superscriptii  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher superscriptii
    Superscriptii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 106 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscriptii/product/Thermo Fisher
    Average 99 stars, based on 106 article reviews
    Price from $9.99 to $1999.99
    superscriptii - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Complement component 1q subcomponent binding protein in the brain of the rat
    Article Snippet: The concentration of RNA was adjusted to 2 µg/µl, and it was treated with Amplification Grade DNase I (Invitrogen). .. Then, cDNA was synthesized using SuperscriptII (Invitrogen) as suggested in the kit protocol.

    Article Title: NLRP3 in Somatic Non-Immune Cells of Rodent and Primate Testes
    Article Snippet: SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers were used for reverse transcription of human and monkey RNA. .. RNA was treated with deoxyribonuclease I (DNase I Amplification Grade Kit, Invitrogen Life Technologies, Paisley, UK) and RT-PCR was carried out using the SensiFAST cDNA Synthesis Kit (Bioline, Bioline reagents Ltd., London, UK).

    Article Title: Circular RNA differential expression in blood cell populations and exploration of circRNA deregulation in pediatric acute lymphoblastic leukemia
    Article Snippet: Reverse Transcription was performed from 500 ng RNA with SuperScriptII (Thermo Fisher Scientific), with random primers (Thermo Fisher Scientific). .. Divergent primers (Supplementary Table ) for selective amplification of circRNAs were designed with Primer3 v. 0.4.0 , .

    Article Title: Analysis of translation using polysome profiling
    Article Snippet: Equal RNA volumes (5 μl) of each polysome gradient fraction were used for reverse transcription using random primers following the protocol recommended by the manufacturer (SuperScriptII, Invitrogen). .. Semi-quantitative polymerase chain reaction (PCR) was then performed using specific primers, diluting the cDNA in RNase-free water (1 volume RT products:300 volume H2 O) for the PCR reaction using the GoTaq Flexi kit (Promega), so that amplification was in the linear range for 30 cycles of amplification ( ).

    Article Title: Transcriptome profiles in peripheral white blood cells at the time of artificial insemination discriminate beef heifers with different fertility potential
    Article Snippet: Reverse transcription was carried out with SuperScriptII (Invitrogen, Carlsbad, CA) following manufacturer’s recommendations. .. The reactions were assayed in a Roche Light Cycler 480 equipment (Roche) equipment with pre-incubation at 95 °C for 1 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 45 s. A melting curve was generated using the thermocycler’s default parameters to validate the presence of a unique amplicon.

    Article Title: ATP-mediated Events in Peritubular Cells Contribute to Sterile Testicular Inflammation
    Article Snippet: Reverse transcription of 200 ng or 1 µg RNA was performed utilizing SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers. .. For qPCR studies the QuantiFast SYBR Green PCR Kit (Qiagen, Hilden, Germany) was applied using the primers depicted in Table (designed using Primer3, http://primer3.wi.mit.edu , final concentration 300–900 nM) for amplification.

    Article Title: Identification of IFN-?-producing innate B cells
    Article Snippet: For retrotranscription, 1 μg of total RNA was used to synthesize cDNA with an oligo(dT)18 primer and 200 units of SuperScriptII (Gibco BRL, Rockville, MD, USA). .. The cDNA was amplified in a final volume of 20 μl containing 2.5 mM magnesium dichloride, 1.25 units Ex Taq polymerase (Takara, Dalian, China), and 1 μl specific primers.

    Article Title: Genome-Wide Profiling of Cap-Independent Translation Enhancing Elements in the Human Genome
    Article Snippet: The library was amplified using the forward primer (5' TTCTAATACGACTCACTATAGGGGGATCCAAGCTTCAGACGTGCCTCACTACG) and reverse primer (5' ATAGCCGGTGTCCACTTCCATGATGATGGTGATGGTGGGCCATG GCTGAGCTTGACGCTTTGC). .. The mRNA-peptide fusion molecules were purified from the crude lysate using oligo (dT)-cellulose beads (NEB) and reverse transcribed with SuperScriptII (Invitrogen) by extending the DNA primer (5' TTTTTTTTTTTTTTTATCC ACTTCCATGATGATGGT) with dNTPs.

    Article Title: RNA sequencing analysis revealed the induction of CCL3 expression in human intracranial aneurysms
    Article Snippet: In brief, after purification of polyA+ RNA from total RNA samples, the RNA was transcribed into cDNA using a SuperScriptIII instead of SuperScriptII (Thermo Fisher Scientific Inc., Waltham, MA). .. After purification with an AMpure XP (Beckman Coulter), the amount of the adapter-ligated DNA was then quantified by quantitative PCR analysis using KAPA Library Preparation Kits with a Real-Time Amp (Kapa Biosystems Inc., Woburn, MA) to estimate the optimal PCR cycle number for library amplification.

    Synthesized:

    Article Title: Complement component 1q subcomponent binding protein in the brain of the rat
    Article Snippet: .. Then, cDNA was synthesized using SuperscriptII (Invitrogen) as suggested in the kit protocol. .. The cDNA was subsequently diluted (10x), and 2.5 µl of the resulting cDNA was used as template in PCR reactions iTaq DNA polymerase (Bio-Rad Laboratories, Hercules, CA, USA).

    Article Title: Salicylic acid modulates arsenic toxicity by reducing its root to shoot translocation in rice (Oryza sativa L.)
    Article Snippet: Gene Expression Analysis Using Quantitative RT-PCR Approximately 5 μg, RNase free DNase-treated, total RNA isolated from roots of rice plants was reverse-transcribed using SuperScriptII (Fermentas, USA), following the manufacturer’s recommendation. .. The synthesized cDNA was diluted 1:5 in DEPC water and subjected to quantitative RT-PCR (qRT-PCR) analysis.

    Article Title: Transcriptome profiles in peripheral white blood cells at the time of artificial insemination discriminate beef heifers with different fertility potential
    Article Snippet: We synthesized complementary DNA from 500 ng of total RNA and using oligodT15 (Promega, Madison, WI). .. Reverse transcription was carried out with SuperScriptII (Invitrogen, Carlsbad, CA) following manufacturer’s recommendations.

    TA Cloning:

    Article Title: Complement component 1q subcomponent binding protein in the brain of the rat
    Article Snippet: Then, cDNA was synthesized using SuperscriptII (Invitrogen) as suggested in the kit protocol. .. The PCR products were purified from gel, inserted into TOPO TA cloning vectors (Life Technologies) and transformed chemically into competent bacteria.

    Quantitative RT-PCR:

    Article Title: Salicylic acid modulates arsenic toxicity by reducing its root to shoot translocation in rice (Oryza sativa L.)
    Article Snippet: .. Gene Expression Analysis Using Quantitative RT-PCR Approximately 5 μg, RNase free DNase-treated, total RNA isolated from roots of rice plants was reverse-transcribed using SuperScriptII (Fermentas, USA), following the manufacturer’s recommendation. .. The synthesized cDNA was diluted 1:5 in DEPC water and subjected to quantitative RT-PCR (qRT-PCR) analysis.

    Article Title: Circular RNA differential expression in blood cell populations and exploration of circRNA deregulation in pediatric acute lymphoblastic leukemia
    Article Snippet: Reverse Transcription was performed from 500 ng RNA with SuperScriptII (Thermo Fisher Scientific), with random primers (Thermo Fisher Scientific). .. Initial denaturation: 95 °C for 15 min; 35 cycles: 95 °C for 30 sec, 54–60 °C for 30 sec, 72 °C for 30 sec; final extension: 72 °C for 10 min. Sanger Sequencing was performed on PCR products after cleaning with Wizard® SV Gel and PCR Clean-Up System (Promega), by Eurofins Genomics. qRT-PCR was performed with technical triplicates with SsoAdvanced Universal SYBR Green Supermix (BioRad) in 10 µl per well, from 5 ng cDNA, 500 nM primers.

    Article Title: Translation repression via modulation of the cytoplasmic poly(A)-binding protein in the inflammatory response
    Article Snippet: Paragraph title: RNA isolation and quantitative RT-PCR ... Reverse transcription was performed using the SuperscriptII (Invitrogen, Waltham, MA) and random hexamers.

    Article Title: Transcriptome profiles in peripheral white blood cells at the time of artificial insemination discriminate beef heifers with different fertility potential
    Article Snippet: Validation of DEGs We used RNA extracted from the PWBC of the 23 heifers from station A and B whose PWBC transcriptome was evaluated though RNA sequencing to confirm the DEGs by RT-qPCR. .. Reverse transcription was carried out with SuperScriptII (Invitrogen, Carlsbad, CA) following manufacturer’s recommendations.

    Real-time Polymerase Chain Reaction:

    Article Title: Maintenance of the bladder cancer precursor urothelial hyperplasia requires FOXA1 and persistent expression of oncogenic HRAS
    Article Snippet: RNA Extraction, Reverse Transcription, and Quantitative Real Time PCR (Q-RT-PCR). .. Reverse transcription was conducted for 1 ug RNA/per sample using SuperScriptII (Thermo Fisher Scientific).

    Article Title: NLRP3 in Somatic Non-Immune Cells of Rodent and Primate Testes
    Article Snippet: Paragraph title: Reverse transcription PCR / Quantitative PCR ... SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers were used for reverse transcription of human and monkey RNA.

    Article Title: Salicylic acid modulates arsenic toxicity by reducing its root to shoot translocation in rice (Oryza sativa L.)
    Article Snippet: Gene Expression Analysis Using Quantitative RT-PCR Approximately 5 μg, RNase free DNase-treated, total RNA isolated from roots of rice plants was reverse-transcribed using SuperScriptII (Fermentas, USA), following the manufacturer’s recommendation. .. Each qPCR reaction contained 5 μl of SYBR Green Supermix (ABI Biosystems, USA), 1 μl of the diluted cDNA reaction mixture (corresponding to 5 ng of starting amount of RNA) and 10 pM of each primer in a total reaction volume of 10 μl.

    Article Title: Neonatal Hyperglycemia Inhibits Angiogenesis and Induces Inflammation and Neuronal Degeneration in the Retina
    Article Snippet: Paragraph title: Reverse Transcription and Real-Time Polymerase Chain Reaction ... Retrotranscription was performed using superscriptII (Invitrogen, Cergy-Pointoise, France).

    Article Title: Translation repression via modulation of the cytoplasmic poly(A)-binding protein in the inflammatory response
    Article Snippet: Reverse transcription was performed using the SuperscriptII (Invitrogen, Waltham, MA) and random hexamers. .. Quantitative PCR was performed using the 2 X SYBR Green qPCR Master Mix (BioRad, Hercules, CA) on a Bio-Rad CFX Real-Time PCR Detection System.

    Article Title: ATP-mediated Events in Peritubular Cells Contribute to Sterile Testicular Inflammation
    Article Snippet: Paragraph title: RT-PCR and qPCR ... Reverse transcription of 200 ng or 1 µg RNA was performed utilizing SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers.

    Article Title: RNA sequencing analysis revealed the induction of CCL3 expression in human intracranial aneurysms
    Article Snippet: In brief, after purification of polyA+ RNA from total RNA samples, the RNA was transcribed into cDNA using a SuperScriptIII instead of SuperScriptII (Thermo Fisher Scientific Inc., Waltham, MA). .. After purification with an AMpure XP (Beckman Coulter), the amount of the adapter-ligated DNA was then quantified by quantitative PCR analysis using KAPA Library Preparation Kits with a Real-Time Amp (Kapa Biosystems Inc., Woburn, MA) to estimate the optimal PCR cycle number for library amplification.

    Article Title: Heterologous expression of Ceratophyllum demersum phytochelatin synthase, CdPCS1, in rice leads to lower arsenic accumulation in grain
    Article Snippet: Approximately, 5 μg RNase free DNase treated total RNA isolated from root and shoot of rice was reverse-transcribed using SuperScriptII (Fermentas, USA), following the manufacturer's recommendation. .. Real Time PCR was performed in 25 μl reaction volume using CdPCS1 specific primers (CdPCS1RTF,TGCTCGATTCAAGTATCCTCCACA; CdPCS1RTR, CTTGCCGTTCTCAGTACATCTTC) using Power SYBR Green PCR Master Mix (ABI, USA) and Fast Real Time PCR System (Model 7500; ABI, USA).

    Incubation:

    Article Title: Maintenance of the bladder cancer precursor urothelial hyperplasia requires FOXA1 and persistent expression of oncogenic HRAS
    Article Snippet: After incubation with secondary antibodies, membranes underwent five 5-minute TBST washes. .. Reverse transcription was conducted for 1 ug RNA/per sample using SuperScriptII (Thermo Fisher Scientific).

    Article Title: Genome-Wide Profiling of Cap-Independent Translation Enhancing Elements in the Human Genome
    Article Snippet: The mixture was then incubated overnight at −20°C in the presence of KCl (600 mM) and MgCl2 (75 mM) to promote fusion formation. .. The mRNA-peptide fusion molecules were purified from the crude lysate using oligo (dT)-cellulose beads (NEB) and reverse transcribed with SuperScriptII (Invitrogen) by extending the DNA primer (5' TTTTTTTTTTTTTTTATCC ACTTCCATGATGATGGT) with dNTPs.

    Formalin-fixed Paraffin-Embedded:

    Article Title: NLRP3 in Somatic Non-Immune Cells of Rodent and Primate Testes
    Article Snippet: RNA from whole human and monkey testis samples was isolated via the RNeasy FFPE Kit (Qiagen, Hilden, Germany). .. SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers were used for reverse transcription of human and monkey RNA.

    Expressing:

    Article Title: Salicylic acid modulates arsenic toxicity by reducing its root to shoot translocation in rice (Oryza sativa L.)
    Article Snippet: .. Gene Expression Analysis Using Quantitative RT-PCR Approximately 5 μg, RNase free DNase-treated, total RNA isolated from roots of rice plants was reverse-transcribed using SuperScriptII (Fermentas, USA), following the manufacturer’s recommendation. .. The synthesized cDNA was diluted 1:5 in DEPC water and subjected to quantitative RT-PCR (qRT-PCR) analysis.

    Article Title: Identification of IFN-?-producing innate B cells
    Article Snippet: Paragraph title: RT-PCR analysis of CD16/CD32 expression ... For retrotranscription, 1 μg of total RNA was used to synthesize cDNA with an oligo(dT)18 primer and 200 units of SuperScriptII (Gibco BRL, Rockville, MD, USA).

    Article Title: Heterologous expression of Ceratophyllum demersum phytochelatin synthase, CdPCS1, in rice leads to lower arsenic accumulation in grain
    Article Snippet: Approximately, 5 μg RNase free DNase treated total RNA isolated from root and shoot of rice was reverse-transcribed using SuperScriptII (Fermentas, USA), following the manufacturer's recommendation. .. Oligonucleotide primers for rice actin gene (F, GAGTATGATGAGTCGGGTCCAG; R-ACACCAACACCAACAATCCCAAACAGAG) were used to calculate the relative expression of the gene in independent lines.

    Western Blot:

    Article Title: Maintenance of the bladder cancer precursor urothelial hyperplasia requires FOXA1 and persistent expression of oncogenic HRAS
    Article Snippet: Paragraph title: Western blotting ... Reverse transcription was conducted for 1 ug RNA/per sample using SuperScriptII (Thermo Fisher Scientific).

    Transformation Assay:

    Article Title: Complement component 1q subcomponent binding protein in the brain of the rat
    Article Snippet: Then, cDNA was synthesized using SuperscriptII (Invitrogen) as suggested in the kit protocol. .. The PCR products were purified from gel, inserted into TOPO TA cloning vectors (Life Technologies) and transformed chemically into competent bacteria.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Complement component 1q subcomponent binding protein in the brain of the rat
    Article Snippet: First, RT-PCR was carried out using total RNA isolated from frozen rat brain. .. Then, cDNA was synthesized using SuperscriptII (Invitrogen) as suggested in the kit protocol.

    Article Title: NLRP3 in Somatic Non-Immune Cells of Rodent and Primate Testes
    Article Snippet: SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers were used for reverse transcription of human and monkey RNA. .. RNA was treated with deoxyribonuclease I (DNase I Amplification Grade Kit, Invitrogen Life Technologies, Paisley, UK) and RT-PCR was carried out using the SensiFAST cDNA Synthesis Kit (Bioline, Bioline reagents Ltd., London, UK).

    Article Title: Circular RNA differential expression in blood cell populations and exploration of circRNA deregulation in pediatric acute lymphoblastic leukemia
    Article Snippet: Reverse Transcription was performed from 500 ng RNA with SuperScriptII (Thermo Fisher Scientific), with random primers (Thermo Fisher Scientific). .. RT-PCR was performed from 12.5 ng cDNA with Taq DNA Polymerase (Qiagen) with the following protocol.

    Article Title: ATP-mediated Events in Peritubular Cells Contribute to Sterile Testicular Inflammation
    Article Snippet: Paragraph title: RT-PCR and qPCR ... Reverse transcription of 200 ng or 1 µg RNA was performed utilizing SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers.

    Article Title: Identification of IFN-?-producing innate B cells
    Article Snippet: Paragraph title: RT-PCR analysis of CD16/CD32 expression ... For retrotranscription, 1 μg of total RNA was used to synthesize cDNA with an oligo(dT)18 primer and 200 units of SuperScriptII (Gibco BRL, Rockville, MD, USA).

    Generated:

    Article Title: Transcriptome profiles in peripheral white blood cells at the time of artificial insemination discriminate beef heifers with different fertility potential
    Article Snippet: Reverse transcription was carried out with SuperScriptII (Invitrogen, Carlsbad, CA) following manufacturer’s recommendations. .. The reactions were assayed in a Roche Light Cycler 480 equipment (Roche) equipment with pre-incubation at 95 °C for 1 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 45 s. A melting curve was generated using the thermocycler’s default parameters to validate the presence of a unique amplicon.

    Negative Control:

    Article Title: Analysis of translation using polysome profiling
    Article Snippet: We also used eIF4A as a negative control, eIF4A being a maternal mRNA that has been shown to remain untranslated shortly after fertilization in mouse ( ). .. Equal RNA volumes (5 μl) of each polysome gradient fraction were used for reverse transcription using random primers following the protocol recommended by the manufacturer (SuperScriptII, Invitrogen).

    Polymerase Chain Reaction:

    Article Title: Complement component 1q subcomponent binding protein in the brain of the rat
    Article Snippet: Then, cDNA was synthesized using SuperscriptII (Invitrogen) as suggested in the kit protocol. .. The cDNA was subsequently diluted (10x), and 2.5 µl of the resulting cDNA was used as template in PCR reactions iTaq DNA polymerase (Bio-Rad Laboratories, Hercules, CA, USA).

    Article Title: NLRP3 in Somatic Non-Immune Cells of Rodent and Primate Testes
    Article Snippet: Paragraph title: Reverse transcription PCR / Quantitative PCR ... SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers were used for reverse transcription of human and monkey RNA.

    Article Title: Circular RNA differential expression in blood cell populations and exploration of circRNA deregulation in pediatric acute lymphoblastic leukemia
    Article Snippet: Reverse Transcription was performed from 500 ng RNA with SuperScriptII (Thermo Fisher Scientific), with random primers (Thermo Fisher Scientific). .. Initial denaturation: 95 °C for 15 min; 35 cycles: 95 °C for 30 sec, 54–60 °C for 30 sec, 72 °C for 30 sec; final extension: 72 °C for 10 min. Sanger Sequencing was performed on PCR products after cleaning with Wizard® SV Gel and PCR Clean-Up System (Promega), by Eurofins Genomics. qRT-PCR was performed with technical triplicates with SsoAdvanced Universal SYBR Green Supermix (BioRad) in 10 µl per well, from 5 ng cDNA, 500 nM primers.

    Article Title: Analysis of translation using polysome profiling
    Article Snippet: Equal RNA volumes (5 μl) of each polysome gradient fraction were used for reverse transcription using random primers following the protocol recommended by the manufacturer (SuperScriptII, Invitrogen). .. Semi-quantitative polymerase chain reaction (PCR) was then performed using specific primers, diluting the cDNA in RNase-free water (1 volume RT products:300 volume H2 O) for the PCR reaction using the GoTaq Flexi kit (Promega), so that amplification was in the linear range for 30 cycles of amplification ( ).

    Article Title: Neonatal Hyperglycemia Inhibits Angiogenesis and Induces Inflammation and Neuronal Degeneration in the Retina
    Article Snippet: Retrotranscription was performed using superscriptII (Invitrogen, Cergy-Pointoise, France). .. Real-time PCR was performed using 7300 Real-Time PCR System (Applied Biosystems, Cergy-Pointoise, France) in a 20 µl final volume with Power SYBR Green PCR Master Mix (Applied Biosystems, Cergy-Pointoise, France) and 0.25 µM primers.

    Article Title: Transcriptome profiles in peripheral white blood cells at the time of artificial insemination discriminate beef heifers with different fertility potential
    Article Snippet: Reverse transcription was carried out with SuperScriptII (Invitrogen, Carlsbad, CA) following manufacturer’s recommendations. .. The final RT reaction was diluted 1:2 (v:v) and 1μl was used as template for each PCR reaction using Perfecta SYBR Green FastMix (Quanta Biosciences), and 100 nM of each primer (Additional file : Table S3, IDT) in a final volume of 10μl.

    Article Title: ATP-mediated Events in Peritubular Cells Contribute to Sterile Testicular Inflammation
    Article Snippet: Reverse transcription of 200 ng or 1 µg RNA was performed utilizing SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers. .. For qPCR studies the QuantiFast SYBR Green PCR Kit (Qiagen, Hilden, Germany) was applied using the primers depicted in Table (designed using Primer3, http://primer3.wi.mit.edu , final concentration 300–900 nM) for amplification.

    Article Title: Identification of IFN-?-producing innate B cells
    Article Snippet: For retrotranscription, 1 μg of total RNA was used to synthesize cDNA with an oligo(dT)18 primer and 200 units of SuperScriptII (Gibco BRL, Rockville, MD, USA). .. All the PCR products were analyzed by 1.5% agarose gel electrophoresis and visualized by staining the gel with ethidium bromide.

    Article Title: Genome-Wide Profiling of Cap-Independent Translation Enhancing Elements in the Human Genome
    Article Snippet: The mRNA-peptide fusion molecules were purified from the crude lysate using oligo (dT)-cellulose beads (NEB) and reverse transcribed with SuperScriptII (Invitrogen) by extending the DNA primer (5' TTTTTTTTTTTTTTTATCC ACTTCCATGATGATGGT) with dNTPs. .. Functional sequences were recovered by eluting the column with 500 mM imidazole, dialyzing the sample into water, and amplifying the cDNA by PCR using previously described overlap PCR primers to add back the necessary sequences for mRNA display.

    Article Title: RNA sequencing analysis revealed the induction of CCL3 expression in human intracranial aneurysms
    Article Snippet: In brief, after purification of polyA+ RNA from total RNA samples, the RNA was transcribed into cDNA using a SuperScriptIII instead of SuperScriptII (Thermo Fisher Scientific Inc., Waltham, MA). .. After purification with an AMpure XP (Beckman Coulter), the amount of the adapter-ligated DNA was then quantified by quantitative PCR analysis using KAPA Library Preparation Kits with a Real-Time Amp (Kapa Biosystems Inc., Woburn, MA) to estimate the optimal PCR cycle number for library amplification.

    Article Title: Heterologous expression of Ceratophyllum demersum phytochelatin synthase, CdPCS1, in rice leads to lower arsenic accumulation in grain
    Article Snippet: Molecular analysis of transgenic lines PCR analysis was used to confirm presence of the CdPCS1 transgene in T4 generation. .. Approximately, 5 μg RNase free DNase treated total RNA isolated from root and shoot of rice was reverse-transcribed using SuperScriptII (Fermentas, USA), following the manufacturer's recommendation.

    RNA Sequencing Assay:

    Article Title: Transcriptome profiles in peripheral white blood cells at the time of artificial insemination discriminate beef heifers with different fertility potential
    Article Snippet: Validation of DEGs We used RNA extracted from the PWBC of the 23 heifers from station A and B whose PWBC transcriptome was evaluated though RNA sequencing to confirm the DEGs by RT-qPCR. .. Reverse transcription was carried out with SuperScriptII (Invitrogen, Carlsbad, CA) following manufacturer’s recommendations.

    Article Title: RNA sequencing analysis revealed the induction of CCL3 expression in human intracranial aneurysms
    Article Snippet: Paragraph title: RNA sequencing analysis of human specimen ... In brief, after purification of polyA+ RNA from total RNA samples, the RNA was transcribed into cDNA using a SuperScriptIII instead of SuperScriptII (Thermo Fisher Scientific Inc., Waltham, MA).

    Isolation:

    Article Title: Complement component 1q subcomponent binding protein in the brain of the rat
    Article Snippet: First, RT-PCR was carried out using total RNA isolated from frozen rat brain. .. Then, cDNA was synthesized using SuperscriptII (Invitrogen) as suggested in the kit protocol.

    Article Title: NLRP3 in Somatic Non-Immune Cells of Rodent and Primate Testes
    Article Snippet: RNA from whole human and monkey testis samples was isolated via the RNeasy FFPE Kit (Qiagen, Hilden, Germany). .. SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers were used for reverse transcription of human and monkey RNA.

    Article Title: Salicylic acid modulates arsenic toxicity by reducing its root to shoot translocation in rice (Oryza sativa L.)
    Article Snippet: .. Gene Expression Analysis Using Quantitative RT-PCR Approximately 5 μg, RNase free DNase-treated, total RNA isolated from roots of rice plants was reverse-transcribed using SuperScriptII (Fermentas, USA), following the manufacturer’s recommendation. .. The synthesized cDNA was diluted 1:5 in DEPC water and subjected to quantitative RT-PCR (qRT-PCR) analysis.

    Article Title: Circular RNA differential expression in blood cell populations and exploration of circRNA deregulation in pediatric acute lymphoblastic leukemia
    Article Snippet: Total RNA was isolated by TRIzol™ (Thermo Fisher Scientific) extraction, followed by isopropanol precipitation. .. Reverse Transcription was performed from 500 ng RNA with SuperScriptII (Thermo Fisher Scientific), with random primers (Thermo Fisher Scientific).

    Article Title: Translation repression via modulation of the cytoplasmic poly(A)-binding protein in the inflammatory response
    Article Snippet: Paragraph title: RNA isolation and quantitative RT-PCR ... Reverse transcription was performed using the SuperscriptII (Invitrogen, Waltham, MA) and random hexamers.

    Article Title: Identification of IFN-?-producing innate B cells
    Article Snippet: In brief, total RNA was isolated with the TRIzol reagent from 2 × 106 cells following the manufacturer's instructions. .. For retrotranscription, 1 μg of total RNA was used to synthesize cDNA with an oligo(dT)18 primer and 200 units of SuperScriptII (Gibco BRL, Rockville, MD, USA).

    Article Title: Genome-Wide Profiling of Cap-Independent Translation Enhancing Elements in the Human Genome
    Article Snippet: The mRNA-peptide fusion molecules were purified from the crude lysate using oligo (dT)-cellulose beads (NEB) and reverse transcribed with SuperScriptII (Invitrogen) by extending the DNA primer (5' TTTTTTTTTTTTTTTATCC ACTTCCATGATGATGGT) with dNTPs. .. Fusion molecules containing the correctly translated His-6 tag were isolated on Ni-NTA agarose beads (Qiagen).

    Article Title: Heterologous expression of Ceratophyllum demersum phytochelatin synthase, CdPCS1, in rice leads to lower arsenic accumulation in grain
    Article Snippet: .. Approximately, 5 μg RNase free DNase treated total RNA isolated from root and shoot of rice was reverse-transcribed using SuperScriptII (Fermentas, USA), following the manufacturer's recommendation. .. Real Time PCR was performed in 25 μl reaction volume using CdPCS1 specific primers (CdPCS1RTF,TGCTCGATTCAAGTATCCTCCACA; CdPCS1RTR, CTTGCCGTTCTCAGTACATCTTC) using Power SYBR Green PCR Master Mix (ABI, USA) and Fast Real Time PCR System (Model 7500; ABI, USA).

    Size-exclusion Chromatography:

    Article Title: Circular RNA differential expression in blood cell populations and exploration of circRNA deregulation in pediatric acute lymphoblastic leukemia
    Article Snippet: Reverse Transcription was performed from 500 ng RNA with SuperScriptII (Thermo Fisher Scientific), with random primers (Thermo Fisher Scientific). .. Initial denaturation: 95 °C for 15 min; 35 cycles: 95 °C for 30 sec, 54–60 °C for 30 sec, 72 °C for 30 sec; final extension: 72 °C for 10 min. Sanger Sequencing was performed on PCR products after cleaning with Wizard® SV Gel and PCR Clean-Up System (Promega), by Eurofins Genomics. qRT-PCR was performed with technical triplicates with SsoAdvanced Universal SYBR Green Supermix (BioRad) in 10 µl per well, from 5 ng cDNA, 500 nM primers.

    Article Title: ATP-mediated Events in Peritubular Cells Contribute to Sterile Testicular Inflammation
    Article Snippet: Reverse transcription of 200 ng or 1 µg RNA was performed utilizing SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers. .. Samples (final cDNA concentration 2 or 20 ng/reaction) were analysed in duplicates in a LightCycler® 96 System (Roche Diagnostics, Penzberg, Germany) under following conditions: Pre-incubation (95 °C, 5 min), 35–42 cycles of denaturation and annealing/extension (95 °C, 10 sec/annealing temperature see Table , 30 sec) followed by a melting step (continuous heating from 65 °C to 97 °C) and a cool-down (37 °C, 30 sec).

    Labeling:

    Article Title: Genome-Wide Profiling of Cap-Independent Translation Enhancing Elements in the Human Genome
    Article Snippet: The mRNA-peptide fusion molecules were purified from the crude lysate using oligo (dT)-cellulose beads (NEB) and reverse transcribed with SuperScriptII (Invitrogen) by extending the DNA primer (5' TTTTTTTTTTTTTTTATCC ACTTCCATGATGATGGT) with dNTPs. .. The selection progress was monitored by measuring the fraction of S35 -labeled mRNA-peptide fusions that bound to and eluted from the oligo (dT) and Ni-NTA affinity columns.

    Purification:

    Article Title: Complement component 1q subcomponent binding protein in the brain of the rat
    Article Snippet: Then, cDNA was synthesized using SuperscriptII (Invitrogen) as suggested in the kit protocol. .. The PCR products were purified from gel, inserted into TOPO TA cloning vectors (Life Technologies) and transformed chemically into competent bacteria.

    Article Title: Circular RNA differential expression in blood cell populations and exploration of circRNA deregulation in pediatric acute lymphoblastic leukemia
    Article Snippet: PBMC RNA was treated with 4 u RNase R/µg (Epicentre) at 37 °C for 15 min and with 5 µl of DNase I (Zymo Research) at room temperature for 15 min. RNA was then purified with RNA Clean & Concentrator ™ −5 (Zymo Research) and quantified with Nanodrop. .. Reverse Transcription was performed from 500 ng RNA with SuperScriptII (Thermo Fisher Scientific), with random primers (Thermo Fisher Scientific).

    Article Title: Analysis of translation using polysome profiling
    Article Snippet: We validated our polysome purification protocol by checking the distribution pattern of these mRNAs that have been demonstrated to enter polysomes after fertilization. .. Equal RNA volumes (5 μl) of each polysome gradient fraction were used for reverse transcription using random primers following the protocol recommended by the manufacturer (SuperScriptII, Invitrogen).

    Article Title: Genome-Wide Profiling of Cap-Independent Translation Enhancing Elements in the Human Genome
    Article Snippet: .. The mRNA-peptide fusion molecules were purified from the crude lysate using oligo (dT)-cellulose beads (NEB) and reverse transcribed with SuperScriptII (Invitrogen) by extending the DNA primer (5' TTTTTTTTTTTTTTTATCC ACTTCCATGATGATGGT) with dNTPs. .. Fusion molecules containing the correctly translated His-6 tag were isolated on Ni-NTA agarose beads (Qiagen).

    Article Title: RNA sequencing analysis revealed the induction of CCL3 expression in human intracranial aneurysms
    Article Snippet: .. In brief, after purification of polyA+ RNA from total RNA samples, the RNA was transcribed into cDNA using a SuperScriptIII instead of SuperScriptII (Thermo Fisher Scientific Inc., Waltham, MA). ..

    Sequencing:

    Article Title: Complement component 1q subcomponent binding protein in the brain of the rat
    Article Snippet: Then, cDNA was synthesized using SuperscriptII (Invitrogen) as suggested in the kit protocol. .. The rat C1qbp cDNA sequence (NCBI Reference Sequence: NM_019259.2) was PCR amplified using the following primer pairs: A: GGGCCTTGTATGACCACCTA and TGATGTCAAGGCAGCTTTTG, B: TAGCATCCCTCCAACCTTTG and TCCCTCCACTCAGAGTCACC.

    Article Title: Circular RNA differential expression in blood cell populations and exploration of circRNA deregulation in pediatric acute lymphoblastic leukemia
    Article Snippet: Reverse Transcription was performed from 500 ng RNA with SuperScriptII (Thermo Fisher Scientific), with random primers (Thermo Fisher Scientific). .. Initial denaturation: 95 °C for 15 min; 35 cycles: 95 °C for 30 sec, 54–60 °C for 30 sec, 72 °C for 30 sec; final extension: 72 °C for 10 min. Sanger Sequencing was performed on PCR products after cleaning with Wizard® SV Gel and PCR Clean-Up System (Promega), by Eurofins Genomics. qRT-PCR was performed with technical triplicates with SsoAdvanced Universal SYBR Green Supermix (BioRad) in 10 µl per well, from 5 ng cDNA, 500 nM primers.

    Article Title: ATP-mediated Events in Peritubular Cells Contribute to Sterile Testicular Inflammation
    Article Snippet: Reverse transcription of 200 ng or 1 µg RNA was performed utilizing SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers. .. Amplicon identity was confirmed via agarose gel electrophoresis and sequence analysis (GATC, Konstanz, Germany).

    Article Title: RNA sequencing analysis revealed the induction of CCL3 expression in human intracranial aneurysms
    Article Snippet: In brief, after purification of polyA+ RNA from total RNA samples, the RNA was transcribed into cDNA using a SuperScriptIII instead of SuperScriptII (Thermo Fisher Scientific Inc., Waltham, MA). .. After purification with an AMpure XP (Beckman Coulter, Indianapolis, IN), sequencing adapter provided by a Sample Prep kit was ligated to the double stranded DNA.

    RNA Extraction:

    Article Title: Maintenance of the bladder cancer precursor urothelial hyperplasia requires FOXA1 and persistent expression of oncogenic HRAS
    Article Snippet: RNA Extraction, Reverse Transcription, and Quantitative Real Time PCR (Q-RT-PCR). .. Reverse transcription was conducted for 1 ug RNA/per sample using SuperScriptII (Thermo Fisher Scientific).

    Article Title: Translation repression via modulation of the cytoplasmic poly(A)-binding protein in the inflammatory response
    Article Snippet: RNA isolation and quantitative RT-PCR The RiboZol RNA Extraction Reagent (Amresco, Solon, OH) was used for total RNA isolation. .. Reverse transcription was performed using the SuperscriptII (Invitrogen, Waltham, MA) and random hexamers.

    IA:

    Article Title: RNA sequencing analysis revealed the induction of CCL3 expression in human intracranial aneurysms
    Article Snippet: RNA sequencing analysis of human specimen Human IA samples and control arteries (middle meningeal artery or superficial temporal artery) were obtained during neck clipping of unruptured IAs. .. In brief, after purification of polyA+ RNA from total RNA samples, the RNA was transcribed into cDNA using a SuperScriptIII instead of SuperScriptII (Thermo Fisher Scientific Inc., Waltham, MA).

    Agarose Gel Electrophoresis:

    Article Title: ATP-mediated Events in Peritubular Cells Contribute to Sterile Testicular Inflammation
    Article Snippet: Reverse transcription of 200 ng or 1 µg RNA was performed utilizing SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers. .. Amplicon identity was confirmed via agarose gel electrophoresis and sequence analysis (GATC, Konstanz, Germany).

    Article Title: Identification of IFN-?-producing innate B cells
    Article Snippet: For retrotranscription, 1 μg of total RNA was used to synthesize cDNA with an oligo(dT)18 primer and 200 units of SuperScriptII (Gibco BRL, Rockville, MD, USA). .. All the PCR products were analyzed by 1.5% agarose gel electrophoresis and visualized by staining the gel with ethidium bromide.

    In Situ Hybridization:

    Article Title: Complement component 1q subcomponent binding protein in the brain of the rat
    Article Snippet: Paragraph title: Production of in situ hybridization probe for C1qbp ... Then, cDNA was synthesized using SuperscriptII (Invitrogen) as suggested in the kit protocol.

    Software:

    Article Title: Analysis of translation using polysome profiling
    Article Snippet: Equal RNA volumes (5 μl) of each polysome gradient fraction were used for reverse transcription using random primers following the protocol recommended by the manufacturer (SuperScriptII, Invitrogen). .. PCRs were carried out as followed: 95°C for 2 min; followed by 30 cycles of 95°C for 30 s, 60°C for 30 s, 72°C for 1 min and a final extension at 72°C for 5 min. PCR products were analyzed on 2% agarose-TBE gels, scanned on a Typhoon Trio (GE Healthcare Life Sciences) and quantified using ImageJ software.

    SYBR Green Assay:

    Article Title: NLRP3 in Somatic Non-Immune Cells of Rodent and Primate Testes
    Article Snippet: SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers were used for reverse transcription of human and monkey RNA. .. For qPCR studies the QuantiFast SYBR Green PCR Kit (Qiagen, Hilden, Germany) was applied using following protocol in a LightCycler® 96 System (Roche Diagnostics, Penzberg, Germany): Pre-incubation (95°C, 5 min), 40 cycles denaturation (95°C, 10 s) and annealing/extension (60°C, 30 s) followed by melting (65°C to 97°C) and cooling-down (37°C, 30 s).

    Article Title: Salicylic acid modulates arsenic toxicity by reducing its root to shoot translocation in rice (Oryza sativa L.)
    Article Snippet: Gene Expression Analysis Using Quantitative RT-PCR Approximately 5 μg, RNase free DNase-treated, total RNA isolated from roots of rice plants was reverse-transcribed using SuperScriptII (Fermentas, USA), following the manufacturer’s recommendation. .. Each qPCR reaction contained 5 μl of SYBR Green Supermix (ABI Biosystems, USA), 1 μl of the diluted cDNA reaction mixture (corresponding to 5 ng of starting amount of RNA) and 10 pM of each primer in a total reaction volume of 10 μl.

    Article Title: Circular RNA differential expression in blood cell populations and exploration of circRNA deregulation in pediatric acute lymphoblastic leukemia
    Article Snippet: Reverse Transcription was performed from 500 ng RNA with SuperScriptII (Thermo Fisher Scientific), with random primers (Thermo Fisher Scientific). .. Initial denaturation: 95 °C for 15 min; 35 cycles: 95 °C for 30 sec, 54–60 °C for 30 sec, 72 °C for 30 sec; final extension: 72 °C for 10 min. Sanger Sequencing was performed on PCR products after cleaning with Wizard® SV Gel and PCR Clean-Up System (Promega), by Eurofins Genomics. qRT-PCR was performed with technical triplicates with SsoAdvanced Universal SYBR Green Supermix (BioRad) in 10 µl per well, from 5 ng cDNA, 500 nM primers.

    Article Title: Neonatal Hyperglycemia Inhibits Angiogenesis and Induces Inflammation and Neuronal Degeneration in the Retina
    Article Snippet: Retrotranscription was performed using superscriptII (Invitrogen, Cergy-Pointoise, France). .. Real-time PCR was performed using 7300 Real-Time PCR System (Applied Biosystems, Cergy-Pointoise, France) in a 20 µl final volume with Power SYBR Green PCR Master Mix (Applied Biosystems, Cergy-Pointoise, France) and 0.25 µM primers.

    Article Title: Translation repression via modulation of the cytoplasmic poly(A)-binding protein in the inflammatory response
    Article Snippet: Reverse transcription was performed using the SuperscriptII (Invitrogen, Waltham, MA) and random hexamers. .. Quantitative PCR was performed using the 2 X SYBR Green qPCR Master Mix (BioRad, Hercules, CA) on a Bio-Rad CFX Real-Time PCR Detection System.

    Article Title: Transcriptome profiles in peripheral white blood cells at the time of artificial insemination discriminate beef heifers with different fertility potential
    Article Snippet: Reverse transcription was carried out with SuperScriptII (Invitrogen, Carlsbad, CA) following manufacturer’s recommendations. .. The final RT reaction was diluted 1:2 (v:v) and 1μl was used as template for each PCR reaction using Perfecta SYBR Green FastMix (Quanta Biosciences), and 100 nM of each primer (Additional file : Table S3, IDT) in a final volume of 10μl.

    Article Title: ATP-mediated Events in Peritubular Cells Contribute to Sterile Testicular Inflammation
    Article Snippet: Reverse transcription of 200 ng or 1 µg RNA was performed utilizing SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers. .. For qPCR studies the QuantiFast SYBR Green PCR Kit (Qiagen, Hilden, Germany) was applied using the primers depicted in Table (designed using Primer3, http://primer3.wi.mit.edu , final concentration 300–900 nM) for amplification.

    Functional Assay:

    Article Title: Genome-Wide Profiling of Cap-Independent Translation Enhancing Elements in the Human Genome
    Article Snippet: The mRNA-peptide fusion molecules were purified from the crude lysate using oligo (dT)-cellulose beads (NEB) and reverse transcribed with SuperScriptII (Invitrogen) by extending the DNA primer (5' TTTTTTTTTTTTTTTATCC ACTTCCATGATGATGGT) with dNTPs. .. Functional sequences were recovered by eluting the column with 500 mM imidazole, dialyzing the sample into water, and amplifying the cDNA by PCR using previously described overlap PCR primers to add back the necessary sequences for mRNA display.

    Selection:

    Article Title: Genome-Wide Profiling of Cap-Independent Translation Enhancing Elements in the Human Genome
    Article Snippet: Paragraph title: Library assembly and mRNA display selection ... The mRNA-peptide fusion molecules were purified from the crude lysate using oligo (dT)-cellulose beads (NEB) and reverse transcribed with SuperScriptII (Invitrogen) by extending the DNA primer (5' TTTTTTTTTTTTTTTATCC ACTTCCATGATGATGGT) with dNTPs.

    Sample Prep:

    Article Title: RNA sequencing analysis revealed the induction of CCL3 expression in human intracranial aneurysms
    Article Snippet: After quality check of purified RNA by the RNA analyzer and a Quant-iT RiboGreen RNA Reagent (Molecular Probes, Eugene, OR), the library was prepared using a TruSeq RNA Sample Preparation v2 Kit (Ilumina, San Diego, CA) according to the manufacture’s protocol with some modifications. .. In brief, after purification of polyA+ RNA from total RNA samples, the RNA was transcribed into cDNA using a SuperScriptIII instead of SuperScriptII (Thermo Fisher Scientific Inc., Waltham, MA).

    In Vitro:

    Article Title: Genome-Wide Profiling of Cap-Independent Translation Enhancing Elements in the Human Genome
    Article Snippet: The RNA-DNA-puromycin product was ethanol precipitated and the cross-linked RNA (400 pmol) was translated in vitro by incubating the library with micrococcal nuclease-treated rabbit reticulocyte lysate and 35 S-methionine for 1 hour at 30°C. .. The mRNA-peptide fusion molecules were purified from the crude lysate using oligo (dT)-cellulose beads (NEB) and reverse transcribed with SuperScriptII (Invitrogen) by extending the DNA primer (5' TTTTTTTTTTTTTTTATCC ACTTCCATGATGATGGT) with dNTPs.

    Transgenic Assay:

    Article Title: Heterologous expression of Ceratophyllum demersum phytochelatin synthase, CdPCS1, in rice leads to lower arsenic accumulation in grain
    Article Snippet: Paragraph title: Molecular analysis of transgenic lines ... Approximately, 5 μg RNase free DNase treated total RNA isolated from root and shoot of rice was reverse-transcribed using SuperScriptII (Fermentas, USA), following the manufacturer's recommendation.

    Concentration Assay:

    Article Title: Complement component 1q subcomponent binding protein in the brain of the rat
    Article Snippet: The concentration of RNA was adjusted to 2 µg/µl, and it was treated with Amplification Grade DNase I (Invitrogen). .. Then, cDNA was synthesized using SuperscriptII (Invitrogen) as suggested in the kit protocol.

    Article Title: ATP-mediated Events in Peritubular Cells Contribute to Sterile Testicular Inflammation
    Article Snippet: Reverse transcription of 200 ng or 1 µg RNA was performed utilizing SuperScriptII (Invitrogen, Darmstadt, Germany) and random 15mer primers. .. For qPCR studies the QuantiFast SYBR Green PCR Kit (Qiagen, Hilden, Germany) was applied using the primers depicted in Table (designed using Primer3, http://primer3.wi.mit.edu , final concentration 300–900 nM) for amplification.

    Staining:

    Article Title: Identification of IFN-?-producing innate B cells
    Article Snippet: For retrotranscription, 1 μg of total RNA was used to synthesize cDNA with an oligo(dT)18 primer and 200 units of SuperScriptII (Gibco BRL, Rockville, MD, USA). .. All the PCR products were analyzed by 1.5% agarose gel electrophoresis and visualized by staining the gel with ethidium bromide.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher superscript iv first strand synthesis system
    Superscript Iv First Strand Synthesis System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 116 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iv first strand synthesis system/product/Thermo Fisher
    Average 90 stars, based on 116 article reviews
    Price from $9.99 to $1999.99
    superscript iv first strand synthesis system - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher qrt pcr kit
    Qrt Pcr Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 82 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/qrt pcr kit/product/Thermo Fisher
    Average 90 stars, based on 82 article reviews
    Price from $9.99 to $1999.99
    qrt pcr kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher superscript vilo mastermix
    Superscript Vilo Mastermix, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 45 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript vilo mastermix/product/Thermo Fisher
    Average 90 stars, based on 45 article reviews
    Price from $9.99 to $1999.99
    superscript vilo mastermix - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results