t4 dna ligase buffer  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    T4 DNA Ligase (2,000,000 units/ml)
    Description:

    Catalog Number:
    M0202T
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    New England Biolabs t4 dna ligase buffer
    Estimation of Michaelis–Menten parameters for the ligation of DNA splinted by RNA for ( A ) T4 DNA ligase and ( B ) PBCV-1 DNA ligase. Reactions were carried out in ligase assay buffer with 1 mM ATP at 25°C. Initial reaction velocity for the consumption of substrate was measured through fits to the linear region of the reaction (generally the first ∼15% of reaction) with error bars taking into account the uncertainty in the linear fits and initial substrate and enzyme concentrations. Kinetic parameters were determined through fitting the Michaelis–Menten equation to the data by non-linear regression as described in Materials and Methods. For (A), in all reactions the only detected product was AppDNA, and the determined parameters for substrate consumption were k cat  = 2.2 ± 0.2 × 10 −4  s −1  and K M  = 300 ± 70 nM. For (B), the reaction products were a ∼ 3:1 mixture of ligated DNA to AppDNA, and the observed V 0 /[E] 0  was independent of substrate concentration over the range 0.5 nM–100 nM. The approximate k cat  is 8 × 10 −3  s −1  with an upper threshold for the K M  estimated to be 1 nM.

    https://www.bioz.com/result/t4 dna ligase buffer/product/New England Biolabs
    Average 99 stars, based on 93 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase buffer - by Bioz Stars, 2020-01
    99/100 stars

    Images

    1) Product Images from "Efficient DNA ligation in DNA-RNA hybrid helices by Chlorella virus DNA ligase"

    Article Title: Efficient DNA ligation in DNA-RNA hybrid helices by Chlorella virus DNA ligase

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkt1032

    Estimation of Michaelis–Menten parameters for the ligation of DNA splinted by RNA for ( A ) T4 DNA ligase and ( B ) PBCV-1 DNA ligase. Reactions were carried out in ligase assay buffer with 1 mM ATP at 25°C. Initial reaction velocity for the consumption of substrate was measured through fits to the linear region of the reaction (generally the first ∼15% of reaction) with error bars taking into account the uncertainty in the linear fits and initial substrate and enzyme concentrations. Kinetic parameters were determined through fitting the Michaelis–Menten equation to the data by non-linear regression as described in Materials and Methods. For (A), in all reactions the only detected product was AppDNA, and the determined parameters for substrate consumption were k cat  = 2.2 ± 0.2 × 10 −4  s −1  and K M  = 300 ± 70 nM. For (B), the reaction products were a ∼ 3:1 mixture of ligated DNA to AppDNA, and the observed V 0 /[E] 0  was independent of substrate concentration over the range 0.5 nM–100 nM. The approximate k cat  is 8 × 10 −3  s −1  with an upper threshold for the K M  estimated to be 1 nM.
    Figure Legend Snippet: Estimation of Michaelis–Menten parameters for the ligation of DNA splinted by RNA for ( A ) T4 DNA ligase and ( B ) PBCV-1 DNA ligase. Reactions were carried out in ligase assay buffer with 1 mM ATP at 25°C. Initial reaction velocity for the consumption of substrate was measured through fits to the linear region of the reaction (generally the first ∼15% of reaction) with error bars taking into account the uncertainty in the linear fits and initial substrate and enzyme concentrations. Kinetic parameters were determined through fitting the Michaelis–Menten equation to the data by non-linear regression as described in Materials and Methods. For (A), in all reactions the only detected product was AppDNA, and the determined parameters for substrate consumption were k cat = 2.2 ± 0.2 × 10 −4 s −1 and K M = 300 ± 70 nM. For (B), the reaction products were a ∼ 3:1 mixture of ligated DNA to AppDNA, and the observed V 0 /[E] 0 was independent of substrate concentration over the range 0.5 nM–100 nM. The approximate k cat is 8 × 10 −3 s −1 with an upper threshold for the K M estimated to be 1 nM.

    Techniques Used: Ligation, Concentration Assay

    Ligation of DNA splinted by RNA. (Left) Outline of the ligation assay: a 5′-phosphorylated, 3′-FAM labelled DNA ‘donor’ oligonucleotide and an unmodified DNA ‘acceptor’ oligonucleotide are annealed to a complementary RNA or DNA splint. This substrate was reacted with a ligase to form a mixture of unreacted starting material, adenylylated DNA and ligated product. The products were denatured, separated on CE, and detected by fluorescence. (Right) ligation of the standard RNA-splinted substrate in ligase assay buffer for 15 min at 25°C with ( A ) no enzyme, ( B ) 1 µM T4 DNA ligase and 10 µM ATP, ( C ) 1 µM T4 DNA ligase and 1 mM ATP, ( D ) 100 nM PBCV-1 DNA ligase and 10 µM ATP, and ( E ) 100 nM PBCV-1 DNA ligase and 1 mM ATP. Indicated peaks correspond to starting pDNA (I), AppDNA (II) and ligated product (III) as determined by coelution with synthetically prepared standards.
    Figure Legend Snippet: Ligation of DNA splinted by RNA. (Left) Outline of the ligation assay: a 5′-phosphorylated, 3′-FAM labelled DNA ‘donor’ oligonucleotide and an unmodified DNA ‘acceptor’ oligonucleotide are annealed to a complementary RNA or DNA splint. This substrate was reacted with a ligase to form a mixture of unreacted starting material, adenylylated DNA and ligated product. The products were denatured, separated on CE, and detected by fluorescence. (Right) ligation of the standard RNA-splinted substrate in ligase assay buffer for 15 min at 25°C with ( A ) no enzyme, ( B ) 1 µM T4 DNA ligase and 10 µM ATP, ( C ) 1 µM T4 DNA ligase and 1 mM ATP, ( D ) 100 nM PBCV-1 DNA ligase and 10 µM ATP, and ( E ) 100 nM PBCV-1 DNA ligase and 1 mM ATP. Indicated peaks correspond to starting pDNA (I), AppDNA (II) and ligated product (III) as determined by coelution with synthetically prepared standards.

    Techniques Used: Ligation, Fluorescence

    Detection of defined amounts of luciferase mRNA from a mixture with Jurkat total RNA through ligation of specific DNA probes (Probe set A) and detection by qPCR. RNA/DNA probe mixtures were annealed then incubated with either T4 DNA ligase (open circle) or PBCV-1 DNA ligase (×). The qPCR C q  for each experiment was recorded, with lower C q  indicating higher concentration of ligated probes. ( A ) Ligation time course with either 1 (solid line) or 0.01 ng (dotted line) of luciferase mRNA target, 0–8 h ligation time. ( B ) Dependence of C q  after probe ligation with target luciferase mRNA present over a 7 log concentration range using a 2 h ligation time. NTC = no template control. The error bars show one standard deviation of the average of a minimum of three replicates.
    Figure Legend Snippet: Detection of defined amounts of luciferase mRNA from a mixture with Jurkat total RNA through ligation of specific DNA probes (Probe set A) and detection by qPCR. RNA/DNA probe mixtures were annealed then incubated with either T4 DNA ligase (open circle) or PBCV-1 DNA ligase (×). The qPCR C q for each experiment was recorded, with lower C q indicating higher concentration of ligated probes. ( A ) Ligation time course with either 1 (solid line) or 0.01 ng (dotted line) of luciferase mRNA target, 0–8 h ligation time. ( B ) Dependence of C q after probe ligation with target luciferase mRNA present over a 7 log concentration range using a 2 h ligation time. NTC = no template control. The error bars show one standard deviation of the average of a minimum of three replicates.

    Techniques Used: Luciferase, Ligation, Real-time Polymerase Chain Reaction, Incubation, Concentration Assay, Standard Deviation

    Ligation of RNA-splinted DNA substrates by PBCV-1 and T4 DNA ligases under general reaction conditions. The 16 RNA-splinted DNA substrates, representing all possible base pairs at the ligation junction, were reacted and the extent of ligation and abortive adenylylation measured. The bases listed on the X axis (dN/pdN) refer to the identity of the base of the DNA acceptor at the ligation junction (dN) and the identity of the phosphorylated base on the donor at the ligation junction (pdN). For all substrates, the correct Watson–Crick base-pairing partner was present in the RNA splint. All reactions were incubated at 37°C in 50 mM Tris pH 7.5, 10 mM MgCl 2 , 10 mM DTT, 100 nM RNA-splinted DNA substrate and ( A ) 100 nM PBCV-1 DNA ligase and 1 mM ATP for 15 min; ( B ) 100 nM PBCV-1 DNA ligase and 10 µM ATP for 15 min; ( C ) 1 µM PBCV-1 DNA ligase and 1 mM ATP for 15 min; ( D ) 1 µM PBCV-1 DNA ligase and 10 µM ATP for 15 min; ( E ) 1 µM T4 DNA ligase and 10 µM ATP for 15 min; and ( F ) 1 µM T4 DNA ligase and 10 µM ATP for 4 h. Here the total height of the bar indicates the fraction of starting material converted to products, with the solid portion indicating ligation product yield and the hashed portion indicating AppDNA yield.
    Figure Legend Snippet: Ligation of RNA-splinted DNA substrates by PBCV-1 and T4 DNA ligases under general reaction conditions. The 16 RNA-splinted DNA substrates, representing all possible base pairs at the ligation junction, were reacted and the extent of ligation and abortive adenylylation measured. The bases listed on the X axis (dN/pdN) refer to the identity of the base of the DNA acceptor at the ligation junction (dN) and the identity of the phosphorylated base on the donor at the ligation junction (pdN). For all substrates, the correct Watson–Crick base-pairing partner was present in the RNA splint. All reactions were incubated at 37°C in 50 mM Tris pH 7.5, 10 mM MgCl 2 , 10 mM DTT, 100 nM RNA-splinted DNA substrate and ( A ) 100 nM PBCV-1 DNA ligase and 1 mM ATP for 15 min; ( B ) 100 nM PBCV-1 DNA ligase and 10 µM ATP for 15 min; ( C ) 1 µM PBCV-1 DNA ligase and 1 mM ATP for 15 min; ( D ) 1 µM PBCV-1 DNA ligase and 10 µM ATP for 15 min; ( E ) 1 µM T4 DNA ligase and 10 µM ATP for 15 min; and ( F ) 1 µM T4 DNA ligase and 10 µM ATP for 4 h. Here the total height of the bar indicates the fraction of starting material converted to products, with the solid portion indicating ligation product yield and the hashed portion indicating AppDNA yield.

    Techniques Used: Ligation, Dominant Negative Mutation, Incubation

    2) Product Images from "Pyrite cloning: a single tube and programmed reaction cloning with restriction enzymes"

    Article Title: Pyrite cloning: a single tube and programmed reaction cloning with restriction enzymes

    Journal: Plant Methods

    doi: 10.1186/s13007-018-0359-7

    Schematic diagram of Pyrite cloning and results. Diagram of Pyrite cloning. An intact plasmid vector and a DNA fragment (purified PCR product) with compatible restriction enzyme sites (RES1 and RES2) are incubated in a single tube together with the restriction enzymes (RE1 and RE2) and T4 DNA ligase. After the Pyrite reaction (incubation condition shown in box), the reaction can be directly transformed into  E. coli  without purification. Colony PCR will then screen for those colonies containing vectors with inserts
    Figure Legend Snippet: Schematic diagram of Pyrite cloning and results. Diagram of Pyrite cloning. An intact plasmid vector and a DNA fragment (purified PCR product) with compatible restriction enzyme sites (RES1 and RES2) are incubated in a single tube together with the restriction enzymes (RE1 and RE2) and T4 DNA ligase. After the Pyrite reaction (incubation condition shown in box), the reaction can be directly transformed into E. coli without purification. Colony PCR will then screen for those colonies containing vectors with inserts

    Techniques Used: Clone Assay, Plasmid Preparation, Purification, Polymerase Chain Reaction, Incubation, Transformation Assay

    3) Product Images from "Pyrite cloning: a single tube and programmed reaction cloning with restriction enzymes"

    Article Title: Pyrite cloning: a single tube and programmed reaction cloning with restriction enzymes

    Journal: Plant Methods

    doi: 10.1186/s13007-018-0359-7

    Schematic diagram of Pyrite cloning and results. Diagram of Pyrite cloning. An intact plasmid vector and a DNA fragment (purified PCR product) with compatible restriction enzyme sites (RES1 and RES2) are incubated in a single tube together with the restriction enzymes (RE1 and RE2) and T4 DNA ligase. After the Pyrite reaction (incubation condition shown in box), the reaction can be directly transformed into  E. coli  without purification. Colony PCR will then screen for those colonies containing vectors with inserts
    Figure Legend Snippet: Schematic diagram of Pyrite cloning and results. Diagram of Pyrite cloning. An intact plasmid vector and a DNA fragment (purified PCR product) with compatible restriction enzyme sites (RES1 and RES2) are incubated in a single tube together with the restriction enzymes (RE1 and RE2) and T4 DNA ligase. After the Pyrite reaction (incubation condition shown in box), the reaction can be directly transformed into E. coli without purification. Colony PCR will then screen for those colonies containing vectors with inserts

    Techniques Used: Clone Assay, Plasmid Preparation, Purification, Polymerase Chain Reaction, Incubation, Transformation Assay

    4) Product Images from "Pyrite cloning: a single tube and programmed reaction cloning with restriction enzymes"

    Article Title: Pyrite cloning: a single tube and programmed reaction cloning with restriction enzymes

    Journal: Plant Methods

    doi: 10.1186/s13007-018-0359-7

    Schematic diagram of Pyrite cloning and results. Diagram of Pyrite cloning. An intact plasmid vector and a DNA fragment (purified PCR product) with compatible restriction enzyme sites (RES1 and RES2) are incubated in a single tube together with the restriction enzymes (RE1 and RE2) and T4 DNA ligase. After the Pyrite reaction (incubation condition shown in box), the reaction can be directly transformed into  E. coli  without purification. Colony PCR will then screen for those colonies containing vectors with inserts
    Figure Legend Snippet: Schematic diagram of Pyrite cloning and results. Diagram of Pyrite cloning. An intact plasmid vector and a DNA fragment (purified PCR product) with compatible restriction enzyme sites (RES1 and RES2) are incubated in a single tube together with the restriction enzymes (RE1 and RE2) and T4 DNA ligase. After the Pyrite reaction (incubation condition shown in box), the reaction can be directly transformed into E. coli without purification. Colony PCR will then screen for those colonies containing vectors with inserts

    Techniques Used: Clone Assay, Plasmid Preparation, Purification, Polymerase Chain Reaction, Incubation, Transformation Assay

    5) Product Images from "Pyrite cloning: a single tube and programmed reaction cloning with restriction enzymes"

    Article Title: Pyrite cloning: a single tube and programmed reaction cloning with restriction enzymes

    Journal: Plant Methods

    doi: 10.1186/s13007-018-0359-7

    Schematic diagram of Pyrite cloning and results. Diagram of Pyrite cloning. An intact plasmid vector and a DNA fragment (purified PCR product) with compatible restriction enzyme sites (RES1 and RES2) are incubated in a single tube together with the restriction enzymes (RE1 and RE2) and T4 DNA ligase. After the Pyrite reaction (incubation condition shown in box), the reaction can be directly transformed into  E. coli  without purification. Colony PCR will then screen for those colonies containing vectors with inserts
    Figure Legend Snippet: Schematic diagram of Pyrite cloning and results. Diagram of Pyrite cloning. An intact plasmid vector and a DNA fragment (purified PCR product) with compatible restriction enzyme sites (RES1 and RES2) are incubated in a single tube together with the restriction enzymes (RE1 and RE2) and T4 DNA ligase. After the Pyrite reaction (incubation condition shown in box), the reaction can be directly transformed into E. coli without purification. Colony PCR will then screen for those colonies containing vectors with inserts

    Techniques Used: Clone Assay, Plasmid Preparation, Purification, Polymerase Chain Reaction, Incubation, Transformation Assay

    6) Product Images from ""

    Article Title:

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M111.284992

    Reaction of T4 DNA ligase with substrate 1 ( A ) and adenylylated substrate 1A ( B ) under single turnover conditions.  Each reaction was run with 500 n m  ligase and 100 n m  substrate in the standard ATP-free assay buffer. Ligase that was  > 95% adenylylated was used for  A , and
    Figure Legend Snippet: Reaction of T4 DNA ligase with substrate 1 ( A ) and adenylylated substrate 1A ( B ) under single turnover conditions. Each reaction was run with 500 n m ligase and 100 n m substrate in the standard ATP-free assay buffer. Ligase that was > 95% adenylylated was used for A , and

    Techniques Used:

    Pre-steady state reactions of 30 n m  (♦) and 50 n m  (■) T4 DNA ligase with 100 n m  substrate 1.  Reactions were run in the standard assay buffer. Each time point represents the average of three experiments, and the  error bars  represent one S.D. The  dashed lines  represent fits by simulation using the chemical rates determined from single turnover reaction of substrate  1 , literature values for Step 1 rates, and diffusion-limited binding of DNA and allowing the rate of product release ( k off ) and the amplitude ( a ) to vary. The best fit was obtained with  a  = 0.51 and  k off  = 0.58 s −1 .
    Figure Legend Snippet: Pre-steady state reactions of 30 n m (♦) and 50 n m (■) T4 DNA ligase with 100 n m substrate 1. Reactions were run in the standard assay buffer. Each time point represents the average of three experiments, and the error bars represent one S.D. The dashed lines represent fits by simulation using the chemical rates determined from single turnover reaction of substrate 1 , literature values for Step 1 rates, and diffusion-limited binding of DNA and allowing the rate of product release ( k off ) and the amplitude ( a ) to vary. The best fit was obtained with a = 0.51 and k off = 0.58 s −1 .

    Techniques Used: Diffusion-based Assay, Binding Assay

    Determination of  k cat  and  k cat / K m  for T4 DNA ligase and nicked substrates.  Shown is reaction of 1 n m  T4 DNA ligase with 1 n m  (○), 2 n m  (*), 5 n m  (×), 10 n m  (△), 20 n m  (♢), and 50 n m  (□) substrate  1  in standard assay buffer at 16 °C ( A ) and 1 n m  T4 DNA ligase (
    Figure Legend Snippet: Determination of k cat and k cat / K m for T4 DNA ligase and nicked substrates. Shown is reaction of 1 n m T4 DNA ligase with 1 n m (○), 2 n m (*), 5 n m (×), 10 n m (△), 20 n m (♢), and 50 n m (□) substrate 1 in standard assay buffer at 16 °C ( A ) and 1 n m T4 DNA ligase (

    Techniques Used:

    7) Product Images from "Structure-seq2: sensitive and accurate genome-wide profiling of RNA structure in vivo"

    Article Title: Structure-seq2: sensitive and accurate genome-wide profiling of RNA structure in vivo

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gkx533

    Structure-seq2 leads to a lower ligation bias. ( A ) After RT (Figure   1 , step 1A/1B), excess of the 27 nt primer (blue, top, right) is still present in the solution. During ligation (Figure   1 , step 3A/3B), this primer can also ligate to the 40 nt hairpin adaptor (pink) to form an unwanted 67 nt by-product which has no insert and so results in sequencing reads with no utility. ( B ) The complement of the first nucleotide after the adaptor sequence read during sequencing is the nucleotide that ligated to the adaptor. Our new T4 DNA ligase-based method (green, –DMS and pink, +DMS) substantially decreases ligation bias as compared to the previous Circligase-based method (blue). Percentages equaling the transcriptomic distribution of the four nucleotides (black) are ideal.
    Figure Legend Snippet: Structure-seq2 leads to a lower ligation bias. ( A ) After RT (Figure 1 , step 1A/1B), excess of the 27 nt primer (blue, top, right) is still present in the solution. During ligation (Figure 1 , step 3A/3B), this primer can also ligate to the 40 nt hairpin adaptor (pink) to form an unwanted 67 nt by-product which has no insert and so results in sequencing reads with no utility. ( B ) The complement of the first nucleotide after the adaptor sequence read during sequencing is the nucleotide that ligated to the adaptor. Our new T4 DNA ligase-based method (green, –DMS and pink, +DMS) substantially decreases ligation bias as compared to the previous Circligase-based method (blue). Percentages equaling the transcriptomic distribution of the four nucleotides (black) are ideal.

    Techniques Used: Ligation, Sequencing

    Two versions of Structure-seq2 produce high quality data. In Structure-seq2, RNA (kelly green) is first modified by DMS or another chemical that can be read-out through reverse transcription. The RNA is then prepared for Illumina NGS sequencing by conversion to cDNA (Step 1A/1B, blue), ligating an adaptor (Step 3A/3B), and amplifying the products while incorporating TruSeq primer sequences (Step 5A/5B). In order to increase library quality, numerous improvements were made to the original Structure-seq protocol (boxed). These include performing the ligation with a hairpin adaptor and T4 DNA ligase (Step 3A/3B; pink) (  10 ), and adding various purification steps to remove a deleterious by-product (Figure   2A ). We present two options for purification: PAGE purification ( A ) or a biotin–streptavidin pull down ( B ). In the PAGE purification method, an additional PAGE purification step is added after reverse transcription (Step 2A). In the biotin–streptavidin pull down method, biotinylated dNTPs (cyan) are incorporated into the extended product during reverse transcription (Step 1B) and are purified via a magnetic streptavidin pull down after reverse transcription (Step 2B) and after ligation (Step 4B). There is also a common, final PAGE purification step following amplification (Step 5A/5B). Finally, a custom sequencing primer (light green) is used during sequencing (Step 7A/7B) to further provide high quality data.   Supplementary Figure S1  is a version of this figure with all the nucleotides shown explicitly.
    Figure Legend Snippet: Two versions of Structure-seq2 produce high quality data. In Structure-seq2, RNA (kelly green) is first modified by DMS or another chemical that can be read-out through reverse transcription. The RNA is then prepared for Illumina NGS sequencing by conversion to cDNA (Step 1A/1B, blue), ligating an adaptor (Step 3A/3B), and amplifying the products while incorporating TruSeq primer sequences (Step 5A/5B). In order to increase library quality, numerous improvements were made to the original Structure-seq protocol (boxed). These include performing the ligation with a hairpin adaptor and T4 DNA ligase (Step 3A/3B; pink) ( 10 ), and adding various purification steps to remove a deleterious by-product (Figure 2A ). We present two options for purification: PAGE purification ( A ) or a biotin–streptavidin pull down ( B ). In the PAGE purification method, an additional PAGE purification step is added after reverse transcription (Step 2A). In the biotin–streptavidin pull down method, biotinylated dNTPs (cyan) are incorporated into the extended product during reverse transcription (Step 1B) and are purified via a magnetic streptavidin pull down after reverse transcription (Step 2B) and after ligation (Step 4B). There is also a common, final PAGE purification step following amplification (Step 5A/5B). Finally, a custom sequencing primer (light green) is used during sequencing (Step 7A/7B) to further provide high quality data. Supplementary Figure S1 is a version of this figure with all the nucleotides shown explicitly.

    Techniques Used: Modification, Next-Generation Sequencing, Sequencing, Ligation, Purification, Polyacrylamide Gel Electrophoresis, Amplification

    8) Product Images from "Nucleic acid evolution and minimization by nonhomologous random recombination"

    Article Title: Nucleic acid evolution and minimization by nonhomologous random recombination

    Journal: Nature biotechnology

    doi: 10.1038/nbt736

    Overview of the nonhomologous random recombination (NRR) method. (A) Starting DNA sequences are randomly digested with DNase I, blunt-ended with T4 DNA polymerase, and recombined with T4 DNA ligase under conditions that strongly favor intermolecular ligation over intramolecular circularization. (B) A defined stoichiometry of hairpin DNA added to the ligation reaction controls the average length of the recombined products. The completed ligation reaction is digested with a restriction endonuclease to provide a library of double-stranded recombined DNA flanked by defined primer-binding sequences.
    Figure Legend Snippet: Overview of the nonhomologous random recombination (NRR) method. (A) Starting DNA sequences are randomly digested with DNase I, blunt-ended with T4 DNA polymerase, and recombined with T4 DNA ligase under conditions that strongly favor intermolecular ligation over intramolecular circularization. (B) A defined stoichiometry of hairpin DNA added to the ligation reaction controls the average length of the recombined products. The completed ligation reaction is digested with a restriction endonuclease to provide a library of double-stranded recombined DNA flanked by defined primer-binding sequences.

    Techniques Used: Ligation, Binding Assay

    Related Articles

    Clone Assay:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs). .. Positive colonies were selected by colony PCR and correct insertion in the plasmid was confirmed by sequencing.

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: A similar format was used to introduce 5′-EcoR1 and 3′-Xho1 cloning ligation sites into the cDNA of the omalizumab-specific murine antibody variable light region cDNA (EcoR1-forward 5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACATTCACAAATTGTTATCACCCAGTCTC-3′ and Xho1-reverse 5′-CCGTTTTATCTCGAGCTTTGTCCCCGAGCCGAAC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The EGT gene sequence containing an upstream activation sequence (UAS) with Asc I and Xho I sites was synthesized by Takara Bio Corporation and cloned into the pMD19-T Simple plasmid to generate pMD19-T [UAS-EGT]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: Total pRV library plasmids were purified with an EndoFree Maxiprep Kit (Cat #12362; QIAGEN). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2]. .. Ligation reactions were concentrated by using ethanol precipitation, electroporated into SS320 electro-competent bacteria, and grown as described above.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were synthesized by Genewiz (South Plainfield, NJ, USA); the P. finnis and A. robustus FEX genes were codon optimized for expression in E. coli whereas the N. californiae FEX gene was synthesized both in a codon-optimized version and a non-codon optimized version. .. The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. In the pYC vector, the cloned gene is downstream of a GAL1 promoter and 3′-terminally fused to green fluorescent protein followed by a decahistidine tag.

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: Paragraph title: Generation of chimeric infectious clones ... The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA).

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr. .. The ligation product was then column purified and electroporated into E. coli DH10B cells.

    Centrifugation:

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs. .. After soaking overnight at room temperature, the residual gel powder was filtered off using a 0.45-mm filtration spin column.

    Amplification:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The ssDNA was gel- and column-purified. .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: For each primer-less PCR reassembly reaction, 500 ng of gel-extracted fragments was used and fully reassembled capsids were amplified in a second PCR with primers (Shuffling_Rescue-F: 5′-GTCGGAAAGCATATGCCGCG-3′, Shuffling_Rescue-R: 5′-GACGTCGCATGCAACTAGTAT-3′) binding the cap gene and carrying overlapping ends to pRV plasmids. .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. In a subset of pYC vectors, the gut fungal FEX gene is preceded by a 5′ Preproleader sequence, which, including a 3’ cloning scar, translates into the following peptide: MKVLIVLLAIFAALPLALAQPVISTTVGSAAEGSLDKREARPDV ( ).

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Filtration:

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs. .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs.

    De-Phosphorylation Assay:

    Article Title: The Cyclin-Dependent Kinase 5 Inhibitor Peptide Inhibits Herpes Simplex Virus Type 1 Replication
    Article Snippet: Digestion of pAAV-CFP-Neo was performed with AfeI (New England Biolabs, Ipswich, MA) for 2 h at 37 °C, followed by dephosphorylation of the 5′ and 3′ ends with Alkaline phosphatase (New England Biolabs, Ipswich, MA) for 20 minutes at 37 °C. .. The 7185 bp pAAV-CFP-Neo linearized fragment was ligated with the 385 bp CIP fragment or with the 406 bp nlsCIP fragment using T4 DNA Ligase (New England Biolabs, Ipswich, MA) for 14 hours at 16 °C.

    DNA Ligation:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The ssDNA was gel- and column-purified. .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Synthesized:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The EGT gene sequence containing an upstream activation sequence (UAS) with Asc I and Xho I sites was synthesized by Takara Bio Corporation and cloned into the pMD19-T Simple plasmid to generate pMD19-T [UAS-EGT]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were synthesized by Genewiz (South Plainfield, NJ, USA); the P. finnis and A. robustus FEX genes were codon optimized for expression in E. coli whereas the N. californiae FEX gene was synthesized both in a codon-optimized version and a non-codon optimized version. .. The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA).

    Construct:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: In brief, an EF1a basal promoter fragment was inserted into HindIII and NheI sites of the promoter-less pGL4.10 (Promega) to construct the pGL4.10EF1a vector, then the BamHI and SalI containing fragment (as the enhancer insertion site) was removed and re-inserted at the SpeI site located upstream of the synthetic poly(A) signal/transcriptional pause site to generate modified versions of pGL4.10EF1a vector. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Paragraph title: pPAL-LACK, pPAL-IL-12p35 and pPAL-IL-12p40 plasmid constructs ... The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA). .. Ligated fragments were transformed into One Shot OmniMAX cells (Invitrogen, Carlsbad, CA), and resulting colonies were screened and sequenced prior to cesium chloride (CsCl) plasmid DNA purification.

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: New sgRNA plasmids were then constructed using inverse PCR. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli .

    Real-time Polymerase Chain Reaction:

    Article Title: Therapeutic expression of human clotting factors IX and X following adeno-associated viral vector–mediated intrauterine gene transfer in early-gestation fetal macaques
    Article Snippet: AAV-inverted terminal repeats with the LP1 promoter were cut with Hin dIII/Mfe I, ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and heat shocked into competent Escherichia coli , which were grown at 37°C overnight ( ). .. Correct clones were identified after DNA extraction by digestion with Hin dIII/Pst I, Ahd I, and Bgl I. Plasmid expression of hFX expression was assessed by ELISA after transient transfection of HepG2 cells with Fugene (Roche, Basel, Switzerland), and clones were amplified with Megaprep (Qiagen, Limberg, The Netherlands). scAAV-LP1-hFIXco and scAAV-LP1-hFXco plasmids were used in adenovirus-free transient transfection of 293T cells to generate scAAV5 and scAAV8 pseudotypes, as described by Nakai et al . ( ).

    Incubation:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The ssDNA was gel- and column-purified. .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Samples were heated to 95°C for 5 min then 80°C for 5 min, cooled to 60°C (4 min/1°C), and finally slowly cooled to 4°C (6 min/1°C). .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs. .. After staining with ethidium bromide, the band of correctly assembled cages was cut out of the gel and grounded into a fine powder, by freezing with liquid nitrogen.

    Article Title: Shaping Rolling Circle Amplification Products into DNA Nanoparticles by Incorporation of Modified Nucleotides and Their Application to In Vitro and In Vivo Delivery of a Photosensitizer
    Article Snippet: The circular template for RCA reactions was prepared following the previous report [ ]. .. Briefly, 5′-phosphorylated linear template (Bioneer, Daejeon, Korea) (phosphate-CTCACCAGAGCCACCACCACCAACACCACCACCACCAAAAAAACCACCACCACCAACACCACCACCACCAAGTCCTGTC) (10 μM) was incubated with primer (15 μM, CTCTGGTGAGGACAGGACTT), 10× ligation buffer (1×) and T4 DNA ligase (400 units/μL) (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight. .. After ligation, the circular template was treated with Exonuclease I and III (New England Biolabs), and then purified by 10% denaturing PAGE followed by ethanol precipitation.

    Activity Assay:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: Paragraph title: Validating enhancer activity in HeLa S3 and neuroblastoma cells ... 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Introduce:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: A similar format was used to introduce 5′-EcoR1 and 3′-Xho1 cloning ligation sites into the cDNA of the omalizumab-specific murine antibody variable light region cDNA (EcoR1-forward 5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACATTCACAAATTGTTATCACCCAGTCTC-3′ and Xho1-reverse 5′-CCGTTTTATCTCGAGCTTTGTCCCCGAGCCGAAC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Expressing:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were synthesized by Genewiz (South Plainfield, NJ, USA); the P. finnis and A. robustus FEX genes were codon optimized for expression in E. coli whereas the N. californiae FEX gene was synthesized both in a codon-optimized version and a non-codon optimized version. .. The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA).

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: Paragraph title: Construction of plasmids for expression of sgRNAs. ... Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli .

    Modification:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: In brief, an EF1a basal promoter fragment was inserted into HindIII and NheI sites of the promoter-less pGL4.10 (Promega) to construct the pGL4.10EF1a vector, then the BamHI and SalI containing fragment (as the enhancer insertion site) was removed and re-inserted at the SpeI site located upstream of the synthetic poly(A) signal/transcriptional pause site to generate modified versions of pGL4.10EF1a vector. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4]. .. Similarly, a piggyBac vector with 3 × P3-DsRed as a screening marker was prepared as follows.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The vector was modified to remove a weak σ 70 binding site present 24 bp upstream of the GFP open reading frame (two point mutations, A → G and T → G, were introduced, changing the putative σ 70 binding site from TAGATT to TGGATG, with the consensus σ 70 binding site being TATAAT). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: The sheared DNA was subsequently purified on a QIAquick column and then processed using the Illumina Paired-End DNA Sample Prep Kit (PE-930-1001). .. DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions). .. The tubes were then incubated at 65 °C for 20 min. DNA molecules with sizes comprised between 400 and 800 pb were purified using the PippinPrep apparatus (SAGE science) and amplified using Phusion (Finnzymes).

    Transformation Assay:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: For mutants generated using AMT or biolistic transformation, inverse PCR was used to identify the genes hit by the insertions; when this was unsuccessful, splinkerette PCR was used. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. Ligation mixtures were used to transform the E . coli SURE strain (Agilent Technologies) following the manufacturer's instructions.

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr. .. The ligation product was then column purified and electroporated into E. coli DH10B cells.

    Derivative Assay:

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: The reciprocal version, IE/IAB, had the 5′ UTR and nonstructural protein gene region of IE 68U201 and structural protein gene region and 3′ UTR derived from IAB TrD. .. The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA).

    High Performance Liquid Chromatography:

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: All oligonucleotides (see , Oligonucleotide sequences section) were HPLC purified and purchased from Integrated DNA technologies (IDT) and IBA. .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs.

    Transfection:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs). .. Positive colonies were selected by colony PCR and correct insertion in the plasmid was confirmed by sequencing.

    Inverse PCR:

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: The DNA was eluted or resuspended in 30 µl of water. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077. .. Splinkerette PCR was performed as previously reported ( ).

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Ligation:

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: A similar format was used to introduce 5′-EcoR1 and 3′-Xho1 cloning ligation sites into the cDNA of the omalizumab-specific murine antibody variable light region cDNA (EcoR1-forward 5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGCAACTGGAGTACATTCACAAATTGTTATCACCCAGTCTC-3′ and Xho1-reverse 5′-CCGTTTTATCTCGAGCTTTGTCCCCGAGCCGAAC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: Multiple RNA–RNA tertiary interactions are dispensable for formation of a functional U2/U6 RNA catalytic core in the spliceosome
    Article Snippet: MS2 actin pre-mRNA was purified as described ( ). .. Yeast U6 snRNAs containing N7-deaza modifications and abasic mutations were prepared by splinted ligation ( ) with T4 DNA ligase (NEB) and a U6(19–108) DNA splint that bridges three U6 snRNA fragments, with the desired mutations located in the central fragment ( ). .. To monitor ligation and recovery, the central U6 fragments were trace-labelled with γ-[32 P] ATP (Perkin Elmer) and polynucleotide kinase (NEB).

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Inserts and vectors were quantified by 260nm UV spectrophotometry and densitometry of 1% agarose gel electrophoretic runs. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. Ligation mixtures were used to transform the E . coli SURE strain (Agilent Technologies) following the manufacturer's instructions.

    Article Title: Shaping Rolling Circle Amplification Products into DNA Nanoparticles by Incorporation of Modified Nucleotides and Their Application to In Vitro and In Vivo Delivery of a Photosensitizer
    Article Snippet: The circular template for RCA reactions was prepared following the previous report [ ]. .. Briefly, 5′-phosphorylated linear template (Bioneer, Daejeon, Korea) (phosphate-CTCACCAGAGCCACCACCACCAACACCACCACCACCAAAAAAACCACCACCACCAACACCACCACCACCAAGTCCTGTC) (10 μM) was incubated with primer (15 μM, CTCTGGTGAGGACAGGACTT), 10× ligation buffer (1×) and T4 DNA ligase (400 units/μL) (New England Biolabs, Ipswich, MA, USA) at 16 °C overnight. .. After ligation, the circular template was treated with Exonuclease I and III (New England Biolabs), and then purified by 10% denaturing PAGE followed by ethanol precipitation.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The vector was modified to remove a weak σ 70 binding site present 24 bp upstream of the GFP open reading frame (two point mutations, A → G and T → G, were introduced, changing the putative σ 70 binding site from TAGATT to TGGATG, with the consensus σ 70 binding site being TATAAT). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr. .. The ligation product was then column purified and electroporated into E. coli DH10B cells.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: The sheared DNA was subsequently purified on a QIAquick column and then processed using the Illumina Paired-End DNA Sample Prep Kit (PE-930-1001). .. DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions). .. The tubes were then incubated at 65 °C for 20 min. DNA molecules with sizes comprised between 400 and 800 pb were purified using the PippinPrep apparatus (SAGE science) and amplified using Phusion (Finnzymes).

    Cell Culture:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. 20 µL of competent cells were transformed with 2 µL of phagemid DNA ligation mix.

    Generated:

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: Single-stranded DNA was generated using asymmetric production with 200 ng of purified dsDNA and 1 μM 5′-phosphorylated primer and Accustart HiFi polymerase (QuantaBio, Inc., Beverly, MA) in 1× Accustart HiFi buffer with 2 mM MgCl2 , and cycled 25 times, as previously described . .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: For mutants generated using AMT or biolistic transformation, inverse PCR was used to identify the genes hit by the insertions; when this was unsuccessful, splinkerette PCR was used. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077.

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: Initially, for each reciprocal chimera, two overlapping fragments that encompassed the fusion site of the two genomes were generated by PCR using a forward primer from within the nsP4 region (7041 F IAB AND 6509 F IE) with a reverse fusion primer (IAB/IE R and IE/IAB R) and reverse primer downstream of the junction site (8007 R IAB and 8312 R) paired with a forward fusion primer for each chimera (IAB/IE F and IE/IAB R) ( ). .. The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA).

    Sequencing:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The PCR reaction was performed in 50 μl reaction to amplify each sequence of interest from 100 ng of human cerebellum tissue gDNA using One Taq DNA polymerase Kit (New England Biolabs). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: This step was followed by a mammalian signal sequence and a 20-base pair overhang with the N-terminal mature sequence of the omalizumab-specific murine antibody (5′-CTATCGATTGAATTCCACCATGGGATGGTCATGTATCATCCTTTTTCTAGTAGCAACTGC AACTGGAGTACATTCACAGGTTCAGCTGCAGCAGTC-3′) and a 3′-reverse oligonucleotide that introduced a Xho1 site at the 3′-end of the variable heavy region (5′-GATGGGGGTGTCGTTTTGGCACTCGAGACGGTGACTGTGGTTCC-3′). .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: Double stranded DNA was generated by amplification of the synthetic gBlock f1 sequence with Phusion™ polymerase (New England Biolabs, Inc., Ipswitch, MA). .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The EGT gene sequence containing an upstream activation sequence (UAS) with Asc I and Xho I sites was synthesized by Takara Bio Corporation and cloned into the pMD19-T Simple plasmid to generate pMD19-T [UAS-EGT]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. In the pYC vector, the cloned gene is downstream of a GAL1 promoter and 3′-terminally fused to green fluorescent protein followed by a decahistidine tag.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: Paragraph title: Processing 3C libraries into 3C-seq libraries ready for sequencing ... DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions).

    Recombinant:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Isolation:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The pGL4.10_mod3_EF1α vector was also digested with BamHI and SalI, the double digested DNA (vector) was isolated and purified in the same way as insert. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. 10% of total transformation mixture volumes were plated onto LB-agar containing 5μM triclosan and grown at 37°C for 16h.

    Purification:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The pGL4.10_mod3_EF1α vector was also digested with BamHI and SalI, the double digested DNA (vector) was isolated and purified in the same way as insert. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S). .. The plasmid for anti-omalizumab IgE was used for transient expression (Roche Diagnostics, Fugene 6) of anti-omalizumab IgE from transfected 293s cells.

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: The ssDNA was gel- and column-purified. .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight. .. E . coli strains M13cp , DH5α F′Iq (Thermo Fisher, Inc., Waltham, MA), and SS320 (Lucigen, UK) were each transformed with the M13cp helper plasmid (a generous gift of Dr. Andrew Bradbury, Los Alamos National Lab) and made competent by washing log-phase grown cells in ice cold 100 mM CaCl2 .

    Article Title: Multiple RNA–RNA tertiary interactions are dispensable for formation of a functional U2/U6 RNA catalytic core in the spliceosome
    Article Snippet: MS2 actin pre-mRNA was purified as described ( ). .. Yeast U6 snRNAs containing N7-deaza modifications and abasic mutations were prepared by splinted ligation ( ) with T4 DNA ligase (NEB) and a U6(19–108) DNA splint that bridges three U6 snRNA fragments, with the desired mutations located in the central fragment ( ).

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077.

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The following PCR profile was used to amplify target sequences: 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; and 72 °C for 10 min. Amplicons were gel purified and cloned into the pMD19-T Simple plasmid (Takara Bio, Otsu, Japan). .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: Total pRV library plasmids were purified with an EndoFree Maxiprep Kit (Cat #12362; QIAGEN). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: The Cyclin-Dependent Kinase 5 Inhibitor Peptide Inhibits Herpes Simplex Virus Type 1 Replication
    Article Snippet: CIP and nls-CIP PCR products were digested with AfeI and demethylated (DpnI) for 2 h at 37 °C and then purified. .. The 7185 bp pAAV-CFP-Neo linearized fragment was ligated with the 385 bp CIP fragment or with the 406 bp nlsCIP fragment using T4 DNA Ligase (New England Biolabs, Ipswich, MA) for 14 hours at 16 °C.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Once pGH-IL12-p40 and pPAL MluI digests were purified, the entire process was repeated with XbaI. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: All oligonucleotides (see , Oligonucleotide sequences section) were HPLC purified and purchased from Integrated DNA technologies (IDT) and IBA. .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: After column purification, sequences were ligated into a version of the low-copy plasmid pUA66, which contains a gfpmut2 open reading frame downstream of a strong ribosomal binding site ( ). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Article Title: ZBTB10 binds the telomeric variant repeat TTGGGG and interacts with TRF2
    Article Snippet: Twenty five microgram of forward and reverse oligonucleotides of telomeric, variant repeat or control sequences ( ) were denatured at 80°C and annealed by cooling. .. Double-stranded oligonucleotides were then polymerized using 50 U T4 polynucleotidekinase (Thermo Scientific) and 80 U T4 DNA ligase (NEB), biotinylated with desthiobiotin-dATP (Jena Bioscience) by Klenow fragment (Thermo Scientific) and purified using G-50 columns (GE Healthcare). .. Chemically synthesized DNA was immobilized on 0.5 mg streptavidin-coated magnetic beads (Dynabeads MyOne Streptavidin C1, Invitrogen) for 15 min at RT and incubated with 400–800 μg protein lysates diluted in PBB buffer (150 mM NaCl, 50 mM Tris–HCl pH 7.5, 10 mM MgCl2 , 0.5% IGEPAL CA-630, 1 μM Pepstatin, 1 μg/ml Leupeptin and 0.5 mM PMSF) for 1.5 h on a rotation wheel at 4°C.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: The sheared DNA was subsequently purified on a QIAquick column and then processed using the Illumina Paired-End DNA Sample Prep Kit (PE-930-1001). .. DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions).

    Article Title: In vitro reconstitution of DNA replication initiated by genetic recombination: a T4 bacteriophage model for a type of DNA synthesis important for all cells
    Article Snippet: All restriction nucleases and most DNA-modifying enzymes (including T4 DNA ligase) were purchased from New England Biolabs in the early 1990s, when all of the reported experiments were performed. .. All restriction nucleases and most DNA-modifying enzymes (including T4 DNA ligase) were purchased from New England Biolabs in the early 1990s, when all of the reported experiments were performed.

    Polymerase Chain Reaction:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The PCR product was digested with BamHI and SalI (New England Biolabs), the restriction DNA fragment (insert) was isolated using agarose gel electrophoresis and purified by the MinElute Gel Extraction Kit (Qiagen). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S). .. The plasmid for anti-omalizumab IgE was used for transient expression (Roche Diagnostics, Fugene 6) of anti-omalizumab IgE from transfected 293s cells.

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: In each case, the PCR-amplified material was purified by ZymoClean agarose gel purification (Zymo Research, Inc., Irvine, CA) and column cleanup (Qiagen miniprep spin purification kit, Qiagen, Inc., Germany). .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: Lineage-specific RUNX2 super-enhancer activates MYC and promotes the development of blastic plasmacytoid dendritic cell neoplasm
    Article Snippet: Paragraph title: Chromosome conformation capture (3C)-quantitative PCR ... Nuclei samples were digested with EcoRI at 37 °C 16 h and then ligated using T4 DNA ligase (NEB) .

    Article Title: Essential Gene Discovery in the Basidiomycete Cryptococcus neoformans for Antifungal Drug Target Prioritization
    Article Snippet: For mutants generated using AMT or biolistic transformation, inverse PCR was used to identify the genes hit by the insertions; when this was unsuccessful, splinkerette PCR was used. .. An 8.5-µl amount was self-ligated with T4 DNA ligase (New England Biolabs) in a 10-µl volume overnight at 4°C, and 1 µl was used as the template for inverse PCR with primers ai076-ai077.

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The following PCR profile was used to amplify target sequences: 95 °C for 5 min; 35 cycles of 95 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min; and 72 °C for 10 min. Amplicons were gel purified and cloned into the pMD19-T Simple plasmid (Takara Bio, Otsu, Japan). .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: A GA reaction was performed by mixing an equal volume of 2 × GA Master Mix (Cat #E2611L; NEB) with 1 pmoL PCR-amplified and DpnI-treated pRV (BB_GAR-F: 5′-ACTTGTTCACTTTGATGGCGAGG-3′, BB_GAR-R: 5′-CTGCACACGACATGACATCACG-3′) and 1 pmol of the recovered shuffled capsids, at 50°C for 30 min. DNA was ethanol precipitated and electroporated into SS320 electro-competent E. coli (Cat #60512-2; Lucigen). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. The gene encoding Fex1p was amplified from the S. cerevisiae genome using primers 1 and 2 ( ) and subcloned into pYC2/CT.

    Article Title: Genetic and Anatomic Determinants of Enzootic Venezuelan Equine Encephalitis Virus Infection of Culex (Melanoconion) taeniopus
    Article Snippet: The two individual fragments were joined by a PCR reaction on both templates utilizing the outermost primer sets. .. The fusion PCR fragment was cleaved with respective restriction enzymes (BssHII and PspOMI for IAB/IE and Bsu36I and NheI for IE/IAB) and ligated to the two other cDNA fragments with T4 DNA ligase (New England Biolabs, Beverly, MA). .. Ligated fragments were transformed into One Shot OmniMAX cells (Invitrogen, Carlsbad, CA), and resulting colonies were screened and sequenced prior to cesium chloride (CsCl) plasmid DNA purification.

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: We gel-purified the double-stranded PCR product and double-digested it using BamHI and XhoI. .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions). .. The tubes were then incubated at 65 °C for 20 min. DNA molecules with sizes comprised between 400 and 800 pb were purified using the PippinPrep apparatus (SAGE science) and amplified using Phusion (Finnzymes).

    3C-Seq:

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: Paragraph title: Processing 3C libraries into 3C-seq libraries ready for sequencing ... DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions).

    Concentration Assay:

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Briefly, cages were assembled by combining equimolar amounts of each strand at a concentration of 1 μM in an assembly buffer containing 40 mM Tris-acetate (pH 8.0) and 15 mM MgCl2 . .. Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs.

    Agarose Gel Electrophoresis:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The PCR product was digested with BamHI and SalI (New England Biolabs), the restriction DNA fragment (insert) was isolated using agarose gel electrophoresis and purified by the MinElute Gel Extraction Kit (Qiagen). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: In each case, the PCR-amplified material was purified by ZymoClean agarose gel purification (Zymo Research, Inc., Irvine, CA) and column cleanup (Qiagen miniprep spin purification kit, Qiagen, Inc., Germany). .. The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Inserts and vectors were quantified by 260nm UV spectrophotometry and densitometry of 1% agarose gel electrophoretic runs. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Plasmid Preparation:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The pGL4.10_mod3_EF1α vector was also digested with BamHI and SalI, the double digested DNA (vector) was isolated and purified in the same way as insert. .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs). .. 1 μl of ligation reaction was transformed to 100 μl of DH5α competent cells (Invitrogen).

    Article Title: Evaluation of IgE Antibodies to Omalizumab (Xolair®) and Their Potential Correlation to Anaphylaxis
    Article Snippet: The mammalian IgE expression vector was also digested with EcoR1 and XhoI and gel purified. .. Purified PCR fragments and vectors were combined and ligated overnight using T4 DNA ligase (New England Biolabs, Cat. No. 0202S).

    Article Title: Therapeutic expression of human clotting factors IX and X following adeno-associated viral vector–mediated intrauterine gene transfer in early-gestation fetal macaques
    Article Snippet: Paragraph title: Vector production ... AAV-inverted terminal repeats with the LP1 promoter were cut with Hin dIII/Mfe I, ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and heat shocked into competent Escherichia coli , which were grown at 37°C overnight ( ).

    Article Title: Bioproduction of pure, kilobase-scale single-stranded DNA
    Article Snippet: Paragraph title: Plasmid assembly by single-stranded DNA ... The two ssDNA products were then mixed in a 1:1 molar ratio and the ssDNA was converted to dsDNA using Phusion polymerase, column purified, and ligated using T4 DNA ligase (NEB) in 1× T4 DNA ligation buffer with 30 ng of amplified DNA incubated at room temperature overnight.

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4]. .. Similarly, a piggyBac vector with 3 × P3-DsRed as a screening marker was prepared as follows.

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: Total pRV library plasmids were purified with an EndoFree Maxiprep Kit (Cat #12362; QIAGEN). .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2]. .. Ligation reactions were concentrated by using ethanol precipitation, electroporated into SS320 electro-competent bacteria, and grown as described above.

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Inserts and vectors were quantified by 260nm UV spectrophotometry and densitometry of 1% agarose gel electrophoretic runs. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL. .. Ligation mixtures were used to transform the E . coli SURE strain (Agilent Technologies) following the manufacturer's instructions.

    Article Title: Heterologous transporters from anaerobic fungi bolster fluoride tolerance in Saccharomyces cerevisiae
    Article Snippet: The genes were synthesized by Genewiz (South Plainfield, NJ, USA); the P. finnis and A. robustus FEX genes were codon optimized for expression in E. coli whereas the N. californiae FEX gene was synthesized both in a codon-optimized version and a non-codon optimized version. .. The genes were subsequently cloned into the yeast centromeric pYC2/CT vector, using restriction enzymes EagI and XhoI and T4 DNA ligase (New England Biolabs, Ipswich, MA, USA). .. In the pYC vector, the cloned gene is downstream of a GAL1 promoter and 3′-terminally fused to green fluorescent protein followed by a decahistidine tag.

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: The base-pairing regions were introduced as overhangs in the forward primer, while the reverse primer was 5′-phosphorylated. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli . .. Purified sgRNA plasmids were verified by sequencing and transformed into electrocompetent L. plantarum harboring pSIP-SH-dCas9.

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The vector was modified to remove a weak σ 70 binding site present 24 bp upstream of the GFP open reading frame (two point mutations, A → G and T → G, were introduced, changing the putative σ 70 binding site from TAGATT to TGGATG, with the consensus σ 70 binding site being TATAAT). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Functional Assay:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: We constructed a piggyBac vector expressing the Gal4 gene under the control of the BmLP3 promoter as follows. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4]. .. Similarly, a piggyBac vector with 3 × P3-DsRed as a screening marker was prepared as follows.

    Binding Assay:

    Article Title: Codon-Optimization of Wild-Type Adeno-Associated Virus Capsid Sequences Enhances DNA Family Shuffling while Conserving Functionality
    Article Snippet: For each primer-less PCR reassembly reaction, 500 ng of gel-extracted fragments was used and fully reassembled capsids were amplified in a second PCR with primers (Shuffling_Rescue-F: 5′-GTCGGAAAGCATATGCCGCG-3′, Shuffling_Rescue-R: 5′-GACGTCGCATGCAACTAGTAT-3′) binding the cap gene and carrying overlapping ends to pRV plasmids. .. Thirty individual clones were picked and Sanger sequenced to sample library variability. pRV-based libraries were then digested overnight with SwaI and NsiI, and 1.4 μg of insert was ligated at 16°C with T4 DNA ligase (Cat #M0202; NEB) for 16 hr into 1 μg of a replication-competent AAV2-based plasmid platform (p-Replication-Competent [p-RC]) containing ITR-2 and rep 2, and unique SwaI and NsiI sites flanking a 1-kb randomized stuffer [ITR2-rep 2-(SwaI)-stuffer-(NsiI)-ITR2].

    Article Title: CRISPR Interference for Rapid Knockdown of Essential Cell Cycle Genes in Lactobacillus plantarum
    Article Snippet: Base-pairing sequences binding to the nontemplate DNA strand were selected. .. Following inverse PCR, the template plasmid was digested using DpnI at 37°C for 2 h. The amplified PCR fragment were self-ligated using T4 DNA ligase (NEB) following the manufacture’s protocol and transformed into E. coli .

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The vector was modified to remove a weak σ 70 binding site present 24 bp upstream of the GFP open reading frame (two point mutations, A → G and T → G, were introduced, changing the putative σ 70 binding site from TAGATT to TGGATG, with the consensus σ 70 binding site being TATAAT). .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Sample Prep:

    Article Title: High-quality genome (re)assembly using chromosomal contact data
    Article Snippet: The sheared DNA was subsequently purified on a QIAquick column and then processed using the Illumina Paired-End DNA Sample Prep Kit (PE-930-1001). .. DNA was ligated to modified Illumina PE adapters (see ) for 3 h at RT in a final volume of 30 μl (20 μl of DNA (~8 μg), 3 μl of ligation buffer 10 × (NEB), 3 μl of T4 DNA ligase (400 U μl−1 ; from NEB) and 4 μl of 10 μM adapter solutions).

    Transgenic Assay:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: Paragraph title: Construction of piggyBac transgenic vectors ... The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Spectrophotometry:

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: Inserts and vectors were quantified by 260nm UV spectrophotometry and densitometry of 1% agarose gel electrophoretic runs. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Article Title: Engineering a responsive DNA triple helix into an octahedral DNA nanostructure for a reversible opening/closing switching mechanism: a computational and experimental integrated study
    Article Snippet: Cages were then incubated for 2 h at 25°C with T4 DNA ligase (New England Biolabs) to covalently close all nicks and analyzed on native 6% polyacrylamide gels in TAE buffer 1× (40 mM Tris, 2 mM EDTA adjust to pH 8.0 with acetic acid) supplemented with 10 mM MgCl2 for 4 h in cold buffer at 250 V. The 50 bp ladder was purchased from New England Biolabs. .. After soaking overnight at room temperature, the residual gel powder was filtered off using a 0.45-mm filtration spin column.

    Activation Assay:

    Article Title: The expression of ecdysteroid UDP-glucosyltransferase enhances cocoon shell ratio by reducing ecdysteroid titre in last-instar larvae of silkworm, Bombyx mori
    Article Snippet: The EGT gene sequence containing an upstream activation sequence (UAS) with Asc I and Xho I sites was synthesized by Takara Bio Corporation and cloned into the pMD19-T Simple plasmid to generate pMD19-T [UAS-EGT]. .. The sequences were assembled into the intermediate plasmid pSL1180 (modified and stored in our laboratory) to generate a functional cassette, which was digested with Asc I and ligated into piggyBac [3 × P3-EGFP] using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), yielding piggyBac [3 × P3-EGFP, Bm LP3-Gal4].

    Produced:

    Article Title: Therapeutic expression of human clotting factors IX and X following adeno-associated viral vector–mediated intrauterine gene transfer in early-gestation fetal macaques
    Article Snippet: scAAV-LP1-hFIXco was produced as described by Nathwani et al . ( ). scAAV-LP1-hFXco was produced similarly, replacing the hFIXco with the codon-optimized hFX transgene (hFXco), from pAV-LP1-hFX with a truncated poly-A. .. AAV-inverted terminal repeats with the LP1 promoter were cut with Hin dIII/Mfe I, ligated with T4 DNA ligase (New England Biolabs, Ipswich, MA, USA), and heat shocked into competent Escherichia coli , which were grown at 37°C overnight ( ).

    Oligonucleotide Synthesis:

    Article Title: Expression noise facilitates the evolution of gene regulation
    Article Snippet: The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr. .. The ligation was performed using T4 DNA ligase (NEB) at 16°C for 24 hr.

    Gel Extraction:

    Article Title: Enhancers active in dopamine neurons are a primary link between genetic variation and neuropsychiatric disease
    Article Snippet: The PCR product was digested with BamHI and SalI (New England Biolabs), the restriction DNA fragment (insert) was isolated using agarose gel electrophoresis and purified by the MinElute Gel Extraction Kit (Qiagen). .. 100 ng of insert and 20 ng of vector were ligated in 10 μl reaction using T4 DNA Ligase (New England Biolabs).

    Article Title: IL12 p35 and p40 subunit genes administered as pPAL plasmid constructs do not improve protection of pPAL-LACK vaccine against canine leishmaniasis
    Article Snippet: The bands were excised and purified with QIAquick Gel Extraction Kit (Qiagen), and the 50μL eluate was diluted to 100μL with milliQ water and precipitated with 0.1 volume of 3M sodium acetate and 2.5 volumes of pre-chilled absolute ethanol at -20°C for 30 min. .. The ligation reactions of insert with 50ng vector at a 5:1 molar ratio were performed at room temperature for 1h using 400 Weiss units of T4-DNA ligase and buffer (NEB) in a final volume of 10μL.

    Variant Assay:

    Article Title: ZBTB10 binds the telomeric variant repeat TTGGGG and interacts with TRF2
    Article Snippet: Double-stranded oligonucleotides were then polymerized using 50 U T4 polynucleotidekinase (Thermo Scientific) and 80 U T4 DNA ligase (NEB), biotinylated with desthiobiotin-dATP (Jena Bioscience) by Klenow fragment (Thermo Scientific) and purified using G-50 columns (GE Healthcare). .. Double-stranded oligonucleotides were then polymerized using 50 U T4 polynucleotidekinase (Thermo Scientific) and 80 U T4 DNA ligase (NEB), biotinylated with desthiobiotin-dATP (Jena Bioscience) by Klenow fragment (Thermo Scientific) and purified using G-50 columns (GE Healthcare).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs t4 dna ligase buffer
    Estimation of Michaelis–Menten parameters for the ligation of DNA splinted by RNA for ( A ) T4 DNA ligase and ( B ) PBCV-1 DNA ligase. Reactions were carried out in ligase assay buffer with 1 mM ATP at 25°C. Initial reaction velocity for the consumption of substrate was measured through fits to the linear region of the reaction (generally the first ∼15% of reaction) with error bars taking into account the uncertainty in the linear fits and initial substrate and enzyme concentrations. Kinetic parameters were determined through fitting the Michaelis–Menten equation to the data by non-linear regression as described in Materials and Methods. For (A), in all reactions the only detected product was AppDNA, and the determined parameters for substrate consumption were k cat  = 2.2 ± 0.2 × 10 −4  s −1  and K M  = 300 ± 70 nM. For (B), the reaction products were a ∼ 3:1 mixture of ligated DNA to AppDNA, and the observed V 0 /[E] 0  was independent of substrate concentration over the range 0.5 nM–100 nM. The approximate k cat  is 8 × 10 −3  s −1  with an upper threshold for the K M  estimated to be 1 nM.
    T4 Dna Ligase Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 93 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase buffer/product/New England Biolabs
    Average 99 stars, based on 93 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase buffer - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs t4 dna ligase
    Reaction of T4 DNA ligase with substrate 1 ( A ) and adenylylated substrate 1A ( B ) under single turnover conditions.  Each reaction was run with 500 n m  ligase and 100 n m  substrate in the standard ATP-free assay buffer. Ligase that was  > 95% adenylylated was used for  A , and
    T4 Dna Ligase, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t4 dna ligase/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    t4 dna ligase - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs e coli dna ligase reaction buffer
    Wild type <t>DNA</t> ligase λ DNA digest ligation assay. Agarose gel electrophoresis of λ DNA cut by EcoRV (A/T Blunt, 1 ), NruI (G/C Blunt, 2 ), BstNI (5′ SBO, 3 ), Hpy188I (3′SBO, 4 ), NdeI (2 BO, 5 ) and BamHI (4 BO, 6 ), generating DNA fragments with ligatable ends. 0.5 ng of the cut DNA was ligated in the presence of T4 ligase reaction buffer (50 mM <t>Tris-HCl</t> pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl2, 1 mM DTT, 1 mM ATP, 6% polyethylene glycol (PEG 6000)) and 7 μM of the indicated DNA ligase for 1 hour at 25°C. Ligation assays performed with T4 DNA ligase (A), T3 DNA ligase (B), PBCV1 DNA ligase (C) and, hLig3 (D), respectively. E) Gel of restriction enzyme digested λ DNA samples as well as a schematic depiction of each substrate. The DNA fragments were visualized using ethidium bromide stain.
    E Coli Dna Ligase Reaction Buffer, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli dna ligase reaction buffer/product/New England Biolabs
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli dna ligase reaction buffer - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Estimation of Michaelis–Menten parameters for the ligation of DNA splinted by RNA for ( A ) T4 DNA ligase and ( B ) PBCV-1 DNA ligase. Reactions were carried out in ligase assay buffer with 1 mM ATP at 25°C. Initial reaction velocity for the consumption of substrate was measured through fits to the linear region of the reaction (generally the first ∼15% of reaction) with error bars taking into account the uncertainty in the linear fits and initial substrate and enzyme concentrations. Kinetic parameters were determined through fitting the Michaelis–Menten equation to the data by non-linear regression as described in Materials and Methods. For (A), in all reactions the only detected product was AppDNA, and the determined parameters for substrate consumption were k cat  = 2.2 ± 0.2 × 10 −4  s −1  and K M  = 300 ± 70 nM. For (B), the reaction products were a ∼ 3:1 mixture of ligated DNA to AppDNA, and the observed V 0 /[E] 0  was independent of substrate concentration over the range 0.5 nM–100 nM. The approximate k cat  is 8 × 10 −3  s −1  with an upper threshold for the K M  estimated to be 1 nM.

    Journal: Nucleic Acids Research

    Article Title: Efficient DNA ligation in DNA-RNA hybrid helices by Chlorella virus DNA ligase

    doi: 10.1093/nar/gkt1032

    Figure Lengend Snippet: Estimation of Michaelis–Menten parameters for the ligation of DNA splinted by RNA for ( A ) T4 DNA ligase and ( B ) PBCV-1 DNA ligase. Reactions were carried out in ligase assay buffer with 1 mM ATP at 25°C. Initial reaction velocity for the consumption of substrate was measured through fits to the linear region of the reaction (generally the first ∼15% of reaction) with error bars taking into account the uncertainty in the linear fits and initial substrate and enzyme concentrations. Kinetic parameters were determined through fitting the Michaelis–Menten equation to the data by non-linear regression as described in Materials and Methods. For (A), in all reactions the only detected product was AppDNA, and the determined parameters for substrate consumption were k cat = 2.2 ± 0.2 × 10 −4 s −1 and K M = 300 ± 70 nM. For (B), the reaction products were a ∼ 3:1 mixture of ligated DNA to AppDNA, and the observed V 0 /[E] 0 was independent of substrate concentration over the range 0.5 nM–100 nM. The approximate k cat is 8 × 10 −3 s −1 with an upper threshold for the K M estimated to be 1 nM.

    Article Snippet: T4 DNA ligase buffer (50 mM Tris pH 7.5 @ 25°C, 10 mM MgCl2 , 10 mM DTT, 1 mM ATP) was obtained as a 10× stock from New England BioLabs, Inc. (NEB, Ipswich, MA).

    Techniques: Ligation, Concentration Assay

    Ligation of DNA splinted by RNA. (Left) Outline of the ligation assay: a 5′-phosphorylated, 3′-FAM labelled DNA ‘donor’ oligonucleotide and an unmodified DNA ‘acceptor’ oligonucleotide are annealed to a complementary RNA or DNA splint. This substrate was reacted with a ligase to form a mixture of unreacted starting material, adenylylated DNA and ligated product. The products were denatured, separated on CE, and detected by fluorescence. (Right) ligation of the standard RNA-splinted substrate in ligase assay buffer for 15 min at 25°C with ( A ) no enzyme, ( B ) 1 µM T4 DNA ligase and 10 µM ATP, ( C ) 1 µM T4 DNA ligase and 1 mM ATP, ( D ) 100 nM PBCV-1 DNA ligase and 10 µM ATP, and ( E ) 100 nM PBCV-1 DNA ligase and 1 mM ATP. Indicated peaks correspond to starting pDNA (I), AppDNA (II) and ligated product (III) as determined by coelution with synthetically prepared standards.

    Journal: Nucleic Acids Research

    Article Title: Efficient DNA ligation in DNA-RNA hybrid helices by Chlorella virus DNA ligase

    doi: 10.1093/nar/gkt1032

    Figure Lengend Snippet: Ligation of DNA splinted by RNA. (Left) Outline of the ligation assay: a 5′-phosphorylated, 3′-FAM labelled DNA ‘donor’ oligonucleotide and an unmodified DNA ‘acceptor’ oligonucleotide are annealed to a complementary RNA or DNA splint. This substrate was reacted with a ligase to form a mixture of unreacted starting material, adenylylated DNA and ligated product. The products were denatured, separated on CE, and detected by fluorescence. (Right) ligation of the standard RNA-splinted substrate in ligase assay buffer for 15 min at 25°C with ( A ) no enzyme, ( B ) 1 µM T4 DNA ligase and 10 µM ATP, ( C ) 1 µM T4 DNA ligase and 1 mM ATP, ( D ) 100 nM PBCV-1 DNA ligase and 10 µM ATP, and ( E ) 100 nM PBCV-1 DNA ligase and 1 mM ATP. Indicated peaks correspond to starting pDNA (I), AppDNA (II) and ligated product (III) as determined by coelution with synthetically prepared standards.

    Article Snippet: T4 DNA ligase buffer (50 mM Tris pH 7.5 @ 25°C, 10 mM MgCl2 , 10 mM DTT, 1 mM ATP) was obtained as a 10× stock from New England BioLabs, Inc. (NEB, Ipswich, MA).

    Techniques: Ligation, Fluorescence

    Detection of defined amounts of luciferase mRNA from a mixture with Jurkat total RNA through ligation of specific DNA probes (Probe set A) and detection by qPCR. RNA/DNA probe mixtures were annealed then incubated with either T4 DNA ligase (open circle) or PBCV-1 DNA ligase (×). The qPCR C q  for each experiment was recorded, with lower C q  indicating higher concentration of ligated probes. ( A ) Ligation time course with either 1 (solid line) or 0.01 ng (dotted line) of luciferase mRNA target, 0–8 h ligation time. ( B ) Dependence of C q  after probe ligation with target luciferase mRNA present over a 7 log concentration range using a 2 h ligation time. NTC = no template control. The error bars show one standard deviation of the average of a minimum of three replicates.

    Journal: Nucleic Acids Research

    Article Title: Efficient DNA ligation in DNA-RNA hybrid helices by Chlorella virus DNA ligase

    doi: 10.1093/nar/gkt1032

    Figure Lengend Snippet: Detection of defined amounts of luciferase mRNA from a mixture with Jurkat total RNA through ligation of specific DNA probes (Probe set A) and detection by qPCR. RNA/DNA probe mixtures were annealed then incubated with either T4 DNA ligase (open circle) or PBCV-1 DNA ligase (×). The qPCR C q for each experiment was recorded, with lower C q indicating higher concentration of ligated probes. ( A ) Ligation time course with either 1 (solid line) or 0.01 ng (dotted line) of luciferase mRNA target, 0–8 h ligation time. ( B ) Dependence of C q after probe ligation with target luciferase mRNA present over a 7 log concentration range using a 2 h ligation time. NTC = no template control. The error bars show one standard deviation of the average of a minimum of three replicates.

    Article Snippet: T4 DNA ligase buffer (50 mM Tris pH 7.5 @ 25°C, 10 mM MgCl2 , 10 mM DTT, 1 mM ATP) was obtained as a 10× stock from New England BioLabs, Inc. (NEB, Ipswich, MA).

    Techniques: Luciferase, Ligation, Real-time Polymerase Chain Reaction, Incubation, Concentration Assay, Standard Deviation

    Ligation of RNA-splinted DNA substrates by PBCV-1 and T4 DNA ligases under general reaction conditions. The 16 RNA-splinted DNA substrates, representing all possible base pairs at the ligation junction, were reacted and the extent of ligation and abortive adenylylation measured. The bases listed on the X axis (dN/pdN) refer to the identity of the base of the DNA acceptor at the ligation junction (dN) and the identity of the phosphorylated base on the donor at the ligation junction (pdN). For all substrates, the correct Watson–Crick base-pairing partner was present in the RNA splint. All reactions were incubated at 37°C in 50 mM Tris pH 7.5, 10 mM MgCl 2 , 10 mM DTT, 100 nM RNA-splinted DNA substrate and ( A ) 100 nM PBCV-1 DNA ligase and 1 mM ATP for 15 min; ( B ) 100 nM PBCV-1 DNA ligase and 10 µM ATP for 15 min; ( C ) 1 µM PBCV-1 DNA ligase and 1 mM ATP for 15 min; ( D ) 1 µM PBCV-1 DNA ligase and 10 µM ATP for 15 min; ( E ) 1 µM T4 DNA ligase and 10 µM ATP for 15 min; and ( F ) 1 µM T4 DNA ligase and 10 µM ATP for 4 h. Here the total height of the bar indicates the fraction of starting material converted to products, with the solid portion indicating ligation product yield and the hashed portion indicating AppDNA yield.

    Journal: Nucleic Acids Research

    Article Title: Efficient DNA ligation in DNA-RNA hybrid helices by Chlorella virus DNA ligase

    doi: 10.1093/nar/gkt1032

    Figure Lengend Snippet: Ligation of RNA-splinted DNA substrates by PBCV-1 and T4 DNA ligases under general reaction conditions. The 16 RNA-splinted DNA substrates, representing all possible base pairs at the ligation junction, were reacted and the extent of ligation and abortive adenylylation measured. The bases listed on the X axis (dN/pdN) refer to the identity of the base of the DNA acceptor at the ligation junction (dN) and the identity of the phosphorylated base on the donor at the ligation junction (pdN). For all substrates, the correct Watson–Crick base-pairing partner was present in the RNA splint. All reactions were incubated at 37°C in 50 mM Tris pH 7.5, 10 mM MgCl 2 , 10 mM DTT, 100 nM RNA-splinted DNA substrate and ( A ) 100 nM PBCV-1 DNA ligase and 1 mM ATP for 15 min; ( B ) 100 nM PBCV-1 DNA ligase and 10 µM ATP for 15 min; ( C ) 1 µM PBCV-1 DNA ligase and 1 mM ATP for 15 min; ( D ) 1 µM PBCV-1 DNA ligase and 10 µM ATP for 15 min; ( E ) 1 µM T4 DNA ligase and 10 µM ATP for 15 min; and ( F ) 1 µM T4 DNA ligase and 10 µM ATP for 4 h. Here the total height of the bar indicates the fraction of starting material converted to products, with the solid portion indicating ligation product yield and the hashed portion indicating AppDNA yield.

    Article Snippet: T4 DNA ligase buffer (50 mM Tris pH 7.5 @ 25°C, 10 mM MgCl2 , 10 mM DTT, 1 mM ATP) was obtained as a 10× stock from New England BioLabs, Inc. (NEB, Ipswich, MA).

    Techniques: Ligation, Dominant Negative Mutation, Incubation

    Reaction of T4 DNA ligase with substrate 1 ( A ) and adenylylated substrate 1A ( B ) under single turnover conditions.  Each reaction was run with 500 n m  ligase and 100 n m  substrate in the standard ATP-free assay buffer. Ligase that was  > 95% adenylylated was used for  A , and

    Journal: The Journal of Biological Chemistry

    Article Title:

    doi: 10.1074/jbc.M111.284992

    Figure Lengend Snippet: Reaction of T4 DNA ligase with substrate 1 ( A ) and adenylylated substrate 1A ( B ) under single turnover conditions. Each reaction was run with 500 n m ligase and 100 n m substrate in the standard ATP-free assay buffer. Ligase that was > 95% adenylylated was used for A , and

    Article Snippet: T4 DNA ligase buffer (50 mm Tris, pH 7.5, at 25 °C, 10 mm MgCl2 , 10 mm DTT, 1 mm ATP) was obtained as a 10× stock from New England Biolabs, Inc. ATP-free T4 DNA ligase buffer (50 mm Tris, pH 7.5, at 25 °C, 10 mm MgCl2 , 10 mm DTT) was prepared from 1 m stocks of each salt from Amresco or New England Biolabs.

    Techniques:

    Pre-steady state reactions of 30 n m  (♦) and 50 n m  (■) T4 DNA ligase with 100 n m  substrate 1.  Reactions were run in the standard assay buffer. Each time point represents the average of three experiments, and the  error bars  represent one S.D. The  dashed lines  represent fits by simulation using the chemical rates determined from single turnover reaction of substrate  1 , literature values for Step 1 rates, and diffusion-limited binding of DNA and allowing the rate of product release ( k off ) and the amplitude ( a ) to vary. The best fit was obtained with  a  = 0.51 and  k off  = 0.58 s −1 .

    Journal: The Journal of Biological Chemistry

    Article Title:

    doi: 10.1074/jbc.M111.284992

    Figure Lengend Snippet: Pre-steady state reactions of 30 n m (♦) and 50 n m (■) T4 DNA ligase with 100 n m substrate 1. Reactions were run in the standard assay buffer. Each time point represents the average of three experiments, and the error bars represent one S.D. The dashed lines represent fits by simulation using the chemical rates determined from single turnover reaction of substrate 1 , literature values for Step 1 rates, and diffusion-limited binding of DNA and allowing the rate of product release ( k off ) and the amplitude ( a ) to vary. The best fit was obtained with a = 0.51 and k off = 0.58 s −1 .

    Article Snippet: T4 DNA ligase buffer (50 mm Tris, pH 7.5, at 25 °C, 10 mm MgCl2 , 10 mm DTT, 1 mm ATP) was obtained as a 10× stock from New England Biolabs, Inc. ATP-free T4 DNA ligase buffer (50 mm Tris, pH 7.5, at 25 °C, 10 mm MgCl2 , 10 mm DTT) was prepared from 1 m stocks of each salt from Amresco or New England Biolabs.

    Techniques: Diffusion-based Assay, Binding Assay

    Determination of  k cat  and  k cat / K m  for T4 DNA ligase and nicked substrates.  Shown is reaction of 1 n m  T4 DNA ligase with 1 n m  (○), 2 n m  (*), 5 n m  (×), 10 n m  (△), 20 n m  (♢), and 50 n m  (□) substrate  1  in standard assay buffer at 16 °C ( A ) and 1 n m  T4 DNA ligase (

    Journal: The Journal of Biological Chemistry

    Article Title:

    doi: 10.1074/jbc.M111.284992

    Figure Lengend Snippet: Determination of k cat and k cat / K m for T4 DNA ligase and nicked substrates. Shown is reaction of 1 n m T4 DNA ligase with 1 n m (○), 2 n m (*), 5 n m (×), 10 n m (△), 20 n m (♢), and 50 n m (□) substrate 1 in standard assay buffer at 16 °C ( A ) and 1 n m T4 DNA ligase (

    Article Snippet: T4 DNA ligase buffer (50 mm Tris, pH 7.5, at 25 °C, 10 mm MgCl2 , 10 mm DTT, 1 mm ATP) was obtained as a 10× stock from New England Biolabs, Inc. ATP-free T4 DNA ligase buffer (50 mm Tris, pH 7.5, at 25 °C, 10 mm MgCl2 , 10 mm DTT) was prepared from 1 m stocks of each salt from Amresco or New England Biolabs.

    Techniques:

    Reaction of T4 DNA ligase with substrate 1 ( A ) and adenylylated substrate 1A ( B ) under single turnover conditions.  Each reaction was run with 500 n m  ligase and 100 n m  substrate in the standard ATP-free assay buffer. Ligase that was  > 95% adenylylated was used for  A , and

    Journal: The Journal of Biological Chemistry

    Article Title:

    doi: 10.1074/jbc.M111.284992

    Figure Lengend Snippet: Reaction of T4 DNA ligase with substrate 1 ( A ) and adenylylated substrate 1A ( B ) under single turnover conditions. Each reaction was run with 500 n m ligase and 100 n m substrate in the standard ATP-free assay buffer. Ligase that was > 95% adenylylated was used for A , and

    Article Snippet: The RQF was utilized as above with T4 DNA ligase (5 μm , < 5% adenylyated in ATP-free buffer) in syringe A and ATP (2 mm ATP added to 1× ATP-free buffer containing 200 μCi of [α-32 P]ATP/ml solution) in syringe B.

    Techniques:

    Pre-steady state reactions of 30 n m  (♦) and 50 n m  (■) T4 DNA ligase with 100 n m  substrate 1.  Reactions were run in the standard assay buffer. Each time point represents the average of three experiments, and the  error bars  represent one S.D. The  dashed lines  represent fits by simulation using the chemical rates determined from single turnover reaction of substrate  1 , literature values for Step 1 rates, and diffusion-limited binding of DNA and allowing the rate of product release ( k off ) and the amplitude ( a ) to vary. The best fit was obtained with  a  = 0.51 and  k off  = 0.58 s −1 .

    Journal: The Journal of Biological Chemistry

    Article Title:

    doi: 10.1074/jbc.M111.284992

    Figure Lengend Snippet: Pre-steady state reactions of 30 n m (♦) and 50 n m (■) T4 DNA ligase with 100 n m substrate 1. Reactions were run in the standard assay buffer. Each time point represents the average of three experiments, and the error bars represent one S.D. The dashed lines represent fits by simulation using the chemical rates determined from single turnover reaction of substrate 1 , literature values for Step 1 rates, and diffusion-limited binding of DNA and allowing the rate of product release ( k off ) and the amplitude ( a ) to vary. The best fit was obtained with a = 0.51 and k off = 0.58 s −1 .

    Article Snippet: The RQF was utilized as above with T4 DNA ligase (5 μm , < 5% adenylyated in ATP-free buffer) in syringe A and ATP (2 mm ATP added to 1× ATP-free buffer containing 200 μCi of [α-32 P]ATP/ml solution) in syringe B.

    Techniques: Diffusion-based Assay, Binding Assay

    Determination of  k cat  and  k cat / K m  for T4 DNA ligase and nicked substrates.  Shown is reaction of 1 n m  T4 DNA ligase with 1 n m  (○), 2 n m  (*), 5 n m  (×), 10 n m  (△), 20 n m  (♢), and 50 n m  (□) substrate  1  in standard assay buffer at 16 °C ( A ) and 1 n m  T4 DNA ligase (

    Journal: The Journal of Biological Chemistry

    Article Title:

    doi: 10.1074/jbc.M111.284992

    Figure Lengend Snippet: Determination of k cat and k cat / K m for T4 DNA ligase and nicked substrates. Shown is reaction of 1 n m T4 DNA ligase with 1 n m (○), 2 n m (*), 5 n m (×), 10 n m (△), 20 n m (♢), and 50 n m (□) substrate 1 in standard assay buffer at 16 °C ( A ) and 1 n m T4 DNA ligase (

    Article Snippet: The RQF was utilized as above with T4 DNA ligase (5 μm , < 5% adenylyated in ATP-free buffer) in syringe A and ATP (2 mm ATP added to 1× ATP-free buffer containing 200 μCi of [α-32 P]ATP/ml solution) in syringe B.

    Techniques:

    Wild type DNA ligase λ DNA digest ligation assay. Agarose gel electrophoresis of λ DNA cut by EcoRV (A/T Blunt, 1 ), NruI (G/C Blunt, 2 ), BstNI (5′ SBO, 3 ), Hpy188I (3′SBO, 4 ), NdeI (2 BO, 5 ) and BamHI (4 BO, 6 ), generating DNA fragments with ligatable ends. 0.5 ng of the cut DNA was ligated in the presence of T4 ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl2, 1 mM DTT, 1 mM ATP, 6% polyethylene glycol (PEG 6000)) and 7 μM of the indicated DNA ligase for 1 hour at 25°C. Ligation assays performed with T4 DNA ligase (A), T3 DNA ligase (B), PBCV1 DNA ligase (C) and, hLig3 (D), respectively. E) Gel of restriction enzyme digested λ DNA samples as well as a schematic depiction of each substrate. The DNA fragments were visualized using ethidium bromide stain.

    Journal: PLoS ONE

    Article Title: Comparative analysis of the end-joining activity of several DNA ligases

    doi: 10.1371/journal.pone.0190062

    Figure Lengend Snippet: Wild type DNA ligase λ DNA digest ligation assay. Agarose gel electrophoresis of λ DNA cut by EcoRV (A/T Blunt, 1 ), NruI (G/C Blunt, 2 ), BstNI (5′ SBO, 3 ), Hpy188I (3′SBO, 4 ), NdeI (2 BO, 5 ) and BamHI (4 BO, 6 ), generating DNA fragments with ligatable ends. 0.5 ng of the cut DNA was ligated in the presence of T4 ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl2, 1 mM DTT, 1 mM ATP, 6% polyethylene glycol (PEG 6000)) and 7 μM of the indicated DNA ligase for 1 hour at 25°C. Ligation assays performed with T4 DNA ligase (A), T3 DNA ligase (B), PBCV1 DNA ligase (C) and, hLig3 (D), respectively. E) Gel of restriction enzyme digested λ DNA samples as well as a schematic depiction of each substrate. The DNA fragments were visualized using ethidium bromide stain.

    Article Snippet: In this case the buffer used was E. Coli DNA Ligase reaction buffer from NEB: 30 mM Tris-HCl, pH 8 @ 25°C,4 mM MgCl2 , 26 μM NAD, 1 mM DTT, 50 μg/ml BSA.

    Techniques: Ligation, Agarose Gel Electrophoresis, Staining

    Effect of DBDs on blunt/cohesive end λ DNA Re-ligation. Agarose gel electrophoresis of λ DNA cut by EcoRV (A/T Blunt, 1), NruI (G/C Blunt, 2), BstNI (5′ SBO, 3), Hpy188I (3′SBO, 4), NdeI (2 BO, 5) and BamHI (4 BO, 6), generating DNA fragments with ligatable ends. 0.5 ng of the cut DNA was ligated in T4 ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl 2 , 1 mM DTT, 1 mM ATP, 6% Polyethylene glycol (PEG 6000)) and 7 μM of the indicated DNA ligase for 1 hour at 25°C. Ligation assays performed with PBCV1-Nterm-Sso7d (A), PBCV1-Cterm-Sso7d terminus (B), PBCV1-Nterm-ZnF (C), PBCV1-Nterm-T4NTD (D). (E) Gel of restriction enzyme digested λ DNA samples as well as a schematic depiction of each substrate. The DNA fragments were visualized using ethidium bromide stain.

    Journal: PLoS ONE

    Article Title: Comparative analysis of the end-joining activity of several DNA ligases

    doi: 10.1371/journal.pone.0190062

    Figure Lengend Snippet: Effect of DBDs on blunt/cohesive end λ DNA Re-ligation. Agarose gel electrophoresis of λ DNA cut by EcoRV (A/T Blunt, 1), NruI (G/C Blunt, 2), BstNI (5′ SBO, 3), Hpy188I (3′SBO, 4), NdeI (2 BO, 5) and BamHI (4 BO, 6), generating DNA fragments with ligatable ends. 0.5 ng of the cut DNA was ligated in T4 ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl 2 , 1 mM DTT, 1 mM ATP, 6% Polyethylene glycol (PEG 6000)) and 7 μM of the indicated DNA ligase for 1 hour at 25°C. Ligation assays performed with PBCV1-Nterm-Sso7d (A), PBCV1-Cterm-Sso7d terminus (B), PBCV1-Nterm-ZnF (C), PBCV1-Nterm-T4NTD (D). (E) Gel of restriction enzyme digested λ DNA samples as well as a schematic depiction of each substrate. The DNA fragments were visualized using ethidium bromide stain.

    Article Snippet: In this case the buffer used was E. Coli DNA Ligase reaction buffer from NEB: 30 mM Tris-HCl, pH 8 @ 25°C,4 mM MgCl2 , 26 μM NAD, 1 mM DTT, 50 μg/ml BSA.

    Techniques: Ligation, Agarose Gel Electrophoresis, Staining

    Wild type DNA ligase blunt/cohesive capillary electrophoresis assay. Bar graphs depict the fraction of either ligated DNA (product, blue) or abortive adenylylation (App, red) produced in a 20-minute sealing reaction with the indicated DNA substrate. Reactions included 1 μM of the DNA ligase, 100 nM of the substrate and reaction conditions consisting of either T4 DNA ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl 2 , 1 mM DTT, 1 mM ATP, 6% Polyethylene glycol (PEG 6000)). Ligation assays performed with T4 DNA ligase (A), T3 DNA ligase (B), PBCV1 DNA ligase (C) and hLig3 (D), respectively Experiments were performed in triplicate; the plotted value is the average and the error bars represent the standard deviation across replicates.

    Journal: PLoS ONE

    Article Title: Comparative analysis of the end-joining activity of several DNA ligases

    doi: 10.1371/journal.pone.0190062

    Figure Lengend Snippet: Wild type DNA ligase blunt/cohesive capillary electrophoresis assay. Bar graphs depict the fraction of either ligated DNA (product, blue) or abortive adenylylation (App, red) produced in a 20-minute sealing reaction with the indicated DNA substrate. Reactions included 1 μM of the DNA ligase, 100 nM of the substrate and reaction conditions consisting of either T4 DNA ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl 2 , 1 mM DTT, 1 mM ATP, 6% Polyethylene glycol (PEG 6000)). Ligation assays performed with T4 DNA ligase (A), T3 DNA ligase (B), PBCV1 DNA ligase (C) and hLig3 (D), respectively Experiments were performed in triplicate; the plotted value is the average and the error bars represent the standard deviation across replicates.

    Article Snippet: In this case the buffer used was E. Coli DNA Ligase reaction buffer from NEB: 30 mM Tris-HCl, pH 8 @ 25°C,4 mM MgCl2 , 26 μM NAD, 1 mM DTT, 50 μg/ml BSA.

    Techniques: Electrophoresis, Produced, Ligation, Standard Deviation

    Effect of DBD on blunt/cohesive end ligation. Bar graphs depict the fraction of either ligated DNA (product, blue) or abortive adenylylation (App, red) produced in a 20-minute sealing reaction with the indicated DNA substrate. Reactions included 1 μM of the DNA ligase, 100 nM of the substrate and reaction conditions consisting of either T4 DNA ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl 2 , 1 mM DTT, 1 mM ATP, 6% Polyethylene glycol (PEG 6000)). Ligation assays performed with PBCV1-Nterm-Sso7d (A), PBCV1-Cterm-Sso7d terminus (B), PBCV1-Nterm-ZnF (C), PBCV1-Nterm-T4NTD (D). Experiments were performed in triplicate; the plotted value is the average and the error bars represent the standard deviation across replicates.

    Journal: PLoS ONE

    Article Title: Comparative analysis of the end-joining activity of several DNA ligases

    doi: 10.1371/journal.pone.0190062

    Figure Lengend Snippet: Effect of DBD on blunt/cohesive end ligation. Bar graphs depict the fraction of either ligated DNA (product, blue) or abortive adenylylation (App, red) produced in a 20-minute sealing reaction with the indicated DNA substrate. Reactions included 1 μM of the DNA ligase, 100 nM of the substrate and reaction conditions consisting of either T4 DNA ligase reaction buffer (50 mM Tris-HCl pH 7.5 @ 25°C, 1 mM ATP and 10 mM MgCl 2 ) or NEBNext ® Quick Ligation reaction buffer (66 mM Tris pH 7.6 @ 25°C, 10 mM MgCl 2 , 1 mM DTT, 1 mM ATP, 6% Polyethylene glycol (PEG 6000)). Ligation assays performed with PBCV1-Nterm-Sso7d (A), PBCV1-Cterm-Sso7d terminus (B), PBCV1-Nterm-ZnF (C), PBCV1-Nterm-T4NTD (D). Experiments were performed in triplicate; the plotted value is the average and the error bars represent the standard deviation across replicates.

    Article Snippet: In this case the buffer used was E. Coli DNA Ligase reaction buffer from NEB: 30 mM Tris-HCl, pH 8 @ 25°C,4 mM MgCl2 , 26 μM NAD, 1 mM DTT, 50 μg/ml BSA.

    Techniques: Ligation, Produced, Standard Deviation