sybr premix ex taq ii  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    Premix Ex Taq
    Description:
    Premix Ex Taq Probe qPCR is a 2X master mix for real time PCR qPCR using probe based qPCR or 5 nuclease assays This 2X master mix includes Takara Ex Taq HS a hot start PCR enzyme in combination with anti Taq antibody in a qPCR optimized buffer Takara Ex Taq HS inhibits non specific amplification while enabling high efficiency amplification and detection sensitivity during real time PCR analyses Additionally Tli RNase H a heat resistant RNase enzyme is included in the real time PCR premix in order to minimize PCR inhibition due to the presence of residual mRNA in the input cDNA This master mix is ideal for high speed PCR allows accurate target quantification and detection over a broad dynamic range and enables highly reproducible and reliable real time PCR analyses
    Catalog Number:
    rr390w
    Price:
    None
    Size:
    1 000 Rxns
    Category:
    Premix Ex Taq Probe qPCR qPCR with probe detection Real time PCR kits Real time PCR
    Buy from Supplier


    Structured Review

    TaKaRa sybr premix ex taq ii
    Quantitative analysis of NOX2 and NOX4 mRNA expression in human OS cell lines. Quantitative analysis of the mRNA expression of NOX family proteins in five human OS cell lines was performed by RT-qPCR using a <t>SYBR</t> Green reagent. The Cq value during the exponential phase of amplification was determined by the real-time monitoring of the fluorescent emission of <t>Taq</t> polymerase nuclease activity. β- actin was used as an internal control for normalization. qPCR efficiencies of the target ( NOX2 and NOX4 ) and control (β-actin) proteins were approximately equal over a concentration range of 0.1–200 ng total cDNA. The relative transcripts were determined by the formula: 1/2 (Cq target-Cq control) ). The bars represent the mean (n=2). OS, osteosarcoma; NOX, NADPH oxidase; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; Cq, quantification cycle; PBMCs, peripheral blood mononuclear cells.
    Premix Ex Taq Probe qPCR is a 2X master mix for real time PCR qPCR using probe based qPCR or 5 nuclease assays This 2X master mix includes Takara Ex Taq HS a hot start PCR enzyme in combination with anti Taq antibody in a qPCR optimized buffer Takara Ex Taq HS inhibits non specific amplification while enabling high efficiency amplification and detection sensitivity during real time PCR analyses Additionally Tli RNase H a heat resistant RNase enzyme is included in the real time PCR premix in order to minimize PCR inhibition due to the presence of residual mRNA in the input cDNA This master mix is ideal for high speed PCR allows accurate target quantification and detection over a broad dynamic range and enables highly reproducible and reliable real time PCR analyses
    https://www.bioz.com/result/sybr premix ex taq ii/product/TaKaRa
    Average 99 stars, based on 3312 article reviews
    Price from $9.99 to $1999.99
    sybr premix ex taq ii - by Bioz Stars, 2020-08
    99/100 stars

    Images

    1) Product Images from "Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation"

    Article Title: Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation

    Journal: Oncology Letters

    doi: 10.3892/ol.2018.8291

    Quantitative analysis of NOX2 and NOX4 mRNA expression in human OS cell lines. Quantitative analysis of the mRNA expression of NOX family proteins in five human OS cell lines was performed by RT-qPCR using a SYBR Green reagent. The Cq value during the exponential phase of amplification was determined by the real-time monitoring of the fluorescent emission of Taq polymerase nuclease activity. β- actin was used as an internal control for normalization. qPCR efficiencies of the target ( NOX2 and NOX4 ) and control (β-actin) proteins were approximately equal over a concentration range of 0.1–200 ng total cDNA. The relative transcripts were determined by the formula: 1/2 (Cq target-Cq control) ). The bars represent the mean (n=2). OS, osteosarcoma; NOX, NADPH oxidase; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; Cq, quantification cycle; PBMCs, peripheral blood mononuclear cells.
    Figure Legend Snippet: Quantitative analysis of NOX2 and NOX4 mRNA expression in human OS cell lines. Quantitative analysis of the mRNA expression of NOX family proteins in five human OS cell lines was performed by RT-qPCR using a SYBR Green reagent. The Cq value during the exponential phase of amplification was determined by the real-time monitoring of the fluorescent emission of Taq polymerase nuclease activity. β- actin was used as an internal control for normalization. qPCR efficiencies of the target ( NOX2 and NOX4 ) and control (β-actin) proteins were approximately equal over a concentration range of 0.1–200 ng total cDNA. The relative transcripts were determined by the formula: 1/2 (Cq target-Cq control) ). The bars represent the mean (n=2). OS, osteosarcoma; NOX, NADPH oxidase; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; Cq, quantification cycle; PBMCs, peripheral blood mononuclear cells.

    Techniques Used: Expressing, Quantitative RT-PCR, SYBR Green Assay, Amplification, Activity Assay, Real-time Polymerase Chain Reaction, Concentration Assay

    Related Articles

    Clone Assay:

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    Amplification:

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
    Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

    Article Title: The C-Type Lectin OCILRP2 Costimulates EL4 T Cell Activation via the DAP12-Raf-MAP Kinase Pathway
    Article Snippet: .. The RT reaction was performed at 42°C for 1 hour, followed by deactivation for 5 minutes at 90°C. cDNA for IL-2, NFκB, NFAT, MAPK8, and MAPK3 or the control household gene β-actin was amplified using SYBR Premix Ex Taq (RRO41A, TaKaRa, Shiga, Japan), and expression was monitored using an Rotor-gene 6000 real-time platform (Corbett Research, Australia). .. CT values were normalized for the expression of the β-actin gene.

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    Polymerase Chain Reaction:

    Article Title: Roles of N-Acetylglucosaminyltransferase III in Epithelial-to-Mesenchymal Transition Induced by Transforming Growth Factor ?1 (TGF-?1) in Epithelial Cell Lines *
    Article Snippet: .. Real time PCR was performed with a StepOnePlus real time PCR system (Applied Biosystems, Inc., Foster City, CA) using SYBR® Premix Ex TaqTM II PCR master mixes (Takara, Japan). .. PCR primers were as follows: GnT-III forward sequence, TCAACGCCATCAACATCAAC, and reverse sequence, GTGGCGGATGTACTCGAAGG; and GAPDH forward sequence, AAATGGTGAAGGTCGGTGTG, and reverse sequence, TGAAGGGGTCGTTGATGG.

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
    Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    TA Cloning:

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    Quantitative RT-PCR:

    Article Title: Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation
    Article Snippet: .. RT-qPCR was performed with SYBR Premix Ex Taq II (Takara Bio, Inc., Otsu, Shiga, Japan) in an ABI PRISM 7500 Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). .. Briefly, a solution of SYBR Premix Ex Taq II (10 µl) containing sense and antisense primers (10 µM each) was prepared and aliquoted into individual wells of a MicroAmp Optical Plate (ABI-PE; Applied Biosystems; Thermo-Fisher Scientific, Inc.): 2 µl cDNA was added to give a final volume of 20 µl.

    Article Title: Gorlin syndrome-derived induced pluripotent stem cells are hypersensitive to hedgehog-mediated osteogenic induction
    Article Snippet: .. Quantitative real-time RT-PCR (qRT-PCR) analysis of GLI family zinc finger 1 (GLI1 ) and Runt-related transcription factor 2 (RUNX2) was conducted using Premix Ex Taq reagent (Takara Bio Inc., Shiga, Japan), according to the manufacturer’s instructions. ..

    Real-time Polymerase Chain Reaction:

    Article Title: Roles of N-Acetylglucosaminyltransferase III in Epithelial-to-Mesenchymal Transition Induced by Transforming Growth Factor ?1 (TGF-?1) in Epithelial Cell Lines *
    Article Snippet: .. Real time PCR was performed with a StepOnePlus real time PCR system (Applied Biosystems, Inc., Foster City, CA) using SYBR® Premix Ex TaqTM II PCR master mixes (Takara, Japan). .. PCR primers were as follows: GnT-III forward sequence, TCAACGCCATCAACATCAAC, and reverse sequence, GTGGCGGATGTACTCGAAGG; and GAPDH forward sequence, AAATGGTGAAGGTCGGTGTG, and reverse sequence, TGAAGGGGTCGTTGATGG.

    Article Title: microRNA-192, -194 and -215 are frequently downregulated in colorectal cancer
    Article Snippet: .. According to the manufacturer's instructions, real-time PCR was performed using the SYBR Premix Ex Taq™ II kit (Takara Bio, Kyoto, Japan) with a Rotor-gene 6000 system (Qiagen, Valencia, CA, USA) ( ). .. The 25 μl mixture of PCR consisted of 12.5 μl SYBR Green supermix, 8.5 μl RNase-free water, 1 μl forward primers, 1 μl reverse primers and 2 μl reverse transcribed product.

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
    Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Knockdown of nucleophosmin 1 suppresses proliferation of triple-negative breast cancer cells through activating CDH1/Skp2/p27kip1 pathway
    Article Snippet: .. The mRNA levels of NPM1 were analyzed using the RT-PCR assays (SYBR Premix Ex Taq™; Takara Bio Inc.) according to the manufacturer’s instructions. .. Cells were lysed in RIPA buffer (Cell Signaling Technology, Inc., Danvers, MA, USA) containing protease inhibitors.

    Expressing:

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript
    Article Snippet: .. Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression). ..

    Article Title: The C-Type Lectin OCILRP2 Costimulates EL4 T Cell Activation via the DAP12-Raf-MAP Kinase Pathway
    Article Snippet: .. The RT reaction was performed at 42°C for 1 hour, followed by deactivation for 5 minutes at 90°C. cDNA for IL-2, NFκB, NFAT, MAPK8, and MAPK3 or the control household gene β-actin was amplified using SYBR Premix Ex Taq (RRO41A, TaKaRa, Shiga, Japan), and expression was monitored using an Rotor-gene 6000 real-time platform (Corbett Research, Australia). .. CT values were normalized for the expression of the β-actin gene.

    Sequencing:

    Article Title: Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation
    Article Snippet: .. RT-qPCR was performed with SYBR Premix Ex Taq II (Takara Bio, Inc., Otsu, Shiga, Japan) in an ABI PRISM 7500 Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.). .. Briefly, a solution of SYBR Premix Ex Taq II (10 µl) containing sense and antisense primers (10 µM each) was prepared and aliquoted into individual wells of a MicroAmp Optical Plate (ABI-PE; Applied Biosystems; Thermo-Fisher Scientific, Inc.): 2 µl cDNA was added to give a final volume of 20 µl.

    Plasmid Preparation:

    Article Title: An unnatural base pair system for efficient PCR amplification and functionalization of DNA molecules
    Article Snippet: .. In the conventional cloning method, the recovered DNA fragments were amplified by eight cycles of PCR using Premix Taq (Ex Taq version; TaKaRa), without the unnatural base substrates, and were cloned using the TA cloning vector of the TOPO TA Cloning Kit Dual Promoter (Invitrogen). .. Plasmid DNAs were isolated and were sequenced using a BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems) on a DNA sequencer (model 3100, Applied Biosystems).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa pcr master mix
    cDNA sequence of mRNA de novo transcribed from <t>TNFSF9</t> in HepG2 clone 9-1 (A) HepG2 clone 9-1 cells were incubated with 500 ng/ml LPS for the indicated times. cDNA was synthesized from total RNA, and TNFSF9 expression was quantified by real-time <t>PCR</t> as described in “Materials and Methods”. (B) HepG2 cells were incubated with 500 ng/ml LPS in the presence of 5-ethynyl uridine (EU) for 16 hrs. EU-labeled RNA was isolated as described in “Materials and Methods”. TNFSF9 cDNA was amplified by PCR and the PCR products were isolated and sequenced. This experiment is representative of four independent experiments.
    Pcr Master Mix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 4477 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr master mix/product/TaKaRa
    Average 99 stars, based on 4477 article reviews
    Price from $9.99 to $1999.99
    pcr master mix - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results


    cDNA sequence of mRNA de novo transcribed from TNFSF9 in HepG2 clone 9-1 (A) HepG2 clone 9-1 cells were incubated with 500 ng/ml LPS for the indicated times. cDNA was synthesized from total RNA, and TNFSF9 expression was quantified by real-time PCR as described in “Materials and Methods”. (B) HepG2 cells were incubated with 500 ng/ml LPS in the presence of 5-ethynyl uridine (EU) for 16 hrs. EU-labeled RNA was isolated as described in “Materials and Methods”. TNFSF9 cDNA was amplified by PCR and the PCR products were isolated and sequenced. This experiment is representative of four independent experiments.

    Journal: Molecules and Cells

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript

    doi: 10.14348/molcells.2018.0209

    Figure Lengend Snippet: cDNA sequence of mRNA de novo transcribed from TNFSF9 in HepG2 clone 9-1 (A) HepG2 clone 9-1 cells were incubated with 500 ng/ml LPS for the indicated times. cDNA was synthesized from total RNA, and TNFSF9 expression was quantified by real-time PCR as described in “Materials and Methods”. (B) HepG2 cells were incubated with 500 ng/ml LPS in the presence of 5-ethynyl uridine (EU) for 16 hrs. EU-labeled RNA was isolated as described in “Materials and Methods”. TNFSF9 cDNA was amplified by PCR and the PCR products were isolated and sequenced. This experiment is representative of four independent experiments.

    Article Snippet: Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression).

    Techniques: Sequencing, Incubation, Synthesized, Expressing, Real-time Polymerase Chain Reaction, Labeling, Isolation, Amplification, Polymerase Chain Reaction

    DNA sequence of genomic TNFSF9 gene edited by CRISPR-Cas9 The TNFSF9 genes in genomic DNAs from wild type and mutated HepG2 cells were amplified by PCR. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the genomic TNFSF9 sequence. On the right are shown the DNA sequences around the region of the mutated triplet in the wildtype and mutant clones. This is one representative of five independent experiments.

    Journal: Molecules and Cells

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript

    doi: 10.14348/molcells.2018.0209

    Figure Lengend Snippet: DNA sequence of genomic TNFSF9 gene edited by CRISPR-Cas9 The TNFSF9 genes in genomic DNAs from wild type and mutated HepG2 cells were amplified by PCR. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the genomic TNFSF9 sequence. On the right are shown the DNA sequences around the region of the mutated triplet in the wildtype and mutant clones. This is one representative of five independent experiments.

    Article Snippet: Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression).

    Techniques: Sequencing, CRISPR, Amplification, Polymerase Chain Reaction, Isolation, Mutagenesis, Clone Assay

    Heteroduplex formation by the cDNA of de novo transcripts of TNFSF9 from HepG2 clone 9-1 Total RNA and EU-labeled RNAs were isolated from clone 9-1 HepG2 cells. cDNA was synthesized and the TNFSF9 cDNA was amplified by PCR as described in “Materials and Methods”. The PCR products were annealed and incubated in the presence or absence of T7E1 endonuclease, and the products were fractionated on 1.2% agarose gels and visualized under UV. This is one representative of three independent experiments.

    Journal: Molecules and Cells

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript

    doi: 10.14348/molcells.2018.0209

    Figure Lengend Snippet: Heteroduplex formation by the cDNA of de novo transcripts of TNFSF9 from HepG2 clone 9-1 Total RNA and EU-labeled RNAs were isolated from clone 9-1 HepG2 cells. cDNA was synthesized and the TNFSF9 cDNA was amplified by PCR as described in “Materials and Methods”. The PCR products were annealed and incubated in the presence or absence of T7E1 endonuclease, and the products were fractionated on 1.2% agarose gels and visualized under UV. This is one representative of three independent experiments.

    Article Snippet: Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression).

    Techniques: Labeling, Isolation, Synthesized, Amplification, Polymerase Chain Reaction, Incubation

    cDNA sequence of mRNA transcribed from mutant genomic TNFSF9 TNFSF9 cDNA was synthesized and amplified by PCR from total RNA extracted from wild type and mutated HepG2 cells. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the TNFSF9 cDNA sequences. On the right are shown the cDNA sequences around the region of the mutated triplet in the wild type and mutant clones. This is one representative of four independent experiments.

    Journal: Molecules and Cells

    Article Title: Editing of Genomic TNFSF9 by CRISPR-Cas9 Can Be Followed by Re-Editing of Its Transcript

    doi: 10.14348/molcells.2018.0209

    Figure Lengend Snippet: cDNA sequence of mRNA transcribed from mutant genomic TNFSF9 TNFSF9 cDNA was synthesized and amplified by PCR from total RNA extracted from wild type and mutated HepG2 cells. The PCR products were isolated and sequenced as described in “Materials and Methods”. Left panels are chromatograms of the TNFSF9 cDNA sequences. On the right are shown the cDNA sequences around the region of the mutated triplet in the wild type and mutant clones. This is one representative of four independent experiments.

    Article Snippet: Real-Time PCR amplification of TNFSF9 cDNA Real-time PCR analysis (MiniOpticon, Bio Rad, USA) was performed using PCR Master Mix (Takara SYBR® PreMix Ex Taq II) to quantify expression of TNFSF9 mRNA (normalized to β-actin expression).

    Techniques: Sequencing, Mutagenesis, Synthesized, Amplification, Polymerase Chain Reaction, Isolation, Clone Assay

    Effects of TGF-β1 on cell morphology, E-cadherin expression, and changes in N -glycans in GE11 cells. GE11 cells were grown in 6-well (2 × 10 5 ) or bottom dishes (2 × 10 4 ) for 24 h and then replaced with fresh complete medium with or without TGF-β1 (5 ng/ml) for another 4 days of incubation. A, cell morphology of the indicated cells was photographed. Photographs were taken of living cells using a ×10 objective. Scale bar, 100 μm. B, E-cadherin expressed on the cell surface was stained with anti-E-cadherin primary antibody, followed by incubation with Alexa Fluor-conjugated secondary antibody. Scale bar, 25 μm. C, total expression levels of E-cadherin were analyzed using Western blotting. Cell lysates from those cells were immunoblotted with anti-E-cadherin antibody. D, equal amounts of cell lysate proteins (20 μg) were used as the enzymatic source for the examination of GnT-III activities. S, substrate; P, product. E, mRNA expression of GnT-III . Quantitative RT-PCR was performed by monitoring in real time the increase in fluorescence of the SYBR Green dye on an ABI StepOnePlus. The mean number of cycles to the threshold ( CT ) of fluorescence detection was calculated for each sample, and the results were normalized to the mean CT of GAPDH for each sample tested. The changes in N -glycans were detected by E4-PHA ( F ) and concanavalin A ( ConA ) ( G ) lectin blot. α-Tubulin was used as a load control. H, N -glycans of GE11 cells cultured under normal conditions and treated with ( bottom ) or without ( top ) TGF-β for 4 days were released with peptide: N -glycosidase F ( PNGaseF ), as described under “Experimental Procedures,” digested with sialidase, and subjected to reversed-phase HPLC. The elution times for those PA-bisected N -glycans were compared with standard PA- N -glycans.

    Journal: The Journal of Biological Chemistry

    Article Title: Roles of N-Acetylglucosaminyltransferase III in Epithelial-to-Mesenchymal Transition Induced by Transforming Growth Factor ?1 (TGF-?1) in Epithelial Cell Lines *

    doi: 10.1074/jbc.M111.262154

    Figure Lengend Snippet: Effects of TGF-β1 on cell morphology, E-cadherin expression, and changes in N -glycans in GE11 cells. GE11 cells were grown in 6-well (2 × 10 5 ) or bottom dishes (2 × 10 4 ) for 24 h and then replaced with fresh complete medium with or without TGF-β1 (5 ng/ml) for another 4 days of incubation. A, cell morphology of the indicated cells was photographed. Photographs were taken of living cells using a ×10 objective. Scale bar, 100 μm. B, E-cadherin expressed on the cell surface was stained with anti-E-cadherin primary antibody, followed by incubation with Alexa Fluor-conjugated secondary antibody. Scale bar, 25 μm. C, total expression levels of E-cadherin were analyzed using Western blotting. Cell lysates from those cells were immunoblotted with anti-E-cadherin antibody. D, equal amounts of cell lysate proteins (20 μg) were used as the enzymatic source for the examination of GnT-III activities. S, substrate; P, product. E, mRNA expression of GnT-III . Quantitative RT-PCR was performed by monitoring in real time the increase in fluorescence of the SYBR Green dye on an ABI StepOnePlus. The mean number of cycles to the threshold ( CT ) of fluorescence detection was calculated for each sample, and the results were normalized to the mean CT of GAPDH for each sample tested. The changes in N -glycans were detected by E4-PHA ( F ) and concanavalin A ( ConA ) ( G ) lectin blot. α-Tubulin was used as a load control. H, N -glycans of GE11 cells cultured under normal conditions and treated with ( bottom ) or without ( top ) TGF-β for 4 days were released with peptide: N -glycosidase F ( PNGaseF ), as described under “Experimental Procedures,” digested with sialidase, and subjected to reversed-phase HPLC. The elution times for those PA-bisected N -glycans were compared with standard PA- N -glycans.

    Article Snippet: Real time PCR was performed with a StepOnePlus real time PCR system (Applied Biosystems, Inc., Foster City, CA) using SYBR® Premix Ex TaqTM II PCR master mixes (Takara, Japan).

    Techniques: Expressing, Incubation, Staining, Western Blot, Quantitative RT-PCR, Fluorescence, SYBR Green Assay, Cell Culture, High Performance Liquid Chromatography

    Expression levels of miR-192, -194 and -215 in three colorectal cancer (CRC) cell lines (HT-29, HCT-116 and SW-620). Quantification of miRNAs was measured by SYBR Premix Ex Taq II. Data are presented in CRC cell lines relative to normal colorectal tissues

    Journal: Experimental and Therapeutic Medicine

    Article Title: microRNA-192, -194 and -215 are frequently downregulated in colorectal cancer

    doi: 10.3892/etm.2011.436

    Figure Lengend Snippet: Expression levels of miR-192, -194 and -215 in three colorectal cancer (CRC) cell lines (HT-29, HCT-116 and SW-620). Quantification of miRNAs was measured by SYBR Premix Ex Taq II. Data are presented in CRC cell lines relative to normal colorectal tissues

    Article Snippet: According to the manufacturer's instructions, real-time PCR was performed using the SYBR Premix Ex Taq™ II kit (Takara Bio, Kyoto, Japan) with a Rotor-gene 6000 system (Qiagen, Valencia, CA, USA) ( ).

    Techniques: Expressing

    Expression levels of miR-192, -194 and -215 in 107 patients with colorectal cancer (CRC). (A, C and E) Quantification of miRNAs was measured by SYBR Premix Ex Taq II. Each sample was analyzed in triplicate and repeated three times. Data are presented

    Journal: Experimental and Therapeutic Medicine

    Article Title: microRNA-192, -194 and -215 are frequently downregulated in colorectal cancer

    doi: 10.3892/etm.2011.436

    Figure Lengend Snippet: Expression levels of miR-192, -194 and -215 in 107 patients with colorectal cancer (CRC). (A, C and E) Quantification of miRNAs was measured by SYBR Premix Ex Taq II. Each sample was analyzed in triplicate and repeated three times. Data are presented

    Article Snippet: According to the manufacturer's instructions, real-time PCR was performed using the SYBR Premix Ex Taq™ II kit (Takara Bio, Kyoto, Japan) with a Rotor-gene 6000 system (Qiagen, Valencia, CA, USA) ( ).

    Techniques: Expressing

    Quantitative analysis of NOX2 and NOX4 mRNA expression in human OS cell lines. Quantitative analysis of the mRNA expression of NOX family proteins in five human OS cell lines was performed by RT-qPCR using a SYBR Green reagent. The Cq value during the exponential phase of amplification was determined by the real-time monitoring of the fluorescent emission of Taq polymerase nuclease activity. β- actin was used as an internal control for normalization. qPCR efficiencies of the target ( NOX2 and NOX4 ) and control (β-actin) proteins were approximately equal over a concentration range of 0.1–200 ng total cDNA. The relative transcripts were determined by the formula: 1/2 (Cq target-Cq control) ). The bars represent the mean (n=2). OS, osteosarcoma; NOX, NADPH oxidase; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; Cq, quantification cycle; PBMCs, peripheral blood mononuclear cells.

    Journal: Oncology Letters

    Article Title: Inhibition of NADPH oxidase 2 induces apoptosis in osteosarcoma: The role of reactive oxygen species in cell proliferation

    doi: 10.3892/ol.2018.8291

    Figure Lengend Snippet: Quantitative analysis of NOX2 and NOX4 mRNA expression in human OS cell lines. Quantitative analysis of the mRNA expression of NOX family proteins in five human OS cell lines was performed by RT-qPCR using a SYBR Green reagent. The Cq value during the exponential phase of amplification was determined by the real-time monitoring of the fluorescent emission of Taq polymerase nuclease activity. β- actin was used as an internal control for normalization. qPCR efficiencies of the target ( NOX2 and NOX4 ) and control (β-actin) proteins were approximately equal over a concentration range of 0.1–200 ng total cDNA. The relative transcripts were determined by the formula: 1/2 (Cq target-Cq control) ). The bars represent the mean (n=2). OS, osteosarcoma; NOX, NADPH oxidase; RT-qPCR, reverse transcription-quantitative polymerase chain reaction; Cq, quantification cycle; PBMCs, peripheral blood mononuclear cells.

    Article Snippet: RT-qPCR was performed with SYBR Premix Ex Taq II (Takara Bio, Inc., Otsu, Shiga, Japan) in an ABI PRISM 7500 Sequence Detection system (Applied Biosystems; Thermo Fisher Scientific, Inc.).

    Techniques: Expressing, Quantitative RT-PCR, SYBR Green Assay, Amplification, Activity Assay, Real-time Polymerase Chain Reaction, Concentration Assay