification of sequences.

Amplification:

Article Title: SINE Retrotransposon variation drives Ecotypic disparity in natural populations of Coilia nasus
Article Snippet: Isolation and identification of SINEs Genomic DNA enrichment was performed according to the amplified fragment length polymorphism (AFLP) technique as described previously [ ]. .. The genomic DNA was digested with EcoR1 and BcII (Takara, China), purified, and ligated to either the EcoRI adaptor [ ] or the modified MseI adaptor (Additional file : Table S1) using T4 DNA ligase (Takara, China).

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: .. Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan). .. The recombinant plasmid was transformed into competent E. coli BL21(DE3) cells, cultured in LB broth, and then detected by colony PCR.

Article Title: Identification of Azole Resistance Markers in Clinical Isolates of Candida tropicalis Using cDNA‐AFLP Method
Article Snippet: Briefly, it was conducted 1 min at 50°C, decreasing to 10°C over 1 h (i.e., 1°C/1.5 min) and then 6 U T4 DNA Ligase (Takara, Tokyo, Japan) was added and incubated at 16°C for 16 h. The preamplification was performed with preamp primers (Table ) on ligated fragments according to the following PCR conditions: 5 min of denaturation at 94°C; 30 cycles of 94°C for 30 sec; 63°C, 30 sec; 72°C, 30 sec; and final extension at 72°C for 5 min. .. The sensitive amplification was performed using sensitive primers with the same preamplification PCR conditions.

Reporter Assay:

Article Title: Role of Nkx2.5 in H2O2-induced Nsd1 suppression
Article Snippet: H2 O2 treatment was performed at 0.25 mmol/L, 0.5 mmol/L, and 1 mmol/L for 1 h and 0.25 mmol/L and 0.5 mmol/L for 2 h. The dual luciferase reporter assay system, pGL3-basic, and pRL-TK were obtained from Promega (Madison, WI, USA). .. Restriction endonuclease, T4 DNA ligase, T4 polynucleotide kinase, Taq polymerase, and PrimeSTAR Max DNA Polymerase were purchased from TaKaRa Biotech (TaKaRa, Dalian, China).

Article Title: hsa-miR-155 targeted NCSTN 3’UTR mutation promotes the pathogenesis and development of acne inversa
Article Snippet: Paragraph title: Dual luciferase reporter assay ... The PCR products were cloned downstream of the Renilla luciferase gene containing psiCHECK-2 vector, generating a psiCHECK-2-3’UTR-NCSNT (termed wt- NCSTN ), using T4 DNA Ligase (TaKaRa, Dalian, China, Cat. No. D2011A).

Mass Spectrometry:

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Based on the result of MS analysis and sequence alignment, the recombinant plasmids pET-32a-VDAC2 ( ) and pET-32a-RACK1 were constructed. .. Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan).

Synthesized:

Article Title: Efficient Synthesis of Methyl 3-Acetoxypropionate by a Newly Identified Baeyer-Villiger Monooxygenase
Article Snippet: .. Primers were synthesized by Shanghai Generay Biotech Co., and DNA polymerases, restriction enzymes, and T4 DNA ligase were from TaKaRa (Dalian, China). .. The 5-ml HisTrap FF crude column was supplied by GE Healthcare.

Article Title: High-level expression of Thermomyces dupontii thermo-alkaline lipase in Pichia pastoris under the control of different promoters
Article Snippet: DNA polymerase (PrimeSTARTMHS ), restriction enzymes (EcoRI, NotI and SacI), in-fusion cloning kit and T4 -DNA ligase were purchased from Takara Biotechnology (Dalian, China). .. The gene of TDL (GenBank: ) without signal sequence was optimized according to the preference of P. pastoris and synthesized by the Genewiz (Suzhou, China).

Article Title: Molecular modification, expression and purification of new subtype antioxidant peptide from Pinctada fucata by recombinant Escherichia coli to improve antioxidant-activity
Article Snippet: NPFMAP sequence and primers were synthesized by Sangon (Shanghai, China). .. DNA markers of 500 bp and 2000 bp, T4 DNA ligase, and restriction endonucleases ( Bam H I and Xho I) were from TaKaRa.

Construct:

Article Title: Genetic Analysis of Four Sexual Differentiation Process Proteins (isp4/SDPs) in Chaetomium thermophilum and Thermomyces lanuginosus Reveals Their Distinct Roles in Development
Article Snippet: Using the same strategy, double and triple gene expression vectors were constructed, after which the ΔTlSDP /CtSDP12 , ΔTlSDP /CtSDP13 , ΔTlSDP /CtSDP23 , and ΔTlSDP /CtSDP123 mutant strains were obtained. .. Restriction enzymes, T4 DNA ligase, SYBR Premix Ex Taq and other DNA-modifying enzymes were used as recommended by the suppliers (TaKaRa, Dalian).

Article Title: Functional tag SNPs inside the DRD2 gene as a genetic risk factor for major depressive disorder in the Chinese Han population
Article Snippet: Paragraph title: Intronic reporter constructs ... Two products were immediately added into the Sac I and Xho I sites of the pmirGlo du-luciferase reporter gene vector (Promega, Madison, WI, USA) utilizing T4 DNA ligase (TaKaRa, Dalian, China).

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Based on the result of MS analysis and sequence alignment, the recombinant plasmids pET-32a-VDAC2 ( ) and pET-32a-RACK1 were constructed. .. Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan).

Article Title: hsa-miR-155 targeted NCSTN 3’UTR mutation promotes the pathogenesis and development of acne inversa
Article Snippet: PCR products and psiCHECK-2 were digested using Xho I (TaKaRa, Dalian, China, Cat. No. D1094A) and Not I (TaKaRa, Dalian, China, Cat. No. 1166BH) to construct wild type recombinant plasmid. .. The PCR products were cloned downstream of the Renilla luciferase gene containing psiCHECK-2 vector, generating a psiCHECK-2-3’UTR-NCSNT (termed wt- NCSTN ), using T4 DNA Ligase (TaKaRa, Dalian, China, Cat. No. D2011A).

Gene Assay:

Article Title: Functional tag SNPs inside the DRD2 gene as a genetic risk factor for major depressive disorder in the Chinese Han population
Article Snippet: A reported gene assay system was used to investigate the possible effect of rs7131056 polymorphisms located in intron 2 of the DRD2 gene on the transcription activity. .. Two products were immediately added into the Sac I and Xho I sites of the pmirGlo du-luciferase reporter gene vector (Promega, Madison, WI, USA) utilizing T4 DNA ligase (TaKaRa, Dalian, China).

Incubation:

Article Title: Functional tag SNPs inside the DRD2 gene as a genetic risk factor for major depressive disorder in the Chinese Han population
Article Snippet: Two products were immediately added into the Sac I and Xho I sites of the pmirGlo du-luciferase reporter gene vector (Promega, Madison, WI, USA) utilizing T4 DNA ligase (TaKaRa, Dalian, China). .. Plasmids with varying alleles were transfected into MES23.5 cells using Lipofectamine 2000TM (Life Technologies, Carlsbad, CA, USA) and incubated for 48 h. Luciferase activity was established with the Dual-Glo Luciferase Assay system (Promega, Madison, WI, USA) and a Luminoskan Ascent luminometer (Thermo Labsystems, Helsinki, Finland) utilizing Renilla luciferase activity to quantify transcriptional activity with normalization by Firefly luciferase activity in every assay (i.e., in the identical well).

Article Title: Identification of Azole Resistance Markers in Clinical Isolates of Candida tropicalis Using cDNA‐AFLP Method
Article Snippet: .. Briefly, it was conducted 1 min at 50°C, decreasing to 10°C over 1 h (i.e., 1°C/1.5 min) and then 6 U T4 DNA Ligase (Takara, Tokyo, Japan) was added and incubated at 16°C for 16 h. The preamplification was performed with preamp primers (Table ) on ligated fragments according to the following PCR conditions: 5 min of denaturation at 94°C; 30 cycles of 94°C for 30 sec; 63°C, 30 sec; 72°C, 30 sec; and final extension at 72°C for 5 min. .. The sensitive amplification was performed using sensitive primers with the same preamplification PCR conditions.

Luciferase:

Article Title: Functional tag SNPs inside the DRD2 gene as a genetic risk factor for major depressive disorder in the Chinese Han population
Article Snippet: Two products were immediately added into the Sac I and Xho I sites of the pmirGlo du-luciferase reporter gene vector (Promega, Madison, WI, USA) utilizing T4 DNA ligase (TaKaRa, Dalian, China). .. Plasmids with varying alleles were transfected into MES23.5 cells using Lipofectamine 2000TM (Life Technologies, Carlsbad, CA, USA) and incubated for 48 h. Luciferase activity was established with the Dual-Glo Luciferase Assay system (Promega, Madison, WI, USA) and a Luminoskan Ascent luminometer (Thermo Labsystems, Helsinki, Finland) utilizing Renilla luciferase activity to quantify transcriptional activity with normalization by Firefly luciferase activity in every assay (i.e., in the identical well).

Article Title: Role of Nkx2.5 in H2O2-induced Nsd1 suppression
Article Snippet: H2 O2 treatment was performed at 0.25 mmol/L, 0.5 mmol/L, and 1 mmol/L for 1 h and 0.25 mmol/L and 0.5 mmol/L for 2 h. The dual luciferase reporter assay system, pGL3-basic, and pRL-TK were obtained from Promega (Madison, WI, USA). .. Restriction endonuclease, T4 DNA ligase, T4 polynucleotide kinase, Taq polymerase, and PrimeSTAR Max DNA Polymerase were purchased from TaKaRa Biotech (TaKaRa, Dalian, China).

Article Title: hsa-miR-155 targeted NCSTN 3’UTR mutation promotes the pathogenesis and development of acne inversa
Article Snippet: .. The PCR products were cloned downstream of the Renilla luciferase gene containing psiCHECK-2 vector, generating a psiCHECK-2-3’UTR-NCSNT (termed wt- NCSTN ), using T4 DNA Ligase (TaKaRa, Dalian, China, Cat. No. D2011A). .. On the following day, a single clone was randomly selected and a reconstructed plasmid was extracted (AXYGEN, California, USA, Cat. No. AP-MN-P-50) for digestion, PCR, and identification of sequences.

Activity Assay:

Article Title: Functional tag SNPs inside the DRD2 gene as a genetic risk factor for major depressive disorder in the Chinese Han population
Article Snippet: A reported gene assay system was used to investigate the possible effect of rs7131056 polymorphisms located in intron 2 of the DRD2 gene on the transcription activity. .. Two products were immediately added into the Sac I and Xho I sites of the pmirGlo du-luciferase reporter gene vector (Promega, Madison, WI, USA) utilizing T4 DNA ligase (TaKaRa, Dalian, China).

Expressing:

Article Title: Genetic Analysis of Four Sexual Differentiation Process Proteins (isp4/SDPs) in Chaetomium thermophilum and Thermomyces lanuginosus Reveals Their Distinct Roles in Development
Article Snippet: Using the same strategy, double and triple gene expression vectors were constructed, after which the ΔTlSDP /CtSDP12 , ΔTlSDP /CtSDP13 , ΔTlSDP /CtSDP23 , and ΔTlSDP /CtSDP123 mutant strains were obtained. .. Restriction enzymes, T4 DNA ligase, SYBR Premix Ex Taq and other DNA-modifying enzymes were used as recommended by the suppliers (TaKaRa, Dalian).

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Paragraph title: Recombinant expression of VDAC2 and RACK1. ... Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan).

Article Title: High-level expression of Thermomyces dupontii thermo-alkaline lipase in Pichia pastoris under the control of different promoters
Article Snippet: P. pastoris X33 was purchased from Invitrogen (Carlsbad, CA, USA) and used as host for the expression of TDL. .. DNA polymerase (PrimeSTARTMHS ), restriction enzymes (EcoRI, NotI and SacI), in-fusion cloning kit and T4 -DNA ligase were purchased from Takara Biotechnology (Dalian, China).

Modification:

Article Title: Efficient DNA ligation by selective heating of DNA ligase with a radio frequency alternating magnetic field
Article Snippet: .. 2.1 Immobilization of T4 DNA ligase on ferromagnetic particles We immobilized T4 DNA ligase (EC 6.5.1.1, Takara Bio Inc.) on ferromagnetic iron particles, the surface of which had not been modified with any molecules (Spherical Ferromagnetic Iron Powder, Catalog No. 19844-1, Polysciences Inc.). .. The average diameter of the particles measured by an optical microscope (TE2000-U, Nikon Corp.) was 1.1 ± 0.5 μm.

Article Title: SINE Retrotransposon variation drives Ecotypic disparity in natural populations of Coilia nasus
Article Snippet: .. The genomic DNA was digested with EcoR1 and BcII (Takara, China), purified, and ligated to either the EcoRI adaptor [ ] or the modified MseI adaptor (Additional file : Table S1) using T4 DNA ligase (Takara, China). .. Genomic DNA was amplified by PCR with EcoRI and MseI primers (Additional file : Table S1).

Transformation Assay:

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan). .. The recombinant plasmid was transformed into competent E. coli BL21(DE3) cells, cultured in LB broth, and then detected by colony PCR.

Transfection:

Article Title: Functional tag SNPs inside the DRD2 gene as a genetic risk factor for major depressive disorder in the Chinese Han population
Article Snippet: Two products were immediately added into the Sac I and Xho I sites of the pmirGlo du-luciferase reporter gene vector (Promega, Madison, WI, USA) utilizing T4 DNA ligase (TaKaRa, Dalian, China). .. Plasmids with varying alleles were transfected into MES23.5 cells using Lipofectamine 2000TM (Life Technologies, Carlsbad, CA, USA) and incubated for 48 h. Luciferase activity was established with the Dual-Glo Luciferase Assay system (Promega, Madison, WI, USA) and a Luminoskan Ascent luminometer (Thermo Labsystems, Helsinki, Finland) utilizing Renilla luciferase activity to quantify transcriptional activity with normalization by Firefly luciferase activity in every assay (i.e., in the identical well).

Ligation:

Article Title: Manipulating the hydrophobicity of DNA as a universal strategy for visual biosensing.
Article Snippet: .. Current visual biosensing methods, including colorimetric-based, fluorescence-based and chemiluminescence-based methods, are inappropriate for the hundreds of millions of people affected by color blindness and color weakness. .. Current visual biosensing methods, including colorimetric-based, fluorescence-based and chemiluminescence-based methods, are inappropriate for the hundreds of millions of people affected by color blindness and color weakness.

Cell Culture:

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan). .. The recombinant plasmid was transformed into competent E. coli BL21(DE3) cells, cultured in LB broth, and then detected by colony PCR.

Article Title: Role of Nkx2.5 in H2O2-induced Nsd1 suppression
Article Snippet: Paragraph title: Cell culture and regents ... Restriction endonuclease, T4 DNA ligase, T4 polynucleotide kinase, Taq polymerase, and PrimeSTAR Max DNA Polymerase were purchased from TaKaRa Biotech (TaKaRa, Dalian, China).

cDNA-AFLP Assay:

Article Title: Identification of Azole Resistance Markers in Clinical Isolates of Candida tropicalis Using cDNA‐AFLP Method
Article Snippet: Paragraph title: cDNA‐AFLP ... Briefly, it was conducted 1 min at 50°C, decreasing to 10°C over 1 h (i.e., 1°C/1.5 min) and then 6 U T4 DNA Ligase (Takara, Tokyo, Japan) was added and incubated at 16°C for 16 h. The preamplification was performed with preamp primers (Table ) on ligated fragments according to the following PCR conditions: 5 min of denaturation at 94°C; 30 cycles of 94°C for 30 sec; 63°C, 30 sec; 72°C, 30 sec; and final extension at 72°C for 5 min.

DNA Sequencing:

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan). .. DNA sequencing of positive clones was performed by Shanghai Sangon Biotech (China).

Sequencing:

Article Title: Functional tag SNPs inside the DRD2 gene as a genetic risk factor for major depressive disorder in the Chinese Han population
Article Snippet: The PCR products had no sequence differences at any site, except for rs7131056 C/A. .. Two products were immediately added into the Sac I and Xho I sites of the pmirGlo du-luciferase reporter gene vector (Promega, Madison, WI, USA) utilizing T4 DNA ligase (TaKaRa, Dalian, China).

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Based on the result of MS analysis and sequence alignment, the recombinant plasmids pET-32a-VDAC2 ( ) and pET-32a-RACK1 were constructed. .. Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan).

Article Title: High-level expression of Thermomyces dupontii thermo-alkaline lipase in Pichia pastoris under the control of different promoters
Article Snippet: DNA polymerase (PrimeSTARTMHS ), restriction enzymes (EcoRI, NotI and SacI), in-fusion cloning kit and T4 -DNA ligase were purchased from Takara Biotechnology (Dalian, China). .. The gene of TDL (GenBank: ) without signal sequence was optimized according to the preference of P. pastoris and synthesized by the Genewiz (Suzhou, China).

Article Title: Molecular modification, expression and purification of new subtype antioxidant peptide from Pinctada fucata by recombinant Escherichia coli to improve antioxidant-activity
Article Snippet: NPFMAP sequence and primers were synthesized by Sangon (Shanghai, China). .. DNA markers of 500 bp and 2000 bp, T4 DNA ligase, and restriction endonucleases ( Bam H I and Xho I) were from TaKaRa.

Article Title: hsa-miR-155 targeted NCSTN 3’UTR mutation promotes the pathogenesis and development of acne inversa
Article Snippet: The 286 bp sequence of the NCSTN 3’UTR was inserted into the vector at the 3’ end of the hRluc ( Renilla luciferase) reporter gene. .. The PCR products were cloned downstream of the Renilla luciferase gene containing psiCHECK-2 vector, generating a psiCHECK-2-3’UTR-NCSNT (termed wt- NCSTN ), using T4 DNA Ligase (TaKaRa, Dalian, China, Cat. No. D2011A).

Binding Assay:

Article Title: hsa-miR-155 targeted NCSTN 3’UTR mutation promotes the pathogenesis and development of acne inversa
Article Snippet: The PCR products were cloned downstream of the Renilla luciferase gene containing psiCHECK-2 vector, generating a psiCHECK-2-3’UTR-NCSNT (termed wt- NCSTN ), using T4 DNA Ligase (TaKaRa, Dalian, China, Cat. No. D2011A). .. PsiCHECK-mt- NCSTN plasmid, containing a mutated binding site at the position 513-519 of NCSTN 3’UTR, was constructed using the following primers: 5’ACTGTCCTTTCTCCAGGCCCTCAGATGGCATTAGGGTGGGCGTGCTGCGGGTGGGTAT3’ (forward) and 5’ATACCCACCCGCAGCACGCCCACCCTAATGCCATCTGAGGGCCTGGAGAAAGGACAGT3’ (reverse).

DNA Extraction:

Article Title: Functional tag SNPs inside the DRD2 gene as a genetic risk factor for major depressive disorder in the Chinese Han population
Article Snippet: The MiniBEST Agarose Gel DNA Extraction Kit Ver.4.2 (TaKaRa, Dalian, China) was used to purify each allele from the PCR products in the gel, following which they were severed with Sac I and Xho I restriction enzymes. .. Two products were immediately added into the Sac I and Xho I sites of the pmirGlo du-luciferase reporter gene vector (Promega, Madison, WI, USA) utilizing T4 DNA ligase (TaKaRa, Dalian, China).

Mutagenesis:

Article Title: Genetic Analysis of Four Sexual Differentiation Process Proteins (isp4/SDPs) in Chaetomium thermophilum and Thermomyces lanuginosus Reveals Their Distinct Roles in Development
Article Snippet: Using the same strategy, double and triple gene expression vectors were constructed, after which the ΔTlSDP /CtSDP12 , ΔTlSDP /CtSDP13 , ΔTlSDP /CtSDP23 , and ΔTlSDP /CtSDP123 mutant strains were obtained. .. Restriction enzymes, T4 DNA ligase, SYBR Premix Ex Taq and other DNA-modifying enzymes were used as recommended by the suppliers (TaKaRa, Dalian).

Isolation:

Article Title: SINE Retrotransposon variation drives Ecotypic disparity in natural populations of Coilia nasus
Article Snippet: Paragraph title: Isolation and identification of SINEs ... The genomic DNA was digested with EcoR1 and BcII (Takara, China), purified, and ligated to either the EcoRI adaptor [ ] or the modified MseI adaptor (Additional file : Table S1) using T4 DNA ligase (Takara, China).

Flow Cytometry:

Article Title: Molecular modification, expression and purification of new subtype antioxidant peptide from Pinctada fucata by recombinant Escherichia coli to improve antioxidant-activity
Article Snippet: Chelating Sepharose Fast Flow column and glutathione S-transferase (GST)-Sefinose™ Resin were from Sangon. .. DNA markers of 500 bp and 2000 bp, T4 DNA ligase, and restriction endonucleases ( Bam H I and Xho I) were from TaKaRa.

Microscopy:

Article Title: Efficient DNA ligation by selective heating of DNA ligase with a radio frequency alternating magnetic field
Article Snippet: 2.1 Immobilization of T4 DNA ligase on ferromagnetic particles We immobilized T4 DNA ligase (EC 6.5.1.1, Takara Bio Inc.) on ferromagnetic iron particles, the surface of which had not been modified with any molecules (Spherical Ferromagnetic Iron Powder, Catalog No. 19844-1, Polysciences Inc.). .. 2.1 Immobilization of T4 DNA ligase on ferromagnetic particles We immobilized T4 DNA ligase (EC 6.5.1.1, Takara Bio Inc.) on ferromagnetic iron particles, the surface of which had not been modified with any molecules (Spherical Ferromagnetic Iron Powder, Catalog No. 19844-1, Polysciences Inc.).

Purification:

Article Title: Efficient Synthesis of Methyl 3-Acetoxypropionate by a Newly Identified Baeyer-Villiger Monooxygenase
Article Snippet: All chemicals and reagents were purchased from authentic suppliers, were of reagent grade or higher, and were used without further purification, unless otherwise specified. .. Primers were synthesized by Shanghai Generay Biotech Co., and DNA polymerases, restriction enzymes, and T4 DNA ligase were from TaKaRa (Dalian, China).

Article Title: SINE Retrotransposon variation drives Ecotypic disparity in natural populations of Coilia nasus
Article Snippet: .. The genomic DNA was digested with EcoR1 and BcII (Takara, China), purified, and ligated to either the EcoRI adaptor [ ] or the modified MseI adaptor (Additional file : Table S1) using T4 DNA ligase (Takara, China). .. Genomic DNA was amplified by PCR with EcoRI and MseI primers (Additional file : Table S1).

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan). .. E. coli BL21(DE3) cells containing recombinant plasmid pET-32a-VDAC2/pET-32a-RACK1 were cultured, and the expression of rVDAC2/rRACK1 was induced by adding 100 mM isopropyl-β- d -thiogalactopyranoside (1:100) (Solarbio, China). rVDAC2 and rRACK1 were purified using HisTrap Ni-NTA affinity chromatography (GE Healthcare, USA) with a protein purification apparatus according to the manufacturer’s instructions.

Article Title: Molecular modification, expression and purification of new subtype antioxidant peptide from Pinctada fucata by recombinant Escherichia coli to improve antioxidant-activity
Article Snippet: 4.0 and MiniBEST Plasmid Purification Kit Ver. .. DNA markers of 500 bp and 2000 bp, T4 DNA ligase, and restriction endonucleases ( Bam H I and Xho I) were from TaKaRa.

Article Title: Identification of Azole Resistance Markers in Clinical Isolates of Candida tropicalis Using cDNA‐AFLP Method
Article Snippet: Two micrograms purified dscDNA was digested with 5U EcoR1 restriction enzyme (Fermentas, Burlington, Canada) for 4 h at 37°C, and the enzyme was inactivated at 80°C for 20 min. .. Briefly, it was conducted 1 min at 50°C, decreasing to 10°C over 1 h (i.e., 1°C/1.5 min) and then 6 U T4 DNA Ligase (Takara, Tokyo, Japan) was added and incubated at 16°C for 16 h. The preamplification was performed with preamp primers (Table ) on ligated fragments according to the following PCR conditions: 5 min of denaturation at 94°C; 30 cycles of 94°C for 30 sec; 63°C, 30 sec; 72°C, 30 sec; and final extension at 72°C for 5 min.

Protein Purification:

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan). .. E. coli BL21(DE3) cells containing recombinant plasmid pET-32a-VDAC2/pET-32a-RACK1 were cultured, and the expression of rVDAC2/rRACK1 was induced by adding 100 mM isopropyl-β- d -thiogalactopyranoside (1:100) (Solarbio, China). rVDAC2 and rRACK1 were purified using HisTrap Ni-NTA affinity chromatography (GE Healthcare, USA) with a protein purification apparatus according to the manufacturer’s instructions.

Polymerase Chain Reaction:

Article Title: Genetic Analysis of Four Sexual Differentiation Process Proteins (isp4/SDPs) in Chaetomium thermophilum and Thermomyces lanuginosus Reveals Their Distinct Roles in Development
Article Snippet: PCR cloning and analyses were performed using high fidelity fusion polymerase (Fermentas). .. Restriction enzymes, T4 DNA ligase, SYBR Premix Ex Taq and other DNA-modifying enzymes were used as recommended by the suppliers (TaKaRa, Dalian).

Article Title: SINE Retrotransposon variation drives Ecotypic disparity in natural populations of Coilia nasus
Article Snippet: The genomic DNA was digested with EcoR1 and BcII (Takara, China), purified, and ligated to either the EcoRI adaptor [ ] or the modified MseI adaptor (Additional file : Table S1) using T4 DNA ligase (Takara, China). .. Genomic DNA was amplified by PCR with EcoRI and MseI primers (Additional file : Table S1).

Article Title: Functional tag SNPs inside the DRD2 gene as a genetic risk factor for major depressive disorder in the Chinese Han population
Article Snippet: The MiniBEST Agarose Gel DNA Extraction Kit Ver.4.2 (TaKaRa, Dalian, China) was used to purify each allele from the PCR products in the gel, following which they were severed with Sac I and Xho I restriction enzymes. .. Two products were immediately added into the Sac I and Xho I sites of the pmirGlo du-luciferase reporter gene vector (Promega, Madison, WI, USA) utilizing T4 DNA ligase (TaKaRa, Dalian, China).

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan). .. The recombinant plasmid was transformed into competent E. coli BL21(DE3) cells, cultured in LB broth, and then detected by colony PCR.

Article Title: hsa-miR-155 targeted NCSTN 3’UTR mutation promotes the pathogenesis and development of acne inversa
Article Snippet: .. The PCR products were cloned downstream of the Renilla luciferase gene containing psiCHECK-2 vector, generating a psiCHECK-2-3’UTR-NCSNT (termed wt- NCSTN ), using T4 DNA Ligase (TaKaRa, Dalian, China, Cat. No. D2011A). .. On the following day, a single clone was randomly selected and a reconstructed plasmid was extracted (AXYGEN, California, USA, Cat. No. AP-MN-P-50) for digestion, PCR, and identification of sequences.

Article Title: Identification of Azole Resistance Markers in Clinical Isolates of Candida tropicalis Using cDNA‐AFLP Method
Article Snippet: .. Briefly, it was conducted 1 min at 50°C, decreasing to 10°C over 1 h (i.e., 1°C/1.5 min) and then 6 U T4 DNA Ligase (Takara, Tokyo, Japan) was added and incubated at 16°C for 16 h. The preamplification was performed with preamp primers (Table ) on ligated fragments according to the following PCR conditions: 5 min of denaturation at 94°C; 30 cycles of 94°C for 30 sec; 63°C, 30 sec; 72°C, 30 sec; and final extension at 72°C for 5 min. .. The sensitive amplification was performed using sensitive primers with the same preamplification PCR conditions.

Affinity Chromatography:

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan). .. E. coli BL21(DE3) cells containing recombinant plasmid pET-32a-VDAC2/pET-32a-RACK1 were cultured, and the expression of rVDAC2/rRACK1 was induced by adding 100 mM isopropyl-β- d -thiogalactopyranoside (1:100) (Solarbio, China). rVDAC2 and rRACK1 were purified using HisTrap Ni-NTA affinity chromatography (GE Healthcare, USA) with a protein purification apparatus according to the manufacturer’s instructions.

Polyacrylamide Gel Electrophoresis:

Article Title: Identification of Azole Resistance Markers in Clinical Isolates of Candida tropicalis Using cDNA‐AFLP Method
Article Snippet: Briefly, it was conducted 1 min at 50°C, decreasing to 10°C over 1 h (i.e., 1°C/1.5 min) and then 6 U T4 DNA Ligase (Takara, Tokyo, Japan) was added and incubated at 16°C for 16 h. The preamplification was performed with preamp primers (Table ) on ligated fragments according to the following PCR conditions: 5 min of denaturation at 94°C; 30 cycles of 94°C for 30 sec; 63°C, 30 sec; 72°C, 30 sec; and final extension at 72°C for 5 min. .. The PCR products resulting from this step were separated by 8% nondenaturated polyacrylamide gel electrophoresis (PAGE) and stained with silver nitrate.

Plasmid Preparation:

Article Title: Genetic Analysis of Four Sexual Differentiation Process Proteins (isp4/SDPs) in Chaetomium thermophilum and Thermomyces lanuginosus Reveals Their Distinct Roles in Development
Article Snippet: The primer pairs used for a gene cloning and vector construction are listed in . .. Restriction enzymes, T4 DNA ligase, SYBR Premix Ex Taq and other DNA-modifying enzymes were used as recommended by the suppliers (TaKaRa, Dalian).

Article Title: Functional tag SNPs inside the DRD2 gene as a genetic risk factor for major depressive disorder in the Chinese Han population
Article Snippet: .. Two products were immediately added into the Sac I and Xho I sites of the pmirGlo du-luciferase reporter gene vector (Promega, Madison, WI, USA) utilizing T4 DNA ligase (TaKaRa, Dalian, China). .. The inserts with various alleles were verified by PCR-direct sequencing.

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: .. Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan). .. The recombinant plasmid was transformed into competent E. coli BL21(DE3) cells, cultured in LB broth, and then detected by colony PCR.

Article Title: High-level expression of Thermomyces dupontii thermo-alkaline lipase in Pichia pastoris under the control of different promoters
Article Snippet: The vector pPICZαA was also purchased from Invitrogen. .. DNA polymerase (PrimeSTARTMHS ), restriction enzymes (EcoRI, NotI and SacI), in-fusion cloning kit and T4 -DNA ligase were purchased from Takara Biotechnology (Dalian, China).

Article Title: Molecular modification, expression and purification of new subtype antioxidant peptide from Pinctada fucata by recombinant Escherichia coli to improve antioxidant-activity
Article Snippet: 4.0 and MiniBEST Plasmid Purification Kit Ver. .. DNA markers of 500 bp and 2000 bp, T4 DNA ligase, and restriction endonucleases ( Bam H I and Xho I) were from TaKaRa.

Article Title: hsa-miR-155 targeted NCSTN 3’UTR mutation promotes the pathogenesis and development of acne inversa
Article Snippet: .. The PCR products were cloned downstream of the Renilla luciferase gene containing psiCHECK-2 vector, generating a psiCHECK-2-3’UTR-NCSNT (termed wt- NCSTN ), using T4 DNA Ligase (TaKaRa, Dalian, China, Cat. No. D2011A). .. On the following day, a single clone was randomly selected and a reconstructed plasmid was extracted (AXYGEN, California, USA, Cat. No. AP-MN-P-50) for digestion, PCR, and identification of sequences.

Recombinant:

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: Paragraph title: Recombinant expression of VDAC2 and RACK1. ... Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan).

Article Title: hsa-miR-155 targeted NCSTN 3’UTR mutation promotes the pathogenesis and development of acne inversa
Article Snippet: PCR products and psiCHECK-2 were digested using Xho I (TaKaRa, Dalian, China, Cat. No. D1094A) and Not I (TaKaRa, Dalian, China, Cat. No. 1166BH) to construct wild type recombinant plasmid. .. The PCR products were cloned downstream of the Renilla luciferase gene containing psiCHECK-2 vector, generating a psiCHECK-2-3’UTR-NCSNT (termed wt- NCSTN ), using T4 DNA Ligase (TaKaRa, Dalian, China, Cat. No. D2011A).

Agarose Gel Electrophoresis:

Article Title: Functional tag SNPs inside the DRD2 gene as a genetic risk factor for major depressive disorder in the Chinese Han population
Article Snippet: The MiniBEST Agarose Gel DNA Extraction Kit Ver.4.2 (TaKaRa, Dalian, China) was used to purify each allele from the PCR products in the gel, following which they were severed with Sac I and Xho I restriction enzymes. .. Two products were immediately added into the Sac I and Xho I sites of the pmirGlo du-luciferase reporter gene vector (Promega, Madison, WI, USA) utilizing T4 DNA ligase (TaKaRa, Dalian, China).

Size-exclusion Chromatography:

Article Title: Identification of Azole Resistance Markers in Clinical Isolates of Candida tropicalis Using cDNA‐AFLP Method
Article Snippet: .. Briefly, it was conducted 1 min at 50°C, decreasing to 10°C over 1 h (i.e., 1°C/1.5 min) and then 6 U T4 DNA Ligase (Takara, Tokyo, Japan) was added and incubated at 16°C for 16 h. The preamplification was performed with preamp primers (Table ) on ligated fragments according to the following PCR conditions: 5 min of denaturation at 94°C; 30 cycles of 94°C for 30 sec; 63°C, 30 sec; 72°C, 30 sec; and final extension at 72°C for 5 min. .. The sensitive amplification was performed using sensitive primers with the same preamplification PCR conditions.

Nuclear Magnetic Resonance:

Article Title: Efficient Synthesis of Methyl 3-Acetoxypropionate by a Newly Identified Baeyer-Villiger Monooxygenase
Article Snippet: Primers were synthesized by Shanghai Generay Biotech Co., and DNA polymerases, restriction enzymes, and T4 DNA ligase were from TaKaRa (Dalian, China). .. 1 H NMR analysis was conducted on a Bruker Avance 400 MHz spectrometer, and chemical shifts (δ) are reported in parts per million (ppm), while coupling constants ( J ) are reported in Hz.

Concentration Assay:

Article Title: Manipulating the hydrophobicity of DNA as a universal strategy for visual biosensing.
Article Snippet: .. Current visual biosensing methods, including colorimetric-based, fluorescence-based and chemiluminescence-based methods, are inappropriate for the hundreds of millions of people affected by color blindness and color weakness. .. Current visual biosensing methods, including colorimetric-based, fluorescence-based and chemiluminescence-based methods, are inappropriate for the hundreds of millions of people affected by color blindness and color weakness.

Staining:

Article Title: Identification of Azole Resistance Markers in Clinical Isolates of Candida tropicalis Using cDNA‐AFLP Method
Article Snippet: Briefly, it was conducted 1 min at 50°C, decreasing to 10°C over 1 h (i.e., 1°C/1.5 min) and then 6 U T4 DNA Ligase (Takara, Tokyo, Japan) was added and incubated at 16°C for 16 h. The preamplification was performed with preamp primers (Table ) on ligated fragments according to the following PCR conditions: 5 min of denaturation at 94°C; 30 cycles of 94°C for 30 sec; 63°C, 30 sec; 72°C, 30 sec; and final extension at 72°C for 5 min. .. The PCR products resulting from this step were separated by 8% nondenaturated polyacrylamide gel electrophoresis (PAGE) and stained with silver nitrate.

Positron Emission Tomography:

Article Title: Voltage-Dependent Anion Channel Protein 2 (VDAC2) and Receptor of Activated Protein C Kinase 1 (RACK1) Act as Functional Receptors for Lymphocystis Disease Virus Infection
Article Snippet: .. Briefly, the VDAC2 and RACK1 genes were amplified from the cDNA of FG cells using the primers shown in , the amplified VDAC2 and pET-32a plasmids were doubly digested by KpnI and HindIII restriction enzymes (TaKaRa, Japan), the amplified RACK1 and pET-32a plasmids were doubly digested by KpnI and XhoI restriction enzymes (TaKaRa, Japan), and the doubly digested gene and plasmid were then linked together using T4 DNA ligase (TaKaRa, Japan). .. The recombinant plasmid was transformed into competent E. coli BL21(DE3) cells, cultured in LB broth, and then detected by colony PCR.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa t4 dna ligase
    Ligation assay by <t>T4</t> DNA ligase. Time scan curves of liga tion catalyzed by various concentrations of T4 DNA ligase. The curves from top to bottom are those obtained with different T4 DNA ligase concentrations: 2.3, 0.23, 0.115, 6.9 × 10 –2 , 2.3 × 10 –2 , 1.2 × 10 –2 , 6.9 × 10 –3 , 2.3 × 10 –3 , 1.2 × 10 –3 and 2.3 × 10 –4 U/ml. (Insert) The initial ligation velocity is plotted as a function of the concentration of T4 DNA ligase.
    T4 Dna Ligase, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 297 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/TaKaRa
    Average 99 stars, based on 297 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Ligation assay by T4 DNA ligase. Time scan curves of liga tion catalyzed by various concentrations of T4 DNA ligase. The curves from top to bottom are those obtained with different T4 DNA ligase concentrations: 2.3, 0.23, 0.115, 6.9 × 10 –2 , 2.3 × 10 –2 , 1.2 × 10 –2 , 6.9 × 10 –3 , 2.3 × 10 –3 , 1.2 × 10 –3 and 2.3 × 10 –4 U/ml. (Insert) The initial ligation velocity is plotted as a function of the concentration of T4 DNA ligase.

    Journal: Nucleic Acids Research

    Article Title: Real-time monitoring of nucleic acid ligation in homogenous solutions using molecular beacons

    doi: 10.1093/nar/gng146

    Figure Lengend Snippet: Ligation assay by T4 DNA ligase. Time scan curves of liga tion catalyzed by various concentrations of T4 DNA ligase. The curves from top to bottom are those obtained with different T4 DNA ligase concentrations: 2.3, 0.23, 0.115, 6.9 × 10 –2 , 2.3 × 10 –2 , 1.2 × 10 –2 , 6.9 × 10 –3 , 2.3 × 10 –3 , 1.2 × 10 –3 and 2.3 × 10 –4 U/ml. (Insert) The initial ligation velocity is plotted as a function of the concentration of T4 DNA ligase.

    Article Snippet: Two samples containing 10 µl reaction solutions were moved from each sample before adding T4 DNA ligase, and after the ligation process had taken place for 360 s with the addition of ligase.

    Techniques: Ligation, Concentration Assay

    Real-time fluorescence scans and corresponding gel electrophoresis. (Left) Curve A is a time scan of fluorescence intensity of MB with N1; B is of MB with N2 and N4; C is of MB with N2 and N3; curve D is of MB itself. t 0 is the time when T4 DNA ligase is added into the MB/oligo solution. (Right) Gel electrophoresis images. Lanes 1 and 2 are for sample D; 3 and 4 for sample C; 5 and 6 for sample B; and 7 and 8 for sample A. Lanes 1, 3, 5 and 7 represent samples D, C, B and A before the addition of T4 DNA ligase, while lanes 2, 4, 6 and 8 represent corresponding samples obtained at 360 s after the addition of ligase. There is a major difference between lanes 5 and 6, while there is basically no difference for all the other pairs.

    Journal: Nucleic Acids Research

    Article Title: Real-time monitoring of nucleic acid ligation in homogenous solutions using molecular beacons

    doi: 10.1093/nar/gng146

    Figure Lengend Snippet: Real-time fluorescence scans and corresponding gel electrophoresis. (Left) Curve A is a time scan of fluorescence intensity of MB with N1; B is of MB with N2 and N4; C is of MB with N2 and N3; curve D is of MB itself. t 0 is the time when T4 DNA ligase is added into the MB/oligo solution. (Right) Gel electrophoresis images. Lanes 1 and 2 are for sample D; 3 and 4 for sample C; 5 and 6 for sample B; and 7 and 8 for sample A. Lanes 1, 3, 5 and 7 represent samples D, C, B and A before the addition of T4 DNA ligase, while lanes 2, 4, 6 and 8 represent corresponding samples obtained at 360 s after the addition of ligase. There is a major difference between lanes 5 and 6, while there is basically no difference for all the other pairs.

    Article Snippet: Two samples containing 10 µl reaction solutions were moved from each sample before adding T4 DNA ligase, and after the ligation process had taken place for 360 s with the addition of ligase.

    Techniques: Fluorescence, Nucleic Acid Electrophoresis

    15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: 15% denaturing PAGE for the ligation products of linkers A–B, C–D and linkers G–H. PAGE (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5x TBE) was run in 0.5 x TBE, 25°C, 100 V for 3.5 hrs in ( A )–( F ), or 4.3 hrs in ( G ). The ligation products were indicated by the arrows. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas). Lane M1: DNA marker I plus oligo 15. ( A ) The ligation products joined by using T4 DNA ligase from Fermentas. Lane 1: the ligation products of linkers C–D preincubated with T4 DNA ligase; Lane 2: the ligation products of linkers C–D without the preincubation; Lane 4: the ligation products of linkers A–B; Lanes 3 and 5: the negative controls. ( B ) The ligation products joined by using T4 DNA ligase from Takara. Lanes 1–3∶0.5, 1, and 2 µl of 1 µM oligo 15, respectively; Lanes 4 and 6: the ligation products of linkers A–B; Lane 8: the ligation products of linkers C–D. Lanes 5, 7, and 9: the negative controls. ( C ) The ligation products joined by using T4 DNA ligase from Promega. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products joined by using E. coli DNA ligase from Takara. Lanes 1 and 3: the ligation products of linkers A–B, and C–D, respectively; Lanes 2 and 4: the negative controls. ( E ) The ligation products of linkers A–B joined in T4 DNA ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lanes 1–3: the ligase reaction mixture with 7.5 mM (NH 4 ) 2 SO 4 , 3.75 mM (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively; Lane 4: the negative control. ( F ) The ligation products of the phosphorylated linkers A–B and C–D joined by using T4 and E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of the phosphorylated linkers A–B joined by using T4 and E. coli DNA ligase, respectively; Lanes 3 and 5: the ligation products of the phosphorylated linkers C–D joined by using T4 and E. coli DNA ligase, respectively; Lanes 6 and 7: the ligation products of linkers A–B and C–D, respectively; Lanes 8 and 9: the negative controls of lanes 6 and 7, respectively. ( G ) The ligation products of linkers A–B and the phosphorylated linkers G–H. Lanes 1 and 2: the ligation products of linkers A–B and the ligation products of the phosphorylated linkers G–H plus the negative control of linkers A–B, respectively; Lane 3: the negative control of linkers G–H plus the negative control of linkers A–B. The band from the ligation products of the phosphorylated linkers G–H run a little more slowly than that of linkers A–B. The sequences of linkers G and H are similar to those of linkers A and B, respectively. But there is a 1-base deletion at the 5′ end of each of linkers G and H.

    Article Snippet: These results of CIAP treatments might perhaps give us at least 3 messages: (i) CIAP treatments of linkers A–B could block, but not completely, the ligation of linkers A–B, indicating that some of linkers A–B could still be joined by T4 DNA ligase even after CIAP treatment; (ii) the ligation of linkers A–B could be recovered after CIAP was inactivated at 85°C for 30–90 min, perhaps suggesting that some of linkers A–B could spontaneously delete one or more nucleotide(s) at their 5′-ends and generate some 5′-phosphate ends when the linkers were incubated at 85°C for 30–90 min; and (iii) these results of CIAP treatments again indicated that band 5 in was the ligation products of linkers A–B.

    Techniques: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

    12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B treated with CIAP. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15. The ligases used in ( A )–( C ) were T4 DNA ligases. The ligases used in ( D )–( E ) were E. coli DNA ligases. ( A ) CIAP was inactivated at 75°C for 15 min. Lanes 1 and 5∶1 µl of 1 µM oligo 15; Lanes 2: CIAP was inactivated at 75°C for 15 min; Lane 3: the positive control without CIAP treatment; Lane 4: the negative control without ligase. ( B ) CIAP was inactivated at 85°C for 25 min and 45 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 25 min and 45 min, respectively; Lane 5: the negative control without ligase. ( C ) CIAP was inactivated at 85°C for 65 min and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 min and 90 min, respectively; Lane 5: the negative control without ligase. ( D ) CIAP was inactivated at 85°C for 45 min. Lanes 1 and 3: the positive control without CIAP treatment and the negative control without ligase, respectively; Lane 2: CIAP was inactivated at 85°C for 45 min. ( E ) CIAP was inactivated at 85°C for 65 and 90 min. Lanes 1 and 3: the positive controls without CIAP treatment; Lanes 2 and 4: CIAP was inactivated at 85°C for 65 and 90 min, respectively; Lane 5: the negative control without ligase.

    Article Snippet: These results of CIAP treatments might perhaps give us at least 3 messages: (i) CIAP treatments of linkers A–B could block, but not completely, the ligation of linkers A–B, indicating that some of linkers A–B could still be joined by T4 DNA ligase even after CIAP treatment; (ii) the ligation of linkers A–B could be recovered after CIAP was inactivated at 85°C for 30–90 min, perhaps suggesting that some of linkers A–B could spontaneously delete one or more nucleotide(s) at their 5′-ends and generate some 5′-phosphate ends when the linkers were incubated at 85°C for 30–90 min; and (iii) these results of CIAP treatments again indicated that band 5 in was the ligation products of linkers A–B.

    Techniques: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Positive Control, Negative Control

    12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: 12% denaturing PAGE for the ligation products of linkers A–B, C–D, and E–F. PAGE (10×10×0.03 cm, A:B = 19∶1, 7 M urea and 0.5 x TBE) was run in 0.5 x TBE, 25°C, 200 V for 1.7 hrs for the ligation products of linkers A–B and C–D, or 100 V for 3.5 hrs for those of linkers E–F. The arrows indicate the ligation products. Lane M: DNA marker I (GeneRuler™ 50 bp DNA ladder, Fermentas); Lane M1: DNA marker I +1 µl of 1 µM oligo 15; Lane M2: pUC19 DNA/MspI Marker (Fermentas). ( A ) The ligation products joined by using T4 DNA ligase from Takara and Fermentas. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 6: the ligation products of linkers A–B joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 5 bands. Of them, bands 1 and 2 were from oligos 4 and 1, respectively. Band 3 was from both oligos 2 and 3. Band 4 was unknown. Perhaps it might be the intermixtures of oligos 1–4. Band 5 was the denatured ligation products of linkers A–B; Lanes 4 and 8: the ligation products of linkers C–D joined by using T4 DNA ligase from Takara and Fermentas, respectively. We could see 4 bands. Of them, bands 6 and 7 were from both oligos 6 and 7, and both oligos 5 and 8, respectively. Band 8 was the denatured ligation products of linkers C–D. Band 9 was unknown. Perhaps it might be the intermixtures of oligos 5–8 and the double-strand ligation products of linkers C–D; Lanes 3, 5, 7, and 9: the negative controls. ( B ) The ligation products of linkers A–B and C–D joined by using T4 DNA ligase from Promega and the ligation products of linkers A–B joined in the ligase reaction mixture containing (NH 4 ) 2 SO 4 . Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the denatured ligation products of linkers A–B, and C–D, respectively. T4 DNA ligase was from Promega; Lanes 6 and 7: the ligation products of linkers A–B joined in the ligase reaction mixture without (NH 4 ) 2 SO 4 and with (NH 4 ) 2 SO 4 , respectively. T4 DNA ligase used was from Takara; Lanes 3, 5, and 8: the negative controls. ( C ) The ligation products of linkers A–B and C–D joined by using E. coli DNA ligase. Lane 1∶1 µl of 1 µM oligo 15; Lanes 2 and 4: the ligation products of linkers A–B, and C–D, respectively; Lanes 3 and 5: the negative controls. ( D ) The ligation products of linkers E–F joined in the ligase reaction mixture with (NH 4 ) 2 SO 4 . The ligase was T4 DNA ligase (Fermentas). Lane 1: pUC19 DNA/MspI Marker plus 2 µl of ligation products of linkers E–F; Lanes 2 and 3: the ligation products of linkers E–F joined in the ligase reaction mixtures with (NH 4 ) 2 SO 4 , and without (NH 4 ) 2 SO 4 , respectively. We could see 3 bands. Bands 10 and 11 are from both oligos 9 and 12, and both oligos 10 and 11, respectively; Band 12 is the ligation products of linkers E–F; Lane 4: the negative control. ( E ) The ligation products of linkers E–F joined by using E. coli DNA ligase. Lane 1: the ligation products of linkers E–F. Lane 2: the negative control. ( F ) The ligation products of linkers A–B preincubated with T4 PNK in the E. coli DNA ligase reaction mixture without ATP. The ligase was E. coli DNA ligase (Takara). Lane 1∶1 µl of 1 µM oligo 15; Lane 2: linkers A–B were not preincubated with T4 PNK; Lane 3: linkers A–B were preincubated with T4 PNK; Lane 4: the negative control.

    Article Snippet: These results of CIAP treatments might perhaps give us at least 3 messages: (i) CIAP treatments of linkers A–B could block, but not completely, the ligation of linkers A–B, indicating that some of linkers A–B could still be joined by T4 DNA ligase even after CIAP treatment; (ii) the ligation of linkers A–B could be recovered after CIAP was inactivated at 85°C for 30–90 min, perhaps suggesting that some of linkers A–B could spontaneously delete one or more nucleotide(s) at their 5′-ends and generate some 5′-phosphate ends when the linkers were incubated at 85°C for 30–90 min; and (iii) these results of CIAP treatments again indicated that band 5 in was the ligation products of linkers A–B.

    Techniques: Polyacrylamide Gel Electrophoresis, Ligation, Marker, Negative Control

    The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

    Journal: PLoS ONE

    Article Title: Detection of Ligation Products of DNA Linkers with 5?-OH Ends by Denaturing PAGE Silver Stain

    doi: 10.1371/journal.pone.0039251

    Figure Lengend Snippet: The radioautograph of oligo 11 phosphorylated by T4 DNA ligase. The oligo 11 was phosphorylated by using commercial T4 DNA ligase. The phosphorylation products were loaded on a 15% denaturing PAGE gel (10×10×0.03 cm, A:B = 29∶1, 7 M urea, 0.5 x TBE). Electrophoresis was run in 0.5 x TBE at 100 V and 25°C for 3 hrs. The gel was dried between two semipermeable cellulose acetate membranes and radioautographed at −20°C for 1–3 days. The arrows indicate the phosphorylation products. The positive controls were oligo 11 phosphorylated by T4 PNK. ( A ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lanes 2 and 4: the negative controls without ligase, and without oligo 11, respectively; Lane 3: the phosphorylation products of oligo 11 by T4 DNA ligase. ( B ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 15 min, 30 min, and 60 min, respectively. Lanes 9 and 10: the negative controls without ligase, and without oligo 11, respectively. ( C ) Oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. Lanes 1 and 5: the positive controls; Lane 2: the phosphorylation products of oligo 11 by T4 DNA ligase; Lanes 3 and 4: the negative controls without ligase, and without oligo 11, respectively; Lanes 6, 7, and 8: oligo 11 treated with CIAP was phosphorylated by T4 DNA ligase. CIAP was inactivated at 85°C for 60 min, 15 min, and 30 min, respectively. ( D ) Oligos 11 and 12 were phosphorylated by T4 DNA ligase at 37°C for 1 hr. Lane 1: oligos 11 and 12 were phosphorylated by T4 PNK; Lane 2: oligos 11 and 12 were phosphorylated by T4 DNA ligase; Lane 3: oligo 11 were phosphorylated by T4 DNA ligase; Lane 4: the negative control without ligase. ( E ) Oligo 11 was phosphorylated by T4 DNA ligase at 37°C for 2 hrs. 1 x TE and 10% SDS were not added to the phosphorylation products before phenol/chloroform extraction. Lane 1: the positive control; Lanes 2 and 3: the phosphorylation products of oligo 11 by T4 DNA ligase and the negative controls without ligase, respectively.

    Article Snippet: These results of CIAP treatments might perhaps give us at least 3 messages: (i) CIAP treatments of linkers A–B could block, but not completely, the ligation of linkers A–B, indicating that some of linkers A–B could still be joined by T4 DNA ligase even after CIAP treatment; (ii) the ligation of linkers A–B could be recovered after CIAP was inactivated at 85°C for 30–90 min, perhaps suggesting that some of linkers A–B could spontaneously delete one or more nucleotide(s) at their 5′-ends and generate some 5′-phosphate ends when the linkers were incubated at 85°C for 30–90 min; and (iii) these results of CIAP treatments again indicated that band 5 in was the ligation products of linkers A–B.

    Techniques: Polyacrylamide Gel Electrophoresis, Electrophoresis, Negative Control, Positive Control