t4 dna ligase  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs t4 dna ligase
    T4 Dna Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 497 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/New England Biolabs
    Average 99 stars, based on 497 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: Should be “(ii) the four-slot (#1 to #4) cloning site”. .. "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “[…]and T4 DNA ligase (….) for all ligations.” We accept this suggestion and also changed the sentence accordingly.

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: A similar format was used to introduce 5′-EcoR1 and 3′-Xho1 cloning ligation sites into the cDNA of the omalizumab-specific murine antibody variable light region cDNA (EcoR1-forward 5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACATTCACAAATTGTTATCACCCAGTCTC-3′ and Xho1-reverse 5′-CCGTTTTATCTCGAGCTTTGTCCCCGAGCCGAAC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: Specific versus Nonspecific Isothermal DNA Amplification through Thermophilic Polymerase and Nicking Enzyme Activities
    Article Snippet: .. The blunt-ended DNA was cloned into a Sma I-linerarized, 2× calf intestinal phosphatase, pUC19 plasmid using T4 DNA ligase: 25 fmol of linearized pUC19, 5 μ L of blunted DNA, and 400 ceU/ μ L T4 DNA ligase (NEB) were combined in T4 DNA ligase buffer [NEB (1× final concentration), 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol (pH 7.5) at 25 °C] in a total volume of 40 μ L. The reaction was allowed to proceed at 16 °C for 12 h prior to the mixture being transformed into DH5α chemically competent cells (Invitrogen), plated on 25 μ g/mL ampicillin plates, and incubated at 37 °C for 16 h. Single colonies were selected for colony PCR and inserts verified using M13 forward (−20) and M13 reverse (−27). ..

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: Should be “(ii) the four-slot (#1 to #4) cloning site” and change “evolved” to “derived”. .. "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “…and T4 DNA ligase (….) for all ligations.” “One transformation vector was created that allowed the expression of a mEmerald-labeled sianyltransferase ubiquitously throughout the whole embryonic development.” This sentence (and all other similar sentences) is a little confusing.

    Amplification:

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: Array hybridizations performed before and after LM-PCR showed that the LM-PCR did not introduce significant amplification bias ( ). .. Ligation of the adaptors was performed by incubating overnight at 16°C in a final volume of 100 μL containing the DNA sample, 40 μL adaptors, T4 DNA ligase 10× buffer, 5 μL of T4 DNA ligase (NEB).

    Article Title: Specific versus Nonspecific Isothermal DNA Amplification through Thermophilic Polymerase and Nicking Enzyme Activities
    Article Snippet: Paragraph title: Sequencing of EXPAR Amplification Products ... The blunt-ended DNA was cloned into a Sma I-linerarized, 2× calf intestinal phosphatase, pUC19 plasmid using T4 DNA ligase: 25 fmol of linearized pUC19, 5 μ L of blunted DNA, and 400 ceU/ μ L T4 DNA ligase (NEB) were combined in T4 DNA ligase buffer [NEB (1× final concentration), 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol (pH 7.5) at 25 °C] in a total volume of 40 μ L. The reaction was allowed to proceed at 16 °C for 12 h prior to the mixture being transformed into DH5α chemically competent cells (Invitrogen), plated on 25 μ g/mL ampicillin plates, and incubated at 37 °C for 16 h. Single colonies were selected for colony PCR and inserts verified using M13 forward (−20) and M13 reverse (−27).

    Synthesized:

    Article Title: Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo
    Article Snippet: In this protocol, the 12-mer lesion-containing ODNs (5′-ATGGCGXGCTAT-3′, X = N 3-CMdT or O 4 -CMdT) were previously synthesized in our laboratory Appropriate cell lines. .. Cycle Pure kit (Omega Bio-Tek, cat. no. D6492-02) QIAprep spin miniprep kit (Qiagen, cat. no.27104) EcoRI (New England BioLabs, cat. no. R0101S) NheI (New England BioLabs, cat. no. R0131S) Shrimp alkaline phosphatase (New England BioLabs, cat. no. R0371S) Adenosine 5′-triphosphate (ATP; New England BioLabs, cat. no. R0756S) T4 polynucleotide kinase (T4 PNK; New England BioLabs, cat. no. R0201S) T4 DNA ligase (New England BioLabs, cat. no. R0202L) Nt.BstNBI (New England BioLabs, cat. no. R0607L) Ethidium bromide (Sigma-Aldrich, cat. no. E1510) !

    Electrophoresis:

    Article Title: Defining CRISPR-Cas9 genome-wide nuclease activities with CIRCLE-seq
    Article Snippet: 50× TAE electrophoresis buffer (Thermo, cat.no. .. 200130) T4 DNA Ligase (New England BioLabs, cat.no.

    Incubation:

    Article Title: Generation of a genomic tiling array of the human Major Histocompatibility Complex (MHC) and its application for DNA methylation analysis
    Article Snippet: .. The adaptors JW102 (5'-gcggtgacccgggagatctgaattc-3') and JW103 (5'-gaattcagatc-3') were ligated to the cleaned-up DNA by incubation overnight at 16°C in a reaction containing 40 μl adaptor mix (50 μM), 6 μl T4 DNA ligase 10 × buffer (NEB, UK), 5 μl T4 DNA ligase (400 U/μl) (NEB, U.K.) and distilled water to a final volume of 100 μl. ..

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: The resulting fragments were blunt-ended by incubation for 20 min at 12°C in a 120-μL reaction containing the DNA sample, 1× Buffer 2 (NEB), 10× BSA (NEB), 100 μM dNTP mix, and T4 DNA polymerase (NEB). .. Ligation of the adaptors was performed by incubating overnight at 16°C in a final volume of 100 μL containing the DNA sample, 40 μL adaptors, T4 DNA ligase 10× buffer, 5 μL of T4 DNA ligase (NEB).

    Article Title: Specific versus Nonspecific Isothermal DNA Amplification through Thermophilic Polymerase and Nicking Enzyme Activities
    Article Snippet: .. The blunt-ended DNA was cloned into a Sma I-linerarized, 2× calf intestinal phosphatase, pUC19 plasmid using T4 DNA ligase: 25 fmol of linearized pUC19, 5 μ L of blunted DNA, and 400 ceU/ μ L T4 DNA ligase (NEB) were combined in T4 DNA ligase buffer [NEB (1× final concentration), 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol (pH 7.5) at 25 °C] in a total volume of 40 μ L. The reaction was allowed to proceed at 16 °C for 12 h prior to the mixture being transformed into DH5α chemically competent cells (Invitrogen), plated on 25 μ g/mL ampicillin plates, and incubated at 37 °C for 16 h. Single colonies were selected for colony PCR and inserts verified using M13 forward (−20) and M13 reverse (−27). ..

    In Silico:

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: Suggestion: “this study utilizes a set of vectors based on in silico design and de novo synthethesis.” We agree that the suggested shorter sentence also comes with an increase in legibility. .. "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “[…]and T4 DNA ligase (….) for all ligations.” We accept this suggestion and also changed the sentence accordingly.

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: Suggestion: “this study utilizes a set of vectors based on in silico design and de novo synthethesis.” “(ii) the four-slots (#1to #4) cloning site…." .. "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “…and T4 DNA ligase (….) for all ligations.” “One transformation vector was created that allowed the expression of a mEmerald-labeled sianyltransferase ubiquitously throughout the whole embryonic development.” This sentence (and all other similar sentences) is a little confusing.

    Expressing:

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “[…]and T4 DNA ligase (….) for all ligations.” We accept this suggestion and also changed the sentence accordingly. .. “One transformation vector was created that allowed the expression of a mEmerald-labeled sianyltransferase ubiquitously throughout the whole embryonic development.” This sentence (and all other similar sentences) is a little confusing.

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: .. "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “…and T4 DNA ligase (….) for all ligations.” “One transformation vector was created that allowed the expression of a mEmerald-labeled sianyltransferase ubiquitously throughout the whole embryonic development.” This sentence (and all other similar sentences) is a little confusing. .. Suggestion: “We created one transformation vector that ubiquitously drives expression of mEmerald-labeled sianyltransferase throughout embryonic development.” Did you name Plain-White As Snow?

    Transformation Assay:

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “[…]and T4 DNA ligase (….) for all ligations.” We accept this suggestion and also changed the sentence accordingly. .. “One transformation vector was created that allowed the expression of a mEmerald-labeled sianyltransferase ubiquitously throughout the whole embryonic development.” This sentence (and all other similar sentences) is a little confusing.

    Article Title: Specific versus Nonspecific Isothermal DNA Amplification through Thermophilic Polymerase and Nicking Enzyme Activities
    Article Snippet: .. The blunt-ended DNA was cloned into a Sma I-linerarized, 2× calf intestinal phosphatase, pUC19 plasmid using T4 DNA ligase: 25 fmol of linearized pUC19, 5 μ L of blunted DNA, and 400 ceU/ μ L T4 DNA ligase (NEB) were combined in T4 DNA ligase buffer [NEB (1× final concentration), 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol (pH 7.5) at 25 °C] in a total volume of 40 μ L. The reaction was allowed to proceed at 16 °C for 12 h prior to the mixture being transformed into DH5α chemically competent cells (Invitrogen), plated on 25 μ g/mL ampicillin plates, and incubated at 37 °C for 16 h. Single colonies were selected for colony PCR and inserts verified using M13 forward (−20) and M13 reverse (−27). ..

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: .. "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “…and T4 DNA ligase (….) for all ligations.” “One transformation vector was created that allowed the expression of a mEmerald-labeled sianyltransferase ubiquitously throughout the whole embryonic development.” This sentence (and all other similar sentences) is a little confusing. .. Suggestion: “We created one transformation vector that ubiquitously drives expression of mEmerald-labeled sianyltransferase throughout embryonic development.” Did you name Plain-White As Snow?

    Derivative Assay:

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: Should be “(ii) the four-slot (#1 to #4) cloning site” and change “evolved” to “derived”. .. "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “…and T4 DNA ligase (….) for all ligations.” “One transformation vector was created that allowed the expression of a mEmerald-labeled sianyltransferase ubiquitously throughout the whole embryonic development.” This sentence (and all other similar sentences) is a little confusing.

    Transfection:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S). .. The plasmid for anti-omalizumab IgE was used for transient expression (Roche Diagnostics, Fugene 6) of anti-omalizumab IgE from transfected 293s cells.

    Ligation:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: A similar format was used to introduce 5′-EcoR1 and 3′-Xho1 cloning ligation sites into the cDNA of the omalizumab-specific murine antibody variable light region cDNA (EcoR1-forward 5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACATTCACAAATTGTTATCACCCAGTCTC-3′ and Xho1-reverse 5′-CCGTTTTATCTCGAGCTTTGTCCCCGAGCCGAAC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: .. Ligation of the adaptors was performed by incubating overnight at 16°C in a final volume of 100 μL containing the DNA sample, 40 μL adaptors, T4 DNA ligase 10× buffer, 5 μL of T4 DNA ligase (NEB). .. The reactions were purified using a Zymo-5 kit as described above.

    Article Title: Coronaviruses: Propagation, Quantification, Storage, and Construction of Recombinant Mouse Hepatitis Virus
    Article Snippet: .. Each ligation reaction will contain 2.5 μl of T4 DNA ligase (New England Biolabs, Cat. No. PA1804) or 5% of the ligation reaction (the ligase should be relatively fresh). .. Check ligation results by removing 1 μl from each ligation reaction and running in a 0.8% agarose gel in parallel to Lambda HindIII markers.

    Introduce:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: A similar format was used to introduce 5′-EcoR1 and 3′-Xho1 cloning ligation sites into the cDNA of the omalizumab-specific murine antibody variable light region cDNA (EcoR1-forward 5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACATTCACAAATTGTTATCACCCAGTCTC-3′ and Xho1-reverse 5′-CCGTTTTATCTCGAGCTTTGTCCCCGAGCCGAAC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: Array hybridizations performed before and after LM-PCR showed that the LM-PCR did not introduce significant amplification bias ( ). .. Ligation of the adaptors was performed by incubating overnight at 16°C in a final volume of 100 μL containing the DNA sample, 40 μL adaptors, T4 DNA ligase 10× buffer, 5 μL of T4 DNA ligase (NEB).

    Imaging:

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: “we used the AGOC vector concept to systematically creating functional homozygous Tribolium lines that are designed for fluorescence live imaging of embryonic development.” – should be: “We used the AGOC vector concept to systematically create functional homozygous Tribolium lines[…]” "Automation devices, equipped with a fluorescence detection unit, can be used to sort embryos according to their genotype". .. "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “…and T4 DNA ligase (….) for all ligations.” “One transformation vector was created that allowed the expression of a mEmerald-labeled sianyltransferase ubiquitously throughout the whole embryonic development.” This sentence (and all other similar sentences) is a little confusing.

    Polymerase Chain Reaction:

    Article Title: Generation of a genomic tiling array of the human Major Histocompatibility Complex (MHC) and its application for DNA methylation analysis
    Article Snippet: The adaptors JW102 (5'-gcggtgacccgggagatctgaattc-3') and JW103 (5'-gaattcagatc-3') were ligated to the cleaned-up DNA by incubation overnight at 16°C in a reaction containing 40 μl adaptor mix (50 μM), 6 μl T4 DNA ligase 10 × buffer (NEB, UK), 5 μl T4 DNA ligase (400 U/μl) (NEB, U.K.) and distilled water to a final volume of 100 μl. .. To fill in the overhangs, the sample DNA was incubated at 72°C for 10 minutes with 1 μl dNTP mix (10 mM each), 5 μl 10 × AmpliTaq Gold PCR buffer (Applied Biosystems – Roche), 3 μl MgCl2 (250 mM), 5 U AmpliTaq Polymerase and distilled water to a final volume of 50 μl.

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S). .. The plasmid for anti-omalizumab IgE was used for transient expression (Roche Diagnostics, Fugene 6) of anti-omalizumab IgE from transfected 293s cells.

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: Methylated DNA Immunoprecipitation (MeDIP) was based on a previously published protocol, but we also included a ligatin-mediated PCR (LM-PCR) step ( ) to amplify the material. .. Ligation of the adaptors was performed by incubating overnight at 16°C in a final volume of 100 μL containing the DNA sample, 40 μL adaptors, T4 DNA ligase 10× buffer, 5 μL of T4 DNA ligase (NEB).

    Article Title: Specific versus Nonspecific Isothermal DNA Amplification through Thermophilic Polymerase and Nicking Enzyme Activities
    Article Snippet: .. The blunt-ended DNA was cloned into a Sma I-linerarized, 2× calf intestinal phosphatase, pUC19 plasmid using T4 DNA ligase: 25 fmol of linearized pUC19, 5 μ L of blunted DNA, and 400 ceU/ μ L T4 DNA ligase (NEB) were combined in T4 DNA ligase buffer [NEB (1× final concentration), 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol (pH 7.5) at 25 °C] in a total volume of 40 μ L. The reaction was allowed to proceed at 16 °C for 12 h prior to the mixture being transformed into DH5α chemically competent cells (Invitrogen), plated on 25 μ g/mL ampicillin plates, and incubated at 37 °C for 16 h. Single colonies were selected for colony PCR and inserts verified using M13 forward (−20) and M13 reverse (−27). ..

    Methylated DNA Immunoprecipitation:

    Article Title: Generation of a genomic tiling array of the human Major Histocompatibility Complex (MHC) and its application for DNA methylation analysis
    Article Snippet: Paragraph title: Methylated DNA immunoprecipitation (MeDIP) ... The adaptors JW102 (5'-gcggtgacccgggagatctgaattc-3') and JW103 (5'-gaattcagatc-3') were ligated to the cleaned-up DNA by incubation overnight at 16°C in a reaction containing 40 μl adaptor mix (50 μM), 6 μl T4 DNA ligase 10 × buffer (NEB, UK), 5 μl T4 DNA ligase (400 U/μl) (NEB, U.K.) and distilled water to a final volume of 100 μl.

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: Methylated DNA Immunoprecipitation (MeDIP) was based on a previously published protocol, but we also included a ligatin-mediated PCR (LM-PCR) step ( ) to amplify the material. .. Ligation of the adaptors was performed by incubating overnight at 16°C in a final volume of 100 μL containing the DNA sample, 40 μL adaptors, T4 DNA ligase 10× buffer, 5 μL of T4 DNA ligase (NEB).

    Fluorescence:

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: “we used the AGOC vector concept to systematically creating functional homozygous Tribolium lines that are designed for fluorescence live imaging of embryonic development.” – should be: “We used the AGOC vector concept to systematically create functional homozygous Tribolium lines[…]” "Automation devices, equipped with a fluorescence detection unit, can be used to sort embryos according to their genotype". .. "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “…and T4 DNA ligase (….) for all ligations.” “One transformation vector was created that allowed the expression of a mEmerald-labeled sianyltransferase ubiquitously throughout the whole embryonic development.” This sentence (and all other similar sentences) is a little confusing.

    Methylation:

    Article Title: Generation of a genomic tiling array of the human Major Histocompatibility Complex (MHC) and its application for DNA methylation analysis
    Article Snippet: Paragraph title: Methylated DNA immunoprecipitation (MeDIP) ... The adaptors JW102 (5'-gcggtgacccgggagatctgaattc-3') and JW103 (5'-gaattcagatc-3') were ligated to the cleaned-up DNA by incubation overnight at 16°C in a reaction containing 40 μl adaptor mix (50 μM), 6 μl T4 DNA ligase 10 × buffer (NEB, UK), 5 μl T4 DNA ligase (400 U/μl) (NEB, U.K.) and distilled water to a final volume of 100 μl.

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: Paragraph title: Immunoprecipitation of methylated DNA ... Ligation of the adaptors was performed by incubating overnight at 16°C in a final volume of 100 μL containing the DNA sample, 40 μL adaptors, T4 DNA ligase 10× buffer, 5 μL of T4 DNA ligase (NEB).

    Mutagenesis:

    Article Title: Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo
    Article Snippet: In this protocol, we have used the XPA-complemented (GM15876A) and XPA-deficient (XP12RO) human fibroblast cell lines as an example to illustrate the application of the CTAB method for transcriptional lesion bypass, mutagenesis and repair studies in viv o. .. Cycle Pure kit (Omega Bio-Tek, cat. no. D6492-02) QIAprep spin miniprep kit (Qiagen, cat. no.27104) EcoRI (New England BioLabs, cat. no. R0101S) NheI (New England BioLabs, cat. no. R0131S) Shrimp alkaline phosphatase (New England BioLabs, cat. no. R0371S) Adenosine 5′-triphosphate (ATP; New England BioLabs, cat. no. R0756S) T4 polynucleotide kinase (T4 PNK; New England BioLabs, cat. no. R0201S) T4 DNA ligase (New England BioLabs, cat. no. R0202L) Nt.BstNBI (New England BioLabs, cat. no. R0607L) Ethidium bromide (Sigma-Aldrich, cat. no. E1510) !

    Subcloning:

    Article Title: Defining CRISPR-Cas9 genome-wide nuclease activities with CIRCLE-seq
    Article Snippet: 28704) XL1-Blue subcloning grade competent cells (Agilent, cat.no. .. 200130) T4 DNA Ligase (New England BioLabs, cat.no.

    Purification:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S). .. The plasmid for anti-omalizumab IgE was used for transient expression (Roche Diagnostics, Fugene 6) of anti-omalizumab IgE from transfected 293s cells.

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: The reaction was purified using a Zymo-5 kit (Genetix) according to the manufacturer’s instructions, but the final elution was done in 30 μL of TE buffer (pH 8.5). .. Ligation of the adaptors was performed by incubating overnight at 16°C in a final volume of 100 μL containing the DNA sample, 40 μL adaptors, T4 DNA ligase 10× buffer, 5 μL of T4 DNA ligase (NEB).

    Article Title: Specific versus Nonspecific Isothermal DNA Amplification through Thermophilic Polymerase and Nicking Enzyme Activities
    Article Snippet: The excised agarose sections were purified using the QIAquick gel extraction kit (Qiagen) following the manufacturer’s protocol. .. The blunt-ended DNA was cloned into a Sma I-linerarized, 2× calf intestinal phosphatase, pUC19 plasmid using T4 DNA ligase: 25 fmol of linearized pUC19, 5 μ L of blunted DNA, and 400 ceU/ μ L T4 DNA ligase (NEB) were combined in T4 DNA ligase buffer [NEB (1× final concentration), 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol (pH 7.5) at 25 °C] in a total volume of 40 μ L. The reaction was allowed to proceed at 16 °C for 12 h prior to the mixture being transformed into DH5α chemically competent cells (Invitrogen), plated on 25 μ g/mL ampicillin plates, and incubated at 37 °C for 16 h. Single colonies were selected for colony PCR and inserts verified using M13 forward (−20) and M13 reverse (−27).

    Sequencing:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: This step was followed by a mammalian signal sequence and a 20-base pair overhang with the N-terminal mature sequence of the omalizumab-specific murine antibody (5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGC AACTGGAGTACATTCACAGGTTCAGCTGCAGCAGTC-3′) and a 3′-reverse oligonucleotide that introduced a Xho1 site at the 3′-end of the variable heavy region (5′-GATGGGGGTGTCGTTTTGGCACTCGAGACGGTGACTGTGGTTCC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: Specific versus Nonspecific Isothermal DNA Amplification through Thermophilic Polymerase and Nicking Enzyme Activities
    Article Snippet: Paragraph title: Sequencing of EXPAR Amplification Products ... The blunt-ended DNA was cloned into a Sma I-linerarized, 2× calf intestinal phosphatase, pUC19 plasmid using T4 DNA ligase: 25 fmol of linearized pUC19, 5 μ L of blunted DNA, and 400 ceU/ μ L T4 DNA ligase (NEB) were combined in T4 DNA ligase buffer [NEB (1× final concentration), 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol (pH 7.5) at 25 °C] in a total volume of 40 μ L. The reaction was allowed to proceed at 16 °C for 12 h prior to the mixture being transformed into DH5α chemically competent cells (Invitrogen), plated on 25 μ g/mL ampicillin plates, and incubated at 37 °C for 16 h. Single colonies were selected for colony PCR and inserts verified using M13 forward (−20) and M13 reverse (−27).

    Immunoprecipitation:

    Article Title: Generation of a genomic tiling array of the human Major Histocompatibility Complex (MHC) and its application for DNA methylation analysis
    Article Snippet: Paragraph title: Methylated DNA immunoprecipitation (MeDIP) ... The adaptors JW102 (5'-gcggtgacccgggagatctgaattc-3') and JW103 (5'-gaattcagatc-3') were ligated to the cleaned-up DNA by incubation overnight at 16°C in a reaction containing 40 μl adaptor mix (50 μM), 6 μl T4 DNA ligase 10 × buffer (NEB, UK), 5 μl T4 DNA ligase (400 U/μl) (NEB, U.K.) and distilled water to a final volume of 100 μl.

    Article Title: An integrated resource for genome-wide identification and analysis of human tissue-specific differentially methylated regions (tDMRs)
    Article Snippet: Paragraph title: Immunoprecipitation of methylated DNA ... Ligation of the adaptors was performed by incubating overnight at 16°C in a final volume of 100 μL containing the DNA sample, 40 μL adaptors, T4 DNA ligase 10× buffer, 5 μL of T4 DNA ligase (NEB).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Defining CRISPR-Cas9 genome-wide nuclease activities with CIRCLE-seq
    Article Snippet: .. 200130) T4 DNA Ligase (New England BioLabs, cat.no. .. M0202L) 10× T4 DNA ligase Buffer (New England BioLabs), supplied with T4 DNA ligase LB agar (Miller powder) (Fisher Scientific, cat.no.

    Plasmid Preparation:

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: .. "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “[…]and T4 DNA ligase (….) for all ligations.” We accept this suggestion and also changed the sentence accordingly. .. “One transformation vector was created that allowed the expression of a mEmerald-labeled sianyltransferase ubiquitously throughout the whole embryonic development.” This sentence (and all other similar sentences) is a little confusing.

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: Specific versus Nonspecific Isothermal DNA Amplification through Thermophilic Polymerase and Nicking Enzyme Activities
    Article Snippet: .. The blunt-ended DNA was cloned into a Sma I-linerarized, 2× calf intestinal phosphatase, pUC19 plasmid using T4 DNA ligase: 25 fmol of linearized pUC19, 5 μ L of blunted DNA, and 400 ceU/ μ L T4 DNA ligase (NEB) were combined in T4 DNA ligase buffer [NEB (1× final concentration), 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol (pH 7.5) at 25 °C] in a total volume of 40 μ L. The reaction was allowed to proceed at 16 °C for 12 h prior to the mixture being transformed into DH5α chemically competent cells (Invitrogen), plated on 25 μ g/mL ampicillin plates, and incubated at 37 °C for 16 h. Single colonies were selected for colony PCR and inserts verified using M13 forward (−20) and M13 reverse (−27). ..

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: .. "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “…and T4 DNA ligase (….) for all ligations.” “One transformation vector was created that allowed the expression of a mEmerald-labeled sianyltransferase ubiquitously throughout the whole embryonic development.” This sentence (and all other similar sentences) is a little confusing. .. Suggestion: “We created one transformation vector that ubiquitously drives expression of mEmerald-labeled sianyltransferase throughout embryonic development.” Did you name Plain-White As Snow?

    Functional Assay:

    Article Title: A universal vector concept for a direct genotyping of transgenic organisms and a systematic creation of homozygous lines
    Article Snippet: “we used the AGOC vector concept to systematically creating functional homozygous Tribolium lines that are designed for fluorescence live imaging of embryonic development.” – should be: “We used the AGOC vector concept to systematically create functional homozygous Tribolium lines[…]” "Automation devices, equipped with a fluorescence detection unit, can be used to sort embryos according to their genotype". .. "and for all ligations the T4 DNA ligase (M0202L, New England BioLabs or provided with the pGEM-T Easy vector).” Change this to “…and T4 DNA ligase (….) for all ligations.” “One transformation vector was created that allowed the expression of a mEmerald-labeled sianyltransferase ubiquitously throughout the whole embryonic development.” This sentence (and all other similar sentences) is a little confusing.

    Agarose Gel Electrophoresis:

    Article Title: Coronaviruses: Propagation, Quantification, Storage, and Construction of Recombinant Mouse Hepatitis Virus
    Article Snippet: Each ligation reaction will contain 2.5 μl of T4 DNA ligase (New England Biolabs, Cat. No. PA1804) or 5% of the ligation reaction (the ligase should be relatively fresh). .. Check ligation results by removing 1 μl from each ligation reaction and running in a 0.8% agarose gel in parallel to Lambda HindIII markers.

    Produced:

    Article Title: Specific versus Nonspecific Isothermal DNA Amplification through Thermophilic Polymerase and Nicking Enzyme Activities
    Article Snippet: To ensure that the DNA produced during EXPAR was double-stranded and blunt-ended for cloning, 5′-overhangs were filled using Klenow exo- and 3′-overhangs were removed using mung bean nuclease. .. The blunt-ended DNA was cloned into a Sma I-linerarized, 2× calf intestinal phosphatase, pUC19 plasmid using T4 DNA ligase: 25 fmol of linearized pUC19, 5 μ L of blunted DNA, and 400 ceU/ μ L T4 DNA ligase (NEB) were combined in T4 DNA ligase buffer [NEB (1× final concentration), 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol (pH 7.5) at 25 °C] in a total volume of 40 μ L. The reaction was allowed to proceed at 16 °C for 12 h prior to the mixture being transformed into DH5α chemically competent cells (Invitrogen), plated on 25 μ g/mL ampicillin plates, and incubated at 37 °C for 16 h. Single colonies were selected for colony PCR and inserts verified using M13 forward (−20) and M13 reverse (−27).

    Concentration Assay:

    Article Title: Specific versus Nonspecific Isothermal DNA Amplification through Thermophilic Polymerase and Nicking Enzyme Activities
    Article Snippet: .. The blunt-ended DNA was cloned into a Sma I-linerarized, 2× calf intestinal phosphatase, pUC19 plasmid using T4 DNA ligase: 25 fmol of linearized pUC19, 5 μ L of blunted DNA, and 400 ceU/ μ L T4 DNA ligase (NEB) were combined in T4 DNA ligase buffer [NEB (1× final concentration), 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol (pH 7.5) at 25 °C] in a total volume of 40 μ L. The reaction was allowed to proceed at 16 °C for 12 h prior to the mixture being transformed into DH5α chemically competent cells (Invitrogen), plated on 25 μ g/mL ampicillin plates, and incubated at 37 °C for 16 h. Single colonies were selected for colony PCR and inserts verified using M13 forward (−20) and M13 reverse (−27). ..

    Molecular Weight:

    Article Title: Coronaviruses: Propagation, Quantification, Storage, and Construction of Recombinant Mouse Hepatitis Virus
    Article Snippet: Each ligation reaction will contain 2.5 μl of T4 DNA ligase (New England Biolabs, Cat. No. PA1804) or 5% of the ligation reaction (the ligase should be relatively fresh). .. Ligation A+B is complete when fragment B has all been converted to high molecular weight form.

    Gel Extraction:

    Article Title: Defining CRISPR-Cas9 genome-wide nuclease activities with CIRCLE-seq
    Article Snippet: R3535L) 10× CutSmart Buffer (New England BioLabs) supplied with Bsa I-HF QIAquick Gel extraction kit (Qiagen, cat.no. .. 200130) T4 DNA Ligase (New England BioLabs, cat.no.

    Article Title: Specific versus Nonspecific Isothermal DNA Amplification through Thermophilic Polymerase and Nicking Enzyme Activities
    Article Snippet: The excised agarose sections were purified using the QIAquick gel extraction kit (Qiagen) following the manufacturer’s protocol. .. The blunt-ended DNA was cloned into a Sma I-linerarized, 2× calf intestinal phosphatase, pUC19 plasmid using T4 DNA ligase: 25 fmol of linearized pUC19, 5 μ L of blunted DNA, and 400 ceU/ μ L T4 DNA ligase (NEB) were combined in T4 DNA ligase buffer [NEB (1× final concentration), 50 mM Tris-HCl, 10 mM MgCl2 , 1 mM ATP, and 10 mM dithiothreitol (pH 7.5) at 25 °C] in a total volume of 40 μ L. The reaction was allowed to proceed at 16 °C for 12 h prior to the mixture being transformed into DH5α chemically competent cells (Invitrogen), plated on 25 μ g/mL ampicillin plates, and incubated at 37 °C for 16 h. Single colonies were selected for colony PCR and inserts verified using M13 forward (−20) and M13 reverse (−27).

    Hood:

    Article Title: Quantitative measurement of transcriptional inhibition and mutagenesis induced by site-specifically incorporated DNA lesions in vitro and in vivo
    Article Snippet: Cycle Pure kit (Omega Bio-Tek, cat. no. D6492-02) QIAprep spin miniprep kit (Qiagen, cat. no.27104) EcoRI (New England BioLabs, cat. no. R0101S) NheI (New England BioLabs, cat. no. R0131S) Shrimp alkaline phosphatase (New England BioLabs, cat. no. R0371S) Adenosine 5′-triphosphate (ATP; New England BioLabs, cat. no. R0756S) T4 polynucleotide kinase (T4 PNK; New England BioLabs, cat. no. R0201S) T4 DNA ligase (New England BioLabs, cat. no. R0202L) Nt.BstNBI (New England BioLabs, cat. no. R0607L) Ethidium bromide (Sigma-Aldrich, cat. no. E1510) ! .. CAUTION Phenol:chloroform:isoamyl alcohol is toxic and corrosive; wear gloves and work in a fume hood.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    New England Biolabs t4 dna ligase
    T4 Dna Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 90/100, based on 548 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/New England Biolabs
    Average 90 stars, based on 548 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results