superscriptii reverse transcriptase  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    SuperScript II Reverse Transcriptase
    Description:
    Invitrogen SuperScript II Reverse Transcriptase is a genetically engineered MMLV reverse transcriptase (RT) with reduced RNase H activity and increased thermal stability compared to wild-type MMLV RT. Mutations in the RNase H domain of the enzyme eliminate degradation of the RNA during first-strand cDNA synthesis, which results in higher yields of full-length cDNA. SuperScript RTs are the most highly trusted and widely used RTs with over 50,000 citations, reviews, and publications to date. Note: The latest member of the SuperScript RT family, SuperScript IV Reverse Transcriptase, features enhanced thermostability, processivity, yields, and performance with any RNA samples, including those of suboptimal purity or integrity.
    Catalog Number:
    18064014
    Price:
    None
    Applications:
    PCR & Real-Time PCR|Reverse Transcription
    Size:
    10 000 units
    Category:
    Proteins, Enzymes, & Peptides, PCR & Cloning Enzymes, Reverse Transcriptase
    Score:
    85
    Buy from Supplier
    Name:
    Superscript II Reverse Transcriptase
    Description:

    Catalog Number:
    18064071
    Price:
    None
    Score:
    85
    Buy from Supplier


    Structured Review

    Thermo Fisher superscriptii reverse transcriptase

    https://www.bioz.com/result/superscriptii reverse transcriptase/product/Thermo Fisher
    Average 99 stars, based on 85 article reviews
    Price from $9.99 to $1999.99
    superscriptii reverse transcriptase - by Bioz Stars, 2020-01
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: The transcriptional network for mesenchymal transformation of brain tumors
    Article Snippet: RNA was prepared with RiboPure kit (Ambion), and used for first strand cDNA synthesis using random primers and SuperScriptII Reverse Transcriptase (Invitrogen). .. QRT-PCR results were analyzed by the ΔΔCT method using 18S as housekeeping gene.

    Article Title: ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes
    Article Snippet: The PCR products amplified with specific primer sets ( ) were directly sequenced using the BigDye terminator v3.1 cycle sequencing mix and the standard protocol for an Applied Biosystems 3130 DNA Sequencer (Life Technologies). .. First strand cDNA was synthesized from 5 μg of total RNA that had been treated with DNase using an oligo(dT)12–18 primer and SuperscriptII reverse transcriptase (Invitrogen).

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: In total, 2 µg of isolated RNA were transcribed to cDNA using random hexamers and 200 U of SuperScriptII Reverse Transcriptase (Invitrogen). .. Reactions were performed in triplicate using the SYBR Green Supermix (Bio-Rad) on an iQ5 System (Bio-Rad).

    Whole Genome Amplification:

    Article Title: ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes
    Article Snippet: After incubation for 24 h, two-cell embryos were collected and genomic DNA was amplified using the GenomePlex Single Cell Whole Genome Amplification Kit (Sigma Aldrich, St Louis, MO, USA). .. First strand cDNA was synthesized from 5 μg of total RNA that had been treated with DNase using an oligo(dT)12–18 primer and SuperscriptII reverse transcriptase (Invitrogen).

    Synthesized:

    Article Title: ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes
    Article Snippet: Total RNA was extracted using Isogen reagent (Nippon Gene) from the spleen of 5-week-old rats. .. First strand cDNA was synthesized from 5 μg of total RNA that had been treated with DNase using an oligo(dT)12–18 primer and SuperscriptII reverse transcriptase (Invitrogen). .. PCR was performed with the primers for human SIRPA and rat Sirpa described in .

    Article Title: Assessment of Heat Shock Protein 70 Induction by Heat in Alfalfa Varieties and Constitutive Overexpression in Transgenic Plants
    Article Snippet: To remove contaminating genomic DNA, the RNA was treated with DNase I (Ambion, Norwalk, CT, USA). .. First strand cDNA was synthesized from 2 μg of total RNA using SuperScriptII Reverse Transcriptase (Invitrogen, http://www.invitrogen.com ), according to the manufacturer’s protocol. .. A qualitative RT-PCR was performed using 5 μl of cDNA and the specific primer pair HSP70 screening FOR/REV.

    Article Title: Low level genome mistranslations deregulate the transcriptome and translatome and generate proteotoxic stress in yeast
    Article Snippet: Briefly, total yeast RNA extracts were prepared using hot phenol (T0' to T180'). cDNA synthesis was carried out using 40 μg of total RNA extracted from T0' to T180' samples and SuperscriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Briefly, total yeast RNA extracts were prepared using hot phenol (T0' to T180'). cDNA synthesis was carried out using 40 μg of total RNA extracted from T0' to T180' samples and SuperscriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA).

    Article Title: GALNT14 promotes lung-specific breast cancer metastasis by modulating self-renewal and interaction with the lung microenvironment
    Article Snippet: Total RNA was isolated using Qiazol (Qiagen, Valencia, CA) followed by chloroform extraction. .. First-strand cDNA was synthesized from 400 ng of total RNA using SuperscriptII reverse transcriptase (Life technologies) according to the manufacturer's instructions. qRT-PCR assay was performed using SYBR Green Real-time PCR Master Mix (Toyobo, Osaka, Japan) in a Real-Time PCR machine CFX96 (Biorad, Hercules, CA) using the gene-specific primer sets. .. Analysis of GALNT8 , GALNT15 , GALNT17 , GALNT20 , ANGPTL4 , B2M, MmGALNT14 and MmB2M mRNAs were detected using TaqMan Gene Expression Assay (Life technologies).

    Quantitative RT-PCR:

    Article Title: The transcriptional network for mesenchymal transformation of brain tumors
    Article Snippet: Paragraph title: QRT-PCR and microarray analysis ... RNA was prepared with RiboPure kit (Ambion), and used for first strand cDNA synthesis using random primers and SuperScriptII Reverse Transcriptase (Invitrogen).

    Article Title: Hepatitis C virus upregulates B-cell receptor signaling: a novel mechanism for HCV-associated B-cell lymphoproliferative disorders
    Article Snippet: Paragraph title: Real-time quantitative RT–PCR ... RNA from IP material was subjected to reverse transcription using random hexamers and SuperScriptII reverse transcriptase (Invitrogen).

    Article Title: Isoform level expression profiles provide better cancer signatures than gene level expression profiles
    Article Snippet: Expression of transcripts/isoforms for seven genes in HMEC, MCF7, MDA-MBA-231, and T47D cell lines and expression of two TPM4 isoforms in primary breast-cancer tissues were measured by reverse transcriptase -quantitativePCR (RT-qPCR). .. Briefly, 0.5 μg of total RNA was reverse-transcribed in a 20 μl reaction with SuperscriptII reverse transcriptase (Invitrogen Inc.) in accordance with the manufacturer's instructions.

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: Quantitative real-time-PCR (qRT-PCR) was used to validate the relative expression of genes selected from the RNA-seq analysis. .. In total, 2 µg of isolated RNA were transcribed to cDNA using random hexamers and 200 U of SuperScriptII Reverse Transcriptase (Invitrogen).

    Article Title: Antisense oligonucleotide-mediated Dnm2 knockdown prevents and reverts myotubular myopathy in mice
    Article Snippet: Paragraph title: RNA extraction and qRT-PCR ... RT-PCR was carried out on 1–1.5 μg aliquot using SuperscriptII Reverse Transcriptase (Thermofischer Scientific). qRTPCR was performed in Lightcycler 480 (Roche) using: Dnm 2 (F): CCAACAAAGGCATCTCCCCT, Dnm2 (R):TGGTGAGTAGACCCGAAGGT, Hprt (F): GTAATGATCAGTCAACGGGGGAC and Hprt (R): CCAGCAAGCTTGCAACCTTAACCA mixed in SybrGreen (Qiagen).

    Article Title: Molecular Characterization and Immune Protection of a New Conserved Hypothetical Protein of Eimeria tenella
    Article Snippet: Paragraph title: Quantitative reverse transcriptase PCR (qRT-PCR) of Et CHP559 gene transcripts ... The cDNA was generated by SuperScriptII reverse transcriptase (Invitrogen) using random primers.

    Article Title: GALNT14 promotes lung-specific breast cancer metastasis by modulating self-renewal and interaction with the lung microenvironment
    Article Snippet: Total RNA was isolated using Qiazol (Qiagen, Valencia, CA) followed by chloroform extraction. .. First-strand cDNA was synthesized from 400 ng of total RNA using SuperscriptII reverse transcriptase (Life technologies) according to the manufacturer's instructions. qRT-PCR assay was performed using SYBR Green Real-time PCR Master Mix (Toyobo, Osaka, Japan) in a Real-Time PCR machine CFX96 (Biorad, Hercules, CA) using the gene-specific primer sets. .. Analysis of GALNT8 , GALNT15 , GALNT17 , GALNT20 , ANGPTL4 , B2M, MmGALNT14 and MmB2M mRNAs were detected using TaqMan Gene Expression Assay (Life technologies).

    SYBR Green Assay:

    Article Title: Colorectal cancer specific conditions promote Streptococcus gallolyticus gut colonization
    Article Snippet: Following RNA extraction, reverse transcription was performed by using SuperScriptII reverse transcriptase (Thermo Fisher Scientific) and random hexamers. .. Quantitative PCR experiments were performed by using Power SYBR Green mix (Applied) and 10 ng of cDNA.

    Article Title: Cryptochromes mediate rhythmic repression of the glucocorticoid receptor
    Article Snippet: Heat map was constructed with cubic spline-normalized values using the CIMminer program at http://discover.nci.nih.gov/ , a development of the Genomics and Bioinformatics Group, Laboratory of Molecular Pharmacology (LMP), Center for Cancer Research (CCR) National Cancer Institute (NCI). .. RNA was extracted from livers or cultured cells with Trizol or using the Qiagen RNeasy purification system. cDNA was prepared using the SuperscriptII reverse transcriptase (Invitrogen) and analyzed for gene expression using quantitative real-time PCR with SYBR green (Invitrogen SybrGreenER or Biorad iQ SybrGreen supermix) chemistry. .. Primer sequences are available upon request.

    Article Title: GALNT14 promotes lung-specific breast cancer metastasis by modulating self-renewal and interaction with the lung microenvironment
    Article Snippet: Total RNA was isolated using Qiazol (Qiagen, Valencia, CA) followed by chloroform extraction. .. First-strand cDNA was synthesized from 400 ng of total RNA using SuperscriptII reverse transcriptase (Life technologies) according to the manufacturer's instructions. qRT-PCR assay was performed using SYBR Green Real-time PCR Master Mix (Toyobo, Osaka, Japan) in a Real-Time PCR machine CFX96 (Biorad, Hercules, CA) using the gene-specific primer sets. .. Analysis of GALNT8 , GALNT15 , GALNT17 , GALNT20 , ANGPTL4 , B2M, MmGALNT14 and MmB2M mRNAs were detected using TaqMan Gene Expression Assay (Life technologies).

    Microarray:

    Article Title: The transcriptional network for mesenchymal transformation of brain tumors
    Article Snippet: Paragraph title: QRT-PCR and microarray analysis ... RNA was prepared with RiboPure kit (Ambion), and used for first strand cDNA synthesis using random primers and SuperScriptII Reverse Transcriptase (Invitrogen).

    Article Title: Low level genome mistranslations deregulate the transcriptome and translatome and generate proteotoxic stress in yeast
    Article Snippet: Briefly, total yeast RNA extracts were prepared using hot phenol (T0' to T180'). cDNA synthesis was carried out using 40 μg of total RNA extracted from T0' to T180' samples and SuperscriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Before hybridization, free dyes were removed using Chromaspin-30 (Clontech, Palo Alto, CA, USA) columns and the efficiency of cDNA synthesis and dye incorporation was measured using a Nanodrop spectrophotometer by determining the full spectrum of absorption in the 190 to 750 nm range and registering the OD values at 260 nm, 550 nm and 649 nm points for each sample.

    Incubation:

    Article Title: In vivo expression technology and 5′ end mapping of the Borrelia burgdorferi transcriptome identify novel RNAs expressed during mammalian infection
    Article Snippet: A total of 52 μM of phosphorylated 3′ RNA adapter was next ligated to the libraries using 25 U RNA Ligase 1 (NEB), 1X RNA Ligase 1 Buffer, 10% DMSO, 1 mM ATP (NEB) and 40 U rRNasin (Promega) in 25 μl DEPC–H2 O and incubated at 20°C for 6 h. To remove unincorporated adapter, size selection (∼200–300 nts) on an 8% polyacrylamide 8 M urea gel was performed and RNA extracted from gel, as described above. .. Adapter conjugated RNA library preps were converted to cDNA with SuperScriptII reverse transcriptase (Invitrogen) and random nonamers, per manufacturer's instructions.

    Article Title: ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes
    Article Snippet: After incubation for 24 h, two-cell embryos were collected and genomic DNA was amplified using the GenomePlex Single Cell Whole Genome Amplification Kit (Sigma Aldrich, St Louis, MO, USA). .. First strand cDNA was synthesized from 5 μg of total RNA that had been treated with DNase using an oligo(dT)12–18 primer and SuperscriptII reverse transcriptase (Invitrogen).

    Expressing:

    Article Title: The transcriptional network for mesenchymal transformation of brain tumors
    Article Snippet: RNA was prepared with RiboPure kit (Ambion), and used for first strand cDNA synthesis using random primers and SuperScriptII Reverse Transcriptase (Invitrogen). .. RNA was prepared with RiboPure kit (Ambion), and used for first strand cDNA synthesis using random primers and SuperScriptII Reverse Transcriptase (Invitrogen).

    Article Title: Colorectal cancer specific conditions promote Streptococcus gallolyticus gut colonization
    Article Snippet: Paragraph title: Gene Expression Analysis in Mouse Tissues. ... Following RNA extraction, reverse transcription was performed by using SuperScriptII reverse transcriptase (Thermo Fisher Scientific) and random hexamers.

    Article Title: Cryptochromes mediate rhythmic repression of the glucocorticoid receptor
    Article Snippet: Heat map was constructed with cubic spline-normalized values using the CIMminer program at http://discover.nci.nih.gov/ , a development of the Genomics and Bioinformatics Group, Laboratory of Molecular Pharmacology (LMP), Center for Cancer Research (CCR) National Cancer Institute (NCI). .. RNA was extracted from livers or cultured cells with Trizol or using the Qiagen RNeasy purification system. cDNA was prepared using the SuperscriptII reverse transcriptase (Invitrogen) and analyzed for gene expression using quantitative real-time PCR with SYBR green (Invitrogen SybrGreenER or Biorad iQ SybrGreen supermix) chemistry. .. Primer sequences are available upon request.

    Article Title: Isoform level expression profiles provide better cancer signatures than gene level expression profiles
    Article Snippet: Expression of transcripts/isoforms for seven genes in HMEC, MCF7, MDA-MBA-231, and T47D cell lines and expression of two TPM4 isoforms in primary breast-cancer tissues were measured by reverse transcriptase -quantitativePCR (RT-qPCR). .. Briefly, 0.5 μg of total RNA was reverse-transcribed in a 20 μl reaction with SuperscriptII reverse transcriptase (Invitrogen Inc.) in accordance with the manufacturer's instructions.

    Article Title: ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes
    Article Snippet: Paragraph title: Gene expression of KI and mutation detection assay ... First strand cDNA was synthesized from 5 μg of total RNA that had been treated with DNase using an oligo(dT)12–18 primer and SuperscriptII reverse transcriptase (Invitrogen).

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: Quantitative real-time-PCR (qRT-PCR) was used to validate the relative expression of genes selected from the RNA-seq analysis. .. In total, 2 µg of isolated RNA were transcribed to cDNA using random hexamers and 200 U of SuperScriptII Reverse Transcriptase (Invitrogen).

    MANN-WHITNEY:

    Article Title: Canonical Notch signalling is inactive in urothelial carcinoma
    Article Snippet: RNA was reverse transcribed using 200 U SuperScriptII reverse transcriptase (Invitrogen, Darmstadt, Germany), with 300 ng oligo-dT and 25 ng random hexamer primers. .. RNA was reverse transcribed using 200 U SuperScriptII reverse transcriptase (Invitrogen, Darmstadt, Germany), with 300 ng oligo-dT and 25 ng random hexamer primers.

    Hybridization:

    Article Title: Low level genome mistranslations deregulate the transcriptome and translatome and generate proteotoxic stress in yeast
    Article Snippet: Briefly, total yeast RNA extracts were prepared using hot phenol (T0' to T180'). cDNA synthesis was carried out using 40 μg of total RNA extracted from T0' to T180' samples and SuperscriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Briefly, total yeast RNA extracts were prepared using hot phenol (T0' to T180'). cDNA synthesis was carried out using 40 μg of total RNA extracted from T0' to T180' samples and SuperscriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA).

    Ligation:

    Article Title: Chronic sun exposure-related fusion oncogenes EGFR-PPARGC1A in cutaneous squamous cell carcinoma
    Article Snippet: In brief, poly-A-containing mRNA was purified from high quality total RNA using poly-T oligo-conjugated magnetic beads. .. The mRNA was fragmented by divalent cations, and the cleaved RNA fragments were transcribed into first-strand cDNA using random primers and SuperScriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA), followed by second strand cDNA synthesis using DNA polymerase I and RNase H. The cDNA fragments were then subjected to an end repair process, A-base addition, and the ligation of adapters, to convert them into a library of template molecules suitable for the subsequent cluster generation. .. The product was purified and enriched by PCR to create final cDNA library.

    Cell Culture:

    Article Title: Cryptochromes mediate rhythmic repression of the glucocorticoid receptor
    Article Snippet: Heat map was constructed with cubic spline-normalized values using the CIMminer program at http://discover.nci.nih.gov/ , a development of the Genomics and Bioinformatics Group, Laboratory of Molecular Pharmacology (LMP), Center for Cancer Research (CCR) National Cancer Institute (NCI). .. RNA was extracted from livers or cultured cells with Trizol or using the Qiagen RNeasy purification system. cDNA was prepared using the SuperscriptII reverse transcriptase (Invitrogen) and analyzed for gene expression using quantitative real-time PCR with SYBR green (Invitrogen SybrGreenER or Biorad iQ SybrGreen supermix) chemistry. .. Primer sequences are available upon request.

    Multiple Displacement Amplification:

    Article Title: Isoform level expression profiles provide better cancer signatures than gene level expression profiles
    Article Snippet: Expression of transcripts/isoforms for seven genes in HMEC, MCF7, MDA-MBA-231, and T47D cell lines and expression of two TPM4 isoforms in primary breast-cancer tissues were measured by reverse transcriptase -quantitativePCR (RT-qPCR). .. Briefly, 0.5 μg of total RNA was reverse-transcribed in a 20 μl reaction with SuperscriptII reverse transcriptase (Invitrogen Inc.) in accordance with the manufacturer's instructions.

    Generated:

    Article Title: An Integrated Analysis of miRNAs and Methylated Genes Encoding mRNAs and lncRNAs in Sheep Breeds with Different Fecundity
    Article Snippet: Next, the RNA was reverse transcribed with SuperScriptII Reverse Transcriptase (Invitrogen). .. Next, the RNA was reverse transcribed with SuperScriptII Reverse Transcriptase (Invitrogen).

    Article Title: Molecular Characterization and Immune Protection of a New Conserved Hypothetical Protein of Eimeria tenella
    Article Snippet: The quality and quantity of total RNA were assessed as describedin above. .. The cDNA was generated by SuperScriptII reverse transcriptase (Invitrogen) using random primers. .. Quantitative RT-PCR was performed on a Realplex 4 (Eppendorf, Hamburg, Germany) using the SYBR1 Green Idye method.

    Polymerase Chain Reaction:

    Article Title: Colorectal cancer specific conditions promote Streptococcus gallolyticus gut colonization
    Article Snippet: Following RNA extraction, reverse transcription was performed by using SuperScriptII reverse transcriptase (Thermo Fisher Scientific) and random hexamers. .. Quantitative PCR experiments were performed by using Power SYBR Green mix (Applied) and 10 ng of cDNA.

    Article Title: Development and validation of a targeted next generation DNA sequencing panel outperforming whole exome sequencing for the identification of clinically relevant genetic variants
    Article Snippet: First-strand cDNA synthesis was performed using random primers and SuperScriptII Reverse-Transcriptase (Thermo Fisher Scientific, Waltham, MA). .. First-strand cDNA synthesis was performed using random primers and SuperScriptII Reverse-Transcriptase (Thermo Fisher Scientific, Waltham, MA).

    Article Title: Isoform level expression profiles provide better cancer signatures than gene level expression profiles
    Article Snippet: Paragraph title: RNA isolation and reverse transcriptase-quantitative PCR experiment ... Briefly, 0.5 μg of total RNA was reverse-transcribed in a 20 μl reaction with SuperscriptII reverse transcriptase (Invitrogen Inc.) in accordance with the manufacturer's instructions.

    Article Title: ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes
    Article Snippet: The PCR products amplified with specific primer sets ( ) were directly sequenced using the BigDye terminator v3.1 cycle sequencing mix and the standard protocol for an Applied Biosystems 3130 DNA Sequencer (Life Technologies). .. First strand cDNA was synthesized from 5 μg of total RNA that had been treated with DNase using an oligo(dT)12–18 primer and SuperscriptII reverse transcriptase (Invitrogen).

    Article Title: Molecular Characterization and Immune Protection of a New Conserved Hypothetical Protein of Eimeria tenella
    Article Snippet: Paragraph title: Quantitative reverse transcriptase PCR (qRT-PCR) of Et CHP559 gene transcripts ... The cDNA was generated by SuperScriptII reverse transcriptase (Invitrogen) using random primers.

    Article Title: Assessment of Heat Shock Protein 70 Induction by Heat in Alfalfa Varieties and Constitutive Overexpression in Transgenic Plants
    Article Snippet: Paragraph title: Reverse-transcriptase PCR ... First strand cDNA was synthesized from 2 μg of total RNA using SuperScriptII Reverse Transcriptase (Invitrogen, http://www.invitrogen.com ), according to the manufacturer’s protocol.

    Sequencing:

    Article Title: In vivo expression technology and 5′ end mapping of the Borrelia burgdorferi transcriptome identify novel RNAs expressed during mammalian infection
    Article Snippet: The 3′ RNA adapter, based on the Illumina multiplexing sequence and blocked on the 3′ end with an inverted dT (5′-(p)AGAUCGGAAGAGCACACGUCU(idT)-3′), was 5′ phosphorylated using T4 PNK (NEB) per manufacturer's instructions, and purified using illustra MicroSpin G-25 columns (GE). .. Adapter conjugated RNA library preps were converted to cDNA with SuperScriptII reverse transcriptase (Invitrogen) and random nonamers, per manufacturer's instructions.

    Article Title: Chronic sun exposure-related fusion oncogenes EGFR-PPARGC1A in cutaneous squamous cell carcinoma
    Article Snippet: Paragraph title: Library preparation and sequencing ... The mRNA was fragmented by divalent cations, and the cleaved RNA fragments were transcribed into first-strand cDNA using random primers and SuperScriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA), followed by second strand cDNA synthesis using DNA polymerase I and RNase H. The cDNA fragments were then subjected to an end repair process, A-base addition, and the ligation of adapters, to convert them into a library of template molecules suitable for the subsequent cluster generation.

    Article Title: Development and validation of a targeted next generation DNA sequencing panel outperforming whole exome sequencing for the identification of clinically relevant genetic variants
    Article Snippet: A sequencing library for the Illumina 2500 platform was created from the polyadenylated fraction of RNA. mRNA was isolated with Dyna1 oligo-dT beads (Thermo Fisher Scientific, Waltham, MA) from 10 μg of total RNA. .. First-strand cDNA synthesis was performed using random primers and SuperScriptII Reverse-Transcriptase (Thermo Fisher Scientific, Waltham, MA).

    Article Title: An Integrated Analysis of miRNAs and Methylated Genes Encoding mRNAs and lncRNAs in Sheep Breeds with Different Fecundity
    Article Snippet: Paragraph title: RNA isolation and sequencing ... Next, the RNA was reverse transcribed with SuperScriptII Reverse Transcriptase (Invitrogen).

    Article Title: ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes
    Article Snippet: The PCR products amplified with specific primer sets ( ) were directly sequenced using the BigDye terminator v3.1 cycle sequencing mix and the standard protocol for an Applied Biosystems 3130 DNA Sequencer (Life Technologies). .. First strand cDNA was synthesized from 5 μg of total RNA that had been treated with DNase using an oligo(dT)12–18 primer and SuperscriptII reverse transcriptase (Invitrogen).

    Binding Assay:

    Article Title: Hepatitis C virus upregulates B-cell receptor signaling: a novel mechanism for HCV-associated B-cell lymphoproliferative disorders
    Article Snippet: RNA from IP material was subjected to reverse transcription using random hexamers and SuperScriptII reverse transcriptase (Invitrogen). .. The mRNA levels of HuR target were measured by RT–qPCR analysis using iQSYBR Green Supermix (Quanta BioSciences, Inc., Gaithersburg, MD, USA) and a Bio-Rad CFXConnect instrument (Bio-Rad, Hercules, CA, USA).

    Multiplexing:

    Article Title: In vivo expression technology and 5′ end mapping of the Borrelia burgdorferi transcriptome identify novel RNAs expressed during mammalian infection
    Article Snippet: The 3′ RNA adapter, based on the Illumina multiplexing sequence and blocked on the 3′ end with an inverted dT (5′-(p)AGAUCGGAAGAGCACACGUCU(idT)-3′), was 5′ phosphorylated using T4 PNK (NEB) per manufacturer's instructions, and purified using illustra MicroSpin G-25 columns (GE). .. Adapter conjugated RNA library preps were converted to cDNA with SuperScriptII reverse transcriptase (Invitrogen) and random nonamers, per manufacturer's instructions.

    RNA Sequencing Assay:

    Article Title: Development and validation of a targeted next generation DNA sequencing panel outperforming whole exome sequencing for the identification of clinically relevant genetic variants
    Article Snippet: Paragraph title: RNA Sequencing (RNA-Seq) ... First-strand cDNA synthesis was performed using random primers and SuperScriptII Reverse-Transcriptase (Thermo Fisher Scientific, Waltham, MA).

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: Quantitative real-time-PCR (qRT-PCR) was used to validate the relative expression of genes selected from the RNA-seq analysis. .. In total, 2 µg of isolated RNA were transcribed to cDNA using random hexamers and 200 U of SuperScriptII Reverse Transcriptase (Invitrogen).

    Magnetic Beads:

    Article Title: Chronic sun exposure-related fusion oncogenes EGFR-PPARGC1A in cutaneous squamous cell carcinoma
    Article Snippet: In brief, poly-A-containing mRNA was purified from high quality total RNA using poly-T oligo-conjugated magnetic beads. .. The mRNA was fragmented by divalent cations, and the cleaved RNA fragments were transcribed into first-strand cDNA using random primers and SuperScriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA), followed by second strand cDNA synthesis using DNA polymerase I and RNase H. The cDNA fragments were then subjected to an end repair process, A-base addition, and the ligation of adapters, to convert them into a library of template molecules suitable for the subsequent cluster generation.

    Mutagenesis:

    Article Title: ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes
    Article Snippet: Paragraph title: Gene expression of KI and mutation detection assay ... First strand cDNA was synthesized from 5 μg of total RNA that had been treated with DNase using an oligo(dT)12–18 primer and SuperscriptII reverse transcriptase (Invitrogen).

    Isolation:

    Article Title: In vivo expression technology and 5′ end mapping of the Borrelia burgdorferi transcriptome identify novel RNAs expressed during mammalian infection
    Article Snippet: RNA gel segments from ∼150–300 nts were isolated and extracted overnight in RNA gel elution buffer (10 mM Tris pH 7.5, 0.1% SDS, 2 mM EDTA, 0.3 M NaOAC) at 4°C with agitation. .. Adapter conjugated RNA library preps were converted to cDNA with SuperScriptII reverse transcriptase (Invitrogen) and random nonamers, per manufacturer's instructions.

    Article Title: Development and validation of a targeted next generation DNA sequencing panel outperforming whole exome sequencing for the identification of clinically relevant genetic variants
    Article Snippet: A sequencing library for the Illumina 2500 platform was created from the polyadenylated fraction of RNA. mRNA was isolated with Dyna1 oligo-dT beads (Thermo Fisher Scientific, Waltham, MA) from 10 μg of total RNA. .. First-strand cDNA synthesis was performed using random primers and SuperScriptII Reverse-Transcriptase (Thermo Fisher Scientific, Waltham, MA).

    Article Title: Concomitant downregulation of the imprinted genes DLK1 and MEG3 at 14q32.2 by epigenetic mechanisms in urothelial carcinoma
    Article Snippet: Paragraph title: RNA isolation and quantitative reverse transcription polymerase chain reaction ... Two μg RNA was reverse transcribed using 200 U SuperScriptII reverse transcriptase (Invitrogen, Darmstadt, Germany), with 300 ng oligo-dT and 25 ng random hexamer primers in a reaction volume of 20 μl.

    Article Title: An Integrated Analysis of miRNAs and Methylated Genes Encoding mRNAs and lncRNAs in Sheep Breeds with Different Fecundity
    Article Snippet: Paragraph title: RNA isolation and sequencing ... Next, the RNA was reverse transcribed with SuperScriptII Reverse Transcriptase (Invitrogen).

    Article Title: Isoform level expression profiles provide better cancer signatures than gene level expression profiles
    Article Snippet: Paragraph title: RNA isolation and reverse transcriptase-quantitative PCR experiment ... Briefly, 0.5 μg of total RNA was reverse-transcribed in a 20 μl reaction with SuperscriptII reverse transcriptase (Invitrogen Inc.) in accordance with the manufacturer's instructions.

    Article Title: Suppression of a Prolyl 4 Hydroxylase Results in Delayed Abscission of Overripe Tomato Fruits
    Article Snippet: Total RNA was isolated from 200mg of tissue of Br + 30 and Br + 90 fruit AZs as well as leaf AZs, from an empty vector (pBi121) line and three SlP4H3 RNAi lines (#1, #6, and #7). .. Approximately 1 μg of total RNA was reverse transcribed using SuperscriptII® Reverse Transcriptase (ThermoFisher Scientific, Walttham, MA, USA) and cDNA synthesis was performed following manufacturer’s instructions using oligodT12–18 primers.

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: Total RNA was extracted from 1 × 107 MEL and MEL-R cells as described above. .. In total, 2 µg of isolated RNA were transcribed to cDNA using random hexamers and 200 U of SuperScriptII Reverse Transcriptase (Invitrogen). .. Reactions were performed in triplicate using the SYBR Green Supermix (Bio-Rad) on an iQ5 System (Bio-Rad).

    Article Title: Antisense oligonucleotide-mediated Dnm2 knockdown prevents and reverts myotubular myopathy in mice
    Article Snippet: Total RNA was isolated from electroporated cells or muscle tissue using TRIzol reagent according to the manufacturer's instruction (Invitrogen, UK). .. RT-PCR was carried out on 1–1.5 μg aliquot using SuperscriptII Reverse Transcriptase (Thermofischer Scientific). qRTPCR was performed in Lightcycler 480 (Roche) using: Dnm 2 (F): CCAACAAAGGCATCTCCCCT, Dnm2 (R):TGGTGAGTAGACCCGAAGGT, Hprt (F): GTAATGATCAGTCAACGGGGGAC and Hprt (R): CCAGCAAGCTTGCAACCTTAACCA mixed in SybrGreen (Qiagen).

    Article Title: Molecular Characterization and Immune Protection of a New Conserved Hypothetical Protein of Eimeria tenella
    Article Snippet: To validate the differential expression of Et CHP559 in the different developmental stages, Total RNA was isolated by the TRIzol reagent (Invitrogen) from the four stages of E . tenella (UO, SO, Spz and Mrz). .. The cDNA was generated by SuperScriptII reverse transcriptase (Invitrogen) using random primers.

    Article Title: Canonical Notch signalling is inactive in urothelial carcinoma
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... RNA was reverse transcribed using 200 U SuperScriptII reverse transcriptase (Invitrogen, Darmstadt, Germany), with 300 ng oligo-dT and 25 ng random hexamer primers.

    Article Title: Low level genome mistranslations deregulate the transcriptome and translatome and generate proteotoxic stress in yeast
    Article Snippet: Paragraph title: RNA isolation and labeling ... Briefly, total yeast RNA extracts were prepared using hot phenol (T0' to T180'). cDNA synthesis was carried out using 40 μg of total RNA extracted from T0' to T180' samples and SuperscriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA).

    Article Title: GALNT14 promotes lung-specific breast cancer metastasis by modulating self-renewal and interaction with the lung microenvironment
    Article Snippet: Total RNA was isolated using Qiazol (Qiagen, Valencia, CA) followed by chloroform extraction. .. First-strand cDNA was synthesized from 400 ng of total RNA using SuperscriptII reverse transcriptase (Life technologies) according to the manufacturer's instructions. qRT-PCR assay was performed using SYBR Green Real-time PCR Master Mix (Toyobo, Osaka, Japan) in a Real-Time PCR machine CFX96 (Biorad, Hercules, CA) using the gene-specific primer sets.

    Detection Assay:

    Article Title: ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes
    Article Snippet: Paragraph title: Gene expression of KI and mutation detection assay ... First strand cDNA was synthesized from 5 μg of total RNA that had been treated with DNase using an oligo(dT)12–18 primer and SuperscriptII reverse transcriptase (Invitrogen).

    Size-exclusion Chromatography:

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: In total, 2 µg of isolated RNA were transcribed to cDNA using random hexamers and 200 U of SuperScriptII Reverse Transcriptase (Invitrogen). .. Reactions were performed in triplicate using the SYBR Green Supermix (Bio-Rad) on an iQ5 System (Bio-Rad).

    Labeling:

    Article Title: Low level genome mistranslations deregulate the transcriptome and translatome and generate proteotoxic stress in yeast
    Article Snippet: Paragraph title: RNA isolation and labeling ... Briefly, total yeast RNA extracts were prepared using hot phenol (T0' to T180'). cDNA synthesis was carried out using 40 μg of total RNA extracted from T0' to T180' samples and SuperscriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA).

    Purification:

    Article Title: In vivo expression technology and 5′ end mapping of the Borrelia burgdorferi transcriptome identify novel RNAs expressed during mammalian infection
    Article Snippet: The 3′ RNA adapter, based on the Illumina multiplexing sequence and blocked on the 3′ end with an inverted dT (5′-(p)AGAUCGGAAGAGCACACGUCU(idT)-3′), was 5′ phosphorylated using T4 PNK (NEB) per manufacturer's instructions, and purified using illustra MicroSpin G-25 columns (GE). .. Adapter conjugated RNA library preps were converted to cDNA with SuperScriptII reverse transcriptase (Invitrogen) and random nonamers, per manufacturer's instructions.

    Article Title: Cryptochromes mediate rhythmic repression of the glucocorticoid receptor
    Article Snippet: Heat map was constructed with cubic spline-normalized values using the CIMminer program at http://discover.nci.nih.gov/ , a development of the Genomics and Bioinformatics Group, Laboratory of Molecular Pharmacology (LMP), Center for Cancer Research (CCR) National Cancer Institute (NCI). .. RNA was extracted from livers or cultured cells with Trizol or using the Qiagen RNeasy purification system. cDNA was prepared using the SuperscriptII reverse transcriptase (Invitrogen) and analyzed for gene expression using quantitative real-time PCR with SYBR green (Invitrogen SybrGreenER or Biorad iQ SybrGreen supermix) chemistry. .. Primer sequences are available upon request.

    Article Title: Chronic sun exposure-related fusion oncogenes EGFR-PPARGC1A in cutaneous squamous cell carcinoma
    Article Snippet: In brief, poly-A-containing mRNA was purified from high quality total RNA using poly-T oligo-conjugated magnetic beads. .. The mRNA was fragmented by divalent cations, and the cleaved RNA fragments were transcribed into first-strand cDNA using random primers and SuperScriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA), followed by second strand cDNA synthesis using DNA polymerase I and RNase H. The cDNA fragments were then subjected to an end repair process, A-base addition, and the ligation of adapters, to convert them into a library of template molecules suitable for the subsequent cluster generation.

    Article Title: An Integrated Analysis of miRNAs and Methylated Genes Encoding mRNAs and lncRNAs in Sheep Breeds with Different Fecundity
    Article Snippet: Additionally, small RNAs, between 18 and 30 nt long, were purified from the total RNA from each sheep group. .. Next, the RNA was reverse transcribed with SuperScriptII Reverse Transcriptase (Invitrogen).

    Article Title: ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes
    Article Snippet: After purification of the DNA, CRISPR-Cas-mediated mutations at target sites were analysed by direct sequencing. .. First strand cDNA was synthesized from 5 μg of total RNA that had been treated with DNase using an oligo(dT)12–18 primer and SuperscriptII reverse transcriptase (Invitrogen).

    Article Title: Low level genome mistranslations deregulate the transcriptome and translatome and generate proteotoxic stress in yeast
    Article Snippet: Briefly, total yeast RNA extracts were prepared using hot phenol (T0' to T180'). cDNA synthesis was carried out using 40 μg of total RNA extracted from T0' to T180' samples and SuperscriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. Briefly, total yeast RNA extracts were prepared using hot phenol (T0' to T180'). cDNA synthesis was carried out using 40 μg of total RNA extracted from T0' to T180' samples and SuperscriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Concomitant downregulation of the imprinted genes DLK1 and MEG3 at 14q32.2 by epigenetic mechanisms in urothelial carcinoma
    Article Snippet: Paragraph title: RNA isolation and quantitative reverse transcription polymerase chain reaction ... Two μg RNA was reverse transcribed using 200 U SuperScriptII reverse transcriptase (Invitrogen, Darmstadt, Germany), with 300 ng oligo-dT and 25 ng random hexamer primers in a reaction volume of 20 μl.

    Article Title: Antisense oligonucleotide-mediated Dnm2 knockdown prevents and reverts myotubular myopathy in mice
    Article Snippet: Total RNA was isolated from electroporated cells or muscle tissue using TRIzol reagent according to the manufacturer's instruction (Invitrogen, UK). .. RT-PCR was carried out on 1–1.5 μg aliquot using SuperscriptII Reverse Transcriptase (Thermofischer Scientific). qRTPCR was performed in Lightcycler 480 (Roche) using: Dnm 2 (F): CCAACAAAGGCATCTCCCCT, Dnm2 (R):TGGTGAGTAGACCCGAAGGT, Hprt (F): GTAATGATCAGTCAACGGGGGAC and Hprt (R): CCAGCAAGCTTGCAACCTTAACCA mixed in SybrGreen (Qiagen). .. TA muscle cryosections, C2C12 cells, liver or kidney samples were lysed in RIPA buffer supplemented with PMSF 1 mM and complete mini EDTA-free protease inhibitor cocktail (Roche Diagnostic).

    Article Title: Assessment of Heat Shock Protein 70 Induction by Heat in Alfalfa Varieties and Constitutive Overexpression in Transgenic Plants
    Article Snippet: First strand cDNA was synthesized from 2 μg of total RNA using SuperScriptII Reverse Transcriptase (Invitrogen, http://www.invitrogen.com ), according to the manufacturer’s protocol. .. A qualitative RT-PCR was performed using 5 μl of cDNA and the specific primer pair HSP70 screening FOR/REV.

    Article Title: Allelic expression mapping across cellular lineages to establish impact of non-coding SNPs
    Article Snippet: Paragraph title: RT–PCR ... First-strand cDNA synthesis was performed using SuperScriptII reverse transcriptase (Invitrogen Corporation, Carlsbad, CA, USA) according to the manufacturer's recommendations and as described above.

    Article Title: Canonical Notch signalling is inactive in urothelial carcinoma
    Article Snippet: Paragraph title: RNA isolation and RT-PCR ... RNA was reverse transcribed using 200 U SuperScriptII reverse transcriptase (Invitrogen, Darmstadt, Germany), with 300 ng oligo-dT and 25 ng random hexamer primers.

    Software:

    Article Title: Chronic sun exposure-related fusion oncogenes EGFR-PPARGC1A in cutaneous squamous cell carcinoma
    Article Snippet: The mRNA was fragmented by divalent cations, and the cleaved RNA fragments were transcribed into first-strand cDNA using random primers and SuperScriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA), followed by second strand cDNA synthesis using DNA polymerase I and RNase H. The cDNA fragments were then subjected to an end repair process, A-base addition, and the ligation of adapters, to convert them into a library of template molecules suitable for the subsequent cluster generation. .. The mRNA was fragmented by divalent cations, and the cleaved RNA fragments were transcribed into first-strand cDNA using random primers and SuperScriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA), followed by second strand cDNA synthesis using DNA polymerase I and RNase H. The cDNA fragments were then subjected to an end repair process, A-base addition, and the ligation of adapters, to convert them into a library of template molecules suitable for the subsequent cluster generation.

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: In total, 2 µg of isolated RNA were transcribed to cDNA using random hexamers and 200 U of SuperScriptII Reverse Transcriptase (Invitrogen). .. The conditions for the amplification were as follows: pre-denaturing step of 95 °C for 3 min followed by 40 cycles of 9 °C for 30 s and 60 °C for 30 s, and a final ramp step of 1 °C/10 sec from 60 °C to 94 °C.

    Article Title: Allelic expression mapping across cellular lineages to establish impact of non-coding SNPs
    Article Snippet: First-strand cDNA synthesis was performed using SuperScriptII reverse transcriptase (Invitrogen Corporation, Carlsbad, CA, USA) according to the manufacturer's recommendations and as described above. .. The CT mean and standard deviation of each technical replicate were calculated, and the mean CT values were then normalized to the 18S mean CT value.

    Construct:

    Article Title: An Integrated Analysis of miRNAs and Methylated Genes Encoding mRNAs and lncRNAs in Sheep Breeds with Different Fecundity
    Article Snippet: Then, we constructed small RNA libraries that represented each species using the Illumina® TruSeq™ Small RNA Sample Preparation protocol. .. Next, the RNA was reverse transcribed with SuperScriptII Reverse Transcriptase (Invitrogen).

    CRISPR:

    Article Title: ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes
    Article Snippet: After purification of the DNA, CRISPR-Cas-mediated mutations at target sites were analysed by direct sequencing. .. First strand cDNA was synthesized from 5 μg of total RNA that had been treated with DNase using an oligo(dT)12–18 primer and SuperscriptII reverse transcriptase (Invitrogen).

    cDNA Library Assay:

    Article Title: In vivo expression technology and 5′ end mapping of the Borrelia burgdorferi transcriptome identify novel RNAs expressed during mammalian infection
    Article Snippet: Paragraph title: cDNA library preparations ... Adapter conjugated RNA library preps were converted to cDNA with SuperScriptII reverse transcriptase (Invitrogen) and random nonamers, per manufacturer's instructions.

    Sample Prep:

    Article Title: Chronic sun exposure-related fusion oncogenes EGFR-PPARGC1A in cutaneous squamous cell carcinoma
    Article Snippet: The transcriptome analysis was performed using Illumina TruSeq RNA Sample Preparation Kit (San Diego, CA) according to the protocol provided by Riken Genesis (Kanagawa, Japan) . .. The mRNA was fragmented by divalent cations, and the cleaved RNA fragments were transcribed into first-strand cDNA using random primers and SuperScriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA), followed by second strand cDNA synthesis using DNA polymerase I and RNase H. The cDNA fragments were then subjected to an end repair process, A-base addition, and the ligation of adapters, to convert them into a library of template molecules suitable for the subsequent cluster generation.

    Article Title: An Integrated Analysis of miRNAs and Methylated Genes Encoding mRNAs and lncRNAs in Sheep Breeds with Different Fecundity
    Article Snippet: Then, we constructed small RNA libraries that represented each species using the Illumina® TruSeq™ Small RNA Sample Preparation protocol. .. Next, the RNA was reverse transcribed with SuperScriptII Reverse Transcriptase (Invitrogen).

    Plasmid Preparation:

    Article Title: Suppression of a Prolyl 4 Hydroxylase Results in Delayed Abscission of Overripe Tomato Fruits
    Article Snippet: Total RNA was isolated from 200mg of tissue of Br + 30 and Br + 90 fruit AZs as well as leaf AZs, from an empty vector (pBi121) line and three SlP4H3 RNAi lines (#1, #6, and #7). .. Approximately 1 μg of total RNA was reverse transcribed using SuperscriptII® Reverse Transcriptase (ThermoFisher Scientific, Walttham, MA, USA) and cDNA synthesis was performed following manufacturer’s instructions using oligodT12–18 primers.

    TaqMan Assay:

    Article Title: GALNT14 promotes lung-specific breast cancer metastasis by modulating self-renewal and interaction with the lung microenvironment
    Article Snippet: First-strand cDNA was synthesized from 400 ng of total RNA using SuperscriptII reverse transcriptase (Life technologies) according to the manufacturer's instructions. qRT-PCR assay was performed using SYBR Green Real-time PCR Master Mix (Toyobo, Osaka, Japan) in a Real-Time PCR machine CFX96 (Biorad, Hercules, CA) using the gene-specific primer sets. .. Analysis of GALNT8 , GALNT15 , GALNT17 , GALNT20 , ANGPTL4 , B2M, MmGALNT14 and MmB2M mRNAs were detected using TaqMan Gene Expression Assay (Life technologies).

    Real-time Polymerase Chain Reaction:

    Article Title: Colorectal cancer specific conditions promote Streptococcus gallolyticus gut colonization
    Article Snippet: Following RNA extraction, reverse transcription was performed by using SuperScriptII reverse transcriptase (Thermo Fisher Scientific) and random hexamers. .. Quantitative PCR experiments were performed by using Power SYBR Green mix (Applied) and 10 ng of cDNA.

    Article Title: In vivo expression technology and 5′ end mapping of the Borrelia burgdorferi transcriptome identify novel RNAs expressed during mammalian infection
    Article Snippet: Adapter conjugated RNA library preps were converted to cDNA with SuperScriptII reverse transcriptase (Invitrogen) and random nonamers, per manufacturer's instructions. .. A total of 2 U of RNaseH (Promega) was used to remove the remaining RNA from the libraries, and a subsequent 18 cycle PCR with Phusion High-fidelity DNA polymerase (NEB) was used to add appropriate barcodes using ScriptSeq Index Primers (Epicentre) (Supplementary Table S1).

    Article Title: Cryptochromes mediate rhythmic repression of the glucocorticoid receptor
    Article Snippet: Heat map was constructed with cubic spline-normalized values using the CIMminer program at http://discover.nci.nih.gov/ , a development of the Genomics and Bioinformatics Group, Laboratory of Molecular Pharmacology (LMP), Center for Cancer Research (CCR) National Cancer Institute (NCI). .. RNA was extracted from livers or cultured cells with Trizol or using the Qiagen RNeasy purification system. cDNA was prepared using the SuperscriptII reverse transcriptase (Invitrogen) and analyzed for gene expression using quantitative real-time PCR with SYBR green (Invitrogen SybrGreenER or Biorad iQ SybrGreen supermix) chemistry. .. Primer sequences are available upon request.

    Article Title: An Integrated Analysis of miRNAs and Methylated Genes Encoding mRNAs and lncRNAs in Sheep Breeds with Different Fecundity
    Article Snippet: The quality control and quantification of the libraries were performed using the BioAnalyzer 2100 system and qPCR (Kapa Biosystems, Woburn, MA, USA), respectively. .. Next, the RNA was reverse transcribed with SuperScriptII Reverse Transcriptase (Invitrogen).

    Article Title: Differential gene expression analysis by RNA-seq reveals the importance of actin cytoskeletal proteins in erythroleukemia cells
    Article Snippet: Paragraph title: Quantitative real-time PCR validation ... In total, 2 µg of isolated RNA were transcribed to cDNA using random hexamers and 200 U of SuperScriptII Reverse Transcriptase (Invitrogen).

    Article Title: GALNT14 promotes lung-specific breast cancer metastasis by modulating self-renewal and interaction with the lung microenvironment
    Article Snippet: Total RNA was isolated using Qiazol (Qiagen, Valencia, CA) followed by chloroform extraction. .. First-strand cDNA was synthesized from 400 ng of total RNA using SuperscriptII reverse transcriptase (Life technologies) according to the manufacturer's instructions. qRT-PCR assay was performed using SYBR Green Real-time PCR Master Mix (Toyobo, Osaka, Japan) in a Real-Time PCR machine CFX96 (Biorad, Hercules, CA) using the gene-specific primer sets. .. Analysis of GALNT8 , GALNT15 , GALNT17 , GALNT20 , ANGPTL4 , B2M, MmGALNT14 and MmB2M mRNAs were detected using TaqMan Gene Expression Assay (Life technologies).

    RNA Extraction:

    Article Title: Colorectal cancer specific conditions promote Streptococcus gallolyticus gut colonization
    Article Snippet: Mouse intestines were flushed with ice-cold PBS solution, and tissue samples were immediately disrupted in TRIzol reagent (Life Technologies) by using a Precellys homogenizer (Ozyme) for 2 × 15 s at a frequency of 6,500 rpm. .. Following RNA extraction, reverse transcription was performed by using SuperScriptII reverse transcriptase (Thermo Fisher Scientific) and random hexamers. .. Quantitative PCR experiments were performed by using Power SYBR Green mix (Applied) and 10 ng of cDNA.

    Article Title: Isoform level expression profiles provide better cancer signatures than gene level expression profiles
    Article Snippet: For breast-cancer and normal breast tissues, up to 50 mg of frozen tissue was transferred to 1 ml of TRI reagent, then the tissue was immediately homogenized and RNA extraction protocol was followed. .. Briefly, 0.5 μg of total RNA was reverse-transcribed in a 20 μl reaction with SuperscriptII reverse transcriptase (Invitrogen Inc.) in accordance with the manufacturer's instructions.

    Article Title: Suppression of a Prolyl 4 Hydroxylase Results in Delayed Abscission of Overripe Tomato Fruits
    Article Snippet: Paragraph title: RNA Extraction and cDNA Synthesis ... Approximately 1 μg of total RNA was reverse transcribed using SuperscriptII® Reverse Transcriptase (ThermoFisher Scientific, Walttham, MA, USA) and cDNA synthesis was performed following manufacturer’s instructions using oligodT12–18 primers.

    Article Title: Antisense oligonucleotide-mediated Dnm2 knockdown prevents and reverts myotubular myopathy in mice
    Article Snippet: Paragraph title: RNA extraction and qRT-PCR ... RT-PCR was carried out on 1–1.5 μg aliquot using SuperscriptII Reverse Transcriptase (Thermofischer Scientific). qRTPCR was performed in Lightcycler 480 (Roche) using: Dnm 2 (F): CCAACAAAGGCATCTCCCCT, Dnm2 (R):TGGTGAGTAGACCCGAAGGT, Hprt (F): GTAATGATCAGTCAACGGGGGAC and Hprt (R): CCAGCAAGCTTGCAACCTTAACCA mixed in SybrGreen (Qiagen).

    Selection:

    Article Title: In vivo expression technology and 5′ end mapping of the Borrelia burgdorferi transcriptome identify novel RNAs expressed during mammalian infection
    Article Snippet: A total of 52 μM of phosphorylated 3′ RNA adapter was next ligated to the libraries using 25 U RNA Ligase 1 (NEB), 1X RNA Ligase 1 Buffer, 10% DMSO, 1 mM ATP (NEB) and 40 U rRNasin (Promega) in 25 μl DEPC–H2 O and incubated at 20°C for 6 h. To remove unincorporated adapter, size selection (∼200–300 nts) on an 8% polyacrylamide 8 M urea gel was performed and RNA extracted from gel, as described above. .. Adapter conjugated RNA library preps were converted to cDNA with SuperScriptII reverse transcriptase (Invitrogen) and random nonamers, per manufacturer's instructions.

    Agarose Gel Electrophoresis:

    Article Title: Assessment of Heat Shock Protein 70 Induction by Heat in Alfalfa Varieties and Constitutive Overexpression in Transgenic Plants
    Article Snippet: First strand cDNA was synthesized from 2 μg of total RNA using SuperScriptII Reverse Transcriptase (Invitrogen, http://www.invitrogen.com ), according to the manufacturer’s protocol. .. A qualitative RT-PCR was performed using 5 μl of cDNA and the specific primer pair HSP70 screening FOR/REV.

    Electrophoresis:

    Article Title: Assessment of Heat Shock Protein 70 Induction by Heat in Alfalfa Varieties and Constitutive Overexpression in Transgenic Plants
    Article Snippet: First strand cDNA was synthesized from 2 μg of total RNA using SuperScriptII Reverse Transcriptase (Invitrogen, http://www.invitrogen.com ), according to the manufacturer’s protocol. .. A qualitative RT-PCR was performed using 5 μl of cDNA and the specific primer pair HSP70 screening FOR/REV.

    Ethanol Precipitation:

    Article Title: In vivo expression technology and 5′ end mapping of the Borrelia burgdorferi transcriptome identify novel RNAs expressed during mammalian infection
    Article Snippet: RNA libraries were then 3′ end dephosphorylated using 10 U T4 Polynucleotide Kinase (PNK) (NEB), minus ATP, with 1X PNK buffer and 20 U rRNasin (Promega) at 37°C for 3 h. A subsequent PCI and ethanol precipitation was performed to purify the libraries, which were then size selected on an 8% polyacrylamide 8 M urea gel. .. Adapter conjugated RNA library preps were converted to cDNA with SuperScriptII reverse transcriptase (Invitrogen) and random nonamers, per manufacturer's instructions.

    Random Hexamer Labeling:

    Article Title: Concomitant downregulation of the imprinted genes DLK1 and MEG3 at 14q32.2 by epigenetic mechanisms in urothelial carcinoma
    Article Snippet: Total RNA was isolated from subconfluent cell cultures and cell lines or from powdered tissues using the RNeasy Mini or Micro Kit (Qiagen, Hilden, Germany). .. Two μg RNA was reverse transcribed using 200 U SuperScriptII reverse transcriptase (Invitrogen, Darmstadt, Germany), with 300 ng oligo-dT and 25 ng random hexamer primers in a reaction volume of 20 μl. .. Real-time PCR assays were performed with the ABI7900HT System using the QuantiTect SYBR Green PCR Kit (Qiagen, Hilden, Germany) and QuantiTect primer assays for DLK1 and TBP in a reaction volume of 25 μl.

    Article Title: Canonical Notch signalling is inactive in urothelial carcinoma
    Article Snippet: Total RNA was isolated from sub-confluent cell lines using the RNeasy Mini Kit (Qiagen, Hilden, Germany). .. RNA was reverse transcribed using 200 U SuperScriptII reverse transcriptase (Invitrogen, Darmstadt, Germany), with 300 ng oligo-dT and 25 ng random hexamer primers. .. Real Time-PCR assays were performed with the ABI7900HT System using the QuantiTect SYBR Green PCR Kit (Qiagen) and premade or self-designed primers (Additional file : Tables S1–S2).

    Spectrophotometry:

    Article Title: Low level genome mistranslations deregulate the transcriptome and translatome and generate proteotoxic stress in yeast
    Article Snippet: Briefly, total yeast RNA extracts were prepared using hot phenol (T0' to T180'). cDNA synthesis was carried out using 40 μg of total RNA extracted from T0' to T180' samples and SuperscriptII Reverse Transcriptase (Invitrogen, Carlsbad, CA, USA). .. For labeling, all cDNAs were synthesized in presence of aminoallyl-dUTP (Sigma-Aldrich, Munich, Germany), purified using Microcon-30 (Millipore, Billerica, MA, USA) columns and were coupled to Cy3 or Cy5 fluorophores (Amersham Biosciences, Piscataway, NJ, USA).

    Produced:

    Article Title: An Integrated Analysis of miRNAs and Methylated Genes Encoding mRNAs and lncRNAs in Sheep Breeds with Different Fecundity
    Article Snippet: Initially, the resulting libraries were sequenced on a HiSeq 2000 instrument, which produced 100 nucleotide paired-end reads. .. Next, the RNA was reverse transcribed with SuperScriptII Reverse Transcriptase (Invitrogen).

    DNA Purification:

    Article Title: ssODN-mediated knock-in with CRISPR-Cas for large genomic regions in zygotes
    Article Snippet: For mutation detection, genomic DNA was extracted from tail biopsies using a GENEXTRACTOR TA-100 automatic DNA purification system (Takara Bio). .. First strand cDNA was synthesized from 5 μg of total RNA that had been treated with DNase using an oligo(dT)12–18 primer and SuperscriptII reverse transcriptase (Invitrogen).

    Standard Deviation:

    Article Title: Allelic expression mapping across cellular lineages to establish impact of non-coding SNPs
    Article Snippet: First-strand cDNA synthesis was performed using SuperScriptII reverse transcriptase (Invitrogen Corporation, Carlsbad, CA, USA) according to the manufacturer's recommendations and as described above. .. First-strand cDNA synthesis was performed using SuperScriptII reverse transcriptase (Invitrogen Corporation, Carlsbad, CA, USA) according to the manufacturer's recommendations and as described above.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher superscript iii reverse transcriptase kit
    <t>IEC</t> intrinsic MyD88 signaling promotes barrier function of the epithelium. (A, B) Gene expression in IEC isolated before (control) or on day 4 p.i. (infected) with C . rodentium from the colon of WT, MyD OFF and IEC-MyD ON mice. Data shown as mean relative expression to Actb . (C) Principal component analysis of the intestinal microbiota in individual mice before (control) or on day 4 p.i. (infected) with C . rodentium . (D) Intestinal permeability in WT, MyD OFF and IEC-MyD ON mice before (control) or on day 8 p.i. (infected) with C . rodentium . FITC-dextran serum levels were determined 4 h after oral administration of this compound. Data were pooled from two (C), <t>three</t> (D) or four (A, B) independent experiments with n = 3–5 mice per group. Error bar represents +SEM. One-Way ANOVA with Bonferroni’s Multiple Comparison test (A, B, D); *p
    Superscript Iii Reverse Transcriptase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 380 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Thermo Fisher
    Average 99 stars, based on 380 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    78
    Thermo Fisher superscript iii reverse transcriptase
    Full <t>WSN</t> HA sequence logo plot: ATF6f/XBP1s 37˚C vs. Basal 37˚C. Logo plot displays variants that behaved consistently across <t>three</t> biological replicates. Variants above the line (representative of selection on wild-type) were enriched upon ATF6f/XBP1s induction at 37˚C; variants below the line were depleted. The wild-type WSN HA residue is shown below the corresponding logo, with the sites numbered below the wild-type sequence (based on sequential numbering of WSN HA). The size of the amino acid letter abbreviation is proportional to the diffsel for that amino acid variant, and all logo plots are plotted on the same scale.
    Superscript Iii Reverse Transcriptase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase/product/Thermo Fisher
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase - by Bioz Stars, 2020-01
    78/100 stars
      Buy from Supplier

    Image Search Results


    IEC intrinsic MyD88 signaling promotes barrier function of the epithelium. (A, B) Gene expression in IEC isolated before (control) or on day 4 p.i. (infected) with C . rodentium from the colon of WT, MyD OFF and IEC-MyD ON mice. Data shown as mean relative expression to Actb . (C) Principal component analysis of the intestinal microbiota in individual mice before (control) or on day 4 p.i. (infected) with C . rodentium . (D) Intestinal permeability in WT, MyD OFF and IEC-MyD ON mice before (control) or on day 8 p.i. (infected) with C . rodentium . FITC-dextran serum levels were determined 4 h after oral administration of this compound. Data were pooled from two (C), three (D) or four (A, B) independent experiments with n = 3–5 mice per group. Error bar represents +SEM. One-Way ANOVA with Bonferroni’s Multiple Comparison test (A, B, D); *p

    Journal: PLoS Pathogens

    Article Title: MyD88 signaling in dendritic cells and the intestinal epithelium controls immunity against intestinal infection with C. rodentium

    doi: 10.1371/journal.ppat.1006357

    Figure Lengend Snippet: IEC intrinsic MyD88 signaling promotes barrier function of the epithelium. (A, B) Gene expression in IEC isolated before (control) or on day 4 p.i. (infected) with C . rodentium from the colon of WT, MyD OFF and IEC-MyD ON mice. Data shown as mean relative expression to Actb . (C) Principal component analysis of the intestinal microbiota in individual mice before (control) or on day 4 p.i. (infected) with C . rodentium . (D) Intestinal permeability in WT, MyD OFF and IEC-MyD ON mice before (control) or on day 8 p.i. (infected) with C . rodentium . FITC-dextran serum levels were determined 4 h after oral administration of this compound. Data were pooled from two (C), three (D) or four (A, B) independent experiments with n = 3–5 mice per group. Error bar represents +SEM. One-Way ANOVA with Bonferroni’s Multiple Comparison test (A, B, D); *p

    Article Snippet: RNA from IEC was isolated using TRIzol and transcribed into cDNA using SuperScript III Reverse Transcriptase Kit (both from Thermo Fisher Scientific).

    Techniques: Expressing, Isolation, Infection, Mouse Assay, Permeability

    MyD88-dependent signaling in IEC contributes to host resistance to infection. (A) Survival of WT, MyD OFF and IEC-MyD ON mice following infection with C . rodentium . (B) Bacterial load in the feces and the liver on day 8 p.i. (C) ILC3 response on day 4 p.i. with C . rodentium . Cells were isolated from the cLP and analyzed by flow cytometry. Representative plots showing the frequency of IL-22 + cells within live ILC3. Graphs represent frequency (%) of IL-22 + and IL-17A + cells amongst live ILC3. (D) Representative H E colon sections on day 8 p.i. with C . rodentium . Black asterisks indicate inflammatory infiltration into to the cLP; black arrow heads indicate crypt elongation. Scale represents 100 μm. Bar graph represents inflammation score based on infiltration and epithelial hyperplasia. (E) Colonic T cell response on day 8 p.i. Representative flow cytometry plots of live CD3 + CD4 + T isolated from the cLP and stained for IL-17A and IFN-γ. Dot plots represent frequency (%) of colonic IL-17A + (IFN-γ +/− ) and IFN-γ + (IL-17 +/− ) cells amongst live CD3 + CD4 + T cells. Data were pooled from two individual experiments with a total of n = 11 mice per group (A) or pooled from two (D) or three (B, C, E) independent experiments with n = 2–5 mice per group. Horizontal bar represents mean. Error bar represents +SEM. Dashed line indicates the limit of detection. Log-rank test (A) and One-Way ANOVA with Bonferroni’s Multiple Comparison test (B-E); *p

    Journal: PLoS Pathogens

    Article Title: MyD88 signaling in dendritic cells and the intestinal epithelium controls immunity against intestinal infection with C. rodentium

    doi: 10.1371/journal.ppat.1006357

    Figure Lengend Snippet: MyD88-dependent signaling in IEC contributes to host resistance to infection. (A) Survival of WT, MyD OFF and IEC-MyD ON mice following infection with C . rodentium . (B) Bacterial load in the feces and the liver on day 8 p.i. (C) ILC3 response on day 4 p.i. with C . rodentium . Cells were isolated from the cLP and analyzed by flow cytometry. Representative plots showing the frequency of IL-22 + cells within live ILC3. Graphs represent frequency (%) of IL-22 + and IL-17A + cells amongst live ILC3. (D) Representative H E colon sections on day 8 p.i. with C . rodentium . Black asterisks indicate inflammatory infiltration into to the cLP; black arrow heads indicate crypt elongation. Scale represents 100 μm. Bar graph represents inflammation score based on infiltration and epithelial hyperplasia. (E) Colonic T cell response on day 8 p.i. Representative flow cytometry plots of live CD3 + CD4 + T isolated from the cLP and stained for IL-17A and IFN-γ. Dot plots represent frequency (%) of colonic IL-17A + (IFN-γ +/− ) and IFN-γ + (IL-17 +/− ) cells amongst live CD3 + CD4 + T cells. Data were pooled from two individual experiments with a total of n = 11 mice per group (A) or pooled from two (D) or three (B, C, E) independent experiments with n = 2–5 mice per group. Horizontal bar represents mean. Error bar represents +SEM. Dashed line indicates the limit of detection. Log-rank test (A) and One-Way ANOVA with Bonferroni’s Multiple Comparison test (B-E); *p

    Article Snippet: RNA from IEC was isolated using TRIzol and transcribed into cDNA using SuperScript III Reverse Transcriptase Kit (both from Thermo Fisher Scientific).

    Techniques: Infection, Mouse Assay, Isolation, Flow Cytometry, Cytometry, Staining

    Full WSN HA sequence logo plot: ATF6f/XBP1s 37˚C vs. Basal 37˚C. Logo plot displays variants that behaved consistently across three biological replicates. Variants above the line (representative of selection on wild-type) were enriched upon ATF6f/XBP1s induction at 37˚C; variants below the line were depleted. The wild-type WSN HA residue is shown below the corresponding logo, with the sites numbered below the wild-type sequence (based on sequential numbering of WSN HA). The size of the amino acid letter abbreviation is proportional to the diffsel for that amino acid variant, and all logo plots are plotted on the same scale.

    Journal: eLife

    Article Title: Enhanced ER proteostasis and temperature differentially impact the mutational tolerance of influenza hemagglutinin

    doi: 10.7554/eLife.38795

    Figure Lengend Snippet: Full WSN HA sequence logo plot: ATF6f/XBP1s 37˚C vs. Basal 37˚C. Logo plot displays variants that behaved consistently across three biological replicates. Variants above the line (representative of selection on wild-type) were enriched upon ATF6f/XBP1s induction at 37˚C; variants below the line were depleted. The wild-type WSN HA residue is shown below the corresponding logo, with the sites numbered below the wild-type sequence (based on sequential numbering of WSN HA). The size of the amino acid letter abbreviation is proportional to the diffsel for that amino acid variant, and all logo plots are plotted on the same scale.

    Article Snippet: Viral RNA was extracted from 140 μL infectious supernatant using the QIAamp Viral RNA Mini kit and at least 106 HA molecules were reverse transcribed using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) with 5ʹ-WSN-HA and 3ʹ-WSN-HA primers ( ).

    Techniques: Hemagglutination Assay, Sequencing, Selection, Variant Assay

    Full WSN HA sequence logo plot: ATF6f/XBP1s 39˚C vs. Basal 39˚C. Logo plot displays variants that behaved consistently across three biological replicates. Variants above the line (representative of selection on wild-type) were enriched upon ATF6f/XBP1s induction at 39˚C; variants below the line were depleted. The wild-type WSN HA residue is shown below the corresponding logo, with the sites numbered below the wild-type sequence (based on sequential numbering of WSN HA). The size of the amino acid letter abbreviation is proportional to the diffsel for that amino acid variant, and all logo plots are plotted on the same scale.

    Journal: eLife

    Article Title: Enhanced ER proteostasis and temperature differentially impact the mutational tolerance of influenza hemagglutinin

    doi: 10.7554/eLife.38795

    Figure Lengend Snippet: Full WSN HA sequence logo plot: ATF6f/XBP1s 39˚C vs. Basal 39˚C. Logo plot displays variants that behaved consistently across three biological replicates. Variants above the line (representative of selection on wild-type) were enriched upon ATF6f/XBP1s induction at 39˚C; variants below the line were depleted. The wild-type WSN HA residue is shown below the corresponding logo, with the sites numbered below the wild-type sequence (based on sequential numbering of WSN HA). The size of the amino acid letter abbreviation is proportional to the diffsel for that amino acid variant, and all logo plots are plotted on the same scale.

    Article Snippet: Viral RNA was extracted from 140 μL infectious supernatant using the QIAamp Viral RNA Mini kit and at least 106 HA molecules were reverse transcribed using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) with 5ʹ-WSN-HA and 3ʹ-WSN-HA primers ( ).

    Techniques: Hemagglutination Assay, Sequencing, Selection, Variant Assay

    Full WSN HA sequence logo plot: XBP1s 39˚C vs. Basal 39˚C. Logo plot displays variants that behaved consistently across three biological replicates. Variants above the line (representative of selection on wild-type) were enriched upon XBP1s induction at 39˚C; variants below the line were depleted. The wild-type WSN HA residue is shown below the corresponding logo, with the sites numbered below the wild-type sequence (based on sequential numbering of WSN HA). The size of the amino acid letter abbreviation is proportional to the diffsel for that amino acid variant, and all logo plots are plotted on the same scale.

    Journal: eLife

    Article Title: Enhanced ER proteostasis and temperature differentially impact the mutational tolerance of influenza hemagglutinin

    doi: 10.7554/eLife.38795

    Figure Lengend Snippet: Full WSN HA sequence logo plot: XBP1s 39˚C vs. Basal 39˚C. Logo plot displays variants that behaved consistently across three biological replicates. Variants above the line (representative of selection on wild-type) were enriched upon XBP1s induction at 39˚C; variants below the line were depleted. The wild-type WSN HA residue is shown below the corresponding logo, with the sites numbered below the wild-type sequence (based on sequential numbering of WSN HA). The size of the amino acid letter abbreviation is proportional to the diffsel for that amino acid variant, and all logo plots are plotted on the same scale.

    Article Snippet: Viral RNA was extracted from 140 μL infectious supernatant using the QIAamp Viral RNA Mini kit and at least 106 HA molecules were reverse transcribed using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) with 5ʹ-WSN-HA and 3ʹ-WSN-HA primers ( ).

    Techniques: Hemagglutination Assay, Sequencing, Selection, Variant Assay

    Full WSN HA sequence logo plot: XBP1s 37˚C vs. Basal 37˚C. Logo plot displays variants that behaved consistently across three biological replicates. Variants above the line (representative of selection on wild-type) were enriched upon XBP1s induction at 37˚C; variants below the line were depleted. The wild-type WSN HA residue is shown below the corresponding logo, with the sites numbered below the wild-type sequence (based on sequential numbering of WSN HA). The size of the amino acid letter abbreviation is proportional to the diffsel for that amino acid variant, and all logo plots are plotted on the same scale.

    Journal: eLife

    Article Title: Enhanced ER proteostasis and temperature differentially impact the mutational tolerance of influenza hemagglutinin

    doi: 10.7554/eLife.38795

    Figure Lengend Snippet: Full WSN HA sequence logo plot: XBP1s 37˚C vs. Basal 37˚C. Logo plot displays variants that behaved consistently across three biological replicates. Variants above the line (representative of selection on wild-type) were enriched upon XBP1s induction at 37˚C; variants below the line were depleted. The wild-type WSN HA residue is shown below the corresponding logo, with the sites numbered below the wild-type sequence (based on sequential numbering of WSN HA). The size of the amino acid letter abbreviation is proportional to the diffsel for that amino acid variant, and all logo plots are plotted on the same scale.

    Article Snippet: Viral RNA was extracted from 140 μL infectious supernatant using the QIAamp Viral RNA Mini kit and at least 106 HA molecules were reverse transcribed using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) with 5ʹ-WSN-HA and 3ʹ-WSN-HA primers ( ).

    Techniques: Hemagglutination Assay, Sequencing, Selection, Variant Assay

    Full WSN HA sequence logo plot: Basal 39˚C vs. Basal 37˚C. Logo plot displays variants that behaved consistently across three biological replicates. Variants above the line (representative of selection on wild-type) were enriched at 39˚C relative to 37˚C in a basal environment; variants below the line were depleted at 39˚C. The wild-type WSN HA residue is shown below the corresponding logo, with the sites numbered below the wild-type sequence (based on sequential numbering of WSN HA). The size of the amino acid letter abbreviation is proportional to the diffsel for that amino acid variant, and all logo plots are plotted on the same scale.

    Journal: eLife

    Article Title: Enhanced ER proteostasis and temperature differentially impact the mutational tolerance of influenza hemagglutinin

    doi: 10.7554/eLife.38795

    Figure Lengend Snippet: Full WSN HA sequence logo plot: Basal 39˚C vs. Basal 37˚C. Logo plot displays variants that behaved consistently across three biological replicates. Variants above the line (representative of selection on wild-type) were enriched at 39˚C relative to 37˚C in a basal environment; variants below the line were depleted at 39˚C. The wild-type WSN HA residue is shown below the corresponding logo, with the sites numbered below the wild-type sequence (based on sequential numbering of WSN HA). The size of the amino acid letter abbreviation is proportional to the diffsel for that amino acid variant, and all logo plots are plotted on the same scale.

    Article Snippet: Viral RNA was extracted from 140 μL infectious supernatant using the QIAamp Viral RNA Mini kit and at least 106 HA molecules were reverse transcribed using SuperScript III Reverse Transcriptase (Thermo Fisher Scientific) with 5ʹ-WSN-HA and 3ʹ-WSN-HA primers ( ).

    Techniques: Hemagglutination Assay, Sequencing, Selection, Variant Assay

    Expression patterns of selected miRNAs obtained by high throughput sequencing and their target genes. ( A ) Northern blot was performed to analyse expression levels of miRNAs at 2 mm region of chickpea root apex after 1 hr and 2 hrs of PEG and salt treatments. 15 µg of enriched small RNA from control and treated samples was loaded on denaturing (7 M urea) polyacrylamide (15%) gel. Radiolabeled antisense probes were used for hybridization. Ethidium bromide-stained small RNAs were shown for equal loading. SnoRD24 was used as control. Size markers (24 nt and 21 nt) were electrophoresed together with the experimental samples and separated before hybridization with marker-specific probes. ( B ) Expression pattern of the miRNAs shown in Fig. 6A and their predicted target genes in response to the same treatments as assessed by qRT-PCR. Standard deviations of three replicates were shown. CaEF1α was used as internal control for normalization. Grey and black lines represent salt and water deficit stress treatments, respectively. While dotted and solid lines represent miRNA and target gene, respectively.

    Journal: Scientific Reports

    Article Title: MicroRNA profiling provides insights into post-transcriptional regulation of gene expression in chickpea root apex under salinity and water deficiency

    doi: 10.1038/s41598-017-04906-z

    Figure Lengend Snippet: Expression patterns of selected miRNAs obtained by high throughput sequencing and their target genes. ( A ) Northern blot was performed to analyse expression levels of miRNAs at 2 mm region of chickpea root apex after 1 hr and 2 hrs of PEG and salt treatments. 15 µg of enriched small RNA from control and treated samples was loaded on denaturing (7 M urea) polyacrylamide (15%) gel. Radiolabeled antisense probes were used for hybridization. Ethidium bromide-stained small RNAs were shown for equal loading. SnoRD24 was used as control. Size markers (24 nt and 21 nt) were electrophoresed together with the experimental samples and separated before hybridization with marker-specific probes. ( B ) Expression pattern of the miRNAs shown in Fig. 6A and their predicted target genes in response to the same treatments as assessed by qRT-PCR. Standard deviations of three replicates were shown. CaEF1α was used as internal control for normalization. Grey and black lines represent salt and water deficit stress treatments, respectively. While dotted and solid lines represent miRNA and target gene, respectively.

    Article Snippet: For miRNAs stem-loop primers were designed and cDNA for individual miRNA was prepared by pulse-RT reaction using SuperScript® III Reverse Transcriptase (Thermo Fisher Scientific) , .

    Techniques: Expressing, Next-Generation Sequencing, Northern Blot, Hybridization, Staining, Marker, Quantitative RT-PCR

    Expression analysis of genome-annotated conserved miRNAs in chickpea root apex under PEG and salt treatment. ( A ) Northern blot was performed to analyse expression levels of miRNAs at 2 mm region of chickpea root apex after 1 hr and 2 hrs of PEG and salt treatments. 15 µg of enriched small RNA from control and treated samples was loaded on denaturing (7 M urea) polyacrylamide (15%) gel. Radiolabeled antisense probes were used for hybridization. Ethidium bromide-stained small RNAs were shown for equal loading. SnoRD24 was used as control. ( B ) Expression pattern of the miRNAs shown in Fig. 2A and their predicted target genes in response to the same treatments as assessed by qRT-PCR. Standard deviations of three replicates were shown. CaEF1α was used as internal control for normalization. Grey and black lines represent salt and water deficit stress treatments, respectively. While dotted and solid lines represent miRNA and target gene, respectively.

    Journal: Scientific Reports

    Article Title: MicroRNA profiling provides insights into post-transcriptional regulation of gene expression in chickpea root apex under salinity and water deficiency

    doi: 10.1038/s41598-017-04906-z

    Figure Lengend Snippet: Expression analysis of genome-annotated conserved miRNAs in chickpea root apex under PEG and salt treatment. ( A ) Northern blot was performed to analyse expression levels of miRNAs at 2 mm region of chickpea root apex after 1 hr and 2 hrs of PEG and salt treatments. 15 µg of enriched small RNA from control and treated samples was loaded on denaturing (7 M urea) polyacrylamide (15%) gel. Radiolabeled antisense probes were used for hybridization. Ethidium bromide-stained small RNAs were shown for equal loading. SnoRD24 was used as control. ( B ) Expression pattern of the miRNAs shown in Fig. 2A and their predicted target genes in response to the same treatments as assessed by qRT-PCR. Standard deviations of three replicates were shown. CaEF1α was used as internal control for normalization. Grey and black lines represent salt and water deficit stress treatments, respectively. While dotted and solid lines represent miRNA and target gene, respectively.

    Article Snippet: For miRNAs stem-loop primers were designed and cDNA for individual miRNA was prepared by pulse-RT reaction using SuperScript® III Reverse Transcriptase (Thermo Fisher Scientific) , .

    Techniques: Expressing, Northern Blot, Hybridization, Staining, Quantitative RT-PCR

    Validation of predicted miRNA targets. ( A ) Predicted secondary structures of miR397, miR5507 and novmiR2. ( B ) Predicted target sequences of miR397, miR5507 and novmiR2. ( C – E ) Candidate miRNA-target interaction was validated by transient over-expression of miRNA precursor sequence in chickpea leaf tissue by agaroinfiltration and change in expression pattern of their respective target genes was estimated by qRT-PCR as compared with control sample. The data represent three biological and three technical replicates for qRT-PCR and two independent samples were used for semi-quantitative RT-PCR. * indicates statistically significant change (p

    Journal: Scientific Reports

    Article Title: MicroRNA profiling provides insights into post-transcriptional regulation of gene expression in chickpea root apex under salinity and water deficiency

    doi: 10.1038/s41598-017-04906-z

    Figure Lengend Snippet: Validation of predicted miRNA targets. ( A ) Predicted secondary structures of miR397, miR5507 and novmiR2. ( B ) Predicted target sequences of miR397, miR5507 and novmiR2. ( C – E ) Candidate miRNA-target interaction was validated by transient over-expression of miRNA precursor sequence in chickpea leaf tissue by agaroinfiltration and change in expression pattern of their respective target genes was estimated by qRT-PCR as compared with control sample. The data represent three biological and three technical replicates for qRT-PCR and two independent samples were used for semi-quantitative RT-PCR. * indicates statistically significant change (p

    Article Snippet: For miRNAs stem-loop primers were designed and cDNA for individual miRNA was prepared by pulse-RT reaction using SuperScript® III Reverse Transcriptase (Thermo Fisher Scientific) , .

    Techniques: Over Expression, Sequencing, Expressing, Quantitative RT-PCR

    LncR492 cooperates with HuR by activation of Wnt signaling. (A) QRT-PCR analysis of lncR492 and Srrm4 after HuR knock-down. Data presents the mean ± SD of four independent experiments. (B) QRT-PCR analysis of lncR492 and Srrm4 after HuR overexpression. Data presents the mean ± SD of four independent experiments. EV—empty vector. (C) Luciferase assay for Wnt signaling using the TOP-Flash and FOP-Flash luciferase construct after esiRNA transfection. Data presents mean ± SD of three independent experiments. (D) Luciferase assay for Wnt signaling after lncR492 or HuR overexpression. Data presents mean ± SD of three independent experiments. * p

    Journal: PLoS ONE

    Article Title: The long noncoding RNA lncR492 inhibits neural differentiation of murine embryonic stem cells

    doi: 10.1371/journal.pone.0191682

    Figure Lengend Snippet: LncR492 cooperates with HuR by activation of Wnt signaling. (A) QRT-PCR analysis of lncR492 and Srrm4 after HuR knock-down. Data presents the mean ± SD of four independent experiments. (B) QRT-PCR analysis of lncR492 and Srrm4 after HuR overexpression. Data presents the mean ± SD of four independent experiments. EV—empty vector. (C) Luciferase assay for Wnt signaling using the TOP-Flash and FOP-Flash luciferase construct after esiRNA transfection. Data presents mean ± SD of three independent experiments. (D) Luciferase assay for Wnt signaling after lncR492 or HuR overexpression. Data presents mean ± SD of three independent experiments. * p

    Article Snippet: 1 μg of RNA was reverse transcribed with SuperScript III Reverse Transcriptase (ThermoFisher Scientific) utilizing oligo(dT)18 primer. qRT-RCR were run as described above.

    Techniques: Activation Assay, Quantitative RT-PCR, Over Expression, Plasmid Preparation, Luciferase, Construct, esiRNA, Transfection

    RNAi screen for Sox1-regulating lncRNAs. (A) Schematic overview over screening setup. Sox1-GFP cells were transfected with esiRNAs targeting lncRNAs under self-renewing conditions. The next day differentiation was initiated by media change and 4 days after differentiation Sox1-GFP expression was analysed by FACS. (B) Z-score values of the primary screen. Rad21 and Apc knock-down were used as controls. (C) Knock-down efficiency of lncR492 targeting esiRNA was tested by qRT-PCR. Data presents the mean ± SD of three independent experiments. Data was normalized to esiControl. (D) FACS analysis of % Sox1-GFP positive cells after esiRNA transfection and 4 days of differentiation. Validation of screening results with two independent esiRNAs. Apc and Rad21 were targeted as controls. Data presents mean ± SD of 5 independent experiments. * p

    Journal: PLoS ONE

    Article Title: The long noncoding RNA lncR492 inhibits neural differentiation of murine embryonic stem cells

    doi: 10.1371/journal.pone.0191682

    Figure Lengend Snippet: RNAi screen for Sox1-regulating lncRNAs. (A) Schematic overview over screening setup. Sox1-GFP cells were transfected with esiRNAs targeting lncRNAs under self-renewing conditions. The next day differentiation was initiated by media change and 4 days after differentiation Sox1-GFP expression was analysed by FACS. (B) Z-score values of the primary screen. Rad21 and Apc knock-down were used as controls. (C) Knock-down efficiency of lncR492 targeting esiRNA was tested by qRT-PCR. Data presents the mean ± SD of three independent experiments. Data was normalized to esiControl. (D) FACS analysis of % Sox1-GFP positive cells after esiRNA transfection and 4 days of differentiation. Validation of screening results with two independent esiRNAs. Apc and Rad21 were targeted as controls. Data presents mean ± SD of 5 independent experiments. * p

    Article Snippet: 1 μg of RNA was reverse transcribed with SuperScript III Reverse Transcriptase (ThermoFisher Scientific) utilizing oligo(dT)18 primer. qRT-RCR were run as described above.

    Techniques: Transfection, Expressing, FACS, esiRNA, Quantitative RT-PCR

    LncR492 inhibits specifically neural differentiation. (A) Gene expression analysis by qRT-PCR in Sox1-GFP ESCs during 4 days of differentiation in N2B27. Data presents the mean ± SD of three independent experiments. (B) Immunofluorescent analysis of Sox1-GFP ESC after 72h of differentiation. Endogenous GFP (green), Tubb3 (red) and DAPI (blue) are shown. Scale bar 50 μm. Bar graph shows quantification of Tubb3 positive cells, which were normalized to the overall cell number. (C) Time course analysis of gene expression by qRT-PCR after lncR492 knock-down in Sox1-GFP ESCs. Data presents mean ± SD of three independent experiments. (D) Transient overexpression of lncR492 analysed by qRT-PCR in Sox1-GFP ESCs. Data presents the mean ± SD of three independent experiments. EV—empty vector. (E) FACS analysis of % Sox1-GFP positive cells after overexpression of lncR492 and 4 days of differentiation. Data presents mean ± SD of 4 independent experiments. (F) FACS analysis of % T-GFP positive cells after overexpression of lncR492 and 4 days of differentiation. Data presents mean ± SD of 4 independent experiments. (G) FACS analysis of % Foxa2-GFP positive cells after overexpression of lncR492 and 4 days of differentiation. Data presents mean ± SD of 4 independent experiments. * p

    Journal: PLoS ONE

    Article Title: The long noncoding RNA lncR492 inhibits neural differentiation of murine embryonic stem cells

    doi: 10.1371/journal.pone.0191682

    Figure Lengend Snippet: LncR492 inhibits specifically neural differentiation. (A) Gene expression analysis by qRT-PCR in Sox1-GFP ESCs during 4 days of differentiation in N2B27. Data presents the mean ± SD of three independent experiments. (B) Immunofluorescent analysis of Sox1-GFP ESC after 72h of differentiation. Endogenous GFP (green), Tubb3 (red) and DAPI (blue) are shown. Scale bar 50 μm. Bar graph shows quantification of Tubb3 positive cells, which were normalized to the overall cell number. (C) Time course analysis of gene expression by qRT-PCR after lncR492 knock-down in Sox1-GFP ESCs. Data presents mean ± SD of three independent experiments. (D) Transient overexpression of lncR492 analysed by qRT-PCR in Sox1-GFP ESCs. Data presents the mean ± SD of three independent experiments. EV—empty vector. (E) FACS analysis of % Sox1-GFP positive cells after overexpression of lncR492 and 4 days of differentiation. Data presents mean ± SD of 4 independent experiments. (F) FACS analysis of % T-GFP positive cells after overexpression of lncR492 and 4 days of differentiation. Data presents mean ± SD of 4 independent experiments. (G) FACS analysis of % Foxa2-GFP positive cells after overexpression of lncR492 and 4 days of differentiation. Data presents mean ± SD of 4 independent experiments. * p

    Article Snippet: 1 μg of RNA was reverse transcribed with SuperScript III Reverse Transcriptase (ThermoFisher Scientific) utilizing oligo(dT)18 primer. qRT-RCR were run as described above.

    Techniques: Expressing, Quantitative RT-PCR, Over Expression, Plasmid Preparation, FACS