superscript iii system  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    SuperScript III First Strand Synthesis System
    Description:
    The SuperScript III First Strand Synthesis System for RT PCR is optimized to synthesize first strand cDNA from purified poly A or total RNA RNA targets from 100 bp to 12 kb can be detected with this system The amount of starting material can vary from 1 pg 5 µg of total RNA SuperScript III Reverse Transcriptase is a version of M MLV RT that has been engineered to reduce RNase H activity and provide increased thermal stability The enzyme is used to synthesize cDNA at a temperature range of 42 55°C providing increased specificity higher yields of cDNA and more full length product than other reverse transcriptases Because SuperScript III RT is not significantly inhibited by ribosomal and transfer RNA it may be used to synthesize first strand cDNA from a total RNA preparation Using the SuperScript III First Strand SystemcDNA synthesis is performed in the first step using either total RNA or poly A selected RNA primed with oligo dT random primers or a gene specific primer In the second step PCR is performed in a separate tube using primers specific for the gene of interest For the PCR reaction we recommend one of the following DNA polymerases Platinum Taq DNA Polymerase provides automatic hot start conditions for increased specificity up to 4 kb Platinum Taq DNA Polymerase High Fidelity provides increased yield and high fidelity for targets up to 15 kb and Platinum Pfx DNA Polymerase provides maximum fidelity for targets up to 12 kb
    Catalog Number:
    18080051
    Price:
    None
    Applications:
    PCR & Real-Time PCR|Reverse Transcription
    Category:
    Kits and Assays
    Buy from Supplier


    Structured Review

    Thermo Fisher superscript iii system
    Antisense transcripts in DM2 and tetrapeptide RAN proteins expressed across CCUG and CAGG expansion RNAs. (A) Schematic diagram of CAGG antisense transcripts and relative location of primers for strand-specific RT-PCR. (B, C) <t>qRT-PCR</t> showing elevated antisense mRNA relative to β-actin in DM2 compared with controls. n=3 samples/group, experiments performed at least <t>three</t> times, error bars show standard deviation (SD) with at least three technical replicates (D) Diagram of putative proteins translated from sense and antisense DM2 transcripts. (E) Non-ATG CCTG and CAGG constructs with 6X stop-codon cassette, two stops in each frame, upstream of the CCTG expansion with C-terminal tags in all three reading frames. Immunoblots of transfected HEK293T cells show expanded LPAC proteins (F) and QAGR proteins (H) are expressed in all three frames. IF detection of (LPAC) EXP proteins (G) and (QAGR) EXP .
    The SuperScript III First Strand Synthesis System for RT PCR is optimized to synthesize first strand cDNA from purified poly A or total RNA RNA targets from 100 bp to 12 kb can be detected with this system The amount of starting material can vary from 1 pg 5 µg of total RNA SuperScript III Reverse Transcriptase is a version of M MLV RT that has been engineered to reduce RNase H activity and provide increased thermal stability The enzyme is used to synthesize cDNA at a temperature range of 42 55°C providing increased specificity higher yields of cDNA and more full length product than other reverse transcriptases Because SuperScript III RT is not significantly inhibited by ribosomal and transfer RNA it may be used to synthesize first strand cDNA from a total RNA preparation Using the SuperScript III First Strand SystemcDNA synthesis is performed in the first step using either total RNA or poly A selected RNA primed with oligo dT random primers or a gene specific primer In the second step PCR is performed in a separate tube using primers specific for the gene of interest For the PCR reaction we recommend one of the following DNA polymerases Platinum Taq DNA Polymerase provides automatic hot start conditions for increased specificity up to 4 kb Platinum Taq DNA Polymerase High Fidelity provides increased yield and high fidelity for targets up to 15 kb and Platinum Pfx DNA Polymerase provides maximum fidelity for targets up to 12 kb
    https://www.bioz.com/result/superscript iii system/product/Thermo Fisher
    Average 99 stars, based on 132 article reviews
    Price from $9.99 to $1999.99
    superscript iii system - by Bioz Stars, 2020-09
    99/100 stars

    Images

    1) Product Images from "RAN Translation Regulated by Muscleblind Proteins in Myotonic Dystrophy Type 2"

    Article Title: RAN Translation Regulated by Muscleblind Proteins in Myotonic Dystrophy Type 2

    Journal: Neuron

    doi: 10.1016/j.neuron.2017.08.039

    Antisense transcripts in DM2 and tetrapeptide RAN proteins expressed across CCUG and CAGG expansion RNAs. (A) Schematic diagram of CAGG antisense transcripts and relative location of primers for strand-specific RT-PCR. (B, C) qRT-PCR showing elevated antisense mRNA relative to β-actin in DM2 compared with controls. n=3 samples/group, experiments performed at least three times, error bars show standard deviation (SD) with at least three technical replicates (D) Diagram of putative proteins translated from sense and antisense DM2 transcripts. (E) Non-ATG CCTG and CAGG constructs with 6X stop-codon cassette, two stops in each frame, upstream of the CCTG expansion with C-terminal tags in all three reading frames. Immunoblots of transfected HEK293T cells show expanded LPAC proteins (F) and QAGR proteins (H) are expressed in all three frames. IF detection of (LPAC) EXP proteins (G) and (QAGR) EXP .
    Figure Legend Snippet: Antisense transcripts in DM2 and tetrapeptide RAN proteins expressed across CCUG and CAGG expansion RNAs. (A) Schematic diagram of CAGG antisense transcripts and relative location of primers for strand-specific RT-PCR. (B, C) qRT-PCR showing elevated antisense mRNA relative to β-actin in DM2 compared with controls. n=3 samples/group, experiments performed at least three times, error bars show standard deviation (SD) with at least three technical replicates (D) Diagram of putative proteins translated from sense and antisense DM2 transcripts. (E) Non-ATG CCTG and CAGG constructs with 6X stop-codon cassette, two stops in each frame, upstream of the CCTG expansion with C-terminal tags in all three reading frames. Immunoblots of transfected HEK293T cells show expanded LPAC proteins (F) and QAGR proteins (H) are expressed in all three frames. IF detection of (LPAC) EXP proteins (G) and (QAGR) EXP .

    Techniques Used: Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Standard Deviation, Construct, Western Blot, Transfection

    2) Product Images from "Human Embryonic Stem Cells Differentiated to Lung Lineage-Specific Cells Ameliorate Pulmonary Fibrosis in a Xenograft Transplant Mouse Model"

    Article Title: Human Embryonic Stem Cells Differentiated to Lung Lineage-Specific Cells Ameliorate Pulmonary Fibrosis in a Xenograft Transplant Mouse Model

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0033165

    Detection of human cells in lungs of bleomycin-treated mice transplanted with differentiated H7 hES cells. The presence of human cells in the lungs of bleomycin-treated mice transplanted with differentiated H7 hES cells was assessed by a–d DAB immunocytochemistry using anti-human nuclear factor antibody on fresh OCT-fixed cryosections, e–i qPCR of human Alu sequence, and j–m in situ hybridization with human pan-centromeric probe. The following groups of Rag2γC −/− mice were studied: bleomycin-treated mice administered intratracheally b , g , k (10× magnification) saline (Bleo/Saline group) or 10 5 H7 hES cells differentiated in SAGM in the c , h , l (60× magnification) absence (SAGM group) or presence of d , i , m (10× magnification) 5 µM ICG-001 (SAGM+ICG-001 group). a , e positive control of H7 hES cells. f , j (60× magnification) negative control of mice given only saline intratracheally. a–d brown reaction indicate human nuclear-specific antibody staining. 60× magnification. e–i qPCR was run using the Alu-specific primer with dissociation curves shown. l and m brown stains indicate DAB-positive pan-centromeric probe reactions. The data are representative of three independent experiments with n = 4 mice per study group in each experiment.
    Figure Legend Snippet: Detection of human cells in lungs of bleomycin-treated mice transplanted with differentiated H7 hES cells. The presence of human cells in the lungs of bleomycin-treated mice transplanted with differentiated H7 hES cells was assessed by a–d DAB immunocytochemistry using anti-human nuclear factor antibody on fresh OCT-fixed cryosections, e–i qPCR of human Alu sequence, and j–m in situ hybridization with human pan-centromeric probe. The following groups of Rag2γC −/− mice were studied: bleomycin-treated mice administered intratracheally b , g , k (10× magnification) saline (Bleo/Saline group) or 10 5 H7 hES cells differentiated in SAGM in the c , h , l (60× magnification) absence (SAGM group) or presence of d , i , m (10× magnification) 5 µM ICG-001 (SAGM+ICG-001 group). a , e positive control of H7 hES cells. f , j (60× magnification) negative control of mice given only saline intratracheally. a–d brown reaction indicate human nuclear-specific antibody staining. 60× magnification. e–i qPCR was run using the Alu-specific primer with dissociation curves shown. l and m brown stains indicate DAB-positive pan-centromeric probe reactions. The data are representative of three independent experiments with n = 4 mice per study group in each experiment.

    Techniques Used: Mouse Assay, Immunocytochemistry, Real-time Polymerase Chain Reaction, Sequencing, In Situ Hybridization, Positive Control, Negative Control, Staining

    3) Product Images from "Glucose-6-Phosphate Dehydrogenase Enhances Antiviral Response through Downregulation of NADPH Sensor HSCARG and Upregulation of NF-κB Signaling"

    Article Title: Glucose-6-Phosphate Dehydrogenase Enhances Antiviral Response through Downregulation of NADPH Sensor HSCARG and Upregulation of NF-κB Signaling

    Journal: Viruses

    doi: 10.3390/v7122966

    TNF-α inhibits viral replication in A549 cells. ( A , B ) The A549 cells were treated with control or TNF-α siRNA for 24 h and challenged with HCoV 229E of 0.1 MOI. Total RNA was harvested at indicated time and analyzed for TNF- α mRNA and viral N gene expression; ( C ) The A549 cells were challenged with different concentration of TNF-á for 24 h then infected with HCoV 229E of 0.1 MOI for 8 h. Total RNA was harvested for analyzing viral N gene expression by quantitative-PCR. Values represent average ± SD of three measurements. * p
    Figure Legend Snippet: TNF-α inhibits viral replication in A549 cells. ( A , B ) The A549 cells were treated with control or TNF-α siRNA for 24 h and challenged with HCoV 229E of 0.1 MOI. Total RNA was harvested at indicated time and analyzed for TNF- α mRNA and viral N gene expression; ( C ) The A549 cells were challenged with different concentration of TNF-á for 24 h then infected with HCoV 229E of 0.1 MOI for 8 h. Total RNA was harvested for analyzing viral N gene expression by quantitative-PCR. Values represent average ± SD of three measurements. * p

    Techniques Used: Expressing, Concentration Assay, Infection, Real-time Polymerase Chain Reaction

    HSCARG -knockdown increases antiviral response and decreases viral replication. ( A , B ) A549-Gi cells were transfected with HSCARG siRNA. Total RNA was collected at 48 h after transfection, and HSCARG gene expression was determined by quantitative-PCR. Level of HSCARG was expressed relative to that of A549-Gi cells transfected with control-siRNA. For assay of NF-êB binding activity, A549-Gi cells were transfected with control or HSCARG siRNA for 48 h, and subsequently infected with HCoV 229E at MOI of 0.1. At indicated time points p.i., NF-êB binding activity was analyzed by EMSA. The temporal change in NF-êB binding activity is shown and quantified by densitometric scanning. The values represent average ± SD of five independent experiments; ( C – E ) A549-Gi cells were transfected with control or HSCARG siRNA for 48 h, and subsequently infected with HCoV 229E at an MOI of 0.1. Total RNA was harvested at indicated time points p.i., and analyzed for expression level of TNF- α ( C ), MX1 ( D ), and viral N genes ( E ) by quantitative-PCR. Values represent average ± SD of three experiments. * p
    Figure Legend Snippet: HSCARG -knockdown increases antiviral response and decreases viral replication. ( A , B ) A549-Gi cells were transfected with HSCARG siRNA. Total RNA was collected at 48 h after transfection, and HSCARG gene expression was determined by quantitative-PCR. Level of HSCARG was expressed relative to that of A549-Gi cells transfected with control-siRNA. For assay of NF-êB binding activity, A549-Gi cells were transfected with control or HSCARG siRNA for 48 h, and subsequently infected with HCoV 229E at MOI of 0.1. At indicated time points p.i., NF-êB binding activity was analyzed by EMSA. The temporal change in NF-êB binding activity is shown and quantified by densitometric scanning. The values represent average ± SD of five independent experiments; ( C – E ) A549-Gi cells were transfected with control or HSCARG siRNA for 48 h, and subsequently infected with HCoV 229E at an MOI of 0.1. Total RNA was harvested at indicated time points p.i., and analyzed for expression level of TNF- α ( C ), MX1 ( D ), and viral N genes ( E ) by quantitative-PCR. Values represent average ± SD of three experiments. * p

    Techniques Used: Transfection, Expressing, Real-time Polymerase Chain Reaction, Binding Assay, Activity Assay, Infection

    Expressions of antiviral gene MX1 and TNF- α decrease upon HCoV 229E infection in A549-Gi cells. ( A ) A549-Sc and -Gi cells were harvested for determination of G6PD expression by western blotting. β-Actin was used as internal control. A549-Sc and -Gi cells were infected with HCoV-229E (0.1 MOI) for 24 h then viral particle was harvested and production was determined using plaque assay; ( B ) A549-Sc and -Gi cells were infected with HCoV-229E (0.1 MOI) for indicated time points. Viral N gene expression was determined by quantitative-PCR. Data were normalized to the value of infected A549-Sc cells at 2 h p.i.; ( C ) RNA was harvested from HCoV-229E-infected cells at indicated time p.i.. TNF- α gene expression was determined by quantitative-PCR. Data were normalized to the value of uninfected A549-Sc cells; ( D ) RNA was harvested from HCoV 229E-infected cells at indicated time points p.i.. MX1 gene expression was determined by quantitative-PCR. Data were normalized to the value of uninfected A549-Sc cells. Values represent average ± SD of three experiments. * p
    Figure Legend Snippet: Expressions of antiviral gene MX1 and TNF- α decrease upon HCoV 229E infection in A549-Gi cells. ( A ) A549-Sc and -Gi cells were harvested for determination of G6PD expression by western blotting. β-Actin was used as internal control. A549-Sc and -Gi cells were infected with HCoV-229E (0.1 MOI) for 24 h then viral particle was harvested and production was determined using plaque assay; ( B ) A549-Sc and -Gi cells were infected with HCoV-229E (0.1 MOI) for indicated time points. Viral N gene expression was determined by quantitative-PCR. Data were normalized to the value of infected A549-Sc cells at 2 h p.i.; ( C ) RNA was harvested from HCoV-229E-infected cells at indicated time p.i.. TNF- α gene expression was determined by quantitative-PCR. Data were normalized to the value of uninfected A549-Sc cells; ( D ) RNA was harvested from HCoV 229E-infected cells at indicated time points p.i.. MX1 gene expression was determined by quantitative-PCR. Data were normalized to the value of uninfected A549-Sc cells. Values represent average ± SD of three experiments. * p

    Techniques Used: Infection, Expressing, Western Blot, Plaque Assay, Real-time Polymerase Chain Reaction

    4) Product Images from "MicroRNA Biogenesis and Hedgehog-Patched Signaling Cooperate to Regulate an Important Developmental Transition in Granule Cell Development"

    Article Title: MicroRNA Biogenesis and Hedgehog-Patched Signaling Cooperate to Regulate an Important Developmental Transition in Granule Cell Development

    Journal: Genetics

    doi: 10.1534/genetics.115.184176

    Excision of exon 24–25 of DICER1 inactivated microRNA bioprocessing. Quantitative PCR of reverse-transcribed RNA verified that the protein products of the DICER1∆ ex24 (medium shading) and DICER1∆ ex24-25 (light shading) were unable to bioprocess three highly expressed microRNAs in Dicer1 null sarcoma cells (A) and Dicer1 null mesenchymal stem cells (B), while the protein product from DICER1 (solid bar) was able to. Quantitative real-time PCR analyses were calculated using the relative threshold cycle (CT) method (A and B) relative to the housekeeping gene Rnu6-2 . Stable expression of the endoribonuclease Dicer splice and recombination variants was confirmed by Western blot analyses of COS-7 cells transfected with various DICER1 constructs (C). Furthermore, Western blot analysis of endogenous endoribonuclease Dicer protein levels was performed on tumors derived from Atoh1-Cre;Ptch1flox/flox mice (D). Protein levels were substantially reduced in tumors derived from Atoh1-Cre;Ptch1flox/flox;Dicer1flox/flox mice. GAPDH was used as a housekeeping protein (D). Representative Western blot images are shown (C and D).
    Figure Legend Snippet: Excision of exon 24–25 of DICER1 inactivated microRNA bioprocessing. Quantitative PCR of reverse-transcribed RNA verified that the protein products of the DICER1∆ ex24 (medium shading) and DICER1∆ ex24-25 (light shading) were unable to bioprocess three highly expressed microRNAs in Dicer1 null sarcoma cells (A) and Dicer1 null mesenchymal stem cells (B), while the protein product from DICER1 (solid bar) was able to. Quantitative real-time PCR analyses were calculated using the relative threshold cycle (CT) method (A and B) relative to the housekeeping gene Rnu6-2 . Stable expression of the endoribonuclease Dicer splice and recombination variants was confirmed by Western blot analyses of COS-7 cells transfected with various DICER1 constructs (C). Furthermore, Western blot analysis of endogenous endoribonuclease Dicer protein levels was performed on tumors derived from Atoh1-Cre;Ptch1flox/flox mice (D). Protein levels were substantially reduced in tumors derived from Atoh1-Cre;Ptch1flox/flox;Dicer1flox/flox mice. GAPDH was used as a housekeeping protein (D). Representative Western blot images are shown (C and D).

    Techniques Used: Real-time Polymerase Chain Reaction, Expressing, Western Blot, Transfection, Construct, Derivative Assay, Mouse Assay

    5) Product Images from "Matrix Metalloproteinase-9-Dependent Release of IL-1β by Human Eosinophils"

    Article Title: Matrix Metalloproteinase-9-Dependent Release of IL-1β by Human Eosinophils

    Journal: Mediators of Inflammation

    doi: 10.1155/2019/7479107

    Activated eosinophils express a high level of IL-1 β mRNA. (a) Blood eosinophils were cultured for 0 (T0), 3, 6, 9, and 20 h with medium, (resting) TNF- α (TNF), IL-3 (IL3), IL-5, TNF- α plus IL-3 (TNF + IL3), or TNF- α plus IL-5 (TNF + IL5). Levels of IL1B mRNA were determined by RT-qPCR, normalized to GUSB and expressed as fold change (2 − ∆∆ Ct ) from T0. Data are mean ± SEM of experiments on eosinophil preparations from three subjects. ∗ p
    Figure Legend Snippet: Activated eosinophils express a high level of IL-1 β mRNA. (a) Blood eosinophils were cultured for 0 (T0), 3, 6, 9, and 20 h with medium, (resting) TNF- α (TNF), IL-3 (IL3), IL-5, TNF- α plus IL-3 (TNF + IL3), or TNF- α plus IL-5 (TNF + IL5). Levels of IL1B mRNA were determined by RT-qPCR, normalized to GUSB and expressed as fold change (2 − ∆∆ Ct ) from T0. Data are mean ± SEM of experiments on eosinophil preparations from three subjects. ∗ p

    Techniques Used: Cell Culture, Quantitative RT-PCR

    6) Product Images from "SREBP-2-driven transcriptional activation of human SND1 oncogene"

    Article Title: SREBP-2-driven transcriptional activation of human SND1 oncogene

    Journal: Oncotarget

    doi: 10.18632/oncotarget.22569

    SND1 promoter contains functional binding sites for SREBPs (A) Partial nucleotide sequence of SND1 gene proximal promoter [GenBank: EF690304]. The transcription start site (+1) is shown in bold. Boxes indicate predicted binding motives for SREBP transcription factors SRE -60 and E-box -230. (B) Electrophoretic mobility shift assay for the predicted SRE and E-box sequences using HepG2 nuclear extracts. Competition assays were performed with 100x excess of specific or non-specific unlabelled probe. Lanes 1 and 8 free probe, lanes 3 and 9 HepG2 nuclear extracts, lanes 2 and 14 non-specific competitor, lanes 4 and 10 SRE -60 and E-box -230 specific competitor, respectively, lanes 5 and 11 non-specific antibodies, lanes 6 and 13 anti-SREBP-2 IgG, and lanes 7 and 12 anti-SREBP-1 IgG. (C) Binding of endogenous SREBP-1 and SREBP-2 to SND1 gene promoter. Chromatin from HepG2 cells was immunoprecipitated with anti-SREBP-2, anti-SREBP-1, or non-immune IgG as negative control. DNA from input or immunoprecipitates (IP) was subjected to PCR to amplify SND1 promoter (-268, -73) and (-176, +4) regions containing the predicted SRE or E-box elements. Results in B and C are representative of three experiments with similar results. (D) Site-directed mutagenesis for SRE -60 or E-box -230 motif was performed in HepG2 and HEK293 cells as described in Material and methods and SND1 promoter activity measured and expressed relative to non-mutated p112 luciferase activity. Results are reported as the mean ± SD of 3 independent experiments, each performed in quadruplicate, and were analyzed by the two-tailed Student's t -test. Significance is denoted: *** p≤0.001.
    Figure Legend Snippet: SND1 promoter contains functional binding sites for SREBPs (A) Partial nucleotide sequence of SND1 gene proximal promoter [GenBank: EF690304]. The transcription start site (+1) is shown in bold. Boxes indicate predicted binding motives for SREBP transcription factors SRE -60 and E-box -230. (B) Electrophoretic mobility shift assay for the predicted SRE and E-box sequences using HepG2 nuclear extracts. Competition assays were performed with 100x excess of specific or non-specific unlabelled probe. Lanes 1 and 8 free probe, lanes 3 and 9 HepG2 nuclear extracts, lanes 2 and 14 non-specific competitor, lanes 4 and 10 SRE -60 and E-box -230 specific competitor, respectively, lanes 5 and 11 non-specific antibodies, lanes 6 and 13 anti-SREBP-2 IgG, and lanes 7 and 12 anti-SREBP-1 IgG. (C) Binding of endogenous SREBP-1 and SREBP-2 to SND1 gene promoter. Chromatin from HepG2 cells was immunoprecipitated with anti-SREBP-2, anti-SREBP-1, or non-immune IgG as negative control. DNA from input or immunoprecipitates (IP) was subjected to PCR to amplify SND1 promoter (-268, -73) and (-176, +4) regions containing the predicted SRE or E-box elements. Results in B and C are representative of three experiments with similar results. (D) Site-directed mutagenesis for SRE -60 or E-box -230 motif was performed in HepG2 and HEK293 cells as described in Material and methods and SND1 promoter activity measured and expressed relative to non-mutated p112 luciferase activity. Results are reported as the mean ± SD of 3 independent experiments, each performed in quadruplicate, and were analyzed by the two-tailed Student's t -test. Significance is denoted: *** p≤0.001.

    Techniques Used: Functional Assay, Binding Assay, Sequencing, Electrophoretic Mobility Shift Assay, Immunoprecipitation, Negative Control, Polymerase Chain Reaction, Mutagenesis, Activity Assay, Luciferase, Two Tailed Test

    7) Product Images from "Epithelial neoplasia coincides with exacerbated injury and fibrotic response in the lungs of Gprc5a-knockout mice following silica exposure"

    Article Title: Epithelial neoplasia coincides with exacerbated injury and fibrotic response in the lungs of Gprc5a-knockout mice following silica exposure

    Journal: Oncotarget

    doi:

    Recruitment of alveolar-macrophages was increased in lungs from Gprc5a −/− mice A. Representative images of IHC staining for macrophage marker CD68 in lung tissue from wild-type and Gprc5a −/− mice three months after silica exposure. B. Graph represents the extent of CD68 staining (IS) estimated from the IHC (A). The scoring method, outlined in the Methods section, used the 0–4 design. C. RT-PCR analysis of mRNA levels in lung tissues from wild-type and Gprc5a −/− mice following silica exposure as indicated.
    Figure Legend Snippet: Recruitment of alveolar-macrophages was increased in lungs from Gprc5a −/− mice A. Representative images of IHC staining for macrophage marker CD68 in lung tissue from wild-type and Gprc5a −/− mice three months after silica exposure. B. Graph represents the extent of CD68 staining (IS) estimated from the IHC (A). The scoring method, outlined in the Methods section, used the 0–4 design. C. RT-PCR analysis of mRNA levels in lung tissues from wild-type and Gprc5a −/− mice following silica exposure as indicated.

    Techniques Used: Mouse Assay, Immunohistochemistry, Staining, Marker, Reverse Transcription Polymerase Chain Reaction

    8) Product Images from "Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development"

    Article Title: Missense Mutation in the Second RNA Binding Domain Reveals a Role for Prkra (PACT/RAX) during Skull Development

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0028537

    Reduced ectopic expression of RAX (S130P) in L929 cells. A RAX mRNA levels: Realtime RT-PCR analyses were used to determine the levels of FLAG-RAX mRNA relative to 18S rRNA using RNA samples isolated from the indicated cells. B RAX protein levels: FLAG western blot of L929 cells infected with empty lentivirus, or lentivirus encoding a provirus to ectopically express FLAG-RAX or FLAG-RAX (S130P) at the indicated MOI. Three times more virus was required for FLAG-RAX (S130P) to achieve protein levels comparable to WT. C RAX turnover analyses: Cells were treated with cycloheximide to inhibit de novo protein synthesis, cells lysates were prepared at the indicated time points and protein levels were measured by Odyssey quantitative western blot of FLAG- RAX and FLAG-RAX (S130P) using actin as the internal control. D Normalized levels of RAX: FLAG-RAX signal was normalized to that of actin and plotted at the indicated times following cycloheximide treatment.
    Figure Legend Snippet: Reduced ectopic expression of RAX (S130P) in L929 cells. A RAX mRNA levels: Realtime RT-PCR analyses were used to determine the levels of FLAG-RAX mRNA relative to 18S rRNA using RNA samples isolated from the indicated cells. B RAX protein levels: FLAG western blot of L929 cells infected with empty lentivirus, or lentivirus encoding a provirus to ectopically express FLAG-RAX or FLAG-RAX (S130P) at the indicated MOI. Three times more virus was required for FLAG-RAX (S130P) to achieve protein levels comparable to WT. C RAX turnover analyses: Cells were treated with cycloheximide to inhibit de novo protein synthesis, cells lysates were prepared at the indicated time points and protein levels were measured by Odyssey quantitative western blot of FLAG- RAX and FLAG-RAX (S130P) using actin as the internal control. D Normalized levels of RAX: FLAG-RAX signal was normalized to that of actin and plotted at the indicated times following cycloheximide treatment.

    Techniques Used: Expressing, Reverse Transcription Polymerase Chain Reaction, Isolation, Western Blot, Infection

    9) Product Images from "Protein kinase Cθ is required for cardiomyocyte survival and cardiac remodeling"

    Article Title: Protein kinase Cθ is required for cardiomyocyte survival and cardiac remodeling

    Journal: Cell Death & Disease

    doi: 10.1038/cddis.2010.24

    PKC θ ablation results in increased fibrosis. ( A ) Gomori's trichrome-stained representative cryosections of LV from 2-month-old WT (a and c) and PKC θ −/− mice (b and d); a–b: bar=2 mm; c–d: bar=200 μ m. ( B ) RT-PCR analysis of the indicated fibrotic markers in LVs from 2-month-old WT and PKC θ −/− mice (3 mice per genotype). Col1α1 : α1 collagen 1 ; Col3α1 : α1 collagen 3 ; αSMA : α-smooth muscle actin ; TGFβ1 : transforming growth factor β1 ; GAPDH expression was used to normalize the reaction. ( C ) Quantification of interstitial fibrosis was examined at the indicated postnatal ages of WT (empty bars) and PKC θ −/− (filled bars) LVs, expressed as a percentage of the total area of the entire section. At least three sections per mouse were analyzed ( n =3 per genotype/age). * P
    Figure Legend Snippet: PKC θ ablation results in increased fibrosis. ( A ) Gomori's trichrome-stained representative cryosections of LV from 2-month-old WT (a and c) and PKC θ −/− mice (b and d); a–b: bar=2 mm; c–d: bar=200 μ m. ( B ) RT-PCR analysis of the indicated fibrotic markers in LVs from 2-month-old WT and PKC θ −/− mice (3 mice per genotype). Col1α1 : α1 collagen 1 ; Col3α1 : α1 collagen 3 ; αSMA : α-smooth muscle actin ; TGFβ1 : transforming growth factor β1 ; GAPDH expression was used to normalize the reaction. ( C ) Quantification of interstitial fibrosis was examined at the indicated postnatal ages of WT (empty bars) and PKC θ −/− (filled bars) LVs, expressed as a percentage of the total area of the entire section. At least three sections per mouse were analyzed ( n =3 per genotype/age). * P

    Techniques Used: Staining, Mouse Assay, Reverse Transcription Polymerase Chain Reaction, Expressing

    10) Product Images from "Validation of Internal Reference Genes for Real-Time Quantitative Polymerase Chain Reaction Studies in the Tick, Ixodes scapularis (Acari: Ixodidae)"

    Article Title: Validation of Internal Reference Genes for Real-Time Quantitative Polymerase Chain Reaction Studies in the Tick, Ixodes scapularis (Acari: Ixodidae)

    Journal: Journal of medical entomology

    doi:

    Expression variations between SG and SYN obtained using NormFinder software over the blood-feeding duration. The data are the average of three biological replications. The circles are for intergroup variation and error bars are for intragroup variation
    Figure Legend Snippet: Expression variations between SG and SYN obtained using NormFinder software over the blood-feeding duration. The data are the average of three biological replications. The circles are for intergroup variation and error bars are for intragroup variation

    Techniques Used: Expressing, Software

    11) Product Images from "Small RNA-Based Antiviral Defense in the Phytopathogenic Fungus Colletotrichum higginsianum"

    Article Title: Small RNA-Based Antiviral Defense in the Phytopathogenic Fungus Colletotrichum higginsianum

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1005640

    RNA silencing in the ascomycete fungus Colletotrichum higginsianum . ( A ) Domain organization of RNA Dependent RNA polymerases (RDR), Dicer (DCL) and Argonaute (AGO) proteins in C . higginsianum . RRM, RNA Recognition motif. dsRBD, dsRNA Binding Domain. The conserved aspartic acid residues required for AGO catalytic activity in the PIWI domain are indicated (DDD). RGG, arginine-glycine-glycine rich domain. ( B-D ) Phylogenetic analysis of RDR ( B ), DCL ( C ) and AGO ( D ) protein sequences. Rooted maximum likelihood neighbor joining trees were constructed by alignment of full-length protein sequences from representative members of the Ascomycota clade (Sordariomycetes in blue, Eurotiomycetes in green, Dothideomycetes in orange, Leotiomycetes in pink). C . higginsianum proteins are indicated with red dots. For the sake of clarity, only maximum likelihood bootstraps values higher than 90% are shown. Two main groups are labeled, the Quelling pathway (shaded in green) and the Meiotic-Silencing by Unpaired DNA (MSUD) pathway (shaded in purple). Accession numbers for protein sequences used in the alignment are in S1 Table . Phylogenetic trees were generated using RAxML under the model LG+G+F of amino acid substitution. Scale bar in each panel represents 0.1 amino acid substitutions per site. ( E ) Expression analysis of RDR , DCL and AGO genes in C . higginsianum mycelium. Silencing genes are grouped into the Quelling pathway (left panel), MSUD pathway (middle panel) and Unknown pathway (right panel). Three biological replicates were used for each gene; values were normalized to the mean of ACTIN and TUBULIN genes and the mean expression of each RNA silencing gene is represented as a relative value compared to AGO1 .
    Figure Legend Snippet: RNA silencing in the ascomycete fungus Colletotrichum higginsianum . ( A ) Domain organization of RNA Dependent RNA polymerases (RDR), Dicer (DCL) and Argonaute (AGO) proteins in C . higginsianum . RRM, RNA Recognition motif. dsRBD, dsRNA Binding Domain. The conserved aspartic acid residues required for AGO catalytic activity in the PIWI domain are indicated (DDD). RGG, arginine-glycine-glycine rich domain. ( B-D ) Phylogenetic analysis of RDR ( B ), DCL ( C ) and AGO ( D ) protein sequences. Rooted maximum likelihood neighbor joining trees were constructed by alignment of full-length protein sequences from representative members of the Ascomycota clade (Sordariomycetes in blue, Eurotiomycetes in green, Dothideomycetes in orange, Leotiomycetes in pink). C . higginsianum proteins are indicated with red dots. For the sake of clarity, only maximum likelihood bootstraps values higher than 90% are shown. Two main groups are labeled, the Quelling pathway (shaded in green) and the Meiotic-Silencing by Unpaired DNA (MSUD) pathway (shaded in purple). Accession numbers for protein sequences used in the alignment are in S1 Table . Phylogenetic trees were generated using RAxML under the model LG+G+F of amino acid substitution. Scale bar in each panel represents 0.1 amino acid substitutions per site. ( E ) Expression analysis of RDR , DCL and AGO genes in C . higginsianum mycelium. Silencing genes are grouped into the Quelling pathway (left panel), MSUD pathway (middle panel) and Unknown pathway (right panel). Three biological replicates were used for each gene; values were normalized to the mean of ACTIN and TUBULIN genes and the mean expression of each RNA silencing gene is represented as a relative value compared to AGO1 .

    Techniques Used: Binding Assay, Activity Assay, Construct, Labeling, Generated, Expressing

    12) Product Images from "Elastin overexpression by cell-based gene therapy preserves matrix and prevents cardiac dilation"

    Article Title: Elastin overexpression by cell-based gene therapy preserves matrix and prevents cardiac dilation

    Journal: Journal of Cellular and Molecular Medicine

    doi: 10.1111/j.1582-4934.2012.01560.x

    Recombinant elastin expression in rat BMSCs. (A) Cultured rat BMSCs were effectively transduced with the adenovector, as indicated by GFP fluorescence in Ad-CMV-GFP transduced cells at day 4 (40× magnification). (B) Human elastin mRNA in the BMSCs was evaluated by RT-PCR 2 and 4 days after transduction, with primer sets specific for human and rat elastin. (C) Western blotting with an antibody specific for human tropoelastin confirmed the expression of elastin protein in the Ad-CMV-elastin transduced rat BMSCs. (D) Immunostaining with DAPI, anti-human elastin antibody and FITC-conjugated phalloidin (for F-actin) revealed no detectable human elastin in the culture of BMSCs transduced with empty vector (left panels). However, BMSCs transduced with Ad-CMV-elastin (right panels) showed a network of human elastin molecules (200× magnification). As the strong elastin staining in the Ad-CMV-elastin group overshadowed the F-actin staining, we enhanced the contrast/brightness of the F-actin staining to show that most of the elastin-staining cells were F-actin positive. (Con = empty vector; GFP = Ad-CMV-GFP; representative of three experiments).
    Figure Legend Snippet: Recombinant elastin expression in rat BMSCs. (A) Cultured rat BMSCs were effectively transduced with the adenovector, as indicated by GFP fluorescence in Ad-CMV-GFP transduced cells at day 4 (40× magnification). (B) Human elastin mRNA in the BMSCs was evaluated by RT-PCR 2 and 4 days after transduction, with primer sets specific for human and rat elastin. (C) Western blotting with an antibody specific for human tropoelastin confirmed the expression of elastin protein in the Ad-CMV-elastin transduced rat BMSCs. (D) Immunostaining with DAPI, anti-human elastin antibody and FITC-conjugated phalloidin (for F-actin) revealed no detectable human elastin in the culture of BMSCs transduced with empty vector (left panels). However, BMSCs transduced with Ad-CMV-elastin (right panels) showed a network of human elastin molecules (200× magnification). As the strong elastin staining in the Ad-CMV-elastin group overshadowed the F-actin staining, we enhanced the contrast/brightness of the F-actin staining to show that most of the elastin-staining cells were F-actin positive. (Con = empty vector; GFP = Ad-CMV-GFP; representative of three experiments).

    Techniques Used: Recombinant, Expressing, Cell Culture, Transduction, Fluorescence, Reverse Transcription Polymerase Chain Reaction, Western Blot, Immunostaining, Plasmid Preparation, Staining

    13) Product Images from "Insertion mutants in Drosophila melanogaster Hsc20 halt larval growth and lead to reduced iron-sulfur cluster enzyme activities and impaired iron homeostasis"

    Article Title: Insertion mutants in Drosophila melanogaster Hsc20 halt larval growth and lead to reduced iron-sulfur cluster enzyme activities and impaired iron homeostasis

    Journal: Journal of Biological Inorganic Chemistry

    doi: 10.1007/s00775-013-0988-2

    The Drosophila Hsc20 gene is broadly expressed at low levels and encodes a mitochondrial protein. a The information presented was retrieved and adapted from the FlyBase and modENCODE databases, where Hsc20 is listed as l(3)72Do or CG34246 . The gene is composed of four exons and three introns. The open reading frame is shown in beige and the noncoding region of the messenger RNA in gray . The two piggyBac insertions used in this study disrupt the first exon. The gene shows ubiquitous low level of expression throughout development and into adulthood. b Confirmation of the presence and small size of introns 2 and 3 by reverse transcription PCR ( RT-PCR ; the location of primers used shown is in a ) and localization of an Hsc20–red fluorescent protein ( RFP ) fusion protein in mitochondria of transfected HeLa cells
    Figure Legend Snippet: The Drosophila Hsc20 gene is broadly expressed at low levels and encodes a mitochondrial protein. a The information presented was retrieved and adapted from the FlyBase and modENCODE databases, where Hsc20 is listed as l(3)72Do or CG34246 . The gene is composed of four exons and three introns. The open reading frame is shown in beige and the noncoding region of the messenger RNA in gray . The two piggyBac insertions used in this study disrupt the first exon. The gene shows ubiquitous low level of expression throughout development and into adulthood. b Confirmation of the presence and small size of introns 2 and 3 by reverse transcription PCR ( RT-PCR ; the location of primers used shown is in a ) and localization of an Hsc20–red fluorescent protein ( RFP ) fusion protein in mitochondria of transfected HeLa cells

    Techniques Used: Expressing, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction, Transfection

    14) Product Images from "Initiation of human astrovirus type 1 infection was blocked by inhibitors of phosphoinositide 3-kinase"

    Article Title: Initiation of human astrovirus type 1 infection was blocked by inhibitors of phosphoinositide 3-kinase

    Journal: Virology Journal

    doi: 10.1186/1743-422X-10-153

    Effects of kinase inhibitors on capsid protein expression following HAstV1 infection. (A) Caco-2 cells were infected with HAstV1 (MOI = 0.22) in the presence of solvent alone ( DMSO, panels A and a ) , staurosporine ( 4 μM; B and b) , genistein ( 10 μM; C and c) , U0126 ( 20 μM; D and d) , SB 203580 ( 50 μM; E and e) , or JNK inhibitor II ( 50 μM; F and f) . The cells were fixed at 24 h post-infection (hpi), and then HAstV capsid protein was detected by immunofluorescence. Each pair of panels shows, for the same field of cells, the staining patterns for the viral capsid protein ( anti-HAstV, A through F) and for cellular DNA (DAPI, a through f). (B) Caco-2 cells were infected with HAstV1 in the presence of various kinase inhibitors, LY294002 ( 50 μM; panels A and a) , wortmannin ( 1 μM; B and b) , Triciribine, ( 10 μM; C and c) , MK-2206 ( 10 μM; D and d) , NSC23766 ( 50 μM; E and e) , Y27632 ( 50 μM; F and f) , and H89 ( 10 μM; G and g) . Each pair of panels shows, for the same field of cells, the staining patterns for the viral capsid protein (A through G) and for cellular DNA (a through g) . (C) Viability of Caco-2 cells infected with HAstV1 in the presence of designated drugs was examined by colorimetric assay using WST-1 reagent (Takara). The absorbance of the cell culture medium was measured at 450 nm versus a 650-nm reference. The vertical axis indicates arbitrary unit divided by the mean value of a solvent-only (DMSO) control sample. The mean value obtained using three of each sample is presented as bar graph, with the standard deviation indicated as error bar. Statistical significance, compared with the solvent control (DMSO) is indicated (*P
    Figure Legend Snippet: Effects of kinase inhibitors on capsid protein expression following HAstV1 infection. (A) Caco-2 cells were infected with HAstV1 (MOI = 0.22) in the presence of solvent alone ( DMSO, panels A and a ) , staurosporine ( 4 μM; B and b) , genistein ( 10 μM; C and c) , U0126 ( 20 μM; D and d) , SB 203580 ( 50 μM; E and e) , or JNK inhibitor II ( 50 μM; F and f) . The cells were fixed at 24 h post-infection (hpi), and then HAstV capsid protein was detected by immunofluorescence. Each pair of panels shows, for the same field of cells, the staining patterns for the viral capsid protein ( anti-HAstV, A through F) and for cellular DNA (DAPI, a through f). (B) Caco-2 cells were infected with HAstV1 in the presence of various kinase inhibitors, LY294002 ( 50 μM; panels A and a) , wortmannin ( 1 μM; B and b) , Triciribine, ( 10 μM; C and c) , MK-2206 ( 10 μM; D and d) , NSC23766 ( 50 μM; E and e) , Y27632 ( 50 μM; F and f) , and H89 ( 10 μM; G and g) . Each pair of panels shows, for the same field of cells, the staining patterns for the viral capsid protein (A through G) and for cellular DNA (a through g) . (C) Viability of Caco-2 cells infected with HAstV1 in the presence of designated drugs was examined by colorimetric assay using WST-1 reagent (Takara). The absorbance of the cell culture medium was measured at 450 nm versus a 650-nm reference. The vertical axis indicates arbitrary unit divided by the mean value of a solvent-only (DMSO) control sample. The mean value obtained using three of each sample is presented as bar graph, with the standard deviation indicated as error bar. Statistical significance, compared with the solvent control (DMSO) is indicated (*P

    Techniques Used: Expressing, Infection, Immunofluorescence, Staining, Colorimetric Assay, Cell Culture, Standard Deviation

    Effects of kinase blockers on viral RNA replication and on the appearance of viral RNA and capsid protein in culture supernatant. Caco-2 cells were infected with HAstV1 in the absence (Mock) or presence of various kinase inhibitors and examined for the following. (A) Effects on viral RNA replication. Viral RNA replication in the infected cells was analyzed using quantitative real-time RT-PCR. For each drug treatment, the quantified amount of viral RNA, normalized to the amount of total RNA, was converted to a value relative to that of mock treatment. The mean relative value from four independent experiments, with the standard deviation indicated as error bar, is presented. (B) Effects on presence of viral RNA in culture supernatant. The level of viral RNA in the post-infection culture supernatant was analyzed using real-time RT-PCR. For each drug treatment, the quantified amount of viral RNA was converted to a value relative to that of mock treatment. The mean relative value from three experiments, with the standard deviation indicated as error bar, is presented. (C) Effects on presence of viral capsid protein in culture supernatant. The level of viral capsid antigen in the post-infection culture supernatant was measured using ELISA. The supernatant samples were prepared in triplicate, and the mean capsid antigen level for each drug treatment was further converted to a value relative to mock treatment. Statistically significant differences, determined as in Figure 2 D, are indicated on the graphs.
    Figure Legend Snippet: Effects of kinase blockers on viral RNA replication and on the appearance of viral RNA and capsid protein in culture supernatant. Caco-2 cells were infected with HAstV1 in the absence (Mock) or presence of various kinase inhibitors and examined for the following. (A) Effects on viral RNA replication. Viral RNA replication in the infected cells was analyzed using quantitative real-time RT-PCR. For each drug treatment, the quantified amount of viral RNA, normalized to the amount of total RNA, was converted to a value relative to that of mock treatment. The mean relative value from four independent experiments, with the standard deviation indicated as error bar, is presented. (B) Effects on presence of viral RNA in culture supernatant. The level of viral RNA in the post-infection culture supernatant was analyzed using real-time RT-PCR. For each drug treatment, the quantified amount of viral RNA was converted to a value relative to that of mock treatment. The mean relative value from three experiments, with the standard deviation indicated as error bar, is presented. (C) Effects on presence of viral capsid protein in culture supernatant. The level of viral capsid antigen in the post-infection culture supernatant was measured using ELISA. The supernatant samples were prepared in triplicate, and the mean capsid antigen level for each drug treatment was further converted to a value relative to mock treatment. Statistically significant differences, determined as in Figure 2 D, are indicated on the graphs.

    Techniques Used: Infection, Quantitative RT-PCR, Standard Deviation, Enzyme-linked Immunosorbent Assay

    15) Product Images from "Hidden Lineage Complexity of Glycan-Dependent HIV-1 Broadly Neutralizing Antibodies Uncovered by Digital Panning and Native-Like gp140 Trimer"

    Article Title: Hidden Lineage Complexity of Glycan-Dependent HIV-1 Broadly Neutralizing Antibodies Uncovered by Digital Panning and Native-Like gp140 Trimer

    Journal: Frontiers in Immunology

    doi: 10.3389/fimmu.2017.01025

    Digital panning, a quantitative method for identification of functional antibodies. (A) Gel electrophoresis of three donor-17 antibody libraries generated from multiplex PCR using gene-specific primers, 5′-RACE PCR using single 3′-reverse primers, and H/L-overlapping PCR using gene-specific primers. For the purpose of formatting, the DNA gel has been rearranged with splicing (labeled with white lines). (B) Read length distributions of three donor-17 antibody libraries obtained from Personal Genome Machine (PGM) sequencing. Five single-chain variable fragment (scFv) libraries are plotted as histograms and color-coded according to their antigen panning steps: gray (Pan0), cyan (Pan1), green (Pan2), orange (Pan3), and red (Pan4). The two mixed HC/LC libraries generated from multiplex PCR and 5′-RACE PCR are shown as black dotted and dashed lines, respectively. (C) Schematic view of the digital panning method with the route of conventional panning included for comparison. Briefly, a scFv library is first constructed from donor peripheral blood mononuclear cells (PBMCs) and displayed on the phage surface for biopanning against an optimized antigen. The pre- and post-panning scFv libraries are sequenced on PGM to achieve 900 bp read length, with the sequenced full-length scFv libraries processed and analyzed by an H/L-paired antibodyomics pipeline. Representative scFv clones are selected for mAb synthesis and functional characterization. In HIV-1 bNAb studies, digital panning may identify high-affinity bNAb-like scFvs, rare bNAb lineage variants, and early intermediates. (D) Schematic view of an H/L-paired antibodyomics analysis.
    Figure Legend Snippet: Digital panning, a quantitative method for identification of functional antibodies. (A) Gel electrophoresis of three donor-17 antibody libraries generated from multiplex PCR using gene-specific primers, 5′-RACE PCR using single 3′-reverse primers, and H/L-overlapping PCR using gene-specific primers. For the purpose of formatting, the DNA gel has been rearranged with splicing (labeled with white lines). (B) Read length distributions of three donor-17 antibody libraries obtained from Personal Genome Machine (PGM) sequencing. Five single-chain variable fragment (scFv) libraries are plotted as histograms and color-coded according to their antigen panning steps: gray (Pan0), cyan (Pan1), green (Pan2), orange (Pan3), and red (Pan4). The two mixed HC/LC libraries generated from multiplex PCR and 5′-RACE PCR are shown as black dotted and dashed lines, respectively. (C) Schematic view of the digital panning method with the route of conventional panning included for comparison. Briefly, a scFv library is first constructed from donor peripheral blood mononuclear cells (PBMCs) and displayed on the phage surface for biopanning against an optimized antigen. The pre- and post-panning scFv libraries are sequenced on PGM to achieve 900 bp read length, with the sequenced full-length scFv libraries processed and analyzed by an H/L-paired antibodyomics pipeline. Representative scFv clones are selected for mAb synthesis and functional characterization. In HIV-1 bNAb studies, digital panning may identify high-affinity bNAb-like scFvs, rare bNAb lineage variants, and early intermediates. (D) Schematic view of an H/L-paired antibodyomics analysis.

    Techniques Used: Functional Assay, Nucleic Acid Electrophoresis, Generated, Multiplex Assay, Polymerase Chain Reaction, Labeling, Sequencing, Construct, Clone Assay

    16) Product Images from "RFX Transcription Factor DAF-19 Regulates 5-HT and Innate Immune Responses to Pathogenic Bacteria in Caenorhabditis elegans"

    Article Title: RFX Transcription Factor DAF-19 Regulates 5-HT and Innate Immune Responses to Pathogenic Bacteria in Caenorhabditis elegans

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1003324

    tir-1(yz68gf) mutants constitutively upregulate tph-1::gfp expression in ADF neurons. A. Mutations in predicted tir-1 protein. The TIR-1 structure is adapted from a previous report [8] . Blue, red and green denote the TIR domain, SAM domains, and regions containing the HEAT/Arm motifs, respectively. B. Photomicrographs showing that tir-1(yz68gf) mutation and transgenic expression of tir-1(yz68gf) cDNA enhanced ADF tph-1::gfp expression. ocr-2 background was used to reduce basal ADF tph-1::gfp for a better detection of tph-1::gfp upregulation by tir-1(yz68gf) . C. Quantification of ADF tph-1::gfp fluorescence in tir-1(lf) and tir-1(gf) mutants under optimal growth conditions. tir-1(yz68gf) mutants displayed enhanced ADF fluorescence on its own and in ocr-2 backgrounds relative to corresponding controls, and RNAi of tir-1 abolished tph-1::gfp upregulation by tir-1(yz68gf) . The value of GFP fluorescence in the ADF neurons of mutants is normalized to that of WT animals. For RNAi experiments, the value of tir-1 RNAi is normalized to that in the same strain but treated with an empty vector. Each bar represents the average of at least three trials ± SEM. Throughout of this paper, statistics between WT and individual mutants is marked on the top of each bar, and that between two mutant strains or two treatments is indicated on the top of the line across compared strains, *** p
    Figure Legend Snippet: tir-1(yz68gf) mutants constitutively upregulate tph-1::gfp expression in ADF neurons. A. Mutations in predicted tir-1 protein. The TIR-1 structure is adapted from a previous report [8] . Blue, red and green denote the TIR domain, SAM domains, and regions containing the HEAT/Arm motifs, respectively. B. Photomicrographs showing that tir-1(yz68gf) mutation and transgenic expression of tir-1(yz68gf) cDNA enhanced ADF tph-1::gfp expression. ocr-2 background was used to reduce basal ADF tph-1::gfp for a better detection of tph-1::gfp upregulation by tir-1(yz68gf) . C. Quantification of ADF tph-1::gfp fluorescence in tir-1(lf) and tir-1(gf) mutants under optimal growth conditions. tir-1(yz68gf) mutants displayed enhanced ADF fluorescence on its own and in ocr-2 backgrounds relative to corresponding controls, and RNAi of tir-1 abolished tph-1::gfp upregulation by tir-1(yz68gf) . The value of GFP fluorescence in the ADF neurons of mutants is normalized to that of WT animals. For RNAi experiments, the value of tir-1 RNAi is normalized to that in the same strain but treated with an empty vector. Each bar represents the average of at least three trials ± SEM. Throughout of this paper, statistics between WT and individual mutants is marked on the top of each bar, and that between two mutant strains or two treatments is indicated on the top of the line across compared strains, *** p

    Techniques Used: Expressing, Mutagenesis, Transgenic Assay, Fluorescence, Plasmid Preparation

    17) Product Images from "A Novel Sphingosine Kinase Inhibitor Induces Autophagy in Tumor Cells S⃞"

    Article Title: A Novel Sphingosine Kinase Inhibitor Induces Autophagy in Tumor Cells S⃞

    Journal: The Journal of Pharmacology and Experimental Therapeutics

    doi: 10.1124/jpet.109.163337

    ABC294640 induces nonapoptotic cell death in A-498 cells. A, chemical formula of ABC294640. B, cells were exposed to the indicated concentrations of ABC294640 and fixed at 24, 48 or 72 h. Nuclei were harvested and stained with PI, and the DNA content was analyzed by flow cytometry as described under Materials and Methods . C, cells were exposed to the indicated concentrations of ABC294640 for 72 h, and caspase 3/7 activity was measured by luminescence as described under Materials and Methods . Cisplatin ( cis- DDP) was used as a control (black bar). Data represent mean ± standard error for three experiments. D, cells were exposed to the indicated concentrations of ABC294640 for 72 h and stained with PI and Annexin-V-FITC before analysis by flow cytometry as described under Materials and Methods . For each panel, the bottom left corner indicates Annexin V- and PI-negative cells; the bottom right corner indicates Annexin V-positive cells (apoptotic cells); the top-right corner indicates dead cells with membranes permeable to PI (PI-positive cells) stained with Annexin V; and the top left corner indicates dissociated nuclei. The percentage of total cells is indicated in each quadrant.
    Figure Legend Snippet: ABC294640 induces nonapoptotic cell death in A-498 cells. A, chemical formula of ABC294640. B, cells were exposed to the indicated concentrations of ABC294640 and fixed at 24, 48 or 72 h. Nuclei were harvested and stained with PI, and the DNA content was analyzed by flow cytometry as described under Materials and Methods . C, cells were exposed to the indicated concentrations of ABC294640 for 72 h, and caspase 3/7 activity was measured by luminescence as described under Materials and Methods . Cisplatin ( cis- DDP) was used as a control (black bar). Data represent mean ± standard error for three experiments. D, cells were exposed to the indicated concentrations of ABC294640 for 72 h and stained with PI and Annexin-V-FITC before analysis by flow cytometry as described under Materials and Methods . For each panel, the bottom left corner indicates Annexin V- and PI-negative cells; the bottom right corner indicates Annexin V-positive cells (apoptotic cells); the top-right corner indicates dead cells with membranes permeable to PI (PI-positive cells) stained with Annexin V; and the top left corner indicates dissociated nuclei. The percentage of total cells is indicated in each quadrant.

    Techniques Used: Staining, Flow Cytometry, Cytometry, Activity Assay

    18) Product Images from "The Transcriptional Activator Hypoxia Inducible Factor 2 (HIF-2/EPAS-1) Regulates the Oxygen-Dependent Expression of Erythropoietin in Cortical Astrocytes"

    Article Title: The Transcriptional Activator Hypoxia Inducible Factor 2 (HIF-2/EPAS-1) Regulates the Oxygen-Dependent Expression of Erythropoietin in Cortical Astrocytes

    Journal: The Journal of Neuroscience

    doi: 10.1523/JNEUROSCI.2838-06.2006

    Cre recombinase-mediated deletion of the HIF-1α allele in cultured astrocytes derived from double-floxed HIF-1α transgenic mice. A , PCR analysis of the occurrence of Cre-mediated deletion of HIF-1α in astrocytes isolated from HIF-1α F/F mice. At various time points after infection of astrocytes with Ad-Cre, DNA was extracted and PCR was performed with the primers indicated in the diagram. The amplified fragments correspond to the floxed HIF-1α allele (HIF-1α F ) and the HIF1α-deleted allele (HIF-1α Δ ). B , HIF-1α F/F astrocytes were infected with Ad-GFP or Ad-Cre and 5 d later exposed to normoxia (N) or hypoxia (H) (0.5% O 2 for 24 h). Total RNA was extracted for RT-PCR analysis of Cre recombinase, HIF-1α, HIF-2α, and glyceraldehyde-3-phosphate dehydrogenase (loading control) expression. In parallel experiments, nuclear extracts were prepared for immunoblot analysis of HIF-1α, HIF-2α, and α-tubulin (loading control). C , HIF-1α F/F cortical astrocytes were subjected to the same experimental conditions as described in B , and real-time RT-PCR was performed for EPO, LDH, VEGF, and β-actin (loading control). Data are expressed as the mean ± SD from three to four independent experiments. * p
    Figure Legend Snippet: Cre recombinase-mediated deletion of the HIF-1α allele in cultured astrocytes derived from double-floxed HIF-1α transgenic mice. A , PCR analysis of the occurrence of Cre-mediated deletion of HIF-1α in astrocytes isolated from HIF-1α F/F mice. At various time points after infection of astrocytes with Ad-Cre, DNA was extracted and PCR was performed with the primers indicated in the diagram. The amplified fragments correspond to the floxed HIF-1α allele (HIF-1α F ) and the HIF1α-deleted allele (HIF-1α Δ ). B , HIF-1α F/F astrocytes were infected with Ad-GFP or Ad-Cre and 5 d later exposed to normoxia (N) or hypoxia (H) (0.5% O 2 for 24 h). Total RNA was extracted for RT-PCR analysis of Cre recombinase, HIF-1α, HIF-2α, and glyceraldehyde-3-phosphate dehydrogenase (loading control) expression. In parallel experiments, nuclear extracts were prepared for immunoblot analysis of HIF-1α, HIF-2α, and α-tubulin (loading control). C , HIF-1α F/F cortical astrocytes were subjected to the same experimental conditions as described in B , and real-time RT-PCR was performed for EPO, LDH, VEGF, and β-actin (loading control). Data are expressed as the mean ± SD from three to four independent experiments. * p

    Techniques Used: Cell Culture, Derivative Assay, Transgenic Assay, Mouse Assay, Polymerase Chain Reaction, Isolation, Infection, Amplification, Reverse Transcription Polymerase Chain Reaction, Expressing, Quantitative RT-PCR

    19) Product Images from "The promoter of cell growth- and RNA protection-associated SND1 gene is activated by endoplasmic reticulum stress in human hepatoma cells"

    Article Title: The promoter of cell growth- and RNA protection-associated SND1 gene is activated by endoplasmic reticulum stress in human hepatoma cells

    Journal: BMC Biochemistry

    doi: 10.1186/s12858-014-0025-2

    Activation of human SND1 gene promoter activity and expression by endoplasmic reticulum stress. A) HepG2 cells were transfected with a luciferase reporter gene driven by six different constructs of the human SND1 gene promoter SND/1-6 and used 24 hours later. Cells were incubated with 5 μg/ml tunicamycin (black) or 1 μM thapsigargin (grey) or the corresponding vehicle (white, control) 2 hours before transfection. Luciferase activity was calculated using a dual luciferase assay and expressed as fold increase relative to the activity of the SND/6 fragment in control cells as described in Methods . B) Levels of SND1 mRNA were determined by quantitative real-time PCR in treated and non-treated HepG2 cells and expressed as relative units, setting to 1.0 the value for control cells. C) SND1 and chaperones GRP78 and GRP94 protein expression was determined by western blotting using β-tubulin as a loading control and expressed as relative units, setting to 1.0 the value for control cells. Data are presented as mean ± SD from at least three independent experiments. * P
    Figure Legend Snippet: Activation of human SND1 gene promoter activity and expression by endoplasmic reticulum stress. A) HepG2 cells were transfected with a luciferase reporter gene driven by six different constructs of the human SND1 gene promoter SND/1-6 and used 24 hours later. Cells were incubated with 5 μg/ml tunicamycin (black) or 1 μM thapsigargin (grey) or the corresponding vehicle (white, control) 2 hours before transfection. Luciferase activity was calculated using a dual luciferase assay and expressed as fold increase relative to the activity of the SND/6 fragment in control cells as described in Methods . B) Levels of SND1 mRNA were determined by quantitative real-time PCR in treated and non-treated HepG2 cells and expressed as relative units, setting to 1.0 the value for control cells. C) SND1 and chaperones GRP78 and GRP94 protein expression was determined by western blotting using β-tubulin as a loading control and expressed as relative units, setting to 1.0 the value for control cells. Data are presented as mean ± SD from at least three independent experiments. * P

    Techniques Used: Activation Assay, Activity Assay, Expressing, Transfection, Luciferase, Construct, Incubation, Real-time Polymerase Chain Reaction, Western Blot

    20) Product Images from "RNA-sequencing analysis of lung primary fibroblast response to eosinophil-degranulation products predicts downstream effects on inflammation, tissue remodeling and lipid metabolism"

    Article Title: RNA-sequencing analysis of lung primary fibroblast response to eosinophil-degranulation products predicts downstream effects on inflammation, tissue remodeling and lipid metabolism

    Journal: Respiratory Research

    doi: 10.1186/s12931-017-0669-8

    PCR analysis demonstrates upregulation of CXCL1 , CXCL8 , IL6 and ICAM1 expression levels in HLF activated with conditioned media from eosinophils pre-activated with IL3 and degranulating on aggregated IgG. Conditioned media were prepared from eosinophils pre-activated for 20 h with IL-3 or IL-5, and seeded on heat-aggregated human IgG for 6 h (IL3IgG or IL5IgG). Conditioned media from eosinophils pre-activated with IL-3 and seeded in uncoated wells (IL3) were also prepared. HLF were cultured for 24 h with the three types of conditioned media (IL3IgG, IL5IgG and IL3), a control medium (Ø) and medium including 1 ng/ml of recombinant human IL-3 plus 0.5 μg/ml of HA-IgG (rhIL3IgG). RT-qPCR were performed from total mRNA extracted from two HLF lines (L20 and L21) cultured in the five different conditions. For each HLF lines, controls (Ø) and rhIL3IgG are n = 2. IL3, IL3IgG and IL5IgG conditioned media were prepared from three different eosinophil donors, including two donors previously used for the RNAseq analyses. IL3, IL3IgG and IL5 were compared using One Way Anova ( n = 3), and * indicates that IL3IgG is upregulated compared to IL3 and IL5IgG; and # indicates that IL5IgG is upregulated compared to IL3
    Figure Legend Snippet: PCR analysis demonstrates upregulation of CXCL1 , CXCL8 , IL6 and ICAM1 expression levels in HLF activated with conditioned media from eosinophils pre-activated with IL3 and degranulating on aggregated IgG. Conditioned media were prepared from eosinophils pre-activated for 20 h with IL-3 or IL-5, and seeded on heat-aggregated human IgG for 6 h (IL3IgG or IL5IgG). Conditioned media from eosinophils pre-activated with IL-3 and seeded in uncoated wells (IL3) were also prepared. HLF were cultured for 24 h with the three types of conditioned media (IL3IgG, IL5IgG and IL3), a control medium (Ø) and medium including 1 ng/ml of recombinant human IL-3 plus 0.5 μg/ml of HA-IgG (rhIL3IgG). RT-qPCR were performed from total mRNA extracted from two HLF lines (L20 and L21) cultured in the five different conditions. For each HLF lines, controls (Ø) and rhIL3IgG are n = 2. IL3, IL3IgG and IL5IgG conditioned media were prepared from three different eosinophil donors, including two donors previously used for the RNAseq analyses. IL3, IL3IgG and IL5 were compared using One Way Anova ( n = 3), and * indicates that IL3IgG is upregulated compared to IL3 and IL5IgG; and # indicates that IL5IgG is upregulated compared to IL3

    Techniques Used: Polymerase Chain Reaction, Expressing, Cell Culture, Recombinant, Quantitative RT-PCR

    21) Product Images from "Convergent transcription induces transcriptional gene silencing in fission yeast and mammalian cells"

    Article Title: Convergent transcription induces transcriptional gene silencing in fission yeast and mammalian cells

    Journal: Nature structural & molecular biology

    doi: 10.1038/nsmb.2392

    in vitro and in vivo analysis of nuclear dicer activity (a) Western blot analysis of dicer and Hsp-70 from whole cell extract (WE) versus nuclear extract (NE) with or without dicer immunodepletion (NE-dicer). Hsp70 was only detectable in WE confirming purity of NE. (b) In vitro transcription. NE dependent in vitro transcription of CTγACT1 Ex4 (390 nt RNA) and vector alone plus control run off template (yielding 363 nt RNA). Following the transcription reaction, RNA was isolated and fractionated. The long RNA fraction was treated with S1 (single strand specific), V1 (double strand specific) nucleases. Lower panel shows that dicer depleted NE still yields CT derived dsRNA. (c) In vitro transcription. Fractionation of small RNAs isolated from templates as indicated ( Supplementary Fig. 4 ). S denotes single promoter construct making just a sense transcript. Only CT and CTT yield detectible siRNAs (denoted by arrow) but not in dicer depleted NE. (d) qRT-PCR. Immunoselection of dsRNA from CTγACT1 or V transfected Hela cells using J2 antibody. Sense and antisense transcripts from CTγACT1 or endogenous GAPDH were monitored by qRT/PCR using strand specific RT primers. RT-PCR values in are based on average values ± SD from at least three independent biological experiments. * indicates statistical significance (p
    Figure Legend Snippet: in vitro and in vivo analysis of nuclear dicer activity (a) Western blot analysis of dicer and Hsp-70 from whole cell extract (WE) versus nuclear extract (NE) with or without dicer immunodepletion (NE-dicer). Hsp70 was only detectable in WE confirming purity of NE. (b) In vitro transcription. NE dependent in vitro transcription of CTγACT1 Ex4 (390 nt RNA) and vector alone plus control run off template (yielding 363 nt RNA). Following the transcription reaction, RNA was isolated and fractionated. The long RNA fraction was treated with S1 (single strand specific), V1 (double strand specific) nucleases. Lower panel shows that dicer depleted NE still yields CT derived dsRNA. (c) In vitro transcription. Fractionation of small RNAs isolated from templates as indicated ( Supplementary Fig. 4 ). S denotes single promoter construct making just a sense transcript. Only CT and CTT yield detectible siRNAs (denoted by arrow) but not in dicer depleted NE. (d) qRT-PCR. Immunoselection of dsRNA from CTγACT1 or V transfected Hela cells using J2 antibody. Sense and antisense transcripts from CTγACT1 or endogenous GAPDH were monitored by qRT/PCR using strand specific RT primers. RT-PCR values in are based on average values ± SD from at least three independent biological experiments. * indicates statistical significance (p

    Techniques Used: In Vitro, In Vivo, Activity Assay, Western Blot, Plasmid Preparation, Isolation, Derivative Assay, Fractionation, Construct, Quantitative RT-PCR, Transfection, Reverse Transcription Polymerase Chain Reaction

    CT ura4 plasmids induce TGS of endogenous ura4 in S. pombe (a) CT ura4 plasmid diagram showing endogenous ura4 with indicated positions of ChIP probes on endogenous ura4 as indicated. (b) qRT-PCR. CT ura4 plasmids containing either ura4 ORF or promoter sequences induce selective reduction of endogenous ura4 but not act1 mRNA levels as measured by qRT-PCR using oligodT primer for cDNA synthesis. Empty CT vector (V) was used as normalizing control. Induction period of CT nmt1 promoters by growth in EMM was overnight (as for all experiments except for (c,d)). (c,d) qRT-PCR of nascent ura4 RNA (using RT primer across PAS) or ura4 mRNA (using oligodT RT primer) following induction of CT for three days. (e,f) ChIP analysis using Pol II specific antibody on chromatin isolated for CTura4prom or CTura4ORF transformed S. pombe with PCR primer pairs as indicated in (a). (g,h) ChIP analysis using histone H3K9me3 specific antibody as in (e,f) All RT-PCR and ChIP values are based on average values ± SD from at least three independent biological experiments. * indicates statistical significance (p
    Figure Legend Snippet: CT ura4 plasmids induce TGS of endogenous ura4 in S. pombe (a) CT ura4 plasmid diagram showing endogenous ura4 with indicated positions of ChIP probes on endogenous ura4 as indicated. (b) qRT-PCR. CT ura4 plasmids containing either ura4 ORF or promoter sequences induce selective reduction of endogenous ura4 but not act1 mRNA levels as measured by qRT-PCR using oligodT primer for cDNA synthesis. Empty CT vector (V) was used as normalizing control. Induction period of CT nmt1 promoters by growth in EMM was overnight (as for all experiments except for (c,d)). (c,d) qRT-PCR of nascent ura4 RNA (using RT primer across PAS) or ura4 mRNA (using oligodT RT primer) following induction of CT for three days. (e,f) ChIP analysis using Pol II specific antibody on chromatin isolated for CTura4prom or CTura4ORF transformed S. pombe with PCR primer pairs as indicated in (a). (g,h) ChIP analysis using histone H3K9me3 specific antibody as in (e,f) All RT-PCR and ChIP values are based on average values ± SD from at least three independent biological experiments. * indicates statistical significance (p

    Techniques Used: Plasmid Preparation, Chromatin Immunoprecipitation, Quantitative RT-PCR, Isolation, Transformation Assay, Polymerase Chain Reaction, Reverse Transcription Polymerase Chain Reaction

    Integrated CT constructs promote endogenous ura4 TGS in trans (a,b) qRT-PCR. iCTura4ORF transformed S. pombe shows reduced levels of endogenous ura4 nascent RNA(a) and mRNA(b) based on qRT-PCR analysis. Diagram shows integrated CT chromosome with position of RT primer used to detect nascent RNA (not cleaved at PAS). Also shown, nmt1 promoters (red arrows) and endogenous ura4 . (c,d) ChIP analysis. Endogenous ura4 is subjected to trans TGS from iCTura4ORF as judged by Pol II and H3K9me3 ChIP analysis. (e,f) qRT-PCR. Induction of iCTcdc10 and iCTrad21 integrated into S. pombe causes a selective reduction in endogenous cdc10 and rad21 mRNA levels based on qRT-PCR analysis. All RT-PCR and ChIP values in a-f) are based on average values ± SD from at least three independent biological experiments. * indicates statistical significance (p
    Figure Legend Snippet: Integrated CT constructs promote endogenous ura4 TGS in trans (a,b) qRT-PCR. iCTura4ORF transformed S. pombe shows reduced levels of endogenous ura4 nascent RNA(a) and mRNA(b) based on qRT-PCR analysis. Diagram shows integrated CT chromosome with position of RT primer used to detect nascent RNA (not cleaved at PAS). Also shown, nmt1 promoters (red arrows) and endogenous ura4 . (c,d) ChIP analysis. Endogenous ura4 is subjected to trans TGS from iCTura4ORF as judged by Pol II and H3K9me3 ChIP analysis. (e,f) qRT-PCR. Induction of iCTcdc10 and iCTrad21 integrated into S. pombe causes a selective reduction in endogenous cdc10 and rad21 mRNA levels based on qRT-PCR analysis. All RT-PCR and ChIP values in a-f) are based on average values ± SD from at least three independent biological experiments. * indicates statistical significance (p

    Techniques Used: Construct, Quantitative RT-PCR, Transformation Assay, Chromatin Immunoprecipitation, Reverse Transcription Polymerase Chain Reaction

    Transfection of mammalian CTura4 plasmid induces γ-ACT1 TGS (a) Diagram of CT γACT1 containing γACT1 cDNA (exons 2-6). (b) Pol II ChIP analysis of γ- ACT1 or GAPDH control using amplicons specific to endogenous gene as shown on gene diagram below. Chromatin was isolated from HeLa cells transiently transfected with CT vector alone (V), CTγACT1 or untransfected (UN). (c) qRT-PCR. Measurement of mRNA levels using oligodT primed qRT-PCR on RNA from HeLa cells transfected as in (b). (d) H3K9me3 antibody ChIP as in (b). (e) Western blot analysis and quantitation of γ-actin protein levels compared to tubulin and OAS1 on total protein isolated from HeLa cells transfected as in (b) for 1-3 days. (f) qRT-PCR. Effect of CTγACT1 transfection of ES cells, wt or ΔDCR1 on nascent transcript levels from γ- ACT1 versus GAPDH . (g) Ago2 ChIP on chromatin from V or CTγACT1 transfected HeLa cells using specific amplicons for endogenous γ- ACT1 or GAPDH . All RT-PCR and ChIP values in b, c, d, f and g are based on average values ± SD from at least three independent biological experiments. * indicates statistical significance (p
    Figure Legend Snippet: Transfection of mammalian CTura4 plasmid induces γ-ACT1 TGS (a) Diagram of CT γACT1 containing γACT1 cDNA (exons 2-6). (b) Pol II ChIP analysis of γ- ACT1 or GAPDH control using amplicons specific to endogenous gene as shown on gene diagram below. Chromatin was isolated from HeLa cells transiently transfected with CT vector alone (V), CTγACT1 or untransfected (UN). (c) qRT-PCR. Measurement of mRNA levels using oligodT primed qRT-PCR on RNA from HeLa cells transfected as in (b). (d) H3K9me3 antibody ChIP as in (b). (e) Western blot analysis and quantitation of γ-actin protein levels compared to tubulin and OAS1 on total protein isolated from HeLa cells transfected as in (b) for 1-3 days. (f) qRT-PCR. Effect of CTγACT1 transfection of ES cells, wt or ΔDCR1 on nascent transcript levels from γ- ACT1 versus GAPDH . (g) Ago2 ChIP on chromatin from V or CTγACT1 transfected HeLa cells using specific amplicons for endogenous γ- ACT1 or GAPDH . All RT-PCR and ChIP values in b, c, d, f and g are based on average values ± SD from at least three independent biological experiments. * indicates statistical significance (p

    Techniques Used: Transfection, Plasmid Preparation, Chromatin Immunoprecipitation, Isolation, Quantitative RT-PCR, Western Blot, Quantitation Assay, Reverse Transcription Polymerase Chain Reaction

    22) Product Images from "Oligonucleotides targeting TCF4 triplet repeat expansion inhibit RNA foci and mis-splicing in Fuchs’ dystrophy"

    Article Title: Oligonucleotides targeting TCF4 triplet repeat expansion inhibit RNA foci and mis-splicing in Fuchs’ dystrophy

    Journal: Human Molecular Genetics

    doi: 10.1093/hmg/ddy018

    One-to-one correspondence between sense foci and mutant TCF4 RNA molecules in FECD. ( A ) Analysis of sense foci in F35T cells. ( B ) Sense foci distribution in F35T cell line. Majority of F35T cells have one or two sense foci in nuclei. ( C ) Copy number of GAPDH , TCF4 intron 2, TCF4 exon 2/3, TCF4 exon 18 transcripts measured with qPCR in F35T cells. F35T cells have less than three TCF4 intron 2 molecules. ( D ) Copy number of TCF4 transcripts in healthy control corneal endothelial tissues ( n = 3). ( E ) Copy number of TCF4 transcripts in FECD corneal endothelial tissues ( n = 3). TCF4 intron 2 molecules are rare RNA species in endothelial tissue. One-to-one correspondence between intronic RNA transcripts per cell and sense foci per cell suggests that each focus is a single mutant TCF4 RNA molecule.
    Figure Legend Snippet: One-to-one correspondence between sense foci and mutant TCF4 RNA molecules in FECD. ( A ) Analysis of sense foci in F35T cells. ( B ) Sense foci distribution in F35T cell line. Majority of F35T cells have one or two sense foci in nuclei. ( C ) Copy number of GAPDH , TCF4 intron 2, TCF4 exon 2/3, TCF4 exon 18 transcripts measured with qPCR in F35T cells. F35T cells have less than three TCF4 intron 2 molecules. ( D ) Copy number of TCF4 transcripts in healthy control corneal endothelial tissues ( n = 3). ( E ) Copy number of TCF4 transcripts in FECD corneal endothelial tissues ( n = 3). TCF4 intron 2 molecules are rare RNA species in endothelial tissue. One-to-one correspondence between intronic RNA transcripts per cell and sense foci per cell suggests that each focus is a single mutant TCF4 RNA molecule.

    Techniques Used: Mutagenesis, Real-time Polymerase Chain Reaction

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: CARM1 methylates MED12 to regulate its RNA-binding ability
    Article Snippet: .. RNA was then extracted using RNeasy Mini Kit (74104; QIAGEN), digested with DNase I (QIAGEN), and used to synthesize cDNA using random hexamers (SuperScript III First-Strand Synthesis system 18080-051; Invitrogen) followed by qPCR analysis. .. Statistical Analysis All the data are reported as sample mean ± SD. t test was performed to determine the P -value for RT–qPCR and RIP-qPCR experiments.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: DDX41 Recognizes RNA/DNA Retroviral Reverse Transcripts and Is Critical for In Vivo Control of Murine Leukemia Virus Infection
    Article Snippet: .. All siRNAs used in this study were previously shown to be on target and to decrease both RNA and protein levels ( ). cDNA was made using the SuperScript III first-strand synthesis system for RT-PCR (Invitrogen). .. RT-PCR was performed using the Power SYBR green PCR master mix kit (Applied Biosystems).

    Article Title: Assessing the detection of human papillomavirus late mRNA in liquid base cytology samples for risk stratification of cervical disease
    Article Snippet: .. SuperScript III First-Strand Synthesis System for RT-PCR (Life Technologies) was used for cDNA synthesis. ..

    Article Title: Arabidopsis genes, AtNPR1, AtTGA2 and AtPR-5, confer partial resistance to soybean cyst nematode (Heterodera glycines) when overexpressed in transgenic soybean roots
    Article Snippet: .. The RNA was converted into cDNA using the Superscript III First-Strand Synthesis System for RT-PCR (Invitrogen) according to manufacturer’s instructions. .. Soybean roots transformed with pRAP15 served as controls.

    Amplification:

    Article Title: An Xist-activating antisense RNA required for X-chromosome inactivation
    Article Snippet: .. A unit of 1 μg DNase-treated total RNA was reverse transcribed (SuperScript III First Strand Synthesis System, Invitrogen # 18080-051) with Abridged Universal Amplification Primer (AUAP) (adapted from Invitrogen 5′ RACE System, # 18374-058)-tagged strand-specific RT primers (see for list of primers) followed by RNase H (Invitrogen #18021-071) treatment to degrade the RNA. ..

    Quantitative RT-PCR:

    Article Title: JIP2 haploinsufficiency contributes to neurodevelopmental abnormalities in human pluripotent stem cell–derived neural progenitors and cortical neurons
    Article Snippet: .. For qRT–PCR, cDNA was synthesized using SuperScript III First Strand Synthesis Kit (#18080051; Thermo Fisher Scientific). .. RNA for RNAseq runs was validated by Agilent Bioanalyzer.

    Synthesized:

    Article Title: JIP2 haploinsufficiency contributes to neurodevelopmental abnormalities in human pluripotent stem cell–derived neural progenitors and cortical neurons
    Article Snippet: .. For qRT–PCR, cDNA was synthesized using SuperScript III First Strand Synthesis Kit (#18080051; Thermo Fisher Scientific). .. RNA for RNAseq runs was validated by Agilent Bioanalyzer.

    Article Title: VC1 catalyzes a key step in the biosynthesis of vicine from GTP in faba bean
    Article Snippet: .. We used the Spectrum Plant Total RNA Kit (Sigma-Aldrich) to extract RNA. cDNA was synthesized from RNA using the SuperScript™ III First-Strand Synthesis System (Thermo Fisher Scientific) and oligo (dT)20 primers. .. The coding sequence was amplified by PCR using cDNA as template and the following primers: ATGGCAGCTGCTACTTTCAAT and TCAAACAGTGATTTTAACACCATTGTTA.

    Article Title: The C/D box small nucleolar RNA SNORD52 regulated by Upf1 facilitates Hepatocarcinogenesis by stabilizing CDK1
    Article Snippet: .. First-strand SNORD52 cDNA was synthesized by using the SuperScript III First-Strand Synthesis System (Invitrogen, USA) with gene-specific primers. .. The full-length SNORD52 sequence was then cloned into the expression vector pCMV (Invitrogen, USA) for SNORD52 overexpression. siRNA and ASO transfection were performed using riboFECT™ CP Reagent (RiboBio, Guangzhou, China), and plasmids were transfected with Lipofectamine 2000 (Life Technologies, USA) according to the manufacturer's protocol.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher superscript iii
    Validation of antisense transcripts. a Nanostring nCounter assays: controls. <t>RNA</t> was isolated from the <t>three</t> indicated cell lines at different timepoints post-infection and used for Nanostring nCounter assays. Experiments were performed with one measurement each from two biological replicates and scaled to the 2 h post-infection (hpi) timepoint after normalization using the provided control spike-ins. Values for HSV-1 mRNAs are shown as log(10) transformed normalized Nanostring counts. Error bars represent standard deviations. b Nanostring nCounter assays: antisense transcripts and corresponding sense mRNAs. Assays were performed as in a . c Absolute counts of SLC27A4 antisense and sense. To compare the three cell lines, absolute counts after technical normalization using the provided control spike-ins are shown. Error bars represent standard deviations. d Expression of antisense transcripts in total NET-seq data. Shown is the distribution of antisense transcripts and protein coding genes as lines, with the values of the 12 selected antisense transcripts and housekeeping genes marked on top
    Superscript Iii, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 254 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii/product/Thermo Fisher
    Average 94 stars, based on 254 article reviews
    Price from $9.99 to $1999.99
    superscript iii - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    93
    Thermo Fisher superscript iii first strand synthesis supermix for qrt pcr
    Rsp positively regulates its own expression. (A) The transcript levels of rsp at different growth phases were measured by <t>qRT-PCR.</t> (B) The β-galactosidase activities of the WT and rsp mutant strains with a plasmid pOS rsp were detected in the indicated time points. (C) Analysis of mRNA half-lives of p rsp - lacZ and rsp . Cells were collected after rifampin (200 μg/ml) treatment for RNA isolation, and then the mRNA half-lives were measured by qRT-PCR. (D) SDS-PAGE analysis of Rsp purified from the pRSF-Duet expression vector. The gel was stained with Coomassie blue. (E) EMSA of purified Rsp with the biotin-labelled DNA fragment containing the putative promoter region of rsp . Increasing concentrations of purified Rsp and 4 fmol of the biotin-labelled probe were used in the reactions. The unlabelled probe was added as a specific competitor, and the unlabelled fragment of the hu ORF region was added as a nonspecific competitor. (F) Promoter sequence of the rsp gene. The start points of the truncated probes are marked by arrows. (G) EMSA assay of Rsp with rsp truncated probes. The nonspecific competitor was added to the reactions. The error bars indicate the standard errors of the means of <t>three</t> biological replicates. ** P
    Superscript Iii First Strand Synthesis Supermix For Qrt Pcr, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii first strand synthesis supermix for qrt pcr/product/Thermo Fisher
    Average 93 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    superscript iii first strand synthesis supermix for qrt pcr - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    94
    Thermo Fisher superscript iii reverse transcriptase kit
    Downstream targets of wheat PBF . The downstream target genes of PBF were identified using a GENIE3 network constructed using 850 <t>RNA-seq</t> samples ( Ramírez-González et al., 2018 ). A. A comparison of the target genes of each of the wheat PBF homoeologs. The number of predicted target genes common to all <t>three</t> homoeologs is 226. B. The 226 common target genes were analysed for evidence of enrichment with respect to molecular function. The top-ranking functional categories (adjusted p value
    Superscript Iii Reverse Transcriptase Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 296 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/superscript iii reverse transcriptase kit/product/Thermo Fisher
    Average 94 stars, based on 296 article reviews
    Price from $9.99 to $1999.99
    superscript iii reverse transcriptase kit - by Bioz Stars, 2020-09
    94/100 stars
      Buy from Supplier

    Image Search Results


    Validation of antisense transcripts. a Nanostring nCounter assays: controls. RNA was isolated from the three indicated cell lines at different timepoints post-infection and used for Nanostring nCounter assays. Experiments were performed with one measurement each from two biological replicates and scaled to the 2 h post-infection (hpi) timepoint after normalization using the provided control spike-ins. Values for HSV-1 mRNAs are shown as log(10) transformed normalized Nanostring counts. Error bars represent standard deviations. b Nanostring nCounter assays: antisense transcripts and corresponding sense mRNAs. Assays were performed as in a . c Absolute counts of SLC27A4 antisense and sense. To compare the three cell lines, absolute counts after technical normalization using the provided control spike-ins are shown. Error bars represent standard deviations. d Expression of antisense transcripts in total NET-seq data. Shown is the distribution of antisense transcripts and protein coding genes as lines, with the values of the 12 selected antisense transcripts and housekeeping genes marked on top

    Journal: Genome Biology

    Article Title: Widespread activation of antisense transcription of the host genome during herpes simplex virus 1 infection

    doi: 10.1186/s13059-017-1329-5

    Figure Lengend Snippet: Validation of antisense transcripts. a Nanostring nCounter assays: controls. RNA was isolated from the three indicated cell lines at different timepoints post-infection and used for Nanostring nCounter assays. Experiments were performed with one measurement each from two biological replicates and scaled to the 2 h post-infection (hpi) timepoint after normalization using the provided control spike-ins. Values for HSV-1 mRNAs are shown as log(10) transformed normalized Nanostring counts. Error bars represent standard deviations. b Nanostring nCounter assays: antisense transcripts and corresponding sense mRNAs. Assays were performed as in a . c Absolute counts of SLC27A4 antisense and sense. To compare the three cell lines, absolute counts after technical normalization using the provided control spike-ins are shown. Error bars represent standard deviations. d Expression of antisense transcripts in total NET-seq data. Shown is the distribution of antisense transcripts and protein coding genes as lines, with the values of the 12 selected antisense transcripts and housekeeping genes marked on top

    Article Snippet: Per reaction, 1 μg total RNA was used and transcribed using SuperScript III with random hexamer primers (both Thermo Fisher Scientific) according to the manufacturer’s protocol.

    Techniques: Isolation, Infection, Transformation Assay, Expressing

    Proteomic evaluation of the parent relative to the ittA mutant. Tandem Mass Tags (TMT) was used to determine the relative abundance of the total proteome of three biological replicates of parent and ittA mutant strains grown under conditions that induce proteins important during mammalian infection. Volcano plot depicts log 2 fold change ( x -axis) and log 10 adjusted p -value ( y -axis) of proteins identified from parent versus the ittA sRNA mutant strain. Single proteins are plotted as dots. Proteins outside of the red dashed boxes are significant. Red spots have a +/- 2 fold change difference in the parent strain relative to the ittA mutant strain and a p- value

    Journal: PLoS Pathogens

    Article Title: The intergenic small non-coding RNA ittA is required for optimal infectivity and tissue tropism in Borrelia burgdorferi

    doi: 10.1371/journal.ppat.1008423

    Figure Lengend Snippet: Proteomic evaluation of the parent relative to the ittA mutant. Tandem Mass Tags (TMT) was used to determine the relative abundance of the total proteome of three biological replicates of parent and ittA mutant strains grown under conditions that induce proteins important during mammalian infection. Volcano plot depicts log 2 fold change ( x -axis) and log 10 adjusted p -value ( y -axis) of proteins identified from parent versus the ittA sRNA mutant strain. Single proteins are plotted as dots. Proteins outside of the red dashed boxes are significant. Red spots have a +/- 2 fold change difference in the parent strain relative to the ittA mutant strain and a p- value

    Article Snippet: For conventional RT-PCR, 200 ng of total RNA from B . burgdorferi strains grown under conventional microaerophilic conditions were used to reverse transcribe into cDNA using primer sRNA R ( ) and SuperScript III (Thermo Fisher Scientific, Waltham, MA).

    Techniques: Mutagenesis, Infection

    Spatial and temporal infectivity analysis of the ittA mutant. A. The course of infection of bioluminescent B . burgdorferi strains was tracked following the infection of C3H/HeN mice with 10 3 of each B . burgdorferi isolate. Mice were infected for 21 days total with the parent (n = 5), ittA sRNA mutant (n = 5), and the ittA genetic complement (n = 4) and imaged on the time or day (d) listed on the left. For each image shown, the mouse on the far left (denoted with a ‘−’) was infected with B . burgdorferi but did not receive D-luciferin to serve as a background control. Mice denoted with a ‘+’ were infected with the strain indicated and treated with D-luciferin to promote light emission. All images were normalized to the same scale (in photons/sec; shown on the right). B. Quantification of in vivo luminescence images of mice infected at a dose of 10 3 of B . burgdorferi . Parent strain ML23/pBBE22 luc is depicted as black circles, the ittA sRNA mutant DM103/pBBE22 luc as red squares, and the genetic complement strain DM113/pBBE22 luc as blue triangles. Each time point represents the average value and the standard error from the four mice given D-luciferin substrate for the parent and sRNA mutant strains and three mice for the complement strain. * p

    Journal: PLoS Pathogens

    Article Title: The intergenic small non-coding RNA ittA is required for optimal infectivity and tissue tropism in Borrelia burgdorferi

    doi: 10.1371/journal.ppat.1008423

    Figure Lengend Snippet: Spatial and temporal infectivity analysis of the ittA mutant. A. The course of infection of bioluminescent B . burgdorferi strains was tracked following the infection of C3H/HeN mice with 10 3 of each B . burgdorferi isolate. Mice were infected for 21 days total with the parent (n = 5), ittA sRNA mutant (n = 5), and the ittA genetic complement (n = 4) and imaged on the time or day (d) listed on the left. For each image shown, the mouse on the far left (denoted with a ‘−’) was infected with B . burgdorferi but did not receive D-luciferin to serve as a background control. Mice denoted with a ‘+’ were infected with the strain indicated and treated with D-luciferin to promote light emission. All images were normalized to the same scale (in photons/sec; shown on the right). B. Quantification of in vivo luminescence images of mice infected at a dose of 10 3 of B . burgdorferi . Parent strain ML23/pBBE22 luc is depicted as black circles, the ittA sRNA mutant DM103/pBBE22 luc as red squares, and the genetic complement strain DM113/pBBE22 luc as blue triangles. Each time point represents the average value and the standard error from the four mice given D-luciferin substrate for the parent and sRNA mutant strains and three mice for the complement strain. * p

    Article Snippet: For conventional RT-PCR, 200 ng of total RNA from B . burgdorferi strains grown under conventional microaerophilic conditions were used to reverse transcribe into cDNA using primer sRNA R ( ) and SuperScript III (Thermo Fisher Scientific, Waltham, MA).

    Techniques: Infection, Mutagenesis, Mouse Assay, In Vivo

    Confirmation that the ittA is not made in the mutant strain and is restored in the genetic complement. A. Northern blot of total RNA isolated from the parent strain ML23 (denoted Parent), the sRNA mutant strain ( ittA :Str R ), and the ittA cis complemented strain (denoted Comp). Detection of 5S from each strain serves as a loading control. B. RT-PCR using purified total RNA from the B . burgdorferi ML23 (Parent), sRNA mutant ( ittA :Str R ), and genetic complement (Comp) strains. The first three lanes had no reverse transcriptase (RT) added to the reactions (indicated with a “-“) whereas the next three lanes included reverse transcriptase (designated with a “+”). The DNA ladder is shown to the left and base pair values are indicated. The arrow on the right indicates the presence of the sRNA species observed in the parent and complement strains.

    Journal: PLoS Pathogens

    Article Title: The intergenic small non-coding RNA ittA is required for optimal infectivity and tissue tropism in Borrelia burgdorferi

    doi: 10.1371/journal.ppat.1008423

    Figure Lengend Snippet: Confirmation that the ittA is not made in the mutant strain and is restored in the genetic complement. A. Northern blot of total RNA isolated from the parent strain ML23 (denoted Parent), the sRNA mutant strain ( ittA :Str R ), and the ittA cis complemented strain (denoted Comp). Detection of 5S from each strain serves as a loading control. B. RT-PCR using purified total RNA from the B . burgdorferi ML23 (Parent), sRNA mutant ( ittA :Str R ), and genetic complement (Comp) strains. The first three lanes had no reverse transcriptase (RT) added to the reactions (indicated with a “-“) whereas the next three lanes included reverse transcriptase (designated with a “+”). The DNA ladder is shown to the left and base pair values are indicated. The arrow on the right indicates the presence of the sRNA species observed in the parent and complement strains.

    Article Snippet: For conventional RT-PCR, 200 ng of total RNA from B . burgdorferi strains grown under conventional microaerophilic conditions were used to reverse transcribe into cDNA using primer sRNA R ( ) and SuperScript III (Thermo Fisher Scientific, Waltham, MA).

    Techniques: Mutagenesis, Northern Blot, Isolation, Reverse Transcription Polymerase Chain Reaction, Purification

    Rsp positively regulates its own expression. (A) The transcript levels of rsp at different growth phases were measured by qRT-PCR. (B) The β-galactosidase activities of the WT and rsp mutant strains with a plasmid pOS rsp were detected in the indicated time points. (C) Analysis of mRNA half-lives of p rsp - lacZ and rsp . Cells were collected after rifampin (200 μg/ml) treatment for RNA isolation, and then the mRNA half-lives were measured by qRT-PCR. (D) SDS-PAGE analysis of Rsp purified from the pRSF-Duet expression vector. The gel was stained with Coomassie blue. (E) EMSA of purified Rsp with the biotin-labelled DNA fragment containing the putative promoter region of rsp . Increasing concentrations of purified Rsp and 4 fmol of the biotin-labelled probe were used in the reactions. The unlabelled probe was added as a specific competitor, and the unlabelled fragment of the hu ORF region was added as a nonspecific competitor. (F) Promoter sequence of the rsp gene. The start points of the truncated probes are marked by arrows. (G) EMSA assay of Rsp with rsp truncated probes. The nonspecific competitor was added to the reactions. The error bars indicate the standard errors of the means of three biological replicates. ** P

    Journal: Emerging Microbes & Infections

    Article Title: Rsp promotes the transcription of virulence factors in an agr-independent manner in Staphylococcus aureus

    doi: 10.1080/22221751.2020.1752116

    Figure Lengend Snippet: Rsp positively regulates its own expression. (A) The transcript levels of rsp at different growth phases were measured by qRT-PCR. (B) The β-galactosidase activities of the WT and rsp mutant strains with a plasmid pOS rsp were detected in the indicated time points. (C) Analysis of mRNA half-lives of p rsp - lacZ and rsp . Cells were collected after rifampin (200 μg/ml) treatment for RNA isolation, and then the mRNA half-lives were measured by qRT-PCR. (D) SDS-PAGE analysis of Rsp purified from the pRSF-Duet expression vector. The gel was stained with Coomassie blue. (E) EMSA of purified Rsp with the biotin-labelled DNA fragment containing the putative promoter region of rsp . Increasing concentrations of purified Rsp and 4 fmol of the biotin-labelled probe were used in the reactions. The unlabelled probe was added as a specific competitor, and the unlabelled fragment of the hu ORF region was added as a nonspecific competitor. (F) Promoter sequence of the rsp gene. The start points of the truncated probes are marked by arrows. (G) EMSA assay of Rsp with rsp truncated probes. The nonspecific competitor was added to the reactions. The error bars indicate the standard errors of the means of three biological replicates. ** P

    Article Snippet: Total RNA isolation, cDNA generation, and real-time quantitative reverse transcription-PCR Overnight cultures of S. aureus were diluted 1:100 in TSB and then grown to the indicated cell density until being collected.

    Techniques: Expressing, Quantitative RT-PCR, Mutagenesis, Plasmid Preparation, Isolation, SDS Page, Purification, Staining, Sequencing

    Rsp positively regulates the transcription of virulence genes. (A) The transcript levels of 7 virulence-related genes were detected by qRT-PCR in the WT and rs p mutant strains. The transcript levels of hla (B), psmα (C), and psmβ (D) in the WT, rs p mutant, and rs p chromosomal-complemented strains at different growth phases. The β-galactosidase activities of hla (E), psmα (F), and psmβ (G) promoter in the WT and rs p mutant strains. Cells were collected at early stationary phase, and the β-galactosidase activity was detected with ONPG. (H) Hla protein levels of the WT, rs p mutant, and rs p chromosomal-complemented strains were measured by Western blot. (I) The transcript levels of hla , psmα , and psmβ in the WT, rs p mutant, and rs p chromosomal-complemented strains in the process of haemolysis. Cells were collected after incubated with 3% sheep red blood cells for 30 min, and the mRNA levels were analysed by qRT-PCR. The error bars indicate the standard errors of the means of three biological replicates. * P

    Journal: Emerging Microbes & Infections

    Article Title: Rsp promotes the transcription of virulence factors in an agr-independent manner in Staphylococcus aureus

    doi: 10.1080/22221751.2020.1752116

    Figure Lengend Snippet: Rsp positively regulates the transcription of virulence genes. (A) The transcript levels of 7 virulence-related genes were detected by qRT-PCR in the WT and rs p mutant strains. The transcript levels of hla (B), psmα (C), and psmβ (D) in the WT, rs p mutant, and rs p chromosomal-complemented strains at different growth phases. The β-galactosidase activities of hla (E), psmα (F), and psmβ (G) promoter in the WT and rs p mutant strains. Cells were collected at early stationary phase, and the β-galactosidase activity was detected with ONPG. (H) Hla protein levels of the WT, rs p mutant, and rs p chromosomal-complemented strains were measured by Western blot. (I) The transcript levels of hla , psmα , and psmβ in the WT, rs p mutant, and rs p chromosomal-complemented strains in the process of haemolysis. Cells were collected after incubated with 3% sheep red blood cells for 30 min, and the mRNA levels were analysed by qRT-PCR. The error bars indicate the standard errors of the means of three biological replicates. * P

    Article Snippet: Total RNA isolation, cDNA generation, and real-time quantitative reverse transcription-PCR Overnight cultures of S. aureus were diluted 1:100 in TSB and then grown to the indicated cell density until being collected.

    Techniques: Quantitative RT-PCR, Mutagenesis, Activity Assay, Western Blot, Incubation

    Downstream targets of wheat PBF . The downstream target genes of PBF were identified using a GENIE3 network constructed using 850 RNA-seq samples ( Ramírez-González et al., 2018 ). A. A comparison of the target genes of each of the wheat PBF homoeologs. The number of predicted target genes common to all three homoeologs is 226. B. The 226 common target genes were analysed for evidence of enrichment with respect to molecular function. The top-ranking functional categories (adjusted p value

    Journal: Journal of Cereal Science

    Article Title: LYS3 encodes a prolamin-box-binding transcription factor that controls embryo growth in barley and wheat

    doi: 10.1016/j.jcs.2020.102965

    Figure Lengend Snippet: Downstream targets of wheat PBF . The downstream target genes of PBF were identified using a GENIE3 network constructed using 850 RNA-seq samples ( Ramírez-González et al., 2018 ). A. A comparison of the target genes of each of the wheat PBF homoeologs. The number of predicted target genes common to all three homoeologs is 226. B. The 226 common target genes were analysed for evidence of enrichment with respect to molecular function. The top-ranking functional categories (adjusted p value

    Article Snippet: An aliquot containing 4 μg RNA was treated for 45 min with 2 μl of DNase RQ1 (1 μg/μl) at 37 °C (Promega, UK), and purified using an RNAeasy spin column (Qiagen, UK). cDNA was prepared from 0.5 μg RNA using a SuperScript III reverse transcriptase kit and oligo (dT)18 primers (Thermo Fisher Scientific, UK) according to the manufacturer's instructions and stored at −20 °C prior to PCR.

    Techniques: Construct, RNA Sequencing Assay, Functional Assay

    Patterns of expression of PBF/LYS3 in barley . A. Tissue-specific expression according to the Barley eFP Browser 2.0 ( www.bar.utoronto ). Samples are from barley cv. Morex. Caryopsis (no Emb) means caryopsis without embryo. B. Temporal and tissue-specific patterns of LYS3 / PBF expression in developing grains of wild type (Bomi) assessed by RT–PCR. Each cDNA sample was from a pool of 10–75 tissue samples each from an individual grain. Samples were collected from at least five spikes, each from a different plant. Amplicons were visualized on 1% agarose gels stained with SYBR Safe (Invitrogen, UK). Numbers above panels are DAF. PBF = Prolamin Binding Factor (HORVU5Hr1G048700). ACT = ACTIN .(HORVU1Hr1G047440), a constitutively expressed gene. Control reactions varied from the test reactions as follows. C1: contained cDNA from the barley PBF deletion mutant Risø18 at 26 DAF. No product was observed showing that the primers used were specific for PBF. C2: no DNase, no reverse transcriptase (RT). C3: no DNase. C4: no RT. C5: contained water used for PCR instead of cDNA. C. In situ localization of PBF in developing wild type (Bomi) grains at 8 and 12 DAF. ( i ) Longitudinal section of 8 DAF grain stained with antisense probe. PBF is expressed mostly in the starchy endosperm (En) cells. ( ii ) Longitudinal section of 12 DAF grain (including the embryo) stained with an antisense probe. PBF is expressed in the scutellum (Sc), coleoptile (Co) and coleorhiza tip (Cr). PBF is not expressed in the radicle (Ra). ( iii ) Longitudinal section of 12 DAF as in (ii) but stained with a sense probe (negative control). Scale bars are 0.5 mm (i) and 20 mm (ii and iii). D. Embryo fresh weight in developing grains of wild type (Bomi) and lys3 mutant Risø19. Embryos were extracted from developing grains and immediately weighed. Values are means ± SE (n > 4) for 10 embryos extracted from the middle of at least three spikes. Values are significantly different (p

    Journal: Journal of Cereal Science

    Article Title: LYS3 encodes a prolamin-box-binding transcription factor that controls embryo growth in barley and wheat

    doi: 10.1016/j.jcs.2020.102965

    Figure Lengend Snippet: Patterns of expression of PBF/LYS3 in barley . A. Tissue-specific expression according to the Barley eFP Browser 2.0 ( www.bar.utoronto ). Samples are from barley cv. Morex. Caryopsis (no Emb) means caryopsis without embryo. B. Temporal and tissue-specific patterns of LYS3 / PBF expression in developing grains of wild type (Bomi) assessed by RT–PCR. Each cDNA sample was from a pool of 10–75 tissue samples each from an individual grain. Samples were collected from at least five spikes, each from a different plant. Amplicons were visualized on 1% agarose gels stained with SYBR Safe (Invitrogen, UK). Numbers above panels are DAF. PBF = Prolamin Binding Factor (HORVU5Hr1G048700). ACT = ACTIN .(HORVU1Hr1G047440), a constitutively expressed gene. Control reactions varied from the test reactions as follows. C1: contained cDNA from the barley PBF deletion mutant Risø18 at 26 DAF. No product was observed showing that the primers used were specific for PBF. C2: no DNase, no reverse transcriptase (RT). C3: no DNase. C4: no RT. C5: contained water used for PCR instead of cDNA. C. In situ localization of PBF in developing wild type (Bomi) grains at 8 and 12 DAF. ( i ) Longitudinal section of 8 DAF grain stained with antisense probe. PBF is expressed mostly in the starchy endosperm (En) cells. ( ii ) Longitudinal section of 12 DAF grain (including the embryo) stained with an antisense probe. PBF is expressed in the scutellum (Sc), coleoptile (Co) and coleorhiza tip (Cr). PBF is not expressed in the radicle (Ra). ( iii ) Longitudinal section of 12 DAF as in (ii) but stained with a sense probe (negative control). Scale bars are 0.5 mm (i) and 20 mm (ii and iii). D. Embryo fresh weight in developing grains of wild type (Bomi) and lys3 mutant Risø19. Embryos were extracted from developing grains and immediately weighed. Values are means ± SE (n > 4) for 10 embryos extracted from the middle of at least three spikes. Values are significantly different (p

    Article Snippet: An aliquot containing 4 μg RNA was treated for 45 min with 2 μl of DNase RQ1 (1 μg/μl) at 37 °C (Promega, UK), and purified using an RNAeasy spin column (Qiagen, UK). cDNA was prepared from 0.5 μg RNA using a SuperScript III reverse transcriptase kit and oligo (dT)18 primers (Thermo Fisher Scientific, UK) according to the manufacturer's instructions and stored at −20 °C prior to PCR.

    Techniques: Expressing, Reverse Transcription Polymerase Chain Reaction, Staining, Binding Assay, Mutagenesis, Polymerase Chain Reaction, In Situ, Negative Control