Structured Review

TaKaRa sybr premix ex taq kits
Sybr Premix Ex Taq Kits, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/sybr premix ex taq kits/product/TaKaRa
Average 99 stars, based on 5 article reviews
Price from $9.99 to $1999.99
sybr premix ex taq kits - by Bioz Stars, 2020-04
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

Amplification:

Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR
Article Snippet: .. A one step PrimeScript RT-PCR Kit (Perfect Real time) (TaKaRa Bio, Otsu, Japan) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) (TaKaRa Bio) was used for amplification of extracts from DNA viruses, bacteria and protozoa. .. All reactions were performed in a total volume of 20 µl, which contained the sample nucleic acid, primers, probes (the final concentration of all primers and probes was 0.2 µ M) and all other components included in the kits, according to the manufacturers’ protocols.

Article Title: The C-Type Lectin OCILRP2 Costimulates EL4 T Cell Activation via the DAP12-Raf-MAP Kinase Pathway
Article Snippet: .. The RT reaction was performed at 42°C for 1 hour, followed by deactivation for 5 minutes at 90°C. cDNA for IL-2, NFκB, NFAT, MAPK8, and MAPK3 or the control household gene β-actin was amplified using SYBR Premix Ex Taq (RRO41A, TaKaRa, Shiga, Japan), and expression was monitored using an Rotor-gene 6000 real-time platform (Corbett Research, Australia). .. CT values were normalized for the expression of the β-actin gene.

Article Title: Susceptibility of Chickens to Porcine Deltacoronavirus Infection
Article Snippet: The cDNA was amplified using Taq DNA Polymerase (TaKaRa, Dalian, China). .. Viral RNA titers was performed by qRT-PCR as reported previously [ ]. qRT-PCR was conducted using the Premix Ex TaqTM (Probe qPCR) kit (TaKaRa, Dalian, China) on a real-time thermocycler (CFX96TM Optics Module, BIO-RAD), and the results were analyzed using the system software.

Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells
Article Snippet: RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany). .. The PCR program was set as below: 94°C 3 min, (94°C 30 s, 55°C 30 s, 72°C 1 min, read plate)×30 cycles; 72°C 5 min. A standard curve for each gene was generated to monitor amplification efficiency and to relatively quantify mRNA abundance. mRNA abundance was normalized to β-actin levels and expressed as percentage of the vehicle control (100%) for statistical analysis.

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

Article Title: Gorlin syndrome-derived induced pluripotent stem cells are hypersensitive to hedgehog-mediated osteogenic induction
Article Snippet: The amplified PCR products were evaluated using electrophoresis on 2% agarose gels. .. Quantitative real-time RT-PCR (qRT-PCR) analysis of GLI family zinc finger 1 (GLI1 ) and Runt-related transcription factor 2 (RUNX2) was conducted using Premix Ex Taq reagent (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions.

Filtration:

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: Then, the IgG-bound DNA fragments were recovered by filtration, using a Microcon YM-100 filter (Millipore). .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen).

Positive Control:

Article Title: Susceptibility of Chickens to Porcine Deltacoronavirus Infection
Article Snippet: Viral RNA titers was performed by qRT-PCR as reported previously [ ]. qRT-PCR was conducted using the Premix Ex TaqTM (Probe qPCR) kit (TaKaRa, Dalian, China) on a real-time thermocycler (CFX96TM Optics Module, BIO-RAD), and the results were analyzed using the system software. .. For each conventional RT-PCR and qRT-PCR assay, 10-fold dilutions of standard plasmid were generated as the positive control, and negative control samples and double-distilled water (ddH2 O) were also included.

Synthesized:

Article Title: Arctigenin Efficiently Enhanced Sedentary Mice Treadmill Endurance
Article Snippet: .. RT-PCR and quantitative real-time PCR Total RNA was extracted from administrated cells or mice tissues using RNAiso (TaKaRa) reagent in accordance with the Kit instruction. cDNA was synthesized by RT reagent Kit (TaKaRa) and real-time PCR was performed using SYRB Premix Ex Taq (TaKaRa) on DNA Engene Opticon TM2 system (MJ Research, Waltham, MA, USA). .. The primers were listed as follows: PGC-1α: sense 5′- gcccggtacagtgagtgttc-3′, anti 5′- ctgggccgtttagtcttcct-3′.

Article Title: Gorlin syndrome-derived induced pluripotent stem cells are hypersensitive to hedgehog-mediated osteogenic induction
Article Snippet: RNA isolation and gene expression Total RNA was extracted using QIAzol reagent (Qiagen Inc., Valencia, CA) according to the manufacturer’s instructions. cDNA was synthesized using a high-capacity cDNA reverse transcription kit (Applied Biosystems, Foster City, CA, USA). .. Quantitative real-time RT-PCR (qRT-PCR) analysis of GLI family zinc finger 1 (GLI1 ) and Runt-related transcription factor 2 (RUNX2) was conducted using Premix Ex Taq reagent (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions.

Pyrolysis Gas Chromatography:

Article Title: Arctigenin Efficiently Enhanced Sedentary Mice Treadmill Endurance
Article Snippet: RT-PCR and quantitative real-time PCR Total RNA was extracted from administrated cells or mice tissues using RNAiso (TaKaRa) reagent in accordance with the Kit instruction. cDNA was synthesized by RT reagent Kit (TaKaRa) and real-time PCR was performed using SYRB Premix Ex Taq (TaKaRa) on DNA Engene Opticon TM2 system (MJ Research, Waltham, MA, USA). .. The primers were listed as follows: PGC-1α: sense 5′- gcccggtacagtgagtgttc-3′, anti 5′- ctgggccgtttagtcttcct-3′.

Quantitative RT-PCR:

Article Title: The Commonly Used Bactericide Bismerthiazol Promotes Rice Defenses against Herbivores
Article Snippet: .. The QRT-PCR assay was performed on a CFX96TM Real-Time system (Bio-Rad, Hercules, CA, USA) using a Premix Ex TaqTM Kit (TaKaRa, Shiga, Japan). ..

Article Title: Susceptibility of Chickens to Porcine Deltacoronavirus Infection
Article Snippet: .. Viral RNA titers was performed by qRT-PCR as reported previously [ ]. qRT-PCR was conducted using the Premix Ex TaqTM (Probe qPCR) kit (TaKaRa, Dalian, China) on a real-time thermocycler (CFX96TM Optics Module, BIO-RAD), and the results were analyzed using the system software. .. The detection limit of the qRT-PCR was 10 GEs/reaction, which was corresponded to 4.6 log10 GE/mL of PDCoV in fecal and 3.6 log10 GE/mL in serum samples, respectively.

Article Title: 21-Gene Recurrence Score and Adjuvant Chemotherapy Decision for Breast Cancer Patients with Positive Lymph Nodes
Article Snippet: .. Quantitative RT-PCR was accomplished using Premix Ex TaqTM (TaKaRa Bio, RR390A) in Applied Biosystems 7500 Real-Time PCR System (Foster City, CA). .. Gene expression was verified in triplicate, and normalized to five endogenous reference genes.

Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells
Article Snippet: Total RNA extraction, reverse transcription and quantitative real-time PCR The effects of QODG on certain genes were determined by quantitative real-time PCR (qRT-PCR). .. RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany).

Article Title: Gorlin syndrome-derived induced pluripotent stem cells are hypersensitive to hedgehog-mediated osteogenic induction
Article Snippet: .. Quantitative real-time RT-PCR (qRT-PCR) analysis of GLI family zinc finger 1 (GLI1 ) and Runt-related transcription factor 2 (RUNX2) was conducted using Premix Ex Taq reagent (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions. ..

Real-time Polymerase Chain Reaction:

Article Title: Arctigenin Efficiently Enhanced Sedentary Mice Treadmill Endurance
Article Snippet: .. RT-PCR and quantitative real-time PCR Total RNA was extracted from administrated cells or mice tissues using RNAiso (TaKaRa) reagent in accordance with the Kit instruction. cDNA was synthesized by RT reagent Kit (TaKaRa) and real-time PCR was performed using SYRB Premix Ex Taq (TaKaRa) on DNA Engene Opticon TM2 system (MJ Research, Waltham, MA, USA). .. The primers were listed as follows: PGC-1α: sense 5′- gcccggtacagtgagtgttc-3′, anti 5′- ctgggccgtttagtcttcct-3′.

Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR
Article Snippet: A LightCycler Nano (Roche Diagnostics GmbH) was used for all qPCR reactions performed in this study. .. A one step PrimeScript RT-PCR Kit (Perfect Real time) (TaKaRa Bio, Otsu, Japan) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) (TaKaRa Bio) was used for amplification of extracts from DNA viruses, bacteria and protozoa.

Article Title: Long noncoding RNA ATB promotes the epithelial−mesenchymal transition by upregulating the miR-200c/Twist1 axe and predicts poor prognosis in breast cancer
Article Snippet: .. The transcript levels of lncATB and the EMT markers were analysed using real-time PCR assays (SYBR Premix Ex Taq™, TaKaRa, Dalian, China) in triplicate by reacting the cDNA with sequence-specific PCR primers in an ABI PRISM 7500 sequence detection PCR system (Applied Biosystems, Foster City, CA, USA). .. The relative expression levels of lncATB and the mRNAs were calculated and normalized relative to β-actin using the 2-ΔΔCt method.

Article Title: Knockdown of nucleophosmin 1 suppresses proliferation of triple-negative breast cancer cells through activating CDH1/Skp2/p27kip1 pathway
Article Snippet: Paragraph title: Real-time PCR (RT-PCR) assay ... The mRNA levels of NPM1 were analyzed using the RT-PCR assays (SYBR Premix Ex Taq™; Takara Bio Inc.) according to the manufacturer’s instructions.

Article Title: The C-Type Lectin OCILRP2 Costimulates EL4 T Cell Activation via the DAP12-Raf-MAP Kinase Pathway
Article Snippet: Paragraph title: cDNA synthesis and Quantitative real-time PCR analysis ... The RT reaction was performed at 42°C for 1 hour, followed by deactivation for 5 minutes at 90°C. cDNA for IL-2, NFκB, NFAT, MAPK8, and MAPK3 or the control household gene β-actin was amplified using SYBR Premix Ex Taq (RRO41A, TaKaRa, Shiga, Japan), and expression was monitored using an Rotor-gene 6000 real-time platform (Corbett Research, Australia).

Article Title: Susceptibility of Chickens to Porcine Deltacoronavirus Infection
Article Snippet: .. Viral RNA titers was performed by qRT-PCR as reported previously [ ]. qRT-PCR was conducted using the Premix Ex TaqTM (Probe qPCR) kit (TaKaRa, Dalian, China) on a real-time thermocycler (CFX96TM Optics Module, BIO-RAD), and the results were analyzed using the system software. .. The detection limit of the qRT-PCR was 10 GEs/reaction, which was corresponded to 4.6 log10 GE/mL of PDCoV in fecal and 3.6 log10 GE/mL in serum samples, respectively.

Article Title: 21-Gene Recurrence Score and Adjuvant Chemotherapy Decision for Breast Cancer Patients with Positive Lymph Nodes
Article Snippet: .. Quantitative RT-PCR was accomplished using Premix Ex TaqTM (TaKaRa Bio, RR390A) in Applied Biosystems 7500 Real-Time PCR System (Foster City, CA). .. Gene expression was verified in triplicate, and normalized to five endogenous reference genes.

Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells
Article Snippet: .. RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany). .. The reverse-transcribed RNA was primed with oligonucleotides specific for VEGFR1 (Flt-1) (forward: 5′–GGGCAGACTCTTGTCCTCAACT–3′ and reverse: 5′–CAGCTCATTTGCACCCTCGT–3′ ), VEGFR2 (Flk-1) (forward: 5′–GACTGTGGCGAAGTGTTTTTGA–3′ and reverse: 5′–GTGCAGGGGAGGGTTGGCGTAG–3′ ), and β-actin (forward: 5′–GTGCGGGACATCAAGGAGAA–3′ and reverse: 5′–AGGAAGGAGGGCTGGAAGAG–3′ ) (Applied Biosystems, Carlsbad, CA, USA).

Incubation:

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: For the isolation of DNA fragments containing FAM-hx- Px , ∼20 pmol of the amplified DNA fragments were mixed with an anti-fluorescein IgG solution (20 μl) (Invitrogen, A-889) and incubated for 1 h on ice in a phosphate-buffered saline (100 μl). .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen).

Formalin-fixed Paraffin-Embedded:

Article Title: 21-Gene Recurrence Score and Adjuvant Chemotherapy Decision for Breast Cancer Patients with Positive Lymph Nodes
Article Snippet: RNA was extracted from three 10μm unstained sections of FFPE breast tumor tissue, which was prepared by experienced pathologists in the Department of Pathology, using RNeasy FFPE RNA kit (Qiagen, 73504, Germany). .. Quantitative RT-PCR was accomplished using Premix Ex TaqTM (TaKaRa Bio, RR390A) in Applied Biosystems 7500 Real-Time PCR System (Foster City, CA).

Expressing:

Article Title: Long noncoding RNA ATB promotes the epithelial−mesenchymal transition by upregulating the miR-200c/Twist1 axe and predicts poor prognosis in breast cancer
Article Snippet: The transcript levels of lncATB and the EMT markers were analysed using real-time PCR assays (SYBR Premix Ex Taq™, TaKaRa, Dalian, China) in triplicate by reacting the cDNA with sequence-specific PCR primers in an ABI PRISM 7500 sequence detection PCR system (Applied Biosystems, Foster City, CA, USA). .. The relative expression levels of lncATB and the mRNAs were calculated and normalized relative to β-actin using the 2-ΔΔCt method.

Article Title: The C-Type Lectin OCILRP2 Costimulates EL4 T Cell Activation via the DAP12-Raf-MAP Kinase Pathway
Article Snippet: .. The RT reaction was performed at 42°C for 1 hour, followed by deactivation for 5 minutes at 90°C. cDNA for IL-2, NFκB, NFAT, MAPK8, and MAPK3 or the control household gene β-actin was amplified using SYBR Premix Ex Taq (RRO41A, TaKaRa, Shiga, Japan), and expression was monitored using an Rotor-gene 6000 real-time platform (Corbett Research, Australia). .. CT values were normalized for the expression of the β-actin gene.

Article Title: 21-Gene Recurrence Score and Adjuvant Chemotherapy Decision for Breast Cancer Patients with Positive Lymph Nodes
Article Snippet: Quantitative RT-PCR was accomplished using Premix Ex TaqTM (TaKaRa Bio, RR390A) in Applied Biosystems 7500 Real-Time PCR System (Foster City, CA). .. Gene expression was verified in triplicate, and normalized to five endogenous reference genes.

Article Title: Gorlin syndrome-derived induced pluripotent stem cells are hypersensitive to hedgehog-mediated osteogenic induction
Article Snippet: Paragraph title: RNA isolation and gene expression ... Quantitative real-time RT-PCR (qRT-PCR) analysis of GLI family zinc finger 1 (GLI1 ) and Runt-related transcription factor 2 (RUNX2) was conducted using Premix Ex Taq reagent (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Arctigenin Efficiently Enhanced Sedentary Mice Treadmill Endurance
Article Snippet: .. RT-PCR and quantitative real-time PCR Total RNA was extracted from administrated cells or mice tissues using RNAiso (TaKaRa) reagent in accordance with the Kit instruction. cDNA was synthesized by RT reagent Kit (TaKaRa) and real-time PCR was performed using SYRB Premix Ex Taq (TaKaRa) on DNA Engene Opticon TM2 system (MJ Research, Waltham, MA, USA). .. The primers were listed as follows: PGC-1α: sense 5′- gcccggtacagtgagtgttc-3′, anti 5′- ctgggccgtttagtcttcct-3′.

Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR
Article Snippet: .. A one step PrimeScript RT-PCR Kit (Perfect Real time) (TaKaRa Bio, Otsu, Japan) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) (TaKaRa Bio) was used for amplification of extracts from DNA viruses, bacteria and protozoa. .. All reactions were performed in a total volume of 20 µl, which contained the sample nucleic acid, primers, probes (the final concentration of all primers and probes was 0.2 µ M) and all other components included in the kits, according to the manufacturers’ protocols.

Article Title: Long noncoding RNA ATB promotes the epithelial−mesenchymal transition by upregulating the miR-200c/Twist1 axe and predicts poor prognosis in breast cancer
Article Snippet: The RNA was reverse-transcribed into cDNA using the Prime-Script RT-PCR kit (Takara, Dalian, China) following the manufacturer’s instructions. .. The transcript levels of lncATB and the EMT markers were analysed using real-time PCR assays (SYBR Premix Ex Taq™, TaKaRa, Dalian, China) in triplicate by reacting the cDNA with sequence-specific PCR primers in an ABI PRISM 7500 sequence detection PCR system (Applied Biosystems, Foster City, CA, USA).

Article Title: The Commonly Used Bactericide Bismerthiazol Promotes Rice Defenses against Herbivores
Article Snippet: One microgram of each total RNA sample was reverse-transcribed using the PrimeScript RT-PCR Kit (TaKaRa, Shiga, Japan). .. The QRT-PCR assay was performed on a CFX96TM Real-Time system (Bio-Rad, Hercules, CA, USA) using a Premix Ex TaqTM Kit (TaKaRa, Shiga, Japan).

Article Title: Knockdown of nucleophosmin 1 suppresses proliferation of triple-negative breast cancer cells through activating CDH1/Skp2/p27kip1 pathway
Article Snippet: .. The mRNA levels of NPM1 were analyzed using the RT-PCR assays (SYBR Premix Ex Taq™; Takara Bio Inc.) according to the manufacturer’s instructions. .. Cells were lysed in RIPA buffer (Cell Signaling Technology, Inc., Danvers, MA, USA) containing protease inhibitors.

Article Title: Susceptibility of Chickens to Porcine Deltacoronavirus Infection
Article Snippet: Paragraph title: 2.6. Viral RNA Extraction and RT-PCR, qRT-PCR ... Viral RNA titers was performed by qRT-PCR as reported previously [ ]. qRT-PCR was conducted using the Premix Ex TaqTM (Probe qPCR) kit (TaKaRa, Dalian, China) on a real-time thermocycler (CFX96TM Optics Module, BIO-RAD), and the results were analyzed using the system software.

Article Title: Gorlin syndrome-derived induced pluripotent stem cells are hypersensitive to hedgehog-mediated osteogenic induction
Article Snippet: The stemness and pluripotency of the iPSCs were analyzed using reverse transcription polymerase chain reaction (RT-PCR) analysis with ExTaq DNA polymerase (Takara Biotechnology, Shiga, Japan). .. Quantitative real-time RT-PCR (qRT-PCR) analysis of GLI family zinc finger 1 (GLI1 ) and Runt-related transcription factor 2 (RUNX2) was conducted using Premix Ex Taq reagent (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions.

Generated:

Article Title: Susceptibility of Chickens to Porcine Deltacoronavirus Infection
Article Snippet: Viral RNA titers was performed by qRT-PCR as reported previously [ ]. qRT-PCR was conducted using the Premix Ex TaqTM (Probe qPCR) kit (TaKaRa, Dalian, China) on a real-time thermocycler (CFX96TM Optics Module, BIO-RAD), and the results were analyzed using the system software. .. For each conventional RT-PCR and qRT-PCR assay, 10-fold dilutions of standard plasmid were generated as the positive control, and negative control samples and double-distilled water (ddH2 O) were also included.

Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells
Article Snippet: RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany). .. The PCR program was set as below: 94°C 3 min, (94°C 30 s, 55°C 30 s, 72°C 1 min, read plate)×30 cycles; 72°C 5 min. A standard curve for each gene was generated to monitor amplification efficiency and to relatively quantify mRNA abundance. mRNA abundance was normalized to β-actin levels and expressed as percentage of the vehicle control (100%) for statistical analysis.

Polymerase Chain Reaction:

Article Title: Long noncoding RNA ATB promotes the epithelial−mesenchymal transition by upregulating the miR-200c/Twist1 axe and predicts poor prognosis in breast cancer
Article Snippet: .. The transcript levels of lncATB and the EMT markers were analysed using real-time PCR assays (SYBR Premix Ex Taq™, TaKaRa, Dalian, China) in triplicate by reacting the cDNA with sequence-specific PCR primers in an ABI PRISM 7500 sequence detection PCR system (Applied Biosystems, Foster City, CA, USA). .. The relative expression levels of lncATB and the mRNAs were calculated and normalized relative to β-actin using the 2-ΔΔCt method.

Article Title: Susceptibility of Chickens to Porcine Deltacoronavirus Infection
Article Snippet: The PCR products were sequenced twice using the forward and reverse PCR primers. .. Viral RNA titers was performed by qRT-PCR as reported previously [ ]. qRT-PCR was conducted using the Premix Ex TaqTM (Probe qPCR) kit (TaKaRa, Dalian, China) on a real-time thermocycler (CFX96TM Optics Module, BIO-RAD), and the results were analyzed using the system software.

Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells
Article Snippet: RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany). .. The PCR program was set as below: 94°C 3 min, (94°C 30 s, 55°C 30 s, 72°C 1 min, read plate)×30 cycles; 72°C 5 min. A standard curve for each gene was generated to monitor amplification efficiency and to relatively quantify mRNA abundance. mRNA abundance was normalized to β-actin levels and expressed as percentage of the vehicle control (100%) for statistical analysis.

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

Article Title: Gorlin syndrome-derived induced pluripotent stem cells are hypersensitive to hedgehog-mediated osteogenic induction
Article Snippet: The PCR primers are listed in . .. Quantitative real-time RT-PCR (qRT-PCR) analysis of GLI family zinc finger 1 (GLI1 ) and Runt-related transcription factor 2 (RUNX2) was conducted using Premix Ex Taq reagent (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions.

Fluorescence:

Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR
Article Snippet: A one step PrimeScript RT-PCR Kit (Perfect Real time) (TaKaRa Bio, Otsu, Japan) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) (TaKaRa Bio) was used for amplification of extracts from DNA viruses, bacteria and protozoa. .. Thermal cycling conditions were as follows: 45°C for 5 min and 95°C for 30 sec, followed by 40 cycles of 95°C for 10 sec, 55°C for 20 sec and 72°C for 20 sec. Fluorescence data were analyzed automatically using LightCycler Nano Software 1.1 (Roche Diagnostics GmbH).

Isolation:

Article Title: The Commonly Used Bactericide Bismerthiazol Promotes Rice Defenses against Herbivores
Article Snippet: Total RNA was isolated using the SV Total RNA Isolation System (Promega, Madison, WI, USA) following the manufacturer’s instructions. .. The QRT-PCR assay was performed on a CFX96TM Real-Time system (Bio-Rad, Hercules, CA, USA) using a Premix Ex TaqTM Kit (TaKaRa, Shiga, Japan).

Article Title: The C-Type Lectin OCILRP2 Costimulates EL4 T Cell Activation via the DAP12-Raf-MAP Kinase Pathway
Article Snippet: cDNA synthesis and Quantitative real-time PCR analysis RNA from anti-CD3/CD28 antibody- or anti-CD3/CD28/OCILRP2 antibody-stimulated EL4 cells and normal EL4 cells were isolated using trizol reagent (15596-018, Invitrogen). .. The RT reaction was performed at 42°C for 1 hour, followed by deactivation for 5 minutes at 90°C. cDNA for IL-2, NFκB, NFAT, MAPK8, and MAPK3 or the control household gene β-actin was amplified using SYBR Premix Ex Taq (RRO41A, TaKaRa, Shiga, Japan), and expression was monitored using an Rotor-gene 6000 real-time platform (Corbett Research, Australia).

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: For the isolation of DNA fragments containing FAM-hx- Px , ∼20 pmol of the amplified DNA fragments were mixed with an anti-fluorescein IgG solution (20 μl) (Invitrogen, A-889) and incubated for 1 h on ice in a phosphate-buffered saline (100 μl). .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen).

Article Title: Gorlin syndrome-derived induced pluripotent stem cells are hypersensitive to hedgehog-mediated osteogenic induction
Article Snippet: Paragraph title: RNA isolation and gene expression ... Quantitative real-time RT-PCR (qRT-PCR) analysis of GLI family zinc finger 1 (GLI1 ) and Runt-related transcription factor 2 (RUNX2) was conducted using Premix Ex Taq reagent (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions.

Size-exclusion Chromatography:

Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR
Article Snippet: A one step PrimeScript RT-PCR Kit (Perfect Real time) (TaKaRa Bio, Otsu, Japan) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) (TaKaRa Bio) was used for amplification of extracts from DNA viruses, bacteria and protozoa. .. Thermal cycling conditions were as follows: 45°C for 5 min and 95°C for 30 sec, followed by 40 cycles of 95°C for 10 sec, 55°C for 20 sec and 72°C for 20 sec. Fluorescence data were analyzed automatically using LightCycler Nano Software 1.1 (Roche Diagnostics GmbH).

TA Cloning:

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

Sequencing:

Article Title: Long noncoding RNA ATB promotes the epithelial−mesenchymal transition by upregulating the miR-200c/Twist1 axe and predicts poor prognosis in breast cancer
Article Snippet: .. The transcript levels of lncATB and the EMT markers were analysed using real-time PCR assays (SYBR Premix Ex Taq™, TaKaRa, Dalian, China) in triplicate by reacting the cDNA with sequence-specific PCR primers in an ABI PRISM 7500 sequence detection PCR system (Applied Biosystems, Foster City, CA, USA). .. The relative expression levels of lncATB and the mRNAs were calculated and normalized relative to β-actin using the 2-ΔΔCt method.

Article Title: Susceptibility of Chickens to Porcine Deltacoronavirus Infection
Article Snippet: The primers targeting the PDCoV S gene (PDCoV-S609-F: 5’-CAACCGTCTTGAGGAAGTAGAG-3’ and PDCoV-S609-R: 5’-TCAACGGTGAGGTTGAGAATAG-3’) were designed based on the sequence of the USA/Iowa136/2015 strain (GenBank accession no. KX022602), and the amplified fragment was 609 bp. .. Viral RNA titers was performed by qRT-PCR as reported previously [ ]. qRT-PCR was conducted using the Premix Ex TaqTM (Probe qPCR) kit (TaKaRa, Dalian, China) on a real-time thermocycler (CFX96TM Optics Module, BIO-RAD), and the results were analyzed using the system software.

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: After five rounds of in vitro selection, about 1 pmol of the recovered DNA was amplified by eight cycles of PCR (25 μl), in a reaction buffer with 50 μM NH2 -hx-d Px TP, 50 μM d Ds TP, 0.3 mM each natural dNTP, 1 μM each of 5′-primer (40-mer, 5′-CGTTGTAAAACGACGGCCAGGATAATACGACTCACTATAG-3′) and 3′-primer (24-mer, 5′-TTTCACACAGGAAACAGCTATGAC-3′) and 0.02 U/μl DeepVent DNA polymerase, and then the PCR products were purified by electrophoresis on 8% polyacrylamide—7 M urea gel for direct sequencing. .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen).

Mouse Assay:

Article Title: Arctigenin Efficiently Enhanced Sedentary Mice Treadmill Endurance
Article Snippet: .. RT-PCR and quantitative real-time PCR Total RNA was extracted from administrated cells or mice tissues using RNAiso (TaKaRa) reagent in accordance with the Kit instruction. cDNA was synthesized by RT reagent Kit (TaKaRa) and real-time PCR was performed using SYRB Premix Ex Taq (TaKaRa) on DNA Engene Opticon TM2 system (MJ Research, Waltham, MA, USA). .. The primers were listed as follows: PGC-1α: sense 5′- gcccggtacagtgagtgttc-3′, anti 5′- ctgggccgtttagtcttcct-3′.

RNA Extraction:

Article Title: Long noncoding RNA ATB promotes the epithelial−mesenchymal transition by upregulating the miR-200c/Twist1 axe and predicts poor prognosis in breast cancer
Article Snippet: Paragraph title: RNA extraction and real-time qPCR ... The transcript levels of lncATB and the EMT markers were analysed using real-time PCR assays (SYBR Premix Ex Taq™, TaKaRa, Dalian, China) in triplicate by reacting the cDNA with sequence-specific PCR primers in an ABI PRISM 7500 sequence detection PCR system (Applied Biosystems, Foster City, CA, USA).

Article Title: Susceptibility of Chickens to Porcine Deltacoronavirus Infection
Article Snippet: Paragraph title: 2.6. Viral RNA Extraction and RT-PCR, qRT-PCR ... Viral RNA titers was performed by qRT-PCR as reported previously [ ]. qRT-PCR was conducted using the Premix Ex TaqTM (Probe qPCR) kit (TaKaRa, Dalian, China) on a real-time thermocycler (CFX96TM Optics Module, BIO-RAD), and the results were analyzed using the system software.

Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells
Article Snippet: Paragraph title: Total RNA extraction, reverse transcription and quantitative real-time PCR ... RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany).

Plasmid Preparation:

Article Title: Susceptibility of Chickens to Porcine Deltacoronavirus Infection
Article Snippet: Viral RNA titers was performed by qRT-PCR as reported previously [ ]. qRT-PCR was conducted using the Premix Ex TaqTM (Probe qPCR) kit (TaKaRa, Dalian, China) on a real-time thermocycler (CFX96TM Optics Module, BIO-RAD), and the results were analyzed using the system software. .. For each conventional RT-PCR and qRT-PCR assay, 10-fold dilutions of standard plasmid were generated as the positive control, and negative control samples and double-distilled water (ddH2 O) were also included.

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

Software:

Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR
Article Snippet: A one step PrimeScript RT-PCR Kit (Perfect Real time) (TaKaRa Bio, Otsu, Japan) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) (TaKaRa Bio) was used for amplification of extracts from DNA viruses, bacteria and protozoa. .. Thermal cycling conditions were as follows: 45°C for 5 min and 95°C for 30 sec, followed by 40 cycles of 95°C for 10 sec, 55°C for 20 sec and 72°C for 20 sec. Fluorescence data were analyzed automatically using LightCycler Nano Software 1.1 (Roche Diagnostics GmbH).

Article Title: Susceptibility of Chickens to Porcine Deltacoronavirus Infection
Article Snippet: .. Viral RNA titers was performed by qRT-PCR as reported previously [ ]. qRT-PCR was conducted using the Premix Ex TaqTM (Probe qPCR) kit (TaKaRa, Dalian, China) on a real-time thermocycler (CFX96TM Optics Module, BIO-RAD), and the results were analyzed using the system software. .. The detection limit of the qRT-PCR was 10 GEs/reaction, which was corresponded to 4.6 log10 GE/mL of PDCoV in fecal and 3.6 log10 GE/mL in serum samples, respectively.

Electrophoresis:

Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells
Article Snippet: HUVECs (5×105 cells/well) were seeded in 24-well plates, and starved with ECGM containing 0.5% FBS for 24 h. After the pre-incubation, cells were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for another 24 h. Then cells were harvested in TRIzol® reagent, and their RNA was extracted, reconstituted in DEPC-treated water, and checked for integrity by agarose-gel electrophoresis. .. RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany).

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: After five rounds of in vitro selection, about 1 pmol of the recovered DNA was amplified by eight cycles of PCR (25 μl), in a reaction buffer with 50 μM NH2 -hx-d Px TP, 50 μM d Ds TP, 0.3 mM each natural dNTP, 1 μM each of 5′-primer (40-mer, 5′-CGTTGTAAAACGACGGCCAGGATAATACGACTCACTATAG-3′) and 3′-primer (24-mer, 5′-TTTCACACAGGAAACAGCTATGAC-3′) and 0.02 U/μl DeepVent DNA polymerase, and then the PCR products were purified by electrophoresis on 8% polyacrylamide—7 M urea gel for direct sequencing. .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen).

Article Title: Gorlin syndrome-derived induced pluripotent stem cells are hypersensitive to hedgehog-mediated osteogenic induction
Article Snippet: The amplified PCR products were evaluated using electrophoresis on 2% agarose gels. .. Quantitative real-time RT-PCR (qRT-PCR) analysis of GLI family zinc finger 1 (GLI1 ) and Runt-related transcription factor 2 (RUNX2) was conducted using Premix Ex Taq reagent (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions.

Negative Control:

Article Title: Susceptibility of Chickens to Porcine Deltacoronavirus Infection
Article Snippet: Viral RNA titers was performed by qRT-PCR as reported previously [ ]. qRT-PCR was conducted using the Premix Ex TaqTM (Probe qPCR) kit (TaKaRa, Dalian, China) on a real-time thermocycler (CFX96TM Optics Module, BIO-RAD), and the results were analyzed using the system software. .. For each conventional RT-PCR and qRT-PCR assay, 10-fold dilutions of standard plasmid were generated as the positive control, and negative control samples and double-distilled water (ddH2 O) were also included.

Selection:

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: Paragraph title: In vitro selection of DNA sequences for efficient PCR amplification ... In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen).

Agarose Gel Electrophoresis:

Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells
Article Snippet: HUVECs (5×105 cells/well) were seeded in 24-well plates, and starved with ECGM containing 0.5% FBS for 24 h. After the pre-incubation, cells were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for another 24 h. Then cells were harvested in TRIzol® reagent, and their RNA was extracted, reconstituted in DEPC-treated water, and checked for integrity by agarose-gel electrophoresis. .. RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany).

In Vitro:

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: Paragraph title: In vitro selection of DNA sequences for efficient PCR amplification ... In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen).

Ethanol Precipitation:

Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
Article Snippet: After phenol extraction and ethanol precipitation, ∼1 pmol of the recovered DNA was used as a template for the next round of PCR (200 μl). .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen).

Concentration Assay:

Article Title: Development of a novel detection system for microbes from bovine diarrhea by real-time PCR
Article Snippet: A one step PrimeScript RT-PCR Kit (Perfect Real time) (TaKaRa Bio, Otsu, Japan) was used for amplification of extracts from RNA viruses, and Premix Ex Taq (Perfect Real time) (TaKaRa Bio) was used for amplification of extracts from DNA viruses, bacteria and protozoa. .. All reactions were performed in a total volume of 20 µl, which contained the sample nucleic acid, primers, probes (the final concentration of all primers and probes was 0.2 µ M) and all other components included in the kits, according to the manufacturers’ protocols.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa sybr premix ex taq ii kit
    Expression levels of miR-192, -194 and -215 in three colorectal cancer (CRC) cell lines (HT-29, HCT-116 and SW-620). Quantification of miRNAs was measured by <t>SYBR</t> Premix Ex <t>Taq</t> II. Data are presented in CRC cell lines relative to normal colorectal tissues
    Sybr Premix Ex Taq Ii Kit, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 248 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/sybr premix ex taq ii kit/product/TaKaRa
    Average 99 stars, based on 248 article reviews
    Price from $9.99 to $1999.99
    sybr premix ex taq ii kit - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    99
    TaKaRa rt pcr assays
    Expression of <t>NPM1</t> was distinct in different breast cancer cell lines. ( A ) NPM1 expression in different molecular subtypes of breast cancer cells using GOBO analysis. ( B – C ) NPM1 expression levels in various human breast cancer cell lines were tested via <t>RT-PCR</t> ( B ) and Western blotting ( C ). ( D ) Immunofluorescence of MDA-MB-231 and MCF-7 cells stained with anti-NPM1 (red signal). Abbreviations: HR, hormone receptor; TN, triple negative.
    Rt Pcr Assays, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 3788 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/rt pcr assays/product/TaKaRa
    Average 99 stars, based on 3788 article reviews
    Price from $9.99 to $1999.99
    rt pcr assays - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results


    Expression levels of miR-192, -194 and -215 in three colorectal cancer (CRC) cell lines (HT-29, HCT-116 and SW-620). Quantification of miRNAs was measured by SYBR Premix Ex Taq II. Data are presented in CRC cell lines relative to normal colorectal tissues

    Journal: Experimental and Therapeutic Medicine

    Article Title: microRNA-192, -194 and -215 are frequently downregulated in colorectal cancer

    doi: 10.3892/etm.2011.436

    Figure Lengend Snippet: Expression levels of miR-192, -194 and -215 in three colorectal cancer (CRC) cell lines (HT-29, HCT-116 and SW-620). Quantification of miRNAs was measured by SYBR Premix Ex Taq II. Data are presented in CRC cell lines relative to normal colorectal tissues

    Article Snippet: According to the manufacturer's instructions, real-time PCR was performed using the SYBR Premix Ex Taq™ II kit (Takara Bio, Kyoto, Japan) with a Rotor-gene 6000 system (Qiagen, Valencia, CA, USA) ( ).

    Techniques: Expressing

    Expression levels of miR-192, -194 and -215 in 107 patients with colorectal cancer (CRC). (A, C and E) Quantification of miRNAs was measured by SYBR Premix Ex Taq II. Each sample was analyzed in triplicate and repeated three times. Data are presented

    Journal: Experimental and Therapeutic Medicine

    Article Title: microRNA-192, -194 and -215 are frequently downregulated in colorectal cancer

    doi: 10.3892/etm.2011.436

    Figure Lengend Snippet: Expression levels of miR-192, -194 and -215 in 107 patients with colorectal cancer (CRC). (A, C and E) Quantification of miRNAs was measured by SYBR Premix Ex Taq II. Each sample was analyzed in triplicate and repeated three times. Data are presented

    Article Snippet: According to the manufacturer's instructions, real-time PCR was performed using the SYBR Premix Ex Taq™ II kit (Takara Bio, Kyoto, Japan) with a Rotor-gene 6000 system (Qiagen, Valencia, CA, USA) ( ).

    Techniques: Expressing

    Expression of NPM1 was distinct in different breast cancer cell lines. ( A ) NPM1 expression in different molecular subtypes of breast cancer cells using GOBO analysis. ( B – C ) NPM1 expression levels in various human breast cancer cell lines were tested via RT-PCR ( B ) and Western blotting ( C ). ( D ) Immunofluorescence of MDA-MB-231 and MCF-7 cells stained with anti-NPM1 (red signal). Abbreviations: HR, hormone receptor; TN, triple negative.

    Journal: Cancer Management and Research

    Article Title: Knockdown of nucleophosmin 1 suppresses proliferation of triple-negative breast cancer cells through activating CDH1/Skp2/p27kip1 pathway

    doi: 10.2147/CMAR.S191176

    Figure Lengend Snippet: Expression of NPM1 was distinct in different breast cancer cell lines. ( A ) NPM1 expression in different molecular subtypes of breast cancer cells using GOBO analysis. ( B – C ) NPM1 expression levels in various human breast cancer cell lines were tested via RT-PCR ( B ) and Western blotting ( C ). ( D ) Immunofluorescence of MDA-MB-231 and MCF-7 cells stained with anti-NPM1 (red signal). Abbreviations: HR, hormone receptor; TN, triple negative.

    Article Snippet: The mRNA levels of NPM1 were analyzed using the RT-PCR assays (SYBR Premix Ex Taq™; Takara Bio Inc.) according to the manufacturer’s instructions.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunofluorescence, Multiple Displacement Amplification, Staining

    mRNA expression in EL4 cells stimulated with or without anti-CD3/CD28 antibodies or anti-CD3/CD28/OCILRP2 antibodies. RNA from un-stimulated or CD3/CD28 antibody- or CD3/CD28/OCILRP2 antibody-stimulated EL4 cells was isolated using the RNeasy kit (Qiagen). cDNA of IL-2, NF-κB, NFAT, MAPK3, and MAPK8 or the control household gene β-actin was amplified using SYBR Premix Ex Taq (RRO41A, TaKaRa, Shiga, Japan), and expression was monitored using an Rotor-gene 6000 real-time platform (Corbett Research, Australia). Ct values were normalized for the expression of the β-actin gene. *P

    Journal: PLoS ONE

    Article Title: The C-Type Lectin OCILRP2 Costimulates EL4 T Cell Activation via the DAP12-Raf-MAP Kinase Pathway

    doi: 10.1371/journal.pone.0113218

    Figure Lengend Snippet: mRNA expression in EL4 cells stimulated with or without anti-CD3/CD28 antibodies or anti-CD3/CD28/OCILRP2 antibodies. RNA from un-stimulated or CD3/CD28 antibody- or CD3/CD28/OCILRP2 antibody-stimulated EL4 cells was isolated using the RNeasy kit (Qiagen). cDNA of IL-2, NF-κB, NFAT, MAPK3, and MAPK8 or the control household gene β-actin was amplified using SYBR Premix Ex Taq (RRO41A, TaKaRa, Shiga, Japan), and expression was monitored using an Rotor-gene 6000 real-time platform (Corbett Research, Australia). Ct values were normalized for the expression of the β-actin gene. *P

    Article Snippet: The RT reaction was performed at 42°C for 1 hour, followed by deactivation for 5 minutes at 90°C. cDNA for IL-2, NFκB, NFAT, MAPK8, and MAPK3 or the control household gene β-actin was amplified using SYBR Premix Ex Taq (RRO41A, TaKaRa, Shiga, Japan), and expression was monitored using an Rotor-gene 6000 real-time platform (Corbett Research, Australia).

    Techniques: Expressing, Isolation, Amplification

    QODG insignificantly regulates the VEGF-triggered activation of VEGFR1 and VEGFR2 mRNAs expression in HUVECs. HUVECs (5×10 5 cells/well) were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for 24 h. RNA was extracted with TRIzol® Reagent (Invitrogen, Life Technologies, Grand Island, NY, USA), reverse transcribed with PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), and quantitated by qRT-PCR using SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan). Cells receiving only DMSO (0.1%) served as a vehicle control. The levels of VEGFR1 and VEGFR2 mRNAs are normalized by β-actin and expressed as percentages of the vehicle control (100%) in mean ± SD from three independent experiments in triplicates. P > 0.05 vs. VEGF-treated control.

    Journal: PLoS ONE

    Article Title: Quercetin-4?-O-?-D-glucopyranoside (QODG) Inhibits Angiogenesis by Suppressing VEGFR2-Mediated Signaling in Zebrafish and Endothelial Cells

    doi: 10.1371/journal.pone.0031708

    Figure Lengend Snippet: QODG insignificantly regulates the VEGF-triggered activation of VEGFR1 and VEGFR2 mRNAs expression in HUVECs. HUVECs (5×10 5 cells/well) were treated with or without VEGF (50 ng/mL) and DMSO (0.1%) or various concentrations of QODG (20, 60, 180 µM) for 24 h. RNA was extracted with TRIzol® Reagent (Invitrogen, Life Technologies, Grand Island, NY, USA), reverse transcribed with PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), and quantitated by qRT-PCR using SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan). Cells receiving only DMSO (0.1%) served as a vehicle control. The levels of VEGFR1 and VEGFR2 mRNAs are normalized by β-actin and expressed as percentages of the vehicle control (100%) in mean ± SD from three independent experiments in triplicates. P > 0.05 vs. VEGF-treated control.

    Article Snippet: RNA samples were quantified at OD260/280 , and RNA was introduced to reverse transcribe to single-stranded cDNA using PrimeScript™ RT reagent kit (TaKaRa, Otsu, Shiga, Japan), followed by qTR-PCR using the SYBR® Premix Ex Taq™ (TaKaRa, Otsu, Shiga, Japan) in Mastercycler® ep gradient realplex2 Real-Time PCR System (Eppendorf, Hamburg, Germany).

    Techniques: Activation Assay, Expressing, Quantitative RT-PCR