t forsythia  (ATCC)


Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    ATCC t forsythia
    T Forsythia, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t forsythia/product/ATCC
    Average 99 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    t forsythia - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia
    Article Snippet: Paragraph title: Cloning and mutant construction ... Genomic DNA from T. forsythia was extracted from strain ATCC 43037.

    Article Title: Mirolysin, a LysargiNase from Tannerella forsythia, proteolytically inactivates the human cathelicidin, LL-37
    Article Snippet: Paragraph title: Cloning and mutant construction ... Genomic DNA from T. forsythia was isolated from strain ATCC 43037.

    Article Title: A Novel Matrix Metalloprotease-like Enzyme (Karilysin) of the Periodontal Pathogen Tannerella forsythia ATCC 43037
    Article Snippet: Genomic DNA of T. forsythia was extracted from strain ATCC 43037. .. The PCR product was purified and cloned into the Bam HI/ Xho I site of pGEX-6P-1 expression vector, which provides the coding sequence for an N-terminal glutathione-S-transferase (GST).

    Centrifugation:

    Article Title: Differential effects of periopathogens on host protease inhibitors SLPI, elafin, SCCA1, and SCCA2
    Article Snippet: T. forsythia (ATCC 49610) was grown in 5% blood agar plates (Remel, Lenexa, KS) with a N-acetylmuramic acid (NAM) disk, and then bacteria were scraped from the agar surface using sterile cotton swabs and subcultured in heart infusion broth media (BBL, sparks, MD) supplemented with hemin, vitamin K, and l-cysteine under anaerobic conditions at 37°C ( ). .. Cell-free Bacterial supernatants were collected by centrifugation at 800g for 5 min at 4°C and frozen at −80°C for all experiments.

    Amplification:

    Article Title: Impact of aging on TREM-1 responses in the periodontium: a cross-sectional study in an elderly population
    Article Snippet: Briefly, DNA amplification and detection were performed in a qPCR system (StepOnePlus, Applied Biosystems Life Technologies, Basel, Switzerland), using master mix SYBR Green Master Mix (Applied Biosystems Life Technologies, Basel, Switzerland) for the amplification reaction. .. T. forsythia (OMZ 1047), T. denticola (ATCC 35405; OMZ 661), P. intermedia (OMZ 278), F. nucleatum (OMZ 598), were maintained in liquid cultures as described earlier [ ].

    Article Title: Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia
    Article Snippet: Genomic DNA from T. forsythia was extracted from strain ATCC 43037. .. The coding sequence of the full length mirolase gene, proMir (Ser19-Lys791, bfor_c_1_10621/10622; ) and mirolase without C-terminal extension, Mircat (Ser19-Pro535), both without the nucleotide sequence that encodes a signal peptide) were amplified by PCR, the amplicon purified and cloned into the pGEX-6P-1 expression vector using BamHI/XhoI sites and the following PCR primers (restriction sites are underlined): proMir_F: 5′-GCA GGATCC TCCGGACAGCAGCGCTATTA -3′ proMir_R: 5′-CCG CTCGAG TTATTTTTTGATCAATTTCTG -3′ Mircat_F: 5′-ATA GGATCC CAGCCGGCAGAGCGCGGT-3′ Mircat_R: 5′-CCG CTCGAG TTAAGGGGCTACGG -3′ The resulting recombinant product included an N-terminal glutathione-S-transferase (GST) tag, a PreScission protease cleavage site followed by the cloned protein.

    Article Title: Comparison of culture and polymerase chain reaction techniques in the identification of Tannerella forsythia in periodontal health and disease, an in vitro study
    Article Snippet: [ ] Purified genomic DNA from T. forsythia (B. forsythus ATCC 43037) was used as a positive control and distilled water as a negative control. .. Preparations were amplified in a DNA thermocycler.

    Article Title: Mirolysin, a LysargiNase from Tannerella forsythia, proteolytically inactivates the human cathelicidin, LL-37
    Article Snippet: Genomic DNA from T. forsythia was isolated from strain ATCC 43037. .. The coding sequences of the full-length mirolysin gene, proMir (Ser25-Lys612, BFO_2661; GenBank accession number: ), and mirolysin CD with NTP, Mircat (Ser25-Ser331), both without the nucleotide sequence that encodes the SP, were amplified by PCR using the following primers (restriction sites are underlined): proMir_F: 5′-ACA GGATCC TCTGAGTTGAATATGGAAC-3′ proMir_R: 5′-CGG CTCGAG TTACTTCTTAATCAATTTCTGC-3′ Mircat_F: 5′-ACA GGATCC TCTGAGTTGAATATGGAACAAATCC-3′ Mircat_R: 5′-CGG CTCGAG TTAGGAGAAAGAAAGTGGATTCG-3′ The PCR products were purified and cloned into the pGEX-6P-1 vector, which provides the sequence for an N-terminal GST tag and inserts five additional residues (Gly-Pro-Leu-Gly-Ser) in the N-terminus of mirolysin.

    Article Title: A Novel Matrix Metalloprotease-like Enzyme (Karilysin) of the Periodontal Pathogen Tannerella forsythia ATCC 43037
    Article Snippet: Genomic DNA of T. forsythia was extracted from strain ATCC 43037. .. The entire karilysin ( kly ), except for the nucleotide sequence that encodes the signal peptide, was amplified by PCR by using forward primer, (Kly-F) 5′-AAG GGATCC CAGCGCCTATACGATAATGG-3′ with an Bam HI recognition site (underlined) and reverse primer (Kly-R) 5′-CCG CTCGAG TTACTTTTTGATCAACTTCTGCG-3′ with an Xho I recognition site (underlined).

    Positive Control:

    Article Title: Comparison of culture and polymerase chain reaction techniques in the identification of Tannerella forsythia in periodontal health and disease, an in vitro study
    Article Snippet: .. [ ] Purified genomic DNA from T. forsythia (B. forsythus ATCC 43037) was used as a positive control and distilled water as a negative control. .. Preparations were amplified in a DNA thermocycler.

    Blocking Assay:

    Article Title: Comparison of serum amyloid A protein and C-reactive protein levels as inflammatory markers in periodontitis
    Article Snippet: ELISA was performed as follows: a 96-well plate (Immulux HB, Technologies Inc., Chantilly, VA, USA) was covered with 50 µL of a 10-µg/mL concentration of sonicated P. gingivalis (TCC 33277), T. forsythia (ATCC43037) or A. actinomycetemcomitans (ATCC 29523) in a carbonate buffer (pH 9.6) and incubated overnight. .. The plates were blocked with 150 µL of solution of phosphate buffered saline (PBS, pH 7.2) with 1% bovine serum albumin (BSA, Sigma-Aldrich Co.), for one hour, and 1% milk and avidin (Avidin/Biotin Blocking Kit, Vector Laboratories Inc., Burlingame, CA, USA).

    SYBR Green Assay:

    Article Title: Impact of aging on TREM-1 responses in the periodontium: a cross-sectional study in an elderly population
    Article Snippet: Briefly, DNA amplification and detection were performed in a qPCR system (StepOnePlus, Applied Biosystems Life Technologies, Basel, Switzerland), using master mix SYBR Green Master Mix (Applied Biosystems Life Technologies, Basel, Switzerland) for the amplification reaction. .. T. forsythia (OMZ 1047), T. denticola (ATCC 35405; OMZ 661), P. intermedia (OMZ 278), F. nucleatum (OMZ 598), were maintained in liquid cultures as described earlier [ ].

    Incubation:

    Article Title: Comparison of serum amyloid A protein and C-reactive protein levels as inflammatory markers in periodontitis
    Article Snippet: .. ELISA was performed as follows: a 96-well plate (Immulux HB, Technologies Inc., Chantilly, VA, USA) was covered with 50 µL of a 10-µg/mL concentration of sonicated P. gingivalis (TCC 33277), T. forsythia (ATCC43037) or A. actinomycetemcomitans (ATCC 29523) in a carbonate buffer (pH 9.6) and incubated overnight. .. The plates were blocked with 150 µL of solution of phosphate buffered saline (PBS, pH 7.2) with 1% bovine serum albumin (BSA, Sigma-Aldrich Co.), for one hour, and 1% milk and avidin (Avidin/Biotin Blocking Kit, Vector Laboratories Inc., Burlingame, CA, USA).

    Article Title: Draft Genome Sequences of Three Clinical Isolates of Tannerella forsythia Isolated from Subgingival Plaque from Periodontitis Patients in the United States
    Article Snippet: Briefly, plaque samples from periodontal pockets > 5 mm were serially diluted and plated on tryptic soy blood agar plus MurNAc plates ( ) and incubated anaerobically (37°C), before sialidase-positive colonies were picked and grown in broth cultures and gDNA was isolated. .. Colonies with a 16S rDNA sequence identifying them as strains of T. forsythia via comparison to ATCC 43037 were subsequently passaged and maintained on agar.

    Expressing:

    Article Title: Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia
    Article Snippet: Genomic DNA from T. forsythia was extracted from strain ATCC 43037. .. The coding sequence of the full length mirolase gene, proMir (Ser19-Lys791, bfor_c_1_10621/10622; ) and mirolase without C-terminal extension, Mircat (Ser19-Pro535), both without the nucleotide sequence that encodes a signal peptide) were amplified by PCR, the amplicon purified and cloned into the pGEX-6P-1 expression vector using BamHI/XhoI sites and the following PCR primers (restriction sites are underlined): proMir_F: 5′-GCA GGATCC TCCGGACAGCAGCGCTATTA -3′ proMir_R: 5′-CCG CTCGAG TTATTTTTTGATCAATTTCTG -3′ Mircat_F: 5′-ATA GGATCC CAGCCGGCAGAGCGCGGT-3′ Mircat_R: 5′-CCG CTCGAG TTAAGGGGCTACGG -3′ The resulting recombinant product included an N-terminal glutathione-S-transferase (GST) tag, a PreScission protease cleavage site followed by the cloned protein.

    Article Title: Impact of Porphyromonas gingivalis Peptidylarginine Deiminase on Bacterial Biofilm Formation, Epithelial Cell Invasion, and Epithelial Cell Transcriptional Landscape
    Article Snippet: Wild-type (WT) P. gingivalis strain ATCC 33277, its isogenic mutants with a deleted PPAD gene (Δ ppad ) and expressing catalytically inactive PPAD (C351A, PPADC351A ), and T. forsythia ATCC 43037, F. nucleatum ATCC 25586, A. naeslundii ATCC 12104, and S. gordonii ATCC 10558 were used in this study. .. T. forsythia was grown on ATCC 1921-NAM agar, and the remaining strains were pre-cultivated on blood agar.

    Article Title: Regulation and Molecular Basis of Environmental Muropeptide Uptake and Utilization in Fastidious Oral Anaerobe Tannerella forsythia
    Article Snippet: Our data presented here utilizing a reporter system in E. coli showed that the promoter driving the expression of Tanf_08345-Tanf_08370 operon was directly regulated by GppX in the E. coli heterologous system where a direct regulation and interaction with promoter is the only explanation for the data observed. .. In addition, in this study we provided direct evidence that T. forsythia can utilize exogenous muropeptides and F. nucleatum ATCC 25586 can support T. forsythia growth.

    Article Title: A Novel Matrix Metalloprotease-like Enzyme (Karilysin) of the Periodontal Pathogen Tannerella forsythia ATCC 43037
    Article Snippet: Paragraph title: Expression and mutant construction ... Genomic DNA of T. forsythia was extracted from strain ATCC 43037.

    Modification:

    Article Title: Impact of Porphyromonas gingivalis Peptidylarginine Deiminase on Bacterial Biofilm Formation, Epithelial Cell Invasion, and Epithelial Cell Transcriptional Landscape
    Article Snippet: T. forsythia was grown on ATCC 1921-NAM agar, and the remaining strains were pre-cultivated on blood agar. .. The biofilm growth medium was the modified Wilkins-Chalgren anaerobe broth supplemented with 5% defibrinated sheep blood and 0.01% N -acetylmuramic-acid (Sigma-Aldrich, St. Louis, USA).

    Transformation Assay:

    Article Title: Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia
    Article Snippet: Genomic DNA from T. forsythia was extracted from strain ATCC 43037. .. The correctness of recombinant plasmids (pGEX-6P-1_proMir, pGEX-6P1_Mircat) were confirmed by DNA sequencing and then they were transformed into Escherichia coli strain BL21 (DE3) (New England Biolabs, Ipswich, MA, USA) under the control of the T7 promoter.

    Cell Culture:

    Article Title: Differential effects of periopathogens on host protease inhibitors SLPI, elafin, SCCA1, and SCCA2
    Article Snippet: P. gingivalis wild-type and mutant strains were cultured under anaerobic conditions (85% N2 , 10% H2 , and 5% CO2 ) at 37°C in Trypticase soy broth (BBL, Sparks, MD) supplemented with 1 g of yeast extract, 5 mg of hemin, and 1 mg of menadione per liter. .. T. forsythia (ATCC 49610) was grown in 5% blood agar plates (Remel, Lenexa, KS) with a N-acetylmuramic acid (NAM) disk, and then bacteria were scraped from the agar surface using sterile cotton swabs and subcultured in heart infusion broth media (BBL, sparks, MD) supplemented with hemin, vitamin K, and l-cysteine under anaerobic conditions at 37°C ( ).

    Article Title: Impact of Porphyromonas gingivalis Peptidylarginine Deiminase on Bacterial Biofilm Formation, Epithelial Cell Invasion, and Epithelial Cell Transcriptional Landscape
    Article Snippet: Paragraph title: Bacterial strains and mammalian cell culture ... T. forsythia was grown on ATCC 1921-NAM agar, and the remaining strains were pre-cultivated on blood agar.

    DNA Sequencing:

    Article Title: Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia
    Article Snippet: Genomic DNA from T. forsythia was extracted from strain ATCC 43037. .. The correctness of recombinant plasmids (pGEX-6P-1_proMir, pGEX-6P1_Mircat) were confirmed by DNA sequencing and then they were transformed into Escherichia coli strain BL21 (DE3) (New England Biolabs, Ipswich, MA, USA) under the control of the T7 promoter.

    Polymerase Chain Reaction:

    Article Title: Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia
    Article Snippet: Genomic DNA from T. forsythia was extracted from strain ATCC 43037. .. The coding sequence of the full length mirolase gene, proMir (Ser19-Lys791, bfor_c_1_10621/10622; ) and mirolase without C-terminal extension, Mircat (Ser19-Pro535), both without the nucleotide sequence that encodes a signal peptide) were amplified by PCR, the amplicon purified and cloned into the pGEX-6P-1 expression vector using BamHI/XhoI sites and the following PCR primers (restriction sites are underlined): proMir_F: 5′-GCA GGATCC TCCGGACAGCAGCGCTATTA -3′ proMir_R: 5′-CCG CTCGAG TTATTTTTTGATCAATTTCTG -3′ Mircat_F: 5′-ATA GGATCC CAGCCGGCAGAGCGCGGT-3′ Mircat_R: 5′-CCG CTCGAG TTAAGGGGCTACGG -3′ The resulting recombinant product included an N-terminal glutathione-S-transferase (GST) tag, a PreScission protease cleavage site followed by the cloned protein.

    Article Title: Comparison of culture and polymerase chain reaction techniques in the identification of Tannerella forsythia in periodontal health and disease, an in vitro study
    Article Snippet: Paragraph title: PCR assay ... [ ] Purified genomic DNA from T. forsythia (B. forsythus ATCC 43037) was used as a positive control and distilled water as a negative control.

    Article Title: Mirolysin, a LysargiNase from Tannerella forsythia, proteolytically inactivates the human cathelicidin, LL-37
    Article Snippet: Genomic DNA from T. forsythia was isolated from strain ATCC 43037. .. The coding sequences of the full-length mirolysin gene, proMir (Ser25-Lys612, BFO_2661; GenBank accession number: ), and mirolysin CD with NTP, Mircat (Ser25-Ser331), both without the nucleotide sequence that encodes the SP, were amplified by PCR using the following primers (restriction sites are underlined): proMir_F: 5′-ACA GGATCC TCTGAGTTGAATATGGAAC-3′ proMir_R: 5′-CGG CTCGAG TTACTTCTTAATCAATTTCTGC-3′ Mircat_F: 5′-ACA GGATCC TCTGAGTTGAATATGGAACAAATCC-3′ Mircat_R: 5′-CGG CTCGAG TTAGGAGAAAGAAAGTGGATTCG-3′ The PCR products were purified and cloned into the pGEX-6P-1 vector, which provides the sequence for an N-terminal GST tag and inserts five additional residues (Gly-Pro-Leu-Gly-Ser) in the N-terminus of mirolysin.

    Article Title: Porphyromonas gingivalis Fim-A genotype distribution among Colombians
    Article Snippet: Paragraph title: PCR specificity for the P. gingivalis FimA gene ... 43056), and T. forsythia (ATCC 43037).

    Article Title: A Novel Matrix Metalloprotease-like Enzyme (Karilysin) of the Periodontal Pathogen Tannerella forsythia ATCC 43037
    Article Snippet: Genomic DNA of T. forsythia was extracted from strain ATCC 43037. .. The entire karilysin ( kly ), except for the nucleotide sequence that encodes the signal peptide, was amplified by PCR by using forward primer, (Kly-F) 5′-AAG GGATCC CAGCGCCTATACGATAATGG-3′ with an Bam HI recognition site (underlined) and reverse primer (Kly-R) 5′-CCG CTCGAG TTACTTTTTGATCAACTTCTGCG-3′ with an Xho I recognition site (underlined).

    Sonication:

    Article Title: Comparison of serum amyloid A protein and C-reactive protein levels as inflammatory markers in periodontitis
    Article Snippet: .. ELISA was performed as follows: a 96-well plate (Immulux HB, Technologies Inc., Chantilly, VA, USA) was covered with 50 µL of a 10-µg/mL concentration of sonicated P. gingivalis (TCC 33277), T. forsythia (ATCC43037) or A. actinomycetemcomitans (ATCC 29523) in a carbonate buffer (pH 9.6) and incubated overnight. .. The plates were blocked with 150 µL of solution of phosphate buffered saline (PBS, pH 7.2) with 1% bovine serum albumin (BSA, Sigma-Aldrich Co.), for one hour, and 1% milk and avidin (Avidin/Biotin Blocking Kit, Vector Laboratories Inc., Burlingame, CA, USA).

    Recombinant:

    Article Title: Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia
    Article Snippet: Genomic DNA from T. forsythia was extracted from strain ATCC 43037. .. The coding sequence of the full length mirolase gene, proMir (Ser19-Lys791, bfor_c_1_10621/10622; ) and mirolase without C-terminal extension, Mircat (Ser19-Pro535), both without the nucleotide sequence that encodes a signal peptide) were amplified by PCR, the amplicon purified and cloned into the pGEX-6P-1 expression vector using BamHI/XhoI sites and the following PCR primers (restriction sites are underlined): proMir_F: 5′-GCA GGATCC TCCGGACAGCAGCGCTATTA -3′ proMir_R: 5′-CCG CTCGAG TTATTTTTTGATCAATTTCTG -3′ Mircat_F: 5′-ATA GGATCC CAGCCGGCAGAGCGCGGT-3′ Mircat_R: 5′-CCG CTCGAG TTAAGGGGCTACGG -3′ The resulting recombinant product included an N-terminal glutathione-S-transferase (GST) tag, a PreScission protease cleavage site followed by the cloned protein.

    Crocin Bleaching Assay:

    Article Title: Impact of aging on TREM-1 responses in the periodontium: a cross-sectional study in an elderly population
    Article Snippet: Briefly, P. gingivalis (ATCC 33277 T; OMZ 925) was grown anaerobically on Columbia Blood Agar (CBA) agar plates for 3–4 days at 37 °C, followed by anaerobic subculturing for 2–3 days at 37 °C in broth. .. T. forsythia (OMZ 1047), T. denticola (ATCC 35405; OMZ 661), P. intermedia (OMZ 278), F. nucleatum (OMZ 598), were maintained in liquid cultures as described earlier [ ].

    Invasion Assay:

    Article Title: Gingipain-dependent degradation of mTOR pathway proteins by the periodontal pathogen Porphyromonas gingivalis during invasion
    Article Snippet: Paragraph title: Invasion assay ... Invasion of P. gingivalis strains NCTC118324, W50 and T. forsythia (ATCC 43037) in both H357 and OK-F6 were quantified by an antibiotic protection assay as previously described ( , ).

    Mutagenesis:

    Article Title: Differential effects of periopathogens on host protease inhibitors SLPI, elafin, SCCA1, and SCCA2
    Article Snippet: Appropriate antibiotics previously described were added to each culture of mutant of P. gingivalis ( , ). .. T. forsythia (ATCC 49610) was grown in 5% blood agar plates (Remel, Lenexa, KS) with a N-acetylmuramic acid (NAM) disk, and then bacteria were scraped from the agar surface using sterile cotton swabs and subcultured in heart infusion broth media (BBL, sparks, MD) supplemented with hemin, vitamin K, and l-cysteine under anaerobic conditions at 37°C ( ).

    Article Title: N-Acetylmuramic Acid (MurNAc) Auxotrophy of the Oral Pathogen Tannerella forsythia: Characterization of a MurNAc Kinase and Analysis of Its Role in Cell Wall Metabolism
    Article Snippet: Morphological Defects of T. forsythia Cells Grown under MurNAc Limitation Confirming the previously reported MurNAc auxotrophy of T. forsythia (strains OMZ 408, FDC 331, and the ATCC 43037 type strain) , in this study, we visualized the effect of step-wise MurNAc depletion of the culture medium on T. forsythia ATCC 43037 cell morphology by applying SEM. .. For optimal growth of T. forsythia , MurNAc supplementation of the medium was routinely done at a concentration of 20 μg/ml, which in our previous experiment resulted in almost identical growth characteristics for the WT and ΔTf_murK::erm mutant, in both growth phases analyzed ( Figure ).

    Article Title: Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia
    Article Snippet: Paragraph title: Cloning and mutant construction ... Genomic DNA from T. forsythia was extracted from strain ATCC 43037.

    Article Title: Mirolysin, a LysargiNase from Tannerella forsythia, proteolytically inactivates the human cathelicidin, LL-37
    Article Snippet: Paragraph title: Cloning and mutant construction ... Genomic DNA from T. forsythia was isolated from strain ATCC 43037.

    Article Title: A Novel Matrix Metalloprotease-like Enzyme (Karilysin) of the Periodontal Pathogen Tannerella forsythia ATCC 43037
    Article Snippet: Paragraph title: Expression and mutant construction ... Genomic DNA of T. forsythia was extracted from strain ATCC 43037.

    Article Title: N-Acetylmuramic Acid (MurNAc) Auxotrophy of the Oral Pathogen Tannerella forsythia: Characterization of a MurNAc Kinase and Analysis of Its Role in Cell Wall Metabolism
    Article Snippet: Confirming the previously reported MurNAc auxotrophy of T. forsythia (strains OMZ 408, FDC 331, and the ATCC 43037 type strain) , in this study, we visualized the effect of step-wise MurNAc depletion of the culture medium on T. forsythia ATCC 43037 cell morphology by applying SEM. .. For optimal growth of T. forsythia , MurNAc supplementation of the medium was routinely done at a concentration of 20 μg/ml, which in our previous experiment resulted in almost identical growth characteristics for the WT and ΔTf_murK::erm mutant, in both growth phases analyzed ( Figure ).

    Isolation:

    Article Title: Mirolysin, a LysargiNase from Tannerella forsythia, proteolytically inactivates the human cathelicidin, LL-37
    Article Snippet: .. Genomic DNA from T. forsythia was isolated from strain ATCC 43037. .. The coding sequences of the full-length mirolysin gene, proMir (Ser25-Lys612, BFO_2661; GenBank accession number: ), and mirolysin CD with NTP, Mircat (Ser25-Ser331), both without the nucleotide sequence that encodes the SP, were amplified by PCR using the following primers (restriction sites are underlined): proMir_F: 5′-ACA GGATCC TCTGAGTTGAATATGGAAC-3′ proMir_R: 5′-CGG CTCGAG TTACTTCTTAATCAATTTCTGC-3′ Mircat_F: 5′-ACA GGATCC TCTGAGTTGAATATGGAACAAATCC-3′ Mircat_R: 5′-CGG CTCGAG TTAGGAGAAAGAAAGTGGATTCG-3′ The PCR products were purified and cloned into the pGEX-6P-1 vector, which provides the sequence for an N-terminal GST tag and inserts five additional residues (Gly-Pro-Leu-Gly-Ser) in the N-terminus of mirolysin.

    Article Title: Draft Genome Sequences of Three Clinical Isolates of Tannerella forsythia Isolated from Subgingival Plaque from Periodontitis Patients in the United States
    Article Snippet: Briefly, plaque samples from periodontal pockets > 5 mm were serially diluted and plated on tryptic soy blood agar plus MurNAc plates ( ) and incubated anaerobically (37°C), before sialidase-positive colonies were picked and grown in broth cultures and gDNA was isolated. .. Colonies with a 16S rDNA sequence identifying them as strains of T. forsythia via comparison to ATCC 43037 were subsequently passaged and maintained on agar.

    Avidin-Biotin Assay:

    Article Title: Comparison of serum amyloid A protein and C-reactive protein levels as inflammatory markers in periodontitis
    Article Snippet: ELISA was performed as follows: a 96-well plate (Immulux HB, Technologies Inc., Chantilly, VA, USA) was covered with 50 µL of a 10-µg/mL concentration of sonicated P. gingivalis (TCC 33277), T. forsythia (ATCC43037) or A. actinomycetemcomitans (ATCC 29523) in a carbonate buffer (pH 9.6) and incubated overnight. .. The plates were blocked with 150 µL of solution of phosphate buffered saline (PBS, pH 7.2) with 1% bovine serum albumin (BSA, Sigma-Aldrich Co.), for one hour, and 1% milk and avidin (Avidin/Biotin Blocking Kit, Vector Laboratories Inc., Burlingame, CA, USA).

    Microscopy:

    Article Title: Differential effects of periopathogens on host protease inhibitors SLPI, elafin, SCCA1, and SCCA2
    Article Snippet: T. forsythia (ATCC 49610) was grown in 5% blood agar plates (Remel, Lenexa, KS) with a N-acetylmuramic acid (NAM) disk, and then bacteria were scraped from the agar surface using sterile cotton swabs and subcultured in heart infusion broth media (BBL, sparks, MD) supplemented with hemin, vitamin K, and l-cysteine under anaerobic conditions at 37°C ( ). .. Bacterial purity was determined by microscopy and Gram staining, and numbers were estimated by absorbance measurement using the TECAN GENios Multidetection Reader, V.4.51 (Phoenix, Hayward, CA).

    Purification:

    Article Title: Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia
    Article Snippet: Genomic DNA from T. forsythia was extracted from strain ATCC 43037. .. The coding sequence of the full length mirolase gene, proMir (Ser19-Lys791, bfor_c_1_10621/10622; ) and mirolase without C-terminal extension, Mircat (Ser19-Pro535), both without the nucleotide sequence that encodes a signal peptide) were amplified by PCR, the amplicon purified and cloned into the pGEX-6P-1 expression vector using BamHI/XhoI sites and the following PCR primers (restriction sites are underlined): proMir_F: 5′-GCA GGATCC TCCGGACAGCAGCGCTATTA -3′ proMir_R: 5′-CCG CTCGAG TTATTTTTTGATCAATTTCTG -3′ Mircat_F: 5′-ATA GGATCC CAGCCGGCAGAGCGCGGT-3′ Mircat_R: 5′-CCG CTCGAG TTAAGGGGCTACGG -3′ The resulting recombinant product included an N-terminal glutathione-S-transferase (GST) tag, a PreScission protease cleavage site followed by the cloned protein.

    Article Title: Comparison of culture and polymerase chain reaction techniques in the identification of Tannerella forsythia in periodontal health and disease, an in vitro study
    Article Snippet: .. [ ] Purified genomic DNA from T. forsythia (B. forsythus ATCC 43037) was used as a positive control and distilled water as a negative control. .. Preparations were amplified in a DNA thermocycler.

    Article Title: Mirolysin, a LysargiNase from Tannerella forsythia, proteolytically inactivates the human cathelicidin, LL-37
    Article Snippet: Genomic DNA from T. forsythia was isolated from strain ATCC 43037. .. The coding sequences of the full-length mirolysin gene, proMir (Ser25-Lys612, BFO_2661; GenBank accession number: ), and mirolysin CD with NTP, Mircat (Ser25-Ser331), both without the nucleotide sequence that encodes the SP, were amplified by PCR using the following primers (restriction sites are underlined): proMir_F: 5′-ACA GGATCC TCTGAGTTGAATATGGAAC-3′ proMir_R: 5′-CGG CTCGAG TTACTTCTTAATCAATTTCTGC-3′ Mircat_F: 5′-ACA GGATCC TCTGAGTTGAATATGGAACAAATCC-3′ Mircat_R: 5′-CGG CTCGAG TTAGGAGAAAGAAAGTGGATTCG-3′ The PCR products were purified and cloned into the pGEX-6P-1 vector, which provides the sequence for an N-terminal GST tag and inserts five additional residues (Gly-Pro-Leu-Gly-Ser) in the N-terminus of mirolysin.

    Article Title: A Novel Matrix Metalloprotease-like Enzyme (Karilysin) of the Periodontal Pathogen Tannerella forsythia ATCC 43037
    Article Snippet: Genomic DNA of T. forsythia was extracted from strain ATCC 43037. .. The PCR product was purified and cloned into the Bam HI/ Xho I site of pGEX-6P-1 expression vector, which provides the coding sequence for an N-terminal glutathione-S-transferase (GST).

    Sequencing:

    Article Title: Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia
    Article Snippet: Genomic DNA from T. forsythia was extracted from strain ATCC 43037. .. The coding sequence of the full length mirolase gene, proMir (Ser19-Lys791, bfor_c_1_10621/10622; ) and mirolase without C-terminal extension, Mircat (Ser19-Pro535), both without the nucleotide sequence that encodes a signal peptide) were amplified by PCR, the amplicon purified and cloned into the pGEX-6P-1 expression vector using BamHI/XhoI sites and the following PCR primers (restriction sites are underlined): proMir_F: 5′-GCA GGATCC TCCGGACAGCAGCGCTATTA -3′ proMir_R: 5′-CCG CTCGAG TTATTTTTTGATCAATTTCTG -3′ Mircat_F: 5′-ATA GGATCC CAGCCGGCAGAGCGCGGT-3′ Mircat_R: 5′-CCG CTCGAG TTAAGGGGCTACGG -3′ The resulting recombinant product included an N-terminal glutathione-S-transferase (GST) tag, a PreScission protease cleavage site followed by the cloned protein.

    Article Title: Mirolysin, a LysargiNase from Tannerella forsythia, proteolytically inactivates the human cathelicidin, LL-37
    Article Snippet: Genomic DNA from T. forsythia was isolated from strain ATCC 43037. .. The coding sequences of the full-length mirolysin gene, proMir (Ser25-Lys612, BFO_2661; GenBank accession number: ), and mirolysin CD with NTP, Mircat (Ser25-Ser331), both without the nucleotide sequence that encodes the SP, were amplified by PCR using the following primers (restriction sites are underlined): proMir_F: 5′-ACA GGATCC TCTGAGTTGAATATGGAAC-3′ proMir_R: 5′-CGG CTCGAG TTACTTCTTAATCAATTTCTGC-3′ Mircat_F: 5′-ACA GGATCC TCTGAGTTGAATATGGAACAAATCC-3′ Mircat_R: 5′-CGG CTCGAG TTAGGAGAAAGAAAGTGGATTCG-3′ The PCR products were purified and cloned into the pGEX-6P-1 vector, which provides the sequence for an N-terminal GST tag and inserts five additional residues (Gly-Pro-Leu-Gly-Ser) in the N-terminus of mirolysin.

    Article Title: A Novel Matrix Metalloprotease-like Enzyme (Karilysin) of the Periodontal Pathogen Tannerella forsythia ATCC 43037
    Article Snippet: Genomic DNA of T. forsythia was extracted from strain ATCC 43037. .. The entire karilysin ( kly ), except for the nucleotide sequence that encodes the signal peptide, was amplified by PCR by using forward primer, (Kly-F) 5′-AAG GGATCC CAGCGCCTATACGATAATGG-3′ with an Bam HI recognition site (underlined) and reverse primer (Kly-R) 5′-CCG CTCGAG TTACTTTTTGATCAACTTCTGCG-3′ with an Xho I recognition site (underlined).

    Article Title: Draft Genome Sequences of Three Clinical Isolates of Tannerella forsythia Isolated from Subgingival Plaque from Periodontitis Patients in the United States
    Article Snippet: .. Colonies with a 16S rDNA sequence identifying them as strains of T. forsythia via comparison to ATCC 43037 were subsequently passaged and maintained on agar. .. Three strains were isolated and named UB4, UB20, and UB22.

    Construct:

    Article Title: Mirolysin, a LysargiNase from Tannerella forsythia, proteolytically inactivates the human cathelicidin, LL-37
    Article Snippet: Genomic DNA from T. forsythia was isolated from strain ATCC 43037. .. The wild-type (WT) constructs (pGEX-6P-1_proMir, pGEX-6P1_Mircat) were used to obtain E225A variants (proMirE225A and MircatE225A ) in which the active site Glu-225 is substituted by alanine ( ).

    Article Title: Regulation and Molecular Basis of Environmental Muropeptide Uptake and Utilization in Fastidious Oral Anaerobe Tannerella forsythia
    Article Snippet: The direct involvement of GppX interaction with the promoter was further corroborated from the results showing that a construct lacking the DNA binding HTH domain of GppX failed to activate the promoter. .. In addition, in this study we provided direct evidence that T. forsythia can utilize exogenous muropeptides and F. nucleatum ATCC 25586 can support T. forsythia growth.

    Plasmid Preparation:

    Article Title: Comparison of serum amyloid A protein and C-reactive protein levels as inflammatory markers in periodontitis
    Article Snippet: ELISA was performed as follows: a 96-well plate (Immulux HB, Technologies Inc., Chantilly, VA, USA) was covered with 50 µL of a 10-µg/mL concentration of sonicated P. gingivalis (TCC 33277), T. forsythia (ATCC43037) or A. actinomycetemcomitans (ATCC 29523) in a carbonate buffer (pH 9.6) and incubated overnight. .. ELISA was performed as follows: a 96-well plate (Immulux HB, Technologies Inc., Chantilly, VA, USA) was covered with 50 µL of a 10-µg/mL concentration of sonicated P. gingivalis (TCC 33277), T. forsythia (ATCC43037) or A. actinomycetemcomitans (ATCC 29523) in a carbonate buffer (pH 9.6) and incubated overnight.

    Article Title: Mirolase, a novel subtilisin-like serine protease from the periodontopathogen Tannerella forsythia
    Article Snippet: Genomic DNA from T. forsythia was extracted from strain ATCC 43037. .. The coding sequence of the full length mirolase gene, proMir (Ser19-Lys791, bfor_c_1_10621/10622; ) and mirolase without C-terminal extension, Mircat (Ser19-Pro535), both without the nucleotide sequence that encodes a signal peptide) were amplified by PCR, the amplicon purified and cloned into the pGEX-6P-1 expression vector using BamHI/XhoI sites and the following PCR primers (restriction sites are underlined): proMir_F: 5′-GCA GGATCC TCCGGACAGCAGCGCTATTA -3′ proMir_R: 5′-CCG CTCGAG TTATTTTTTGATCAATTTCTG -3′ Mircat_F: 5′-ATA GGATCC CAGCCGGCAGAGCGCGGT-3′ Mircat_R: 5′-CCG CTCGAG TTAAGGGGCTACGG -3′ The resulting recombinant product included an N-terminal glutathione-S-transferase (GST) tag, a PreScission protease cleavage site followed by the cloned protein.

    Article Title: Mirolysin, a LysargiNase from Tannerella forsythia, proteolytically inactivates the human cathelicidin, LL-37
    Article Snippet: Genomic DNA from T. forsythia was isolated from strain ATCC 43037. .. The coding sequences of the full-length mirolysin gene, proMir (Ser25-Lys612, BFO_2661; GenBank accession number: ), and mirolysin CD with NTP, Mircat (Ser25-Ser331), both without the nucleotide sequence that encodes the SP, were amplified by PCR using the following primers (restriction sites are underlined): proMir_F: 5′-ACA GGATCC TCTGAGTTGAATATGGAAC-3′ proMir_R: 5′-CGG CTCGAG TTACTTCTTAATCAATTTCTGC-3′ Mircat_F: 5′-ACA GGATCC TCTGAGTTGAATATGGAACAAATCC-3′ Mircat_R: 5′-CGG CTCGAG TTAGGAGAAAGAAAGTGGATTCG-3′ The PCR products were purified and cloned into the pGEX-6P-1 vector, which provides the sequence for an N-terminal GST tag and inserts five additional residues (Gly-Pro-Leu-Gly-Ser) in the N-terminus of mirolysin.

    Article Title: A Novel Matrix Metalloprotease-like Enzyme (Karilysin) of the Periodontal Pathogen Tannerella forsythia ATCC 43037
    Article Snippet: Genomic DNA of T. forsythia was extracted from strain ATCC 43037. .. The PCR product was purified and cloned into the Bam HI/ Xho I site of pGEX-6P-1 expression vector, which provides the coding sequence for an N-terminal glutathione-S-transferase (GST).

    Real-time Polymerase Chain Reaction:

    Article Title: Impact of aging on TREM-1 responses in the periodontium: a cross-sectional study in an elderly population
    Article Snippet: Paragraph title: Bacterial quantification by qPCR ... T. forsythia (OMZ 1047), T. denticola (ATCC 35405; OMZ 661), P. intermedia (OMZ 278), F. nucleatum (OMZ 598), were maintained in liquid cultures as described earlier [ ].

    Negative Control:

    Article Title: Comparison of culture and polymerase chain reaction techniques in the identification of Tannerella forsythia in periodontal health and disease, an in vitro study
    Article Snippet: .. [ ] Purified genomic DNA from T. forsythia (B. forsythus ATCC 43037) was used as a positive control and distilled water as a negative control. .. Preparations were amplified in a DNA thermocycler.

    Binding Assay:

    Article Title: Regulation and Molecular Basis of Environmental Muropeptide Uptake and Utilization in Fastidious Oral Anaerobe Tannerella forsythia
    Article Snippet: The direct involvement of GppX interaction with the promoter was further corroborated from the results showing that a construct lacking the DNA binding HTH domain of GppX failed to activate the promoter. .. In addition, in this study we provided direct evidence that T. forsythia can utilize exogenous muropeptides and F. nucleatum ATCC 25586 can support T. forsythia growth.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Comparison of serum amyloid A protein and C-reactive protein levels as inflammatory markers in periodontitis
    Article Snippet: .. ELISA was performed as follows: a 96-well plate (Immulux HB, Technologies Inc., Chantilly, VA, USA) was covered with 50 µL of a 10-µg/mL concentration of sonicated P. gingivalis (TCC 33277), T. forsythia (ATCC43037) or A. actinomycetemcomitans (ATCC 29523) in a carbonate buffer (pH 9.6) and incubated overnight. .. The plates were blocked with 150 µL of solution of phosphate buffered saline (PBS, pH 7.2) with 1% bovine serum albumin (BSA, Sigma-Aldrich Co.), for one hour, and 1% milk and avidin (Avidin/Biotin Blocking Kit, Vector Laboratories Inc., Burlingame, CA, USA).

    Subculturing Assay:

    Article Title: Impact of aging on TREM-1 responses in the periodontium: a cross-sectional study in an elderly population
    Article Snippet: Briefly, P. gingivalis (ATCC 33277 T; OMZ 925) was grown anaerobically on Columbia Blood Agar (CBA) agar plates for 3–4 days at 37 °C, followed by anaerobic subculturing for 2–3 days at 37 °C in broth. .. T. forsythia (OMZ 1047), T. denticola (ATCC 35405; OMZ 661), P. intermedia (OMZ 278), F. nucleatum (OMZ 598), were maintained in liquid cultures as described earlier [ ].

    Concentration Assay:

    Article Title: Comparison of serum amyloid A protein and C-reactive protein levels as inflammatory markers in periodontitis
    Article Snippet: .. ELISA was performed as follows: a 96-well plate (Immulux HB, Technologies Inc., Chantilly, VA, USA) was covered with 50 µL of a 10-µg/mL concentration of sonicated P. gingivalis (TCC 33277), T. forsythia (ATCC43037) or A. actinomycetemcomitans (ATCC 29523) in a carbonate buffer (pH 9.6) and incubated overnight. .. The plates were blocked with 150 µL of solution of phosphate buffered saline (PBS, pH 7.2) with 1% bovine serum albumin (BSA, Sigma-Aldrich Co.), for one hour, and 1% milk and avidin (Avidin/Biotin Blocking Kit, Vector Laboratories Inc., Burlingame, CA, USA).

    Article Title: N-Acetylmuramic Acid (MurNAc) Auxotrophy of the Oral Pathogen Tannerella forsythia: Characterization of a MurNAc Kinase and Analysis of Its Role in Cell Wall Metabolism
    Article Snippet: Morphological Defects of T. forsythia Cells Grown under MurNAc Limitation Confirming the previously reported MurNAc auxotrophy of T. forsythia (strains OMZ 408, FDC 331, and the ATCC 43037 type strain) , in this study, we visualized the effect of step-wise MurNAc depletion of the culture medium on T. forsythia ATCC 43037 cell morphology by applying SEM. .. For optimal growth of T. forsythia , MurNAc supplementation of the medium was routinely done at a concentration of 20 μg/ml, which in our previous experiment resulted in almost identical growth characteristics for the WT and ΔTf_murK::erm mutant, in both growth phases analyzed ( Figure ).

    Article Title: N-Acetylmuramic Acid (MurNAc) Auxotrophy of the Oral Pathogen Tannerella forsythia: Characterization of a MurNAc Kinase and Analysis of Its Role in Cell Wall Metabolism
    Article Snippet: Confirming the previously reported MurNAc auxotrophy of T. forsythia (strains OMZ 408, FDC 331, and the ATCC 43037 type strain) , in this study, we visualized the effect of step-wise MurNAc depletion of the culture medium on T. forsythia ATCC 43037 cell morphology by applying SEM. .. For optimal growth of T. forsythia , MurNAc supplementation of the medium was routinely done at a concentration of 20 μg/ml, which in our previous experiment resulted in almost identical growth characteristics for the WT and ΔTf_murK::erm mutant, in both growth phases analyzed ( Figure ).

    Staining:

    Article Title: Differential effects of periopathogens on host protease inhibitors SLPI, elafin, SCCA1, and SCCA2
    Article Snippet: T. forsythia (ATCC 49610) was grown in 5% blood agar plates (Remel, Lenexa, KS) with a N-acetylmuramic acid (NAM) disk, and then bacteria were scraped from the agar surface using sterile cotton swabs and subcultured in heart infusion broth media (BBL, sparks, MD) supplemented with hemin, vitamin K, and l-cysteine under anaerobic conditions at 37°C ( ). .. Bacterial purity was determined by microscopy and Gram staining, and numbers were estimated by absorbance measurement using the TECAN GENios Multidetection Reader, V.4.51 (Phoenix, Hayward, CA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    ATCC t forsythia atcc 43037
    Knockout of pseC and legC decreases biofilm formation of T. forsythia <t>ATCC</t> 43037 and T. forsythia UB4 cells, respectively. ( A ) Biofilm formation in T. forsythia ATCC 43037 wild-type compared to ATCC 43037 Δ pseC and the complemented strain ATCC 43037 Δ pseC comp . ( B ) Biofilm formation in T. forsythia UB4 wild-type compared to UB4 Δ legC and the complemented strain T. forsythia UB4 Δ legC comp . Data represent mean values ± SD of at least four independent experiments with four replicates each and were analyzed by the unpaired Student’s t-test. Asterisks indicate significant differences (** P
    T Forsythia Atcc 43037, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/t forsythia atcc 43037/product/ATCC
    Average 99 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    t forsythia atcc 43037 - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Knockout of pseC and legC decreases biofilm formation of T. forsythia ATCC 43037 and T. forsythia UB4 cells, respectively. ( A ) Biofilm formation in T. forsythia ATCC 43037 wild-type compared to ATCC 43037 Δ pseC and the complemented strain ATCC 43037 Δ pseC comp . ( B ) Biofilm formation in T. forsythia UB4 wild-type compared to UB4 Δ legC and the complemented strain T. forsythia UB4 Δ legC comp . Data represent mean values ± SD of at least four independent experiments with four replicates each and were analyzed by the unpaired Student’s t-test. Asterisks indicate significant differences (** P

    Journal: Glycobiology

    Article Title: Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications

    doi: 10.1093/glycob/cww129

    Figure Lengend Snippet: Knockout of pseC and legC decreases biofilm formation of T. forsythia ATCC 43037 and T. forsythia UB4 cells, respectively. ( A ) Biofilm formation in T. forsythia ATCC 43037 wild-type compared to ATCC 43037 Δ pseC and the complemented strain ATCC 43037 Δ pseC comp . ( B ) Biofilm formation in T. forsythia UB4 wild-type compared to UB4 Δ legC and the complemented strain T. forsythia UB4 Δ legC comp . Data represent mean values ± SD of at least four independent experiments with four replicates each and were analyzed by the unpaired Student’s t-test. Asterisks indicate significant differences (** P

    Article Snippet: Detection of Pse/Leg pathway biosynthetic genes in T. forsythia ATCC 43037, FDC 92A2 and UB4 To check for the presence of selected genes from the Pse or Leg biosynthesis pathway, genomic DNA of T. forsythia ATCC 43037, T. forsythia FDC 92A2 and T. forsythia UB4 was used as a template in six separate PCRs.

    Techniques: Knock-Out

    ( A ) Structures of Sia and Sia-like sugars (NulOs). Sialic acid (Neu5Ac), legionaminic acid (Leg5,7Ac 2 ) and pseudaminic acids (Pse5,7Ac 2 and Pse5Am7Gra) are shown. To note, Pse5Am7Gra is found as the terminal sugar of the S-layer glycan in T. forsythia ATCC 43037. For reference, the nine carbon atoms of Sia are numbered, and the structure of the NHAc group is shown in the boxed inset. ( B ) Schematic drawing of the structure of the S-layer O -glycan in T. forsythia ATCC 43037 (amended from Posch et al. (2011) ). This figure is available in black and white in print and in color at Glycobiology online.

    Journal: Glycobiology

    Article Title: Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications

    doi: 10.1093/glycob/cww129

    Figure Lengend Snippet: ( A ) Structures of Sia and Sia-like sugars (NulOs). Sialic acid (Neu5Ac), legionaminic acid (Leg5,7Ac 2 ) and pseudaminic acids (Pse5,7Ac 2 and Pse5Am7Gra) are shown. To note, Pse5Am7Gra is found as the terminal sugar of the S-layer glycan in T. forsythia ATCC 43037. For reference, the nine carbon atoms of Sia are numbered, and the structure of the NHAc group is shown in the boxed inset. ( B ) Schematic drawing of the structure of the S-layer O -glycan in T. forsythia ATCC 43037 (amended from Posch et al. (2011) ). This figure is available in black and white in print and in color at Glycobiology online.

    Article Snippet: Detection of Pse/Leg pathway biosynthetic genes in T. forsythia ATCC 43037, FDC 92A2 and UB4 To check for the presence of selected genes from the Pse or Leg biosynthesis pathway, genomic DNA of T. forsythia ATCC 43037, T. forsythia FDC 92A2 and T. forsythia UB4 was used as a template in six separate PCRs.

    Techniques:

    Experimentally confirmed enzymatic steps (in green) in T. forsythia strains ATCC 43037 (left) and FDC 92A2/UB4 (right) corresponding to the CMP-Pse and CMP-Leg biosynthetic pathways as elucidated in H. pylori and C. jejuni , respectively ( Schoenhofen et al. 2006b , Schoenhofen et al. 2009 ). In T. forsythia , pathways will deviate at some point to produce the unique NulO derivatives found in our strains, such as Pse5Am7Gra. These deviations would be anticipated to occur either within the NulO biosynthetic pathway or post CMP-NulO biosynthesis. Red, blue and orange highlight enzymatic steps that introduce the stereochemical differences between the two pathways and also indicate the positions altered for both hexose intermediates and final NulO. The assignment of roman numerals to each compound is consistent with label designations found throughout the text. Subscripts “P” and “L” indicate intermediates from the CMP-Pse and CMP-Leg biosynthesis pathway, respectively. For simplicity, all sugars except for the NulOs are shown in 4 C 1 form. This figure is available in black and white in print and in color at Glycobiology online.

    Journal: Glycobiology

    Article Title: Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications

    doi: 10.1093/glycob/cww129

    Figure Lengend Snippet: Experimentally confirmed enzymatic steps (in green) in T. forsythia strains ATCC 43037 (left) and FDC 92A2/UB4 (right) corresponding to the CMP-Pse and CMP-Leg biosynthetic pathways as elucidated in H. pylori and C. jejuni , respectively ( Schoenhofen et al. 2006b , Schoenhofen et al. 2009 ). In T. forsythia , pathways will deviate at some point to produce the unique NulO derivatives found in our strains, such as Pse5Am7Gra. These deviations would be anticipated to occur either within the NulO biosynthetic pathway or post CMP-NulO biosynthesis. Red, blue and orange highlight enzymatic steps that introduce the stereochemical differences between the two pathways and also indicate the positions altered for both hexose intermediates and final NulO. The assignment of roman numerals to each compound is consistent with label designations found throughout the text. Subscripts “P” and “L” indicate intermediates from the CMP-Pse and CMP-Leg biosynthesis pathway, respectively. For simplicity, all sugars except for the NulOs are shown in 4 C 1 form. This figure is available in black and white in print and in color at Glycobiology online.

    Article Snippet: Detection of Pse/Leg pathway biosynthetic genes in T. forsythia ATCC 43037, FDC 92A2 and UB4 To check for the presence of selected genes from the Pse or Leg biosynthesis pathway, genomic DNA of T. forsythia ATCC 43037, T. forsythia FDC 92A2 and T. forsythia UB4 was used as a template in six separate PCRs.

    Techniques: Introduce

    Phylogenetic clusters of selected microbial NulO synthase homologs. Based on the prediction of NulO sugar type by Lewis et al. (2009) , a distance-based neighbor joining tree calculated from the amino acid sequences of NulO synthase enzymes places Tanf_01240 of T. forsythia type strain ATCC 43037 in a phylogenetic clade of pseudaminic acid synthases, while BFO_1066 of strain FDC 92A2/UB4 is clustered with Leg synthases (bootstrap values shown at relevant nodes). Green denotes Leg synthases, red Neu synthases and blue Pse synthases. This figure is available in black and white in print and in color at Glycobiology online.

    Journal: Glycobiology

    Article Title: Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications

    doi: 10.1093/glycob/cww129

    Figure Lengend Snippet: Phylogenetic clusters of selected microbial NulO synthase homologs. Based on the prediction of NulO sugar type by Lewis et al. (2009) , a distance-based neighbor joining tree calculated from the amino acid sequences of NulO synthase enzymes places Tanf_01240 of T. forsythia type strain ATCC 43037 in a phylogenetic clade of pseudaminic acid synthases, while BFO_1066 of strain FDC 92A2/UB4 is clustered with Leg synthases (bootstrap values shown at relevant nodes). Green denotes Leg synthases, red Neu synthases and blue Pse synthases. This figure is available in black and white in print and in color at Glycobiology online.

    Article Snippet: Detection of Pse/Leg pathway biosynthetic genes in T. forsythia ATCC 43037, FDC 92A2 and UB4 To check for the presence of selected genes from the Pse or Leg biosynthesis pathway, genomic DNA of T. forsythia ATCC 43037, T. forsythia FDC 92A2 and T. forsythia UB4 was used as a template in six separate PCRs.

    Techniques:

    SDS-PAGE gels (12%) of purified recombinant enzymes of the ( A ) CMP-Pse biosynthesis pathway from T. forsythia ATCC 43037 and ( B ) CMP-Leg biosynthesis pathway from T. forsythia FDC 92A2/UB4.

    Journal: Glycobiology

    Article Title: Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications

    doi: 10.1093/glycob/cww129

    Figure Lengend Snippet: SDS-PAGE gels (12%) of purified recombinant enzymes of the ( A ) CMP-Pse biosynthesis pathway from T. forsythia ATCC 43037 and ( B ) CMP-Leg biosynthesis pathway from T. forsythia FDC 92A2/UB4.

    Article Snippet: Detection of Pse/Leg pathway biosynthetic genes in T. forsythia ATCC 43037, FDC 92A2 and UB4 To check for the presence of selected genes from the Pse or Leg biosynthesis pathway, genomic DNA of T. forsythia ATCC 43037, T. forsythia FDC 92A2 and T. forsythia UB4 was used as a template in six separate PCRs.

    Techniques: SDS Page, Purification, Recombinant

    SDS-PAGE analysis of T. forsythia parent, NulO-deficient, and complemented strains. ( A ) CBB stained SDS-PAGE (7.5% gel) of whole cell extracts from T. forsythia ATCC 43037, ATCC 43037 Δ pseC and the complemented strain ATCC 43037 Δ pseC comp , and ( B ) T. forsythia UB4 wild-type, UB4 Δ legC and the complemented strain UB4 Δ legC comp . For both T. forsythia ATCC 43037 Δ pseC and UB4 Δ legC , a downshift of the S-layer protein bands (TfsA and TfsB) could be observed, which was reverted in the complemented strains.

    Journal: Glycobiology

    Article Title: Tannerella forsythia strains display different cell-surface nonulosonic acids: biosynthetic pathway characterization and first insight into biological implications

    doi: 10.1093/glycob/cww129

    Figure Lengend Snippet: SDS-PAGE analysis of T. forsythia parent, NulO-deficient, and complemented strains. ( A ) CBB stained SDS-PAGE (7.5% gel) of whole cell extracts from T. forsythia ATCC 43037, ATCC 43037 Δ pseC and the complemented strain ATCC 43037 Δ pseC comp , and ( B ) T. forsythia UB4 wild-type, UB4 Δ legC and the complemented strain UB4 Δ legC comp . For both T. forsythia ATCC 43037 Δ pseC and UB4 Δ legC , a downshift of the S-layer protein bands (TfsA and TfsB) could be observed, which was reverted in the complemented strains.

    Article Snippet: Detection of Pse/Leg pathway biosynthetic genes in T. forsythia ATCC 43037, FDC 92A2 and UB4 To check for the presence of selected genes from the Pse or Leg biosynthesis pathway, genomic DNA of T. forsythia ATCC 43037, T. forsythia FDC 92A2 and T. forsythia UB4 was used as a template in six separate PCRs.

    Techniques: SDS Page, Staining

    Dual fluorescence in situ hybridization staining of Tannerella forsythia and Campylobacter rectus for biofilms harboring ATCC 43037 wild‐type (A), UB 4 wild‐type (B), and ATCC 43037 ∆tfs AB (C). Red/yellow: T. forsythia , cyan: C. rectus; green: non‐hybridized cells ( DNA staining YoPro‐1+Sytox). Scale bars 20 μm (A, B) and 15 μm (C)

    Journal: Molecular Oral Microbiology

    Article Title: Behavior of two Tannerella forsythia strains and their cell surface mutants in multispecies oral biofilms. Behavior of two Tannerella forsythia strains and their cell surface mutants in multispecies oral biofilms

    doi: 10.1111/omi.12182

    Figure Lengend Snippet: Dual fluorescence in situ hybridization staining of Tannerella forsythia and Campylobacter rectus for biofilms harboring ATCC 43037 wild‐type (A), UB 4 wild‐type (B), and ATCC 43037 ∆tfs AB (C). Red/yellow: T. forsythia , cyan: C. rectus; green: non‐hybridized cells ( DNA staining YoPro‐1+Sytox). Scale bars 20 μm (A, B) and 15 μm (C)

    Article Snippet: 3.1 Monospecies biofilm formation of T. forsythia wild‐type strains and mutants Based on the observations that deficiency in the protein O ‐glycan's terminal nonulosonic acid triggers a decrease in biofilm formation of T. forsythia ATCC 43037 ∆pseC and T. forsythia UB4 ∆legC on a mucin‐coated surface and that T. forsythia ATCC 43037 ∆wecC possessing an even more truncated O ‐glycan forms more biofilm on untreated plates, the biofilm formation capacity of all these strains was compared here in one microtiter plate assay, where the plates were coated with mucin to mimic the native situation on the tooth surface, and biofilm growth was quantified by OD600 measurement of biofilm cells and normalized to the corresponding total cell mass for each strain.

    Techniques: Fluorescence, In Situ Hybridization, Staining

    Fluorescence in situ hybridization staining of biofilms harboring Tannerella forsythia ATCC 43037 mutants (A) ∆pseC , (B) ∆wecC , and (C) ∆tfs AB . Red: T. forsythia , cyan: Porphyromonas gingivalis , green: non‐hybridized cells ( DNA staining YoPro‐1+Sytox). Scale bars 20 μm (A) and 10 μm (B, C)

    Journal: Molecular Oral Microbiology

    Article Title: Behavior of two Tannerella forsythia strains and their cell surface mutants in multispecies oral biofilms. Behavior of two Tannerella forsythia strains and their cell surface mutants in multispecies oral biofilms

    doi: 10.1111/omi.12182

    Figure Lengend Snippet: Fluorescence in situ hybridization staining of biofilms harboring Tannerella forsythia ATCC 43037 mutants (A) ∆pseC , (B) ∆wecC , and (C) ∆tfs AB . Red: T. forsythia , cyan: Porphyromonas gingivalis , green: non‐hybridized cells ( DNA staining YoPro‐1+Sytox). Scale bars 20 μm (A) and 10 μm (B, C)

    Article Snippet: 3.1 Monospecies biofilm formation of T. forsythia wild‐type strains and mutants Based on the observations that deficiency in the protein O ‐glycan's terminal nonulosonic acid triggers a decrease in biofilm formation of T. forsythia ATCC 43037 ∆pseC and T. forsythia UB4 ∆legC on a mucin‐coated surface and that T. forsythia ATCC 43037 ∆wecC possessing an even more truncated O ‐glycan forms more biofilm on untreated plates, the biofilm formation capacity of all these strains was compared here in one microtiter plate assay, where the plates were coated with mucin to mimic the native situation on the tooth surface, and biofilm growth was quantified by OD600 measurement of biofilm cells and normalized to the corresponding total cell mass for each strain.

    Techniques: Fluorescence, In Situ Hybridization, Staining

    Box plots showing cell numbers of all species determined by quantitative real‐time PCR for biofilms with Tannerella forsythia ATCC 43037 wild‐type or mutants (∆pseC , ∆wecC , ∆tfs AB , ∆pseC comp ) (A) and UB 4 wild‐type or mutants (∆legC , ∆legC comp ), respectively (B). Data derived from three independent experiments were plotted on a logarithmic scale. Asterisk (*) indicates significant differences ( P ≤.05) between the groups

    Journal: Molecular Oral Microbiology

    Article Title: Behavior of two Tannerella forsythia strains and their cell surface mutants in multispecies oral biofilms. Behavior of two Tannerella forsythia strains and their cell surface mutants in multispecies oral biofilms

    doi: 10.1111/omi.12182

    Figure Lengend Snippet: Box plots showing cell numbers of all species determined by quantitative real‐time PCR for biofilms with Tannerella forsythia ATCC 43037 wild‐type or mutants (∆pseC , ∆wecC , ∆tfs AB , ∆pseC comp ) (A) and UB 4 wild‐type or mutants (∆legC , ∆legC comp ), respectively (B). Data derived from three independent experiments were plotted on a logarithmic scale. Asterisk (*) indicates significant differences ( P ≤.05) between the groups

    Article Snippet: 3.1 Monospecies biofilm formation of T. forsythia wild‐type strains and mutants Based on the observations that deficiency in the protein O ‐glycan's terminal nonulosonic acid triggers a decrease in biofilm formation of T. forsythia ATCC 43037 ∆pseC and T. forsythia UB4 ∆legC on a mucin‐coated surface and that T. forsythia ATCC 43037 ∆wecC possessing an even more truncated O ‐glycan forms more biofilm on untreated plates, the biofilm formation capacity of all these strains was compared here in one microtiter plate assay, where the plates were coated with mucin to mimic the native situation on the tooth surface, and biofilm growth was quantified by OD600 measurement of biofilm cells and normalized to the corresponding total cell mass for each strain.

    Techniques: Real-time Polymerase Chain Reaction, Derivative Assay

    Comparison of 10‐species biofilms with two Tannerella forsythia wild‐type strains. (A) Whiskers boxplots (5th to 95th centile) show bacterial numbers determined by quantitative real‐time PCR from three independent experiments. Asterisk (*) indicates a statistically significant difference ( P ≤.05) between groups. The two groups represent biofilms with either T. forsythia ATCC 43037 wild‐type or T. forsythia UB 4 wild‐type. (B, C) Fluorescence in situ hybridization stainings of fixed biofilms showing the localization of ATCC 43037 wild‐type (B) and UB 4 wild‐type (C). Red/yellow: T. forsythia; cyan: Porphyromonas gingivalis , green: non‐hybridized cells ( DNA staining YoPro‐1+Sytox). Here a representative area for one disk each is shown with a top view in the left panel and a side view with the biofilm–disk interface directed towards the top view; scale bars 5 μm (B) and 10 μm (C)

    Journal: Molecular Oral Microbiology

    Article Title: Behavior of two Tannerella forsythia strains and their cell surface mutants in multispecies oral biofilms. Behavior of two Tannerella forsythia strains and their cell surface mutants in multispecies oral biofilms

    doi: 10.1111/omi.12182

    Figure Lengend Snippet: Comparison of 10‐species biofilms with two Tannerella forsythia wild‐type strains. (A) Whiskers boxplots (5th to 95th centile) show bacterial numbers determined by quantitative real‐time PCR from three independent experiments. Asterisk (*) indicates a statistically significant difference ( P ≤.05) between groups. The two groups represent biofilms with either T. forsythia ATCC 43037 wild‐type or T. forsythia UB 4 wild‐type. (B, C) Fluorescence in situ hybridization stainings of fixed biofilms showing the localization of ATCC 43037 wild‐type (B) and UB 4 wild‐type (C). Red/yellow: T. forsythia; cyan: Porphyromonas gingivalis , green: non‐hybridized cells ( DNA staining YoPro‐1+Sytox). Here a representative area for one disk each is shown with a top view in the left panel and a side view with the biofilm–disk interface directed towards the top view; scale bars 5 μm (B) and 10 μm (C)

    Article Snippet: 3.1 Monospecies biofilm formation of T. forsythia wild‐type strains and mutants Based on the observations that deficiency in the protein O ‐glycan's terminal nonulosonic acid triggers a decrease in biofilm formation of T. forsythia ATCC 43037 ∆pseC and T. forsythia UB4 ∆legC on a mucin‐coated surface and that T. forsythia ATCC 43037 ∆wecC possessing an even more truncated O ‐glycan forms more biofilm on untreated plates, the biofilm formation capacity of all these strains was compared here in one microtiter plate assay, where the plates were coated with mucin to mimic the native situation on the tooth surface, and biofilm growth was quantified by OD600 measurement of biofilm cells and normalized to the corresponding total cell mass for each strain.

    Techniques: Real-time Polymerase Chain Reaction, Fluorescence, In Situ Hybridization, Staining

    Monospecies biofilm formation of Tannerella forsythia wild‐type and mutant strains. (A) Biofilm formation of T. forsythia ATCC 43037 wild‐type compared with its mutants ATCC 43037 Δ pseC , Δ wecC , Δ tfs AB and the complemented mutant Δ pseC comp . (B) Biofilm formation of T. forsythia UB 4 wild‐type compared with its mutant UB 4 Δ legC and the complemented mutant Δ legC comp . Mean values ± SD of four independent experiments with three replicates, each, are shown. Asterisks (**) indicate significant differences between samples as determined by the unpaired Student's t ‐test ( P ≤.01)

    Journal: Molecular Oral Microbiology

    Article Title: Behavior of two Tannerella forsythia strains and their cell surface mutants in multispecies oral biofilms. Behavior of two Tannerella forsythia strains and their cell surface mutants in multispecies oral biofilms

    doi: 10.1111/omi.12182

    Figure Lengend Snippet: Monospecies biofilm formation of Tannerella forsythia wild‐type and mutant strains. (A) Biofilm formation of T. forsythia ATCC 43037 wild‐type compared with its mutants ATCC 43037 Δ pseC , Δ wecC , Δ tfs AB and the complemented mutant Δ pseC comp . (B) Biofilm formation of T. forsythia UB 4 wild‐type compared with its mutant UB 4 Δ legC and the complemented mutant Δ legC comp . Mean values ± SD of four independent experiments with three replicates, each, are shown. Asterisks (**) indicate significant differences between samples as determined by the unpaired Student's t ‐test ( P ≤.01)

    Article Snippet: 3.1 Monospecies biofilm formation of T. forsythia wild‐type strains and mutants Based on the observations that deficiency in the protein O ‐glycan's terminal nonulosonic acid triggers a decrease in biofilm formation of T. forsythia ATCC 43037 ∆pseC and T. forsythia UB4 ∆legC on a mucin‐coated surface and that T. forsythia ATCC 43037 ∆wecC possessing an even more truncated O ‐glycan forms more biofilm on untreated plates, the biofilm formation capacity of all these strains was compared here in one microtiter plate assay, where the plates were coated with mucin to mimic the native situation on the tooth surface, and biofilm growth was quantified by OD600 measurement of biofilm cells and normalized to the corresponding total cell mass for each strain.

    Techniques: Mutagenesis